RU2790295C2 - Complex systems of transposome bound on surface - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, in particular to an annealed hybrid of a transposon/polynucleotide connection, containing the first transposon, the second transposon, and connection polynucleotide. A transposome system is also disclosed, containing transposase, the first transposon, the second transposon, and connection polynucleotide, as well as a kit containing it.

EFFECT: invention is effective for creation of a library of marked fragments of nucleic acids.

52 cl, 10 dwg, 2 tbl, 9 ex

Description

INCLUDING ANY PRIORITY APPLICATIONS BY LINK

[0001] This application claims priority from U.S. Provisional Application No. 62/791,509, filed January 11, 2019, and U.S. Provisional Application 62/840,610, filed April 30, 2019, which are incorporated herein by reference in in all its fullness.

FIELD OF THE INVENTION

[0002] The present invention relates to methods, compositions and kits for creating a library of labeled nucleic acid fragments without the use of PCR amplification, including methods and compositions for fragmenting and labeling nucleic acids (for example, DNA) using transposome complexes immobilized on solid substrates.

BACKGROUND OF THE INVENTION

[0003] Current protocols for next generation sequencing (NGS) of nucleic acid samples typically use a sample preparation method that converts DNA or RNA into a library of fragmented templates that can be sequenced. Sample preparation methods often require multiple steps and material transfer, as well as expensive fragmentation apparatus, which can make these methods complex, time consuming, costly, and inefficient. Moreover, primer amplification introduces bias into the contents of the library and thus into the resulting sequencing data. For example, the PCR amplification steps can create gaps that are exacerbated in GC-rich regions due to the inability of polymerases to efficiently replicate GC-rich regions. These gaps create bias in the resulting sequencing data from libraries. Methods for generating libraries with PCR amplification steps may have significantly reduced insertion and deletion efficiency (indel). Accurate sequencing of some regions with many extended repeats can be difficult, and DNA having GC-rich promoters can show low coverage within the genome. Moreover, many methods for obtaining libraries are incompatible with the inclusion of sample indexes or require many additional steps to introduce such indexes.

[0004] Short, efficient and precise procedures are needed to obtain libraries. This document describes various methods, compositions and kits that solve these problems and that support single and dual indexing approaches.

SUMMARY OF THE INVENTION

[0005] The present disclosure relates to methods, compositions, and kits for generating a library of labeled nucleic acid fragments without using PCR amplification to incorporate fragment labels, such as primer sequences and/or index sequences, including methods and compositions for fragmenting and labeling nucleic acids (eg DNA) using transposome complexes immobilized on solid supports.

[0006] Some embodiments provided herein relate to a transposome complex that includes an attachment polynucleotide. In some aspects, the present invention provides a transposome complex comprising the following: (a) a transposase; (b) a first transposon comprising a 3' transposon sequence and a 5' adapter sequence; (c) a second transposon comprising a 5' end sequence of the transposon and a 3' adapter sequence, the 5' end sequence being complementary to at least a portion of the 3' end sequence of the transposon; and (d) an attachment polynucleotide comprising the following: (i) an attachment adapter sequence hybridized to one of the two adapter sequences, and (ii) a binding element. Typically, terminal transposon sequences anneal together to form a double-stranded terminal transposon sequence that is recognized by the transposase. In some aspects, the binding element is immobilized on a solid support to form an immobilized transposome complex.

[0007] In some aspects, the present invention relates to a annealed transposon/attachment polynucleotide comprising a first transposon, a second transposon, and an attachment polynucleotide.

[0008] In some aspects, the present invention relates to methods for producing a annealed transposon/attachment polynucleotide containing a transposome complex, including annealing a first transposon, a second transposon, and an attachment polynucleotide. In some aspects, the present invention relates to methods for preparing a transposome complex, comprising treating a renatured transposon/attachment polynucleotide fusion with a transposase. In some aspects, a method is provided for obtaining an immobilized transposome complex by immobilizing the transposome complex on a solid support using a binding element.

[0009] In some aspects, the present invention provides a transposome complex comprising the following: (a) transposase; (b) a first transposon containing a 3' transposon terminal sequence and a 5' adapter sequence; (c) a second transposon comprising a 5' transposon terminal sequence complementary to at least a portion of the 3' transposon sequence and a 3' adapter sequence; and (d) a linking element attached to the 5' adapter sequence via a cleavable linker. In some aspects, the binding element is immobilized on a solid support to form an immobilized transposome complex. In some aspects, the present disclosure relates to a renatured oligonucleotide construct comprising a first transposon, a second transposon, and a binding element.

[0010] In some aspects, the present invention relates to methods for creating a library of labeled nucleic acid fragments, including contacting a target nucleic acid with a plurality of immobilized transposome complexes, as described herein, under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments. and for joining the 3' ends of the 3' transposon sequences to the 5' ends of the target fragments to obtain a plurality of 5' labeled target fragments.

[0011] Some embodiments provided herein relate to a kit for generating a library of labeled nucleic acid fragments without the use of PCR amplification. In some embodiments, the kit includes an immobilized transposome complex as described herein.

[0012] In some aspects, the invention relates to methods for creating a library of labeled nucleic acid fragments, including bringing an immobilized transposome complex into contact with a target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments, and attaching the 3'-end of the first transposon to the 5' ends of the target fragments to obtain a plurality of 5'-labeled target fragments; treating the solid support to remove unbound nucleic acids; or treating the solid support to remove the transposase from the complex, optionally by (a) heating the solid support and/or (b) washing the solid support with an enzymatic denaturing agent, the enzymatic denaturing agent optionally containing sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase; treatment of a plurality of 5'-labeled target fragments with a polymerase and ligase to extend and ligate the 5'-labeled target fragments to obtain fully double-stranded labeled fragments, optionally the polymerase and ligase treatment is performed in the presence of a DNA secondary structure disruptor, the disruptor optionally being DMSO; removal of fully double-stranded fragments from the solid support, the removal optionally comprising the application of heat and/or a denaturant sufficient to cleave the fully double-stranded labeled fragments from the solid support, optionally the denaturant being NaOH; and selecting fully double-stranded labeled fragments using capture beads, optionally the capture beads being magnetic microcarriers, and optionally performing two separate selection steps.

[0013] In some embodiments, the immobilized transposome complex comprises a solid support and a transposome complex immobilized on a solid support, the transposome complex comprising a transposase; the first transposon containing the 3'-terminal sequence of the transposon and the anchor sequence (anchor); the second transposon containing the 5'-terminal sequence of the transposon and the B15'sequence; an attachment polynucleotide containing a complementary anchor sequence (anchor'), an A14' sequence, a spacer and a P5' sequence, as well as a binding element containing biotin, the biotin being immobilized on a solid support. In some embodiments, the method further comprises sequencing one or more fully double-stranded labeled fragments.

[0014] In some embodiments, the method includes contacting a first immobilized transposome complex and a second immobilized transposome complex with a target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments, and attaching the 3' end of each first transposon to 5 '-ends of target fragments to obtain a plurality of first 5'-labeled target fragments derived from the first immobilized transposome complex and a plurality of second 5'-labeled target fragments derived from the second immobilized transposome complex. In some embodiments, the first immobilized transposome complex comprises a solid support and the first transposome complex immobilized on a solid support, the transposome complex comprising a transposase; the first transposon containing the 3'-terminal sequence of the transposon and the anchor sequence; a second transposon containing a 5'-terminal transposon sequence and a first polynucleotide accession containing (i) a complementary anchor sequence, an A14' sequence, a spacer and a P5'sequence; and (ii) a binding element containing biotin, and the biotin is immobilized on a solid support. In some embodiments, the second immobilized transposome complex comprises a solid support and a second transposome complex immobilized on a solid support, the transposome complex comprising a transposase; the first transposon containing the 3'-terminal sequence of the transposon and the anchor sequence; a second transposon containing a 5'-terminal transposon sequence and a second polynucleotide accession containing (i) a complementary anchor sequence, a B15' sequence, a spacer and a P7'sequence; and (ii) a binding element containing biotin, and the biotin is immobilized on a solid support. In some embodiments, the method includes treating a plurality of 5'-labeled target fragments with a ligase to ligate each 5'-labeled target fragment to either a first indexing oligonucleotide or a second indexing oligonucleotide by bringing the 5'-labeled target fragments into contact with a pool of first and second indexing oligonucleotides, wherein each first indexing oligonucleotide contains an A14 sequence, an i5 sequence, and a P5 sequence and can be linked to a first labeled 5'end; and wherein each second indexing oligonucleotide contains a B15 sequence, an i7 sequence, and a P7 sequence and can be linked to a second 5'-tagged end to obtain a plurality of 5'-labeled target fragments ligated to the indexing oligonucleotides; treating the solid support to remove the transposases from the complex, optionally by (a) heating the solid support and/or (b) washing the solid support with an enzymatic denaturing agent, the enzyme denaturing agent optionally containing sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase ; and treating a plurality of 5'-labeled target fragments ligated to index the oligonucleotides with polymerase to extend to obtain fully double-stranded labeled fragments. In some embodiments, contacting a first immobilized transposome complex with a second immobilized transposome complex and treating a plurality of 5'-labeled target fragments with a ligase is performed in a single reaction. In some embodiments, double-stranded labeled fragments are obtained in solution.

BRIEF DESCRIPTION OF GRAPHICS

[0015] In FIG. 1 is a flowchart depicting an embodiment of a method for generating a library of labeled nucleic acid fragments without using PCR amplification. In the first step, a transposome complex is obtained, as described herein, immobilized on a solid support. The target nucleic acid is applied to a solid support, where the tagmentation reaction proceeds with the formation of labeled and fragmented nucleic acids. An index mixture having index sequences is used and extension and ligation occurs. Finally, the labeled nucleic acid fragments are indexed. In some embodiments, indexing occurs simultaneously with extension and ligation, and in other embodiments, indexing occurs after extension and ligation. In other embodiments, the stage layouts are different, as shown in Example 9.

[0016] In FIG. 2A-2B show a schematic diagram and method for obtaining a library of labeled nucleic acid fragments without the use of PCR amplification. On FIG. 2A shows an example configuration of a transposome complex with biotin (B) attached to one transposon via a cleavable linker. In this embodiment, a transposome complex containing a transposase, a first transposon containing a 3' transposon sequence and a 5' adapter sequence; a second transposon comprising a 5' transposon sequence complementary to at least a portion of the 3' transposon sequence and the 3' adapter sequence; and a linking element attached to the 5' adapter sequence via a cleavable linker (FIG. 2A). On FIG. 2B schematically illustrates exemplary steps of a method for obtaining a library of labeled nucleic acid fragments without the use of PCR amplification using the exemplary transposome complex depicted in FIG. 2A immobilized on a solid support (solid support not shown) including labeling and washing, extension and ligation, and bead removal steps. On FIG. 2B shows the tagmentation steps in which target nucleic acid inserts are attached to tags, extension and ligation, and cleavage from a solid support.

[0017] In FIG. 3A-3C are exemplary steps of a method for generating a library of labeled nucleic acid fragments without the use of PCR amplification. On FIG. 3A shows a transposome complex immobilized on a solid support by a biotin-bearing attachment polynucleotide (B, solid support not shown). For simplicity, the image of the dimer is shown in Fig. 3A but not in FIG. 3B-3C. On FIG. 3B shows a labeled and fragmented nucleic acid that is still complexed with the transposase (upper panel) and structure after removal of the transposase (lower panel). On FIG. 3B shows a transposome complex having a nucleic acid fragment (insert) linked to a first transposon, with the 5' end of the insert attached to the 3' end of the transposon sequence. The transposase is removed using the methods described herein, for example, using a transposase remover such as sodium dodecyl sulfate (SDS). On FIG. 3C shows the structure after gap filling and extension (lengthening and ligation) (upper panel) and after dehybridization to remove the resulting fragments from the solid support (lower panel). As shown in FIG. 3C, indices are added to a solid support and hybridized to a second transposon attachment polynucleotide. Specifically, as shown in the embodiment of FIG. 3C, an index i5 having a primer sequence (P5 sequence), an index sequence (i5 sequence), and an anchor sequence hybridizes to an attachment polynucleotide in complementary sequences such that P5 hybridizes to P5' and the anchor region hybridizes to the anchor region. Similarly, in the embodiment of FIG. 3C index i7, having a primer sequence (P7), an index sequence (i7), and an adapter sequence (sequence B15), hybridizes to the second transposon in complementary sequences such that P7 hybridizes to P7', i7 hybridizes to i7', and B15 hybridizes to B15'. After bringing the solid support into contact with the indices, the fragments are extended and ligated using an extension and ligation mixture (ELM). The solid support is then treated with a chain denaturant, such as NaOH, to thereby produce labeled nucleic acid fragments. An embodiment of a transposome complex containing a Tn5 transposase with first and second transposons is shown. The first transposon includes a 3' transposon sequence (ME sequence) hybridized to a 5' transposon sequence (ME sequence) of a second transposon. The second transposon also includes a 3' adapter sequence (sequence B15'). The first transposon includes a 5' adapter sequence (sequence A14) which is shown hybridized to the junction adapter sequence (sequence A14') of the attachment polynucleotide. The attachment polynucleotide also includes an anchor sequence (anchor'), a spacer region, a primer sequence (P5' sequence), and a linker attached to the linking element (B). The transposome complex is a dimer with two dimerized monomers.

[0018] In FIG. 4A-4E is a schematic diagram for comparing different configurations of a transposome complex immobilized on a solid support with exemplary biotin (B, solid support not shown), including indexed beads and universal beads, each shown in both single indexing mode and double indexing, for embodiments of methods for creating a library of labeled nucleic acid fragments without the use of PCR amplification using variations of transposome complexes, wherein the components of the transposons and/or attachment polynucleotides are changed, ordered or changed compared to each other. On FIG. 4A shows various configurations of the transposome complex attached to a solid support. On FIG. 4A depicts embodiments of transposome complexes showing a transposase with a first and second transposon and attached to a solid support via an attachment polynucleotide. On FIG. 4B shows various configurations after tagging. On FIG. 4B shows a tagging reaction for single or double indexed indexed or universal beads in which a solid support is brought into contact with nucleic acid fragments (insert) that bind to the 3' end of the first transposon. On FIG. 4C shows various configurations after extension and ligation. On FIG. 4C shows the extension and ligation of indexed or universal beads with single or double indexing, in which a solid support is brought into contact with a mixture of indices that hybridizes to a transposon or attachment polynucleotide, and the nucleic acid fragments are extended. On FIG. 4D shows various post-indexing configurations (indexed beads for single indexing are not shown since indexing has been completed for this configuration in FIG. 4C). On FIG. 4D shows the indexing of dual-indexed pellets or universal single- or dual-indexed pellets. As shown in FIG. 4D, single indexing bead indexing was completed in the extensive ligation step shown in FIG. 4C. The solid support is brought into contact with the indexing mixture and the nucleic acid fragments are labeled for indexing. On FIG. 4E shows illustrative results of various configurations showing normalized read rates versus insert size. On FIG. 4E shows the normalized read rates of labeled nucleic acid fragments from indexed or universal beads with single or double indexing. On FIG. 4A-4E specifically show embodiments of transposome complexes arranged as indexed single index beads (top left), universal single index beads (top right), indexed dual index beads (bottom left), and universal dual index beads. indexing. For the indexed bead embodiments shown in FIG. 4A-4E, for both single and double indexing (left), the attachment polynucleotide hybridizes to a second transposon in the 3' adapter sequence (sequence B15'). For the embodiments of the universal granules shown in FIG. 4A-4E, for both single and double indexing (right), the attachment polynucleotide hybridizes to the first transposon in the 5' adapter sequence (sequence A14'). In some embodiments, normalized libraries can be obtained from stock samples such that the nucleic acid is extracted from the stock sample and directly injected into the system or method described herein, the self-normalized sample providing a strong CV across a range of sample types.

[0019] In FIG. 5A and 5B show a schematic diagram of exemplary transposome complexes for action other than indexing, showing an addition polynucleotide hybridized to either a transposon containing the P7 sequence (FIG. 5A) or a transposon containing the P5 sequence (FIG. 5B). In particular, in FIG. 5A and 5B show a primer sequence (P5 sequence) fused to the 5' adapter sequence (A14 sequence) of the first transposon and a primer sequence (P7' sequence) fused to the 3' adapter sequence (B15' sequence) of the second transposon, with thereby obtaining non-indexing transposome complexes. The addition polynucleotide can be hybridized either at the second transposon using the 5' binding element (B) (FIG. 5A) or at the first transposon using the 3' binding element (B) (FIG. 5B).

[0020] In FIG. 6A-6D show schematic diagrams of exemplary transposome complexes including the i5 indexing sequence. On FIG. 6A shows a complex in which an attachment polynucleotide containing a nitro sequence and an anchor sequence can hybridize to an index oligonucleotide, which can then be ligated to the 5' end of the first transposon. On FIG. 6A, the transposome complex contains a first transposon containing a 3' transposon sequence (ME) and a 5' adapter sequence (A14), a second transposon containing a 5' transposon sequence (ME') and a 3' adapter sequence (B15' ), and an attachment polynucleotide containing a junction adapter sequence (A14') hybridized to A14 in the first transposon and a binding element (biotin). In this case, the addition polynucleotide further comprises a nitroindole sequence (a universal sequence that binds to any i5 index region) and a primer sequence (P5'). The B15' region of the second transposon can be hybridized to a polynucleotide containing a complement (B15), an index region and a P7 primer sequence, which itself is annealed to the P7'-i7' index molecule. Ligation of the 5' end of the i7' index region to the 3' end of the 3' adapter sequence serves to create a fully double stranded region.

[0021] In FIG. 6B shows an attachment polynucleotide containing an anchor sequence and a spacer region that can hybridize to an index oligonucleotide that can then be ligated to the 5' end of the first transposon. On FIG. 6B, the first transposon contains a 3' transposon sequence (ME) and a 5' adapter sequence (A14), and the second transposon contains a 5' transposon sequence (ME') and a 3' adapter sequence (B15'), as shown. in FIG. 6A. However, in this case, the attachment polynucleotide contains a complementary adapter (A14'), a fixed sequence, a 2 x sp 18 spacer region, a primer complement (P5'), and a biotin-binding element. The i5 index contains an anchor sequence (complementary to anchor'), an i5 index region, and a primer sequence (P5). The i5 index hybridizes to complementary anchor and primer sequences on the attachment polynucleotide throughout the spacer.

[0022] In FIG. 6C shows an attachment polynucleotide containing a spacer and an A14' sequence that can hybridize to an index oligonucleotide that can then be ligated to an X sequence at the 5' end of the first transposon. On FIG. 6C, the first transposon contains the 3' transposon sequence (ME) and the 5' adapter sequence X, and the second transposon contains the 5' transposon sequence (ME') and the 3' adapter sequence (B15'). The attachment polynucleotide contains a 5' adapter sequence complement (X'), a second adapter sequence (A14'), a spacer region (2 x sp18), a primer complement (P5'), and a biotin binding element. The 5' adapter sequence (X') hybridizes to the first 5' adapter sequence of the transposon (X). The i5 index contains the complement of the second adapter sequence (A14), the 2 x sp18 spacer region and the primer sequence (P5). The i5 index hybridizes to the second adapter sequence and the primer complement on the attachment polynucleotide in the spacer region, and the 3' end of the complement of the second adapter sequence ligates to the X sequence. In addition, the i7 index containing the 5' primer sequence (P7), the i7 index and the complement of the 3' adapter sequence (B15) are annealed and the 3' end of the 3' adapter sequence is extended to form a double stranded region.

[0023] In FIG. 6D shows an attachment polynucleotide containing a spacer and an A14' sequence that can hybridize to an index oligonucleotide that can then be ligated to an X sequence at the 5' end of the first transposon. In this case, the indexing oligonucleotide contains a double-stranded primer region. On FIG. 6D, the first transposon, second transposon, and attachment polynucleotide are the same as those shown in FIG. 6C. The i7 index contains a double-stranded primer (P7/P7'), an i7 index region, and a 3' adapter sequence complement (B15). The double-stranded region at the i7 index can be created (annealed) during the extension and ligation reaction, for example, there is no need to anneal the i7 index before the reaction itself. The P7' oligonucleotide can be included in the reaction mixture. The i7 index is annealed through the B15 region and extension and ligation from the second transposon provides a double stranded region. An example of this method is presented in example 5.

[0024] In FIG. 7A-7B show illustrative results of a method for generating a labeled nucleic acid fragment library with and without PCR amplification, including results for improved accuracy and re-indel recognition (FIG. 7A) and improved coverage of GC-rich promoters (FIG. 7B). Four methods were used to obtain these data: two with PCR (TruSeq™ Nano and Nextera™ DNA Flex) and two without PCR (the present method and TruSeq™ PCR-Free). Each method involved two replications, and a total of eight libraries were created. After sequencing, data were thinned 25 times. On FIG. 7A shows the high percentage of indel accuracy and re-recognition for the non-PCR method described herein. Samples from left to right include the following (in duplicate): TruSeq™ Nano (black); Nextera™ DNA Flex (White); the non-PCR method described herein (inline); and TruSeq™ PCR-Free (cage). On FIG. 7B shows the improvement in GC-rich promoter coverage for the non-PCR method described herein compared to other methods, including: Nextera™ DNA Flex (upper left); TruSeq™ Nano (top right); the non-PCR method described herein (lower left); and TruSeq™ PCR-Free (lower right).

[0025] In FIG. 8 shows the results of sequencing libraries from a sample containing known 100% GC replication (FMR1) generated using DNA from the Nextera™ DNA Flex or TruSeq™ DNA PCR-Free Library Prep kits for comparison with the methods described herein. (in four copies of samples 1-4), as described in example 3.

[0026] In FIG. 9A-9C show % CV results for libraries generated using eight pairs of indexes along with the systems shown in FIG. 6C (data in Fig. 9A) and 6D (data for the two reaction conditions in Figs. 9B and 9C) as described in Example 5.

[0027] In FIG. 10 shows a graphical representation of RNPEPL1 gapped sequencing coverage for PCR library preparation methods (Nextera Flex or Tube-based Nextera), but with fewer gaps using non-PCR methods described here (bottom two panels).

DETAILED DESCRIPTION OF THE INVENTION

[0028] Libraries of fragmented nucleic acids are often created from genomic nucleic acids for use in fields related to next generation sequencing (NGS). The present disclosure provides methods, compositions, and kits for generating a fragmented nucleic acid library that adds sequences necessary to perform sequencing operations, including indexes, without using PCR to add sequences via amplification (also referred to herein as non-PCR library generation or libraries without PCR). This method of obtaining a transposome library without PCR can reduce and/or eliminate PCR-induced bias in current tagging approaches for library preparation.

[0029] "Tagmentation" refers to the use of a transposase to fragment and label nucleic acids. Tagging involves the modification of DNA with a transposome complex containing the enzyme transposase in complex with adapters containing transposon terminal sequences (referred to herein as transposons). Tagging provides simultaneous fragmentation of DNA and ligation of adapters to the 5' ends of both strands of duplex fragments. Typically, after a purification step to remove the transposase enzyme, additional sequences are added to the ends of the adapted fragments by PCR.

[0030] The methods, compositions, systems, and kits described herein relate to complex-hybridized oligonucleotides and complexes containing such hybrids, including surface-immobilized complexes, and to the use of transposome complexes to form a library without PCR. As described herein, the transposome complex includes a transposase and its associated transposons that fragment and label the target DNA molecule. In some aspects, the complex-hybridized oligonucleotide is cleavable and includes a linking element, and in other aspects, the complex-hybridized oligonucleotide contains an attachment polynucleotide with a linking element. In some aspects, an attachment polynucleotide is a nucleotide sequence that hybridizes to a transposon in a transposome complex and is immobilized on a solid support such as a slide, flow cell, or bead. Due to the hybridization of the polynucleotide with the transposon, the transposome complex can be immobilized on a solid support indirectly via the attachment polynucleotide. Binding of the polynucleotide to the solid support occurs via a linking element on the attachment polynucleotide. Target nucleic acids are captured by the transposome complexes, and then the nucleic acids are fragmented and labeled ("tagmentation"). The oligonucleotide system is configured to include any labels required for indexing and sequencing through tagmentation, extension and/or ligation steps without PCR amplification. Thus, in some aspects, labeled fragments can be extended, ligated and indexed without amplification to create a library of nucleic acid fragments without the use of PCR amplification.

[0031] Solution-based tagmentation has disadvantages and requires several laborious steps. In addition, bias can be introduced during the PCR amplification steps used to introduce tag sequences. For example, a decrease in indel may result from PCR due to polymerase slippage. In addition, PCR polymerases have difficulties in certain regions, such as regions with high levels of GC or AT, or regions of sequence repeat, resulting in gaps, misidentifications of structure in the genome, or loss of repeat expansion.

[0032] The methods, compositions, systems, and kits provided herein overcome these disadvantages and allow for undistorted sample preparation and sequencing with minimal sample manipulation or transfer requirements. The methods, compositions, systems and kits described herein relate to the creation of libraries without the use of PCR amplification. The non-PCR approach reduces and/or eliminates PCR-induced biases, including reduction in the number and frequency of gaps, particularly in GC-rich regions difficult to access by PCR; improving the efficiency of indel recognition, including improving the efficiency of repeated recognition of indels and the accuracy of indels; improved recognition of reproduction of repeats; as well as improved coverage in GC-rich promoters. The present application describes various complex transposome configurations for performing non-PCR tagging to improve the generation of nucleic acid libraries.

[0033] In addition, the methods, compositions, systems, and kits described herein can be performed over a period of less than obtaining and analyzing a nucleic acid sample using other methods, such as PCR-based methods. Thus, in some embodiments, the methods for generating a library of labeled nucleic acid fragments described herein can be performed over a period of less than about 5 hours, such as less than 5, less than 4, less than 3, or less than 2 hours. In some embodiments, the methods for generating a library of labeled nucleic acid fragments described herein can be performed over a period ranging from about 90 minutes to about 300 minutes, such as 90, 105, 120, 135, 150, 165, 180, 195, 210, 225, 240, 255, 270, 285 or 300 minutes, or for a period within the range defined by any two of the above values.

[0034] Moreover, in some embodiments, the use of the methods, compositions, systems, and kits described herein results in nucleic acid fragmentation that is time independent, immobilization of the transposome results in a constant insert size, and saturation allows integration of extraction and get the library without quantification.

[0035] Additional advantages of the methods, compositions, systems, and kits described herein relate to the immobilization of a transposome complex on a solid surface and include the following: for example, reducing direct and total library preparation time, cost, and reagent requirements, reducing entry requirements for sample and allowing uncleaned or decomposed samples to be used as a starting point for obtaining a library. In addition, the transposome complexes described herein also allow the production of libraries with more consistent insert sizes compared to methods that use a dissolution phase, even when using different input sample concentrations.

[0036] In some embodiments, nucleic acid libraries obtained by the methods described herein can be sequenced using any suitable nucleic acid sequencing platform to determine the nucleic acid sequence of the target sequence. In some respects, sequences of interest correlate or associate with one or more congenital or inherited disorders, pathogenicity, antibiotic resistance, or genetic modifications. Sequencing can be used to determine the nucleotide sequence of a short tandem repeat, single nucleotide polymorphism, gene, exon, coding region, exome, or portion thereof. Thus, the methods and compositions described herein relate to the creation of sequencing libraries for use without limitation in cancer and other disease diagnostics, prognosis and therapeutics, DNA genotyposcopy applications (e.g., for creating DNA databases, in work on criminal cases), metagenomic research and discovery, agriculture, and pathogen identification and monitoring.

[0037] In some embodiments, the junction adapter sequence is hybridized to at least a portion of the 5' adapter sequence and the junction element is at the 3' end of the attachment polynucleotide. In some embodiments, the attachment adapter sequence hybridizes to at least a portion of the 3' adapter sequence and the binding element is at the 5' end of the attachment oligonucleotide.

[0038] Unless otherwise indicated, all technical and scientific terms used in this document have the same meaning as commonly used by a person skilled in the art. All patents, applications, published applications, and other publications referenced herein are incorporated herein by reference in their entirety, unless otherwise noted. Unless otherwise noted, where there are multiple definitions for a term provided in this document, the definitions provided in this section take precedence. As used in this specification and the appended claims, the singular forms include references to the plural forms, unless the context clearly indicates otherwise. Unless otherwise indicated, conventional methods of mass spectroscopy, NMR, HPLC, protein chemistry, biochemistry, recombinant DNA and pharmacology methods are used. The use of the union "or" or "and" means "and/or", unless otherwise indicated. Moreover, the use of the term "including", as well as other forms such as "include", "includes" and "included", is not intended to be limiting. When used in the present description, either in a transitional phrase or in the structure of the claims, the terms "comprises" and "comprising" should be interpreted as having an unrestricted meaning. In other words, the terms should be interpreted as synonymous with the phrases "having at least" or "comprising at least". In the context of a process, the term "comprising" means that the process includes at least these steps, but may include additional steps. In the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the specified features or components, but may include additional features or components.

[0039] The section headings used in this specification are for organizational purposes only and should not be construed as limiting the subject matter described.

Transposome complexes

[0040] Some embodiments provided herein relate to a composition for generating a library of labeled nucleic acid fragments without PCR amplification. In some embodiments, the composition comprises a solid support and a transposome complex immobilized on the solid support. In some embodiments, the transposome complex includes a transposase, a first transposon, an attachment polynucleotide, and a second transposon. In some embodiments, the first transposon includes a 3' transposon sequence and a 5' adapter sequence. In some embodiments, the attachment polynucleotide includes an attachment adapter sequence fused to a 5' adapter sequence and a linking element. In some embodiments, the second transposon contains a 5' transposon sequence and a 3' adapter sequence. In some embodiments, the transposome complex is immobilized on a solid support via an attachment polynucleotide. In some embodiments, the attachment polynucleotide further comprises a primer sequence.

[0041] In some embodiments, the implementation of the connecting element contains or is an optionally substituted biotin. In some embodiments, the implementation of the connecting element is connected to the polynucleotide accession via a linker. In some embodiments, the linking element comprises or is a biotin linker. In some embodiments, the implementation of the connecting element contains or is a 3', 5' or internal biotin.

[0042] In some embodiments, the 3'-terminal sequence of the transposon contains a terminal mosaic (ME) sequence, and the 5'-terminal sequence of the transposon contains the ME' sequence. In some embodiments, the 5' adapter sequence contains an A14 sequence and the attachment adapter sequence contains an A14' sequence. In some embodiments, the 3' adapter sequence contains the B15' sequence. In some embodiments, the 3' adapter sequence is complementary to at least a portion of the index adapter sequence. In some embodiments, the index adapter sequence comprises a B15 sequence. In some embodiments, a portion of the attachment polynucleotide contains a primer sequence, such as a P5' primer sequence. In some embodiments, the accession polynucleotide primer sequence is complementary to at least a portion of an indexing oligonucleotide sequence, such as a P5 primer sequence.

[0043] In some embodiments, the transposome complex is immobilized on a solid support via a binding element (and an optional linker) as described herein. In some embodiments, the solid support is a bead, a paramagnetic bead, a flow cell, a microfluidic device surface, a test tube, a plate well, a glass slide, a structured surface, or a microparticle. In some embodiments, the solid support comprises or is a bead. In one embodiment, the bead is a paramagnetic bead. In some embodiments, the solid support comprises a plurality of solid supports. In some embodiments, transposome complexes are immobilized on a plurality of solid supports. In some embodiments, the plurality of solid supports comprises a plurality of granules. In some embodiments, a plurality of transposome complexes are immobilized on a solid support at a density of at least 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ complexes per mM ² . In some embodiments, the solid support is a bead or paramagnetic beads and more than 10,000, 20,000, 30,000, 40,000, 50,000, or 60,000 transposome complexes are associated with each bead.

[0044] Transposon-based technology can be used for DNA fragmentation, for example, as shown in the example workflow of NEXTERA™ FLEX DNA Sampler Kits (Illumina, Inc.), where target nucleic acids, such as genomic DNA, are treated with transposome complexes, which simultaneously fragment and label the target (“tagmentation”), thus creating a population of fragmented nucleic acid molecules labeled with unique adapter sequences at the ends of the fragments.

[0045] A transposition reaction is a reaction in which one or more transposons are introduced into target nucleic acids at random sites or substantially random sites. The components of the transposition reaction include a transposase (or other enzyme capable of fragmenting and labeling a nucleic acid as described herein, such as an integrase) and a transposon element that includes a double-stranded transposon terminal sequence that binds to the transposase (or other enzyme described in herein), and an adapter sequence attached to one of the two terminal sequences of the transposon. One strand of the double-stranded transposon end sequence is transferred into one strand of the target nucleic acid, and the complementary strand of the transposon end sequence is not transferred (no transfer transposon sequence). The adapter sequence may include one or more functional sequences or components (eg, primer sequences, anchor sequences, universal sequences, spacer regions, or index tag sequences) as needed.

[0046] A "transposome complex" consists of at least one transposase (or other enzyme described herein) and a transposon recognition sequence. In some of these systems, a transposase binds to a transposon recognition sequence to form a functional complex that is capable of catalyzing the transposition reaction. In some aspects, the transposon recognition sequence is the double-stranded terminal sequence of the transposon. The transposase binds to the transposase recognition site in the target nucleic acid and inserts the transposon recognition sequence into the target nucleic acid. In some such insertion events, one strand of a transposon recognition sequence (or terminal sequence) is transferred into the target nucleic acid, resulting in a cleavage event. Illustrative transposition procedures and systems that can be readily adapted for use with transposases.

[0047] Examples of transposases that can be used with certain embodiments provided herein include the following (or are encoded as follows): Tn5 transposase, Sleeping Beauty (SB) transposase, Vibrio harveyi , MuA transposase, and Mu transposase recognition site containing terminal R1 and R2 sequences, StaphylococcUS aureUS transposaminase Tn552, Ty1, Tn7, Tn/O and IS10, Mariner transposase, Tc1, P-element, Tn3, bacterial insert sequences, retroviruses and yeast retrotransposon. Other examples include IS5, Tn10, Tn903, IS911, and engineered versions of the transposase family of enzymes. The methods described herein may also include combinations of transposases, not just one transposase.

[0048] In some embodiments, the transposase is a Tn5, Tn7, MuA, or Vibrio Haryi transposase, or an active mutant thereof. In other embodiments, the transposase is a Tn5 transposase or a mutant thereof. In other embodiments, the transposase is a Tn5 transposase or a mutant thereof. In other embodiments, the transposase is a Tn5 transposase or an active mutant thereof. In some embodiments, the Tn5 transposase is a hyperactive Tn5 transposase or an active mutant thereof. In some aspects, the Tn5 transposase is the Tn5 transposase described in PCT Publication No. WO2015/160895, which is incorporated herein by reference. In some aspects, the Tn5 transposase is an overactive Tn5 transposase with mutations at positions 54, 56, 372, 212, 214, 251, and 338 relative to the wild-type Tn5 transposase. In some aspects, the Tn5 transposase is an overactive Tn5 transposase with the following mutations relative to the wild-type Tn5 transposase: E54K, M56A, L372P, K212R, P214R, G251R, and A338V. In some embodiments, the Tn5 transposase is a fusion protein. In some embodiments, the Tn5 transposase fusion protein contains a Ts extension factor (Tsf) fusion tag. In some embodiments, the Tn5 transposase is an overactive Tn5 transposase containing mutations at amino acids 54, 56, and 372 relative to the wild-type sequence. In some embodiments, the overactive Tn5 transposase is a fusion protein, optionally the fusion protein is a Ts extension factor (Tsf). In some embodiments, the recognition site is a Tn5 type transposase recognition site (Goryshin and Reznikoff, J. Biol. Chem., 273:7367, 1998). In one embodiment, a transposase recognition site complexed with an overactive Tn5 transposase (eg, EZ-Tn5™ transposase, Epicentre Biotechnologies, Madison, Wis.) is used. In some embodiments, the Tn5 transposase is a wild-type Tn5 transposase.

[0049] In some embodiments, the transposome complex comprises a dimer of two transposase molecules. In some embodiments, the transposome complex is a homodimer in which two transposase molecules are each associated with a first and second transposon of the same type (eg, the sequences of the two transposons associated with each monomer are the same, forming a "homodimer"). In some embodiments, the compositions and methods described herein use two populations of transposome complexes. In some embodiments, the transposases in each population are the same. In some embodiments, the transpomosome complexes in each population are homodimers, with the first population having a first adapter sequence in each monomer and the second population having a different adapter sequence in each monomer.

[0050] In some embodiments, the transposase complex comprises a transposase dimer (eg, Tn5 transposase) containing first and second monomers. In some aspects, each monomer comprises a first transposon, a second transposon, and an attachment polynucleotide, wherein the first transposon includes a transposon terminal sequence at the 3' end (also referred to as a 3' transposon sequence) and an adapter sequence at the 5' end (also referred to as 5'-adapter sequence); the second transposon includes a transposon terminal sequence at the 5' end (also referred to as a 5' transposon sequence) and an adapter sequence at the 3' end (also referred to as a 3' adapter sequence); and the attachment polynucleotide includes an attachment adapter sequence fused to the 5' adapter sequence of the first transposon, a primer sequence, and a linker. In some embodiments, the 5' transposon sequence of the second transposon is at least partially complementary to the 3' transposon sequence of the first transposon. In some embodiments, the attachment polynucleotide junction adapter sequence is at least partially complementary to the 5' adapter sequence of the first transposon. In some embodiments, the attachment polynucleotide linker includes a linking element.

End sequences

[0051] In any of the embodiments of the method described herein, the first transposon includes a 3' transposon sequence and the second transposon includes a 5' transposon sequence. In some embodiments, the 5' end sequence of the transposon is at least partially complementary to the 3' end sequence of the transposon. In some embodiments, the transposon's complementary terminal sequences hybridize to form a double-stranded transposon terminal sequence that binds to a transposase (or other enzyme as described herein). In some embodiments, the terminal sequence of the transposon is a mosaic end (ME) sequence. Thus, in some embodiments, the 3' end sequence of the transposon is the ME sequence and the 5' end sequence of the transposon is the ME sequence.

Adapter sequences

[0052] In any of the embodiments of the method described herein, the first transposon includes a 5' adapter sequence and the second transposon includes a 3' adapter sequence. Adapter sequences may contain one or more functional sequences or components selected from the group including primer sequences, anchor sequences, universal sequences, spacer regions, index sequences, capture sequences, data bank sequences, cleavage sequences, sequences associated with sequencing, and combinations thereof. . In some embodiments, the implementation of the adapter sequence contains a primer sequence. In other embodiments, the adapter sequence comprises a primer sequence and an index or databank sequence. The primer sequence may also be a universal sequence. This disclosure is not limited to the type of adapter sequences that may be used, and the skilled artisan will recognize additional sequences that may be used for library generation and next generation sequencing. A universal sequence is a region of a nucleotide sequence that is common to two or more nucleic acid fragments. Optionally, two or more nucleic acid fragments also have regions of sequence differences. A universal sequence that may be present in different members of a plurality of nucleic acid fragments may allow for the replication or amplification of a plurality of different sequences using a single universal primer that is complementary to the universal sequence.

[0053] In some embodiments, the attachment polynucleotide includes an attachment adapter sequence fused to a 5' adapter sequence. In some embodiments, the adapter attachment sequence is at least partially complementary to the 5' adapter sequence. In some embodiments, the adapter sequence is an A14 sequence or a B15 sequence. Thus, in some embodiments, the 5' adapter sequence is an A14 sequence and the attachment adapter sequence is an A14' sequence. In some embodiments, the 3' adapter sequence is a B15' sequence. In some embodiments, the adapter sequence is any hybridization sequence (referred to herein as an X sequence). In some embodiments, the X sequence contains 16-20 nucleotides. In some embodiments, sequence X has a melting point (Tm) similar to that of the adapter sequence. In some embodiments, sequencing results are improved if the Tm of sequence X has a melting point similar to that of the adapter sequence. In some embodiments, sequence X has a melting point similar to that of sequence A14 or sequence B15. In some embodiments, the Tm of sequence X is 53°-56°. In some embodiments, the adapter sequence is transferred to the 5' ends of the nucleic acid fragment via a tagging reaction.

[0054] In any of the embodiments, the adapter sequence or transposon terminal sequences, including A14-ME, ME, B15-ME, ME', A14, B15, and ME, are as follows:

A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1

B15-ME: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 2).

ME': 5'-phos-CTGTCTCTTATACACATCT-3' (SEQ ID NO: 3).

A14: 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 4)

B15: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 5)

ME: AGATGTGTATAAGAGACAG (SEQ ID NO: 6)

Attachment polynucleotide

[0055] Embodiments of the transposome complex described herein include an attachment polynucleotide. As used herein, an attachment polynucleotide is a polynucleotide that hybridizes to a transposon at one end and binds to a surface at the second end. Thus, the transposome complex described herein is immobilized on a solid support via an attachment polynucleotide. In some embodiments, the attachment polynucleotide comprises an attachment adapter sequence fused to a first transposon adapter sequence or a second transposon adapter sequence, a primer sequence, and a linker. In some embodiments, the implementation of the linker includes a connecting element.

[0056] As described herein, the attachment adapter sequence may be at least partially complementary to the adapter sequence of the first or second transposon. In some embodiments, the attachment adapter sequence hybridizes to a 5' adapter sequence. In embodiments in which the attachment adapter sequence hybridizes to a 5' adapter sequence, where the 5' adapter sequence is an A14 sequence, the attachment adapter sequence is an A14' sequence. In some embodiments, the adapter sequence is an X sequence. In some embodiments, the junction adapter sequence hybridizes to a 3' adapter sequence. In embodiments in which the attachment adapter sequence hybridizes to a 3' adapter sequence, where the 3' adapter sequence is a B15' sequence, the attachment adapter sequence is a B15 sequence. In any of these embodiments, the junction adapter sequence may be fully complementary to the first or second transposon adapter sequence, or partially complementary to the first or second transposon adapter sequence.

[0057] In some embodiments, the attachment polynucleotide contains a primer sequence. In some embodiments, the primer sequence is a P5 primer sequence, or a P7 primer sequence, or its complement (eg, P5' or P7'). Primers P5 and P7 are used on the surface of commercial flow cells supplied by Illumina, Inc. for sequencing on various Illumina platforms. Primer sequences are described in US Patent Publication No. 2011/0059865, which is incorporated herein by reference in its entirety. Examples of P5 and P7 primers that may have an alkyne end group at the 5' end include the following:

P5: AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO: 7)

P7: CAAGCAGAAGACGGCATACGAG*AT (SEQ ID NO: 8)

and their derivatives. In some examples, the P7 sequence includes a modified guanine at the G* position, such as 8-oxoguanine. In other examples, * indicates that the bond between G* and the adjacent 3' A is a thiophosphate bond. In some examples, the P5 and/or P7 primers include non-naturally occurring linkers. Optionally, one or both of the P5 and P7 primers may include a poly-T tail. The poly-T tail is essentially located at the 5' end of the above sequence, for example between the 5' base and the terminal alkyne unit, but in some cases may be located at the 3' end. The poly-T sequence may include any number of T-nucleotides, for example from 2 to 20. Although primers P5 and P7 are given as examples, it should be understood that any suitable primers can be used in the examples provided herein. Index sequences having primer sequences, including P5 and P7 primer sequences, serve to add P5 and P7 to activate the sequencing library. Although primers P5 and P7 are given as examples, it should be understood that any suitable amplification primers can be used in the examples provided herein.

[0058] As used herein, one example of a linker is a functional group that covalently connects the linking element to the end of the nucleotide portion of the attachment polynucleotide and can be used to immobilize the attachment polynucleotide on a solid support. The linker may be a cleavable linker, for example a linker capable of being cleaved to remove the attachment polynucleotide and thus the transposome complex or label product from the solid support. As used herein, a cleavable linker is a linker that can be cleaved off by chemical or physical means such as, for example, photolysis, chemical cleavage, thermal cleavage, or enzymatic cleavage. In some embodiments, the cleavage may be carried out by biochemical, chemical, enzymatic, nucleophilic, reduction-sensitive means, or other means. The cleavable linkers may contain a moiety selected from the group consisting of the following: a restriction endonuclease site; at least one ribonucleotide cleaved by RNase; nucleotide analogs cleavable in the presence of a specific chemical(s) agent(s); photocleavable(s) linker(s) unit(s); a diol bond cleaved off by periodate treatment (as an example); a disulfide group cleaved off by a chemical reducing agent; a cleavable functional group that can be subjected to photochemical cleavage; and a peptide cleavable by a peptidase enzyme or other suitable methods. Cleavage can be mediated by enzymes by incorporating the cleavable nucleotide or nucleotide base into a cleavable linker such as uracil or 8-oxoguanine.

[0059] In some embodiments, the linker described herein may be covalently and directly attached to the attachment polynucleotide, for example, to form an -O- bond, or may be covalently attached through another group, such as a phosphate or ester. In an alternative embodiment, the linker described herein can be covalently attached to the phosphate group of the attachment polynucleotide, eg, covalently attached to the 3'-hydroxyl group via a phosphate group, thereby forming an -OP(O) ₃ bond.

[0060] As used herein, a binding element is a moiety that can be used to bind, covalently or non-covalently, to a binding partner. In some aspects, the binding element is on the transposome complex and the binding partner is on a solid support. In some embodiments, the binding element may bind or non-covalently bind to a binding partner on a solid support, thereby non-covalently attaching the transposome complex to the solid support. In some embodiments, the implementation of the connecting element is able to communicate (covalently or non-covalently) with a binding partner on a solid support. In some aspects, the binding element is linked (covalently or non-covalently) to a binding partner on a solid support, resulting in the formation of an immobilized transposome complex.

[0061] In such embodiments, the binding element contains or is, for example, biotin, and the binding partner contains or is avidin or streptavidin. In other embodiments, the binding element/binding partner combination comprises or is FITC/anti-FITC antibody, digoxigenin/digoxigenin antibody, or hapten/antibody. Other suitable binding pairs include, without limitation, dithiobiotinavidin, iminobiotinavidin, biotinavidin, dithiobiotinsuccinylated avidin, iminobiotinsuccinylated avidin, biotinstreptavidin, and biotinsuccinylated avidin. In some embodiments, the binding element is biotin and the binding partner is streptavidin.

[0062] In some embodiments, the linking element can be linked to a binding partner via a chemical reaction or covalently bonded to a binding partner on a solid support, thereby covalently linking the transposome complex to the solid support. In some aspects, the binding element/binding partner combination comprises or is an amine/carboxylic acid (eg, binding via a standard peptide coupling reaction under conditions known to one of skill in the art, such as EDC or NHS-mediated binding). The reaction of the two components connects the linking element to the linking partner via an amide bond. In an alternative embodiment, the linker and the linker may be two click chemistry partners (eg, an azide/alkyne that react to form a triazole bond).

[0063] In some embodiments, the attachment polynucleotide also includes additional sequences or components, such as a universal sequence, a spacer region, an anchor sequence, or an indexed tag sequence, or a combination thereof. A universal sequence is a region of a nucleotide sequence that is common to two or more nucleic acid fragments. Optionally, two or more nucleic acid fragments also have regions of sequence differences. A universal sequence that may be present in different members of a plurality of nucleic acid fragments may allow for the replication or amplification of a plurality of different sequences using a single universal primer that is complementary to the universal sequence.

[0064] In some embodiments, the first transposon further comprises a 5' primer sequence of the 5' adapter sequence, and the attachment polynucleotide comprises (i) a portion complementary to and hybridized to the 5' adapter sequence, and (ii) a complementary primer sequence ( see Fig. 4A, universal granules with single indexing). Such constructs can be used as general purpose microcarriers in single indexing applications because there is no index mark sequence.

[0065] In some embodiments, the first transposon further comprises a 5' primer sequence of a 5' adapter sequence and the attachment polynucleotide comprises an index tag sequence and a primer sequence (see, e.g., Fig. 4A, single indexing beads).

[0066] In some embodiments, the first transposon comprises a 5' adapter sequence, and the attachment polynucleotide comprises (i) a portion complementary to and hybridized to the 5' adapter sequence, (ii) a spacer region, and (iii) a primer sequence (see Fig. 4A, universal beads, double indexing).

[0067] In some embodiments, the second transposon comprises a 3' adapter sequence, and the attachment polynucleotide comprises (i) a portion complementary to and hybridized to the 3' adapter sequence, (ii) an index tag sequence, and (iii) a primer sequence (see Fig. 4A, double indexing, indexed beads).

[0068] In some embodiments, the attachment polynucleotide comprises a spacer region (see, for example, Fig. 4A) or a spacer region and an anchor region (see, for example, Fig. 3). As used herein, a "spacer region" is a nucleic acid sequence that does not contain any structural or coding information for the known functions of a gene. The spacer region on the attachment polynucleotide is capable of aligning with indexing oligonucleotides of different sequences (eg, i5 sequence range). In some embodiments, the implementation of the spacer region is a universal sequence. In some embodiments, the spacer region is a spacer other than DNA. In some embodiments, the spacer region includes universal bases such as inosines or nitroindoles. In some embodiments, the spacer includes an sp18 linker. As used herein, the sp18 linker is a standard modifier linker with a C18 spacer (18 atom hexaethylene glycol spacer) which is equivalent to 4 base pairs in length. Thus, a 2 x sp18 linker is equivalent in length to 8 base pairs. In some embodiments, the spacer region contains a 2 x sp18 synthetic linker. In some embodiments, the spacer region contains one or more C18 spacers, such as 1, 2, 3, 4, 5, 6 or more C18 spacers. In some embodiments, the spacer region contains two C18 spacers (equivalent to 8 nucleotides in length). In some embodiments, the spacer is a C9 spacer equivalent in length to 2 base pairs. In some embodiments, the spacer region comprises one or more C9 spacers (triethylene glycol spacer), such as 1, 2, 3, 4, 5, 6 or more C9 spacers. In some embodiments, the spacer is a standard spacer used with existing indexes, such as a 10 bp spacer. In some embodiments, the spacer region is a combination of spacers, such as a combination of one or more C18 spacers and one or more C9 spacers, or any combination of any of the spacers described herein. In some embodiments, the spacer region has a length equivalent to 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, or 30 base pairs. In some embodiments, the spacer region has a length approximately equivalent to 8 or 10 base pairs or nucleotides. In some embodiments, the spacer region was specifically the same length as the index region. In some embodiments, the index regions are 8 nucleotides in length and the spacer region contains two C18 spacers. In some embodiments, the index regions are 10 nucleotides in length and the spacer region contains two C18 spacers and one C9 spacer.

[0069] In some aspects, the attachment polynucleotide contains an anchor sequence. In some embodiments, the anchor sequence is GGATATGCTCGG (SEQ ID NO: 22). In some embodiments, the anchor sequence is an A14 sequence (SEQ ID NO: 4). In the context of this document, "anchor region" means a DNA sequence that is complementary to the complement region of the anchor in the indexing oligonucleotide and that allows hybridization of the two components (see, for example, Fig. 3B). In some aspects, the anchor region is complementary to a portion of the complement region of the anchor of the indexing oligonucleotide, wherein the indexing oligonucleotide comprises the complementary region of the anchor and an index tag sequence (--anchor' - index tag sequence -). In some embodiments, the anchor sequence is complementary to the complement region of the anchor that is common to multiple indexing oligonucleotides. In some embodiments, each index tag sequence in a plurality of indexing oligonucleotides is the same (no indexing) or different (with indexing). In some embodiments, the index mark sequence is an i5 sequence. The attachment polynucleotide may further include additional sequence elements or components to enhance the efficiency and functionality of the attachment polynucleotide for binding to indexes, including, for example, primer sequences, anchor sequences, universal sequences, spacer regions, index sequences, capture sequences, data bank sequences, cleavage sequences , sequences associated with sequencing, and combinations thereof. In some embodiments, the attachment polynucleotide contains the sequence A14'.

[0070] Variants of the transposome complex can be implemented, including transposase, transposons, and polynucleotide attachment. For example, variations in configuration, design, hybridization, building blocks, and general arrangement of the transposome complex can be implemented. In the description and drawings presented herein, several options are presented, but it should be understood that additional options can be easily implemented within the scope of the present description of the invention.

7.5. Solid backing

[0071] The terms "solid surface", "solid support" and other grammatical equivalents refer to any material suitable for or capable of attaching transposome complexes. As will be appreciated by those skilled in the art, the number of possible substrates is wide. Possible substrates include, without limitation, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon, etc.), polysaccharides, materials based on polyhedral organic silsesquioxane (POSS), nylon or nitrocellulose, ceramics, resins, silica or silica-based materials, including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, fiber optic bundles, granules, paramagnetic granules, and many other polymers .

[0072] Suitable granular compositions include, without limitation, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thorium sol, carbon in the form of graphite, titanium dioxide, latex, or cross-linked dextran such as sepharose, cellulose, nylon , cross-linked micelles and Teflon, as well as any other materials described in this document in relation to solid substrates. In certain embodiments, the microspheres are magnetic microspheres or beads, such as paramagnetic particles, spheres or beads. The granules need not be spherical; irregularly shaped particles can be used. Alternatively or additionally, the granules may be porous. Bead sizes range from nanometers, such as 100 nM, to millimeters, such as 1 mM, preferably from 0.2 microns to 200 microns, and particularly preferably from 0.5 to 5 microns, although in some embodiments smaller beads can be used. or larger. The bead may be coated with a binding partner, for example the bead may be coated with streptavidin. In some embodiments, the beads are streptavidin-coated paramagnetic beads, e.g., Dynabeads MyOne streptavidin C1 beads (Thermo Scientific, cat. no. 65601), streptavidin paramagnetic beads (Promega, cat. no. Z5481), streptavidin magnetic beads (NEB, cat. no. S1420S) and MaxBead Streptavidin (Abnova, Cat. No. U0087). The solid support may also be a glass slide, such as a flow cell or other glass slide, modified so that the transposome complex can be immobilized on it.

[0073] In some embodiments, the binding partner is present on a solid support or bead at a density of 1000 to about 6000 pmol/mg, or about 2000 to about 5000 pmol/mg, or about 3000 to about 5000 pmol/mg, or from about 3500 to about 4500 pmol/mg.

[0074] In one embodiment, the hard surface is the inner surface of the sample tube. In another embodiment, the hard surface is a capture membrane. In one example, the capture membrane is a biotin capture membrane (eg, available from Promega Corporation). In another example, the capture membrane is filter paper. In some embodiments of the present disclosure, solid supports composed of an inert substrate or matrix (e.g., glass slides, polymer beads, etc.) that have been functionalized, for example, by applying a layer or coating of an intermediate material containing reactive groups, which provide covalent attachment to molecules such as polynucleotides. Examples of such supports include, without limitation, polyacrylamide hydrogels supported on an inert substrate such as glass, in particular the polyacrylamide hydrogels described in WO2005/065814 and US2008/0280773, the contents of which are incorporated herein by reference in their entirety. Methods for tagging (fragmenting and labeling) DNA on a solid surface to construct a labeled DNA library are described in WO2016/189331 and US2014/0093916A1, which are incorporated herein by reference in their entirety. In some embodiments, the transposome complex described herein is immobilized on a solid support by means of a binding element. In some such embodiments, the solid support contains streptavidin as a binding partner and the binding element is biotin.

[0075] In some embodiments, transposome complexes are immobilized on a solid support, such as beads, at a specific density or range of densities. In some embodiments, the density of complexes on a solid support refers to the concentration of transposome complexes in solution during the immobilization reaction. The density of the complex suggests that the immobilization reaction is quantitative. After the formation of complexes with a particular density, this density remains constant for a batch of surface-bound transposome complexes. The resulting granules can be diluted and the resulting concentration of complexes in the dilute solution is the resulting density of the granules divided by the dilution factor. The stock solutions of the dilute granules retain the density of the complex when they are prepared, but the complexes are present at a lower concentration in the dilute solution. During the dilution step, the density of the complexes on the beads does not change and therefore affects the yield of the library, but not the size of the insert (fragment). In some embodiments, the density is from about 5 nM to about 1000 nM, or from about 5 nM to 150 nM, or from about 10 nM to 800 nM. In other embodiments, the density is about 10 nM, or about 25 nM, or about 50 nM, or about 100 nM, or about 200 nM, or about 300 nM, or about 400 nM, or about 500 nM, or about 600 nM, or about 700 nM, or about 800 nM, or about 900 nM, or about 1000 nM. In some embodiments, the implementation of the density is approximately 100 nm. In some embodiments, the implementation of the density is approximately 300 nm. In some embodiments, the density is about 600 nM. In some embodiments, the implementation of the density is approximately 800 nm. In some embodiments, the implementation of the density is approximately 100 nm. In some embodiments, the implementation of the density is approximately 1000 nm.

[0076] Some embodiments provided herein relate to a kit including a transposome complex as described herein and an index mixture containing index sequences. Some embodiments provided herein relate to a kit comprising a composition having a solid support with a transposome complex immobilized thereon, as described herein, and an index mixture containing index sequences. In some embodiments, the index mixture comprises i5 index sequences and i7 index sequences, wherein the i5 index sequences are complementary to and hybridizes to the access polynucleotide, and wherein the i7 index sequences are complementary to and hybridize to the 3' adapter sequence.

7.6. Immobilized Transposome Complexes/Methods for Generating Labeled Nucleic Acid Fragments

[0077] The present disclosure further provides methods for preparing immobilized transposome complexes as described herein. Some embodiments provided herein relate to a method for generating a library of labeled nucleic acid fragments. In some embodiments, the method includes providing a solid support having a transposome complex immobilized thereon, applying a target nucleic acid to the solid support under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and attach the 3' end of the first transposon to the 5' ends. target fragments to obtain a plurality of 5'-labeled target fragments, and using an index mixture containing the index sequences to activate the library for sequencing. In some embodiments, the transposome complex includes a transposase associated with a first and a second transposon, a first transposon containing a 3' transposon sequence and a 5' adapter sequence, an attachment polynucleotide containing an attachment adapter sequence and a binding element, and a second transposon containing 5 the '-terminal sequence of the transposon; and the 3'-adapter sequence.

[0078] In some embodiments, the method includes generating a library of labeled nucleic acid fragments, comprising contacting a target nucleic acid with a plurality of immobilized transposome complexes, as described herein, under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to attaching the 3' end of the first transposon to the 5' ends of the target fragments to obtain a plurality of 5' labeled target fragments.

[0079] In some aspects, the method further includes: treating the solid support to remove unbound nucleic acids; or treating the solid support to remove the transposase from the complex, optionally by (a) heating the solid support and/or (b) washing the solid support with an enzymatic denaturant, the enzymatic denaturant optionally containing sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase.

[0080] In some embodiments, bringing into contact includes adding a biological sample to the transposome complex. In some embodiments, the biological sample contains a cell lysate or whole cells, or is selected from blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspiration, feces, macerated tissue, and fixed FFPE tissue.

[0081] In some aspects, contacting further comprises hybridizing a plurality of index oligonucleotides to anchor polynucleotides, wherein the plurality of index oligonucleotides contain the same or different index sequences.

[0082] In some aspects, the method further comprises treating the plurality of 5'-labeled target fragments with polymerase and ligase to extend and ligate the chains to produce fully double-stranded labeled fragments. In some aspects, the polymerase and ligase treatment is performed in the presence of a DNA secondary structure disruptor, the disruptor being optionally DMSO. In some aspects, the polymerase and ligase treatment is carried out in the presence of an oligonucleotide that is complementary to the primer sequence, wherein the oligonucleotide is a P7' oligonucleotide and the primer sequence is a P7 sequence. In some embodiments, the polymerase comprises a T4 DNA polymerase mutant lacking exonuclease activity.

[0083] In some aspects, the method further comprises removing fully double-stranded labeled fragments from the solid support. In some aspects, removal includes the application of heat and/or a denaturant sufficient to cleave fully double-stranded labeled fragments from the solid support.

[0084] In some aspects, the method further comprises sequencing one or more 5'-labeled target fragments of fully double-stranded labeled fragments. In some aspects, fragments are not quantified by PCR after contact and prior to sequencing. In some aspects, the nucleic acid is DNA or RNA. In some aspects, the 3' adapter sequence is complementary to at least a portion of the index adapter sequence. In some aspects, the primer sequence of the accession polynucleotide is complementary to at least a portion of the index primer sequence. In some aspects, the primer sequence of the polynucleotide of the accession is complementary to the primer sequence of the index of the indexing polynucleotide.

[0085] In some embodiments, the method further comprises washing the solid support to remove unbound nucleic acids. In some embodiments, the method further comprises treating the solid support to remove the transposase. In some embodiments, treating the solid support includes washing the solid support with an enzymatic denaturant. In some embodiments, the enzymatic denaturant includes acetic acid, dimethyl sulfoxide (DMSO), dithiothreitol, ethanol, formaldehyde, formamide, glutaraldehyde, guanidine hydrochloride, lithium perchlorate, mercaptoethanol, propylene glycol, proteinase, sodium bicarbonate, sodium dodecyl sulfate (SDS), salicylate sodium, sulfosalicylic acid, trichloroacetic acid, tris(2-carboxyethyl)phosphine) (TCEP) or urea. In some embodiments, treating the solid support includes heating the solid support to remove the transposase. In some embodiments, the use of the target nucleic acid comprises mixing the biological sample with the transposome complex. The nucleic acid need not be completely purified or purified at all, and may be part of a biological sample or admixture with protein, other types of nucleic acids, other cellular components, and/or any other contaminants. In some embodiments, the biological sample includes a cell lysate. In some embodiments, the biological sample includes whole cells. In some embodiments, the biological sample is selected from a biological fluid, blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspiration, feces, macerated tissue, and fixed tissue, formalin-fixed, paraffin-embedded tissue (FFPE) .

[0086] In some embodiments, applying a mixture of indices includes hybridizing the index sequence to an attachment polynucleotide and a second transposon. In some embodiments, the index mixture includes an intensive ligation mixture (ELM). In some embodiments, the ELM contains a polymerase and a ligase. In some embodiments, the ELM is a split ELM for index ligation. In some embodiments, the polymerase comprises a T4 DNA polymerase or a mutant thereof (eg, a T4 DNA polymerase without exonuclease activity, or a mutant T4 DNA polymerase, or a mutant T4 DNA polymerase without exonuclease activity). In some embodiments, the ligase comprises E. coli DNA ligase. In some embodiments, the extension and ligation reaction is carried out in the presence of a DNA secondary structure disruptor such as DMSO. In some embodiments, the method further comprises denaturing a plurality of 5' labeled target fragments from the solid support. In some embodiments, denaturation can be achieved by applying heat and/or a denaturant sufficient to cleave the labeled 5' target moieties from the solid support. In some embodiments, the method further comprises sequencing one or more of the 5' labeled target fragments or their ligation products. In some embodiments, the nucleic acid is DNA or RNA.

[0087] In some aspects, such methods include contacting the first and second transposons, as described herein, with a surface-bound attachment polynucleotide under conditions suitable for hybridizing the attachment polynucleotide to the first or second transposon. In some aspects, methods for preparing a transposome complex bound to a solid support include incubating the transposome complex, as described herein, with a solid support containing a binding partner under conditions sufficient to bind the (covalent or non-covalent) binding element to the binding partner. The immobilized hybridized polynucleotide, which includes the attachment polynucleotide and the first and second transposons, is then brought into contact with a transposase under conditions suitable for the formation of a transposome complex.

[0088] In some embodiments, the first and second transposons described herein are annealed to each other, and the first transposon is annealed to an attachment polynucleotide. The annealed polynucleotides are then loaded onto a transposase, such as a Tn5 transposase, thereby obtaining a transposome complex, which is then brought into contact with and bound to a solid support, such as a bead. In some embodiments, the annealed transposons are coupled to a solid support, such as a bead, and then the transposase is complexed with the transposons, thereby producing a transposome that binds to the solid support.

[0089] In some aspects, methods for obtaining fragments from a target nucleic acid are provided, including obtaining a solid support containing a transposome complex immobilized thereon, as described herein; applying the target nucleic acid to a solid support under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to attach the 3' end of the first transposon to the 5' ends of the target fragments to produce a plurality of 5' labeled target fragments. In some aspects, the method further comprises using an index mixture including index sequences. In some embodiments, the state of the fragment is a state suitable for tagging using the transposome complex for the fragment and labeling the target nucleic acid.

[0090] In some embodiments of the methods described herein, after fragmentation and labeling, the methods further comprise washing the solid support to remove unbound nucleic acids. In some embodiments of the methods described herein, after fragmentation and labeling, the methods further comprise removing the transposase. Removal of the transposase can be accomplished under chemical conditions, such as washing the solid support with a transposase remover. In some embodiments, the agent is sodium dodecyl sulfate (SDS).

[0091] In some embodiments, the implementation of the method further includes bringing the solid substrate into contact with a mixture of indices. Interaction with a mixture of indices is used to label fragments with a specific index and activate the library for sequencing. In some embodiments, the index mixture includes oligonucleotides that hybridize to a transposon or attachment polynucleotide to label or index nucleic acid fragments. Thus, for example, the oligonucleotide includes an index, and other regions of the oligonucleotide are complementary to and hybridize to the transposon or attachment polynucleotide. As an example, in one embodiment, an i5 index having a primer sequence (P5 sequence), an index sequence (i5 sequence), and an anchor sequence hybridizes to an attachment polynucleotide in complementary sequences such that P5 hybridizes to P5' and the anchor region hybridizes to the anchor. plot'. In some embodiments, the i5 sequence is linked to a nitroindole (nitro) sequence of an attachment polynucleotide. In some embodiments, the nitroindole sequence is complementary to and hybridizes to any i5 index sequence. In one embodiment, an index i7 having a primer sequence (P7), an index sequence (i7), and an adapter sequence (sequence B15) hybridizes to a second transposon in complementary sequences such that P7 hybridizes to P7', i7 hybridizes to i7', and B15 hybridizes with B15'. In some embodiments, the implementation of the mixture of indices includes a double-stranded index. After bringing the solid support into contact with the index mixture, the fragments are ligated and extended using an extension and ligation mixture (ELM). The ELM may include, for example, T4 DNA polymerase and E. coli DNA ligase. Examples of polymerases include, but are not limited to, large Bst fragments of Bst DNA polymerase I, E. coli DNA polymerase I (Klenow fragment), Klenow fragment (3'-5'exo-), T4 DNA polymerase, T7 DNA polymerase, Deep VentR . (exo-) DNA polymerase, Deep VentR DNA polymerase, Therminator II DNA polymerase, AmpliTherm DNA polymerase, SP6 DNA polymerase or Taq polymerase, or mutants, analogues or derivatives of any of the aforementioned polymerases. Examples of ligases include, without limitation, the following: T4 DNA ligase, T4 RNA ligase, Taq DNA ligase, E. coli DNA ligase, Pfu DNA ligase, and Tth DNA ligase. In some embodiments, the ELM is a split ELM reaction to provide index ligation and index extension of different indexes, for example, to provide separate i5 ligation and i7 extension. The solid support is then treated with a chain denaturant, such as NaOH, to thereby produce labeled nucleic acid fragments.

[0092] In some embodiments, fragments are deposited on a flow cell. In some embodiments, the fragments are hybridized to complementary primers grafted onto a flow cell or surface. In some embodiments, the sequences of the sequencing fragments are detected using template sequencing or next generation sequencing methods, such as sequencing by synthesis.

[0093] Table 1 provides examples of sequences used in transposome complexes to create a library of labeled nucleic acid fragments.

7.7. Table 1: Exemplary sequences

Name of the oligonucleotide Design Function Sequence (SEQ ID NO) P5_A14_ME Indexed and universal granules with single indexing 5'-fragment of a transposon AATGATACGGCGACCCACGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO: 9) P_ME'_B15' All constructs involving i7 indexing 3'-fragment of a transposon /5Phos/CTGTCTCTTATACACATCTCCGAGCCCACGAGAC (SEQ ID NO: 10) Bio_P7_i701_B15_ddC i701 indexed pellets, single or double indexed pellets Attachment oligonucleotide /5Biosg/CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG/3ddC/ (SEQ ID NO: 11) A14'_P5'_bio Universal granules, single indexing Attachment oligonucleotide GACGCTGCCGACGAGTGTAGATCTCGGTGGTCGCCGTATCATT/3Bio/ (SEQ ID NO: 12) P_A14_ME Suitable for dual indexing 5'-fragment of a transposon /5Phos/TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO: 13) A14'_nitro_P5'_bio Universal construction of nitroindole Attachment oligonucleotide GACGCTGCCGACGACCC/i5NitInd//i5NitInd//i5NitInd//i5NitInd//i5NitInd//i5NitInd//i5NitInd//i5NitInd/GTGTAGATCTCGGTGGTCGCCGTATCATT/3Bio/ (SEQ ID NO: 14) A14'_12anc'_2sp_p5'_bio Versatile anchor and spacer design Attachment oligonucleotide GACGCTGCCGACGACCGAGCATATCC/iSp18//iSp18/GTGTAGATCTCGGTGGTCGCCGTATCATT/3BioTEG/ (SEQ ID NO: 15) P5_i501 For use with nitroindole construction Indexing oligonucleotide i501 AATGATACGGCGACCACCGAGATCTACACTAGATCGC (SEQ ID NO: 16) P_i701'_P7'_ddC Part of the i7 double strand adapter can be applied with multiple bead designs Indexing oligonucleotide i701 /5Phos/TAAGGCGAATCTCGTATGCCGTCTTCTGCTTG/3ddC/ (SEQ ID NO: 17) P7_i701_B15_ddC Part of the i7 double strand adapter can be applied with multiple bead designs Indexing oligonucleotide i701 CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG/3ddC/ (SEQ ID NO: 18) P5_i501_12anc For use with an anchor and spacer attachment oligonucleotide Indexing oligonucleotide i501 AATGATACGGCGACCCACGAGATCTACACTAGATCGCGGATATGCTCGG (SEQ ID NO: 19)

[0094] In some aspects, methods for creating a library of labeled nucleic acid fragments include bringing the immobilized transposome complex into contact with a target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and attach the 3' end of the first transposon to the 5' ends target fragments to obtain multiple 5'-labeled target fragments; treating the solid support to remove unbound nucleic acids; or treating the solid support to remove the transposase from the complex, optionally by (a) heating the solid support and/or (b) washing the solid support with an enzymatic denaturing agent, the enzymatic denaturing agent optionally containing sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase; treatment of a plurality of 5'-labeled target fragments with a polymerase and ligase to extend and ligate the 5'-labeled target fragments to obtain fully double-stranded labeled fragments, optionally the polymerase and ligase treatment is performed in the presence of a DNA secondary structure disruptor, the disruptor optionally being DMSO; removing fully double-stranded fragments from the solid support, the removal optionally comprising the application of heat and/or a denaturant sufficient to cleave the fully double-stranded labeled fragments from the solid support, optionally the denaturing agent being NaOH; and selecting fully double-stranded labeled fragments using capture beads, optionally the capture beads being magnetic microcarriers, and optionally performing two separate selection steps.

[0095] In some embodiments, the immobilized transposome complex comprises a solid support; and a transposome complex immobilized on a solid support, the transposome complex containing a transposase; the first transposon containing the 3'-terminal sequence of the transposon and the anchor sequence (anchor); the second transposon containing the 5'-terminal sequence of the transposon and the B15'sequence; and an attachment polynucleotide containing a complementary anchor sequence (anchor'), an A14' sequence, a spacer and a P5' sequence, and a binding element containing biotin, the biotin being immobilized on a solid support. In some embodiments, the method further comprises sequencing one or more fully double-stranded labeled fragments.

7.8. Methods for generating labeled nucleic acid fragments by combined tagging and indexing

[0096] In some embodiments, libraries with paired ends after double indexing can be obtained from a DNA sample using a combined tagging and indexing step. By avoiding separate tagging and indexing steps, this protocol has the advantage of ease of use and shorter duration. Moreover, this protocol avoids the denaturation step and obtains double-stranded libraries without the need for a separate step to obtain double-stranded samples from denatured single-stranded samples. This protocol also avoids certain washing steps, further reducing the time required for the workflow.

[0097] This method uses a first immobilized transposon complex and a second immobilized transposon complex. In the first immobilized transposon complex, the X sequence in the first transposon is the anchor sequence and the X' sequence in the attachment polynucleotide is the complement of the anchor sequence. In the second immobilized transposon complex, the X sequence in the first transposon is the anchor sequence and the X' sequence in the attachment polynucleotide is the complement of the anchor sequence. The anchor sequences of the first and second immobilized transposon complexes may be non-complementary to avoid cross-hybridization. The first transposon complex may comprise an exemplary first attachment polynucleotide comprising (i) an anchor sequence complement, an A14' sequence, a spacer, and a P5' sequence, and (ii) a binding element comprising biotin, and the second transposon complex may comprise an exemplary second attachment polynucleotide comprising (i) an anchor sequence complement, a B15' sequence, a spacer and a P7' sequence, and (ii) a binding element containing biotin.

[0098] In combined tagging and indexing, a suspension of solid support bound transposome complexes (BLTs, i.e., immobilized transposome complexes) containing first and second transposome complexes can be added to each well. The indexing step can then be performed in the same reaction solution with index 1 (i7) adapters, index 2 (i5) adapters, and sequences necessary to form sequencing clusters ligated in the same reaction solution as for tagging. The first indexing oligonucleotides may contain an A14 sequence, an i5 sequence, and a P5 sequence, and the second indexing oligonucleotides may contain a B15 sequence, an i7 sequence, and a P7 sequence. Conditions for the tag/ligation step include labeled buffer and E. coli DNA ligase added to the target DNA mixture, the first and second transposome complexes, and the first and second index oligonucleotides. This combined tagmentation and indexing step may last for various periods, such as at least 1 minute to at least 15 minutes, or at least 5 minutes to at least 15 minutes.

[0099] The tagging and indexing reactions can then be stopped using a variety of methods, including heating the solid support and/or washing the solid support with an enzymatic denaturant, for example, optionally using sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase. The time to stop the reaction, whether by heating and/or by using a washing step, can vary from at least 1 minute to at least 5 minutes.

[0100] 5'-labeled target fragments ligated for indexing oligonucleotides can be treated with polymerase to extend and produce fully double-stranded labeled fragments. The elongation reaction may take place over various periods, for example at least 1 minute to at least 10 minutes, or at least 2 minutes to at least 10 minutes.

[0101] In addition, when obtaining a library that includes combined tagging and indexing, the qPCR step can also be avoided, since the final product is a double-stranded DNA library in solution.

[0102] In some embodiments, contacting a first immobilized transposome complex with a second immobilized transposome complex and treating a plurality of 5'-labeled target fragments with a ligase is performed in a single reaction.

[0103] In some embodiments, double-stranded labeled fragments are obtained in solution.

[0104] Some embodiments further comprise selecting fully double-stranded labeled fragments using capture beads, optionally the capture beads being magnetic microcarriers, and optionally additionally performing two separate selection steps.

[0105] In some embodiments, the implementation of the method further includes sequencing one or more fully double-stranded labeled fragments.

Target nucleic acid

[0106] The target nucleic acid can be any type that contains DNA, RNA, cDNA, etc. For example, the target nucleic acid can be in various states of purification, including purified nucleic acid. In some embodiments, the biological sample contains a mixture of nucleic acids (such as DNA), protein, other types of nucleic acids, other cellular components, and/or any other contaminant, in approximately the same proportion as in vivo. For example, in some embodiments, the components are in the same proportion as in an intact cell. Because the methods provided herein allow nucleic acid or DNA to be bound to a solid support through a labeling process, other contaminants can be removed by washing the solid support after tagging has been performed. The biological sample may contain, for example, crude cell lysate or whole cells. For example, a crude cell lysate applied to a solid support by the method described herein does not necessarily need to be subjected to one or more separation steps that are traditionally used to isolate nucleic acids from other cellular components.

[0107] Thus, in some embodiments, the biological sample may contain not only purified nucleic acids from any source, but also, for example, crude nucleic acids found in blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspirate, faeces and macerated tissue or their lysate, or any other biological preparation containing nucleic acid or DNA material. The target nucleic acid may be a tissue sample, a tumor sample, cancer cells, or a biopsy sample. The target nucleic acid may be cell-free DNA (scDNA).

[0108] The target nucleic acid can be obtained from any species or mixture of species. For example, the target nucleic acid may be from a mammal (such as a human, dog, cat, cow, pig, sheep, or other domestic animal) or from other species such as a fish, bacteria, virus, fungus, or archaebacterium. The nucleic acid can come from environmental samples such as soil or water.

[0109] In some embodiments, the target nucleic acid is DNA. In one such embodiment, the DNA is double stranded. In some additional embodiments, the implementation of double-stranded DNA contains genomic DNA. In some other embodiments, the target nucleic acid is RNA or a derivative thereof, or cDNA. In some embodiments, the target nucleic acid is the product of an upstream reaction, such as an amplification or replication event, such as an amplicon. In some embodiments, the target nucleic acid is DNA treated with bisulfite.

[0110] In some embodiments, a biological sample (raw sample or extract) is processed to purify target nucleic acids prior to the tagging methods described herein. In some embodiments, the biological sample is a raw sample or a raw lysate sample (eg, blood, saliva, cell, or cells). In some embodiments, the processing method includes obtaining a stock sample, a lysate of the stock sample, or a pretreated sample (e.g., a blood or saliva sample), mixing the sample with lysis buffer and proteinase K, incubating the cell lysis mixture in the sample, and releasing the DNA from the cells, such thus providing the target nucleic acid(s) for the tagmentation methods described herein. The amount of the biological sample is not specifically stated, provided that the biological sample contains a sufficient amount of nucleic acids for analysis. Thus, the amount of biological sample may include from about 1 µl to about 500 µl, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 90, 100, 150, 200, 250, 300, 350, 400, 450 or 500 µl, or an amount within the range defined by any two of the above values.

[0111] Components of the original samples or lysates of the original samples, such as blood, or additives in pre-treated samples, such as saliva collected in an Oragene gene collection tube (stabilizing agents in collection tubes), can inhibit tagmentation reactions. Thus, the present document proposes a method of processing the original sample, the original sample lysate or pre-treated sample to overcome this problem. In some embodiments, the method includes obtaining a raw sample, a raw sample lysate, or a pretreated sample (e.g., a blood or saliva sample), mixing the image with lysis buffer, proteinase K, and DNA capture or purification beads (e.g., SPRI beads, beads containing carboxyl groups, if the beads are optionally magnetic beads), incubating the mixture to lyse the cells in the sample and release the DNA from the cells, thereby capturing the DNA on the DNA purification or SPRI beads, and separating the beads containing the captured DNA from the mixture. Separation serves to remove potential inhibitors of tagmentation present in the supernatant. The method further includes optionally washing the beads containing the captured DNA and eluting the DNA from the beads to form the target nucleic acid(s).

[0112] In some embodiments, the implementation of the target nucleic acid is present in an amount sufficient to create a library for sequencing. In some embodiments, the amount of target nucleic acid is a 10-500 ng amount of gDNA, such as 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, or 500 ng, or an amount in within the range defined by any two of the above values. In some embodiments, the target nucleic acid is gDNA present at 50 ng.

7.10. Sequencing methods

[0113] Some of the methods provided herein include methods for analyzing nucleic acids. Such methods include obtaining a template nucleic acid library of a target nucleic acid, obtaining sequence data from a template nucleic acid library, and optionally assembling a sequence representation of the target nucleic acid. DNA fragments obtained by transposome-mediated tagging can be sequenced according to any suitable sequencing technique, such as direct sequencing or next generation sequencing, including sequencing by synthesis, sequencing by ligation, sequencing by hybridization, sequencing based on the detection of released protons, can be used electrical detector and related techniques that are commercially available from Ion Torrent (Guilford, CT, a subsidiary of Life Technologies), nanoparticle sequencing, and the like. In some embodiments, DNA fragments are sequenced on a solid support such as a flow cell. Examples of flow cells and associated fluidic detection systems and platforms that can be easily used in the context of this invention are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 04/018497; US 7,057,026; W091/06678; WO 07/123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281 and US 2008/0108082, which are incorporated herein by reference.

[0114] The methods described herein are not limited to any particular type of sequencing equipment used.

EXAMPLES

[0115] The following examples serve to illustrate, but do not limit the description provided herein.

Example 1: Oligonucleotides that do not connect to a user-cleavable linker

[0116] An experiment was conducted to compare sequencing data without PCR with sequencing data using PCR. Libraries were generated using TruSeq PCR-free, TruSeq Nano (+PCR), Nextera Flex (+PCR) and the method of the present invention and then sequenced up to 25x coverage. Each method involved two replications, and a total of eight libraries were created. On FIG. 7A shows that non-PCR methods (linear and checkered columns, which are the present method and TruSeq without PCR, respectively) have improved accuracy and indel re-recognition compared to PCR methods (black bars and white bars, which are TruSeq Nano and Nextera Flex respectively). On FIG. 7B shows that coverage of high GC promoter regions is also improved in non-PCR methods (lower two panels, with the present method in the lower left panel and TruSeq without PCR in the lower right panel).

Example 2. Creation of a library of labeled nucleic acid fragments without the use of PCR amplification

[0117] Step A1. Preparation of immobilized transposome complexes - indexed beads. A mixture of: (1) a first transposon having a 3' mosaic end (ME) sequence (SEQ ID NO: 6), a first tag sequence (A14) and a 5' primer sequence (P5') (final concentration 25 μM); (2) a second transposon with a 5' complementary terminal mosaic sequence (ME'; SEQ ID NO: 3) and a second tag sequence (B15') (final concentration 37.5 μM); and (3) an attachment polynucleotide comprising a 3' sequence complementary to the second tag sequence (B15), an index sequence (in this case, i701 in Table 1) and a 5' primer sequence (P7) with biotin at the 5' end (terminal concentration 25 μM), annealed by treatment with 10 mM Tris-HCl (pH 8.0), 1 mM EDTA and 25 mM NaCl, heating at 95°C for 10 min, and then cooling to 10°C for approximately 15 min . The annealed transposons/attachment polynucleotide (final concentration 2 μM relative to the attachment polynucleotide) were then mixed with transposase enzyme (final concentration 6.1 μM) and incubated at 37°C overnight to form transposome complexes in the dissolution phase (Fig. 4A, figures with indexed granules). The transposome complexes in the dissolution phase were then immobilized on a solid support by mixing with streptavidin-coated beads. In some examples, immobilization can be carried out in the presence of HT1 buffer (Illumina), which is a high salt buffer that promotes the formation of biotin-streptavidin bonds. After stirring in HT1 for 1 hour, the beads were precipitated and washed once in a mixture of HT1 buffer solution and 50% glycerol standard storage buffer (Illumina) (9:1). The beads were then resuspended in 360 µl of buffer containing 50 mM Tris pH 7.5, 30 mM NaCl and 0.1% Tween 20. 40 µl of EPX2 (Illumina) was added and the beads were further rotated for 10 minutes at room temperature. The beads were again pelleted and then resuspended in 396 µl of the same buffer, treated with 4 µl of single chain binding protein (5 mg/ml) and rotated again for 10 min. The beads were precipitated again, washed once in 9:1 HT1: standard storage buffer and resuspended in 15% glycerol standard storage buffer (Illumina). The resulting indexed beads were used in single indexing and double indexing tagmentation protocols.

[0118] Step A2. Formation of immobilized transposome complexes - universal granules. Annealed transposons were prepared as described in step A1, except that the addition polynucleotide included a 5' sequence complementary to the first tag sequence (A14') and a 3' primer sequence (P5') with biotin at the 3' end. (for single indexing), and optionally an intermediate universal nitroindole sequence (for double indexing). Transposome complexes were prepared from annealed transposons and immobilized on a solid support as described for step A1. The resulting universal beads were used in single indexing and dual indexing protocols as above.

[0119] Step b. Tagging. DNA (e.g., approximately 50 pg to 5 μg) was mixed with immobilized transposome complexes and 50 μl of tagging buffer (10 mM tris-acetate (pH 7.6), 5 mM magnesium acetate, and 10% dimethylformamide as described in US patents Nos. 9,080,211, 9,085,801 and 9,115,396, each of which is incorporated herein by reference, and the resulting mixture was incubated at 55°C for 5 min. buffer containing 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween 20, and the resulting mixture was incubated at 37°C for 5 min to denature the transposase enzyme from transposome complexes. Then, beads with immobilized DNA fragments were deposited on a magnet and washed three times with washing buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween) to remove residual SDS Beads were separated from the supernatant by magnetic capture and complete were washed with 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20. The resulting labeled fragments for all four approaches are shown in FIG. 4b.

[0120] Stage C. Lengthening, ligation and indexing. Extension and ligation was performed by contacting the beads with an extension and ligation mixture (ELM) that included T4 DNA polymerase (exonuclease minus) and E. coli DNA ligase, and incubation at 30° C. for 15 min, and then at 16°C for 15 min, thus filling in the gap of the DNA fragments between the 3' ends of the fragments and the 5' ends of the ME' sequences and elongation of the single-stranded regions to form fully double-stranded products by introducing the remaining sequences from the attachment polynucleotide (Fig. 4C) . In certain cases, indexes were also added at this stage. As shown in FIG. 4D, upper right figure, an index was added to the universal bead/single-index construct by adding an oligonucleotide with a double-stranded primer sequence (P7/P7'), a double-stranded index sequence (in this case, i701/i701'), and a single-stranded overhang with a 3'-sequence , complementary to the second label sequence (B15). For the indexed bead/double indexing approach (FIG. 4D, lower left figure), the indexing reagent included a double stranded primer sequence (P5/P5'), a double stranded index sequence (in this case i501/i501'), and a single stranded overhang. with a 5' sequence complementary to the label of the first sequence (A14'). For the universal bead/dual indexing approach (Fig. 4D, lower right figure), the index reagent was the same as for the universal bead/single index, but an additional second index reagent containing a complementary primer sequence (P5) and an index sequence ( i5), hybridized and ligated to the 5' end of the A14 sequences.

[0121] The reaction mixture was treated with 10 μl of stop buffer containing 5% SDS, 100 mm Tris-HCl (pH 7.5), 100 mm NaCl and 0.1% Tween 20, and the resulting mixture was incubated at 37°C for 5 min to denature the transposase enzyme from transposome complexes. Then, beads with immobilized DNA fragments were deposited on a magnet and washed three times with washing buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween) to remove residual SDS. The beads were separated from the supernatant by magnetic capture and washed further with 100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween 20.

[0122] Step D. Release of labeled fragments. After the third wash, the beads were resuspended in 100 µl of 0.2 N. NaOH to denature the library fragments and release them from the beads. The library was purified by adding 100 μl of supernatant directly to 180 μl of SPRI beads according to standard SPRI purification protocol and eluting in 15 μl of Illumina resuspension buffer. Libraries were quantified by qPCR method and then prepared for sequencing on MiSeq® by diluting to 5 µl at about 3200 pM and denaturing 5 µl with 0.2N. NaOH at room temperature for 5 minutes. Chilled Illumina HT1 buffer (990 μl) was added and the entire 1 ml of the mixture was loaded into a MiSeq® cartridge.

[0123] The results are shown in FIG. 4E and summarized in Table 2 below for indexed pellets or universal single or double indexed pellets.

Table 2: Results of obtaining a library for various configurations of the transposome complex

Sample median insert Clusters Aligned Reads Leveled bases Indexed beads, single indexing (3 samples) 390, 404, 393 93% 87%, 87%, 90% 85%, 85%, 88% Universal granules, single indexing (1 sample) 417 84% 53% 83% Indexed beads, double indexing (3 samples) 353, 364, 366 90% 91%, 90%, 88% 90%, 90%, 90% Universal granules, double indexing (1 sample) 385 91% 68% 86%

[0124] Using the methods described herein, it was possible to overcome errors in sequencing data that are usually introduced by PCR. For example, using the non-PCR methods described herein, the resulting libraries of nucleic acid fragments were sequenced and the sequences did not have significant gaps in the GC-rich regions that are commonly seen using PCR.

Example 3 Sequencing Comparison of Tested Libraries

[0125] In this example, two comparative libraries from a sample containing known 100% GC replication (FMR1) were generated using Nextera™ DNA Flex kits (which includes PCR) and TruSeq™ PCR-Free Library Prep, and four libraries for testing was prepared as described herein using the universal bead/double indexing method as shown in FIG. 4D. As shown in FIG. 8, no repeats were obtained for the sequencing data from the library obtained using the Nextera™ DNA Flex kit (first column, column not shown because the result is 0). Repeats were described using TruSeq™ PCR-Free (column 2) and four libraries for testing using the methods described herein (samples 1-4, columns 3-6). Thus, the present methods demonstrate an improvement in calling replicated samples with 100% GC regions.

Example 4 Cleavable Linker Split Oligonucleotides

[0126] Step 1: Formation of transposome complexes. Biotinylated oligonucleotide (50 μM) containing 5'-biotin, three T residues, then three U, P5, A14 and ME residues, with the sequence: /5Biosg/TTUUUAATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACA (SEQ ID NO: 20)

and an oligonucleotide containing ME'_B15'_P7' (75 μM) with the sequence: CTGTCTCTTATACACATCTCCGAGCCCACGAGACATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 21)

treated with 10 mM Tris-HCl (pH 8.0), 1 mM EDTA and 25 mM NaCl, heated to 95° C. for 10 min and then cooled to 10° C. at a rate of -0.1° C. per second. The annealed transposons were then mixed with the transposase enzyme so that the final concentration of the biotinylated oligonucleotide was 2 μM and the transposase concentration was 4 μM. The mixture was incubated at 37°C overnight with the formation of transposome complexes in the dissolution phase. The dissolution phase transposome complexes were then immobilized on a solid support by mixing with streptavidin-coated beads and HT1 buffer (Illumina) and rotating at room temperature for 1 hour. The beads were then washed three times in HT1 buffer and then resuspended in 15% glycerol standard storage buffer (Illumina) (FIG. 2A).

[0127] Stage 2: Tagging. DNA (e.g., approximately 50 pg to 5 μg) was mixed with immobilized transposome complexes and 50 μl of tagging buffer (10 mM tris-acetate (pH 7.6), 5 mM magnesium acetate, and 10% dimethylformamide as described in US patents Nos. 9,080,211, 9,085,801 and 9,115,396, each of which is incorporated herein by reference, and the resulting mixture was incubated at 55°C for 5 min. buffer containing 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween 20, and the resulting mixture was incubated at 37°C for 5 min to denature the transposase enzyme from transposome complexes. Then, beads with immobilized DNA fragments were deposited on a magnet and washed three times with washing buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween) to remove residual SDS Beads were separated from the supernatant by magnetic capture and complete Washed well with 100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween 20.

[0128] Step 3: Lengthening and ligation. Extension and ligation was performed by contacting the beads with an extension and ligation mixture (ELM) that included T4 DNA polymerase (exonuclease minus) and E. coli DNA ligase, and incubation at 30°C for 15 min, and then at 16°C for 15 min, thus filling the gap between the DNA fragments between the 3' ends of the fragments and the 5' ends of the ME' sequences. The reaction mixture was treated with 10 µl of wash buffer containing 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween 20, and the resulting mixture was incubated at 37°C for 5 min to denature the transposase enzyme from transposome complexes. Then, beads with immobilized DNA fragments were deposited on a magnet and washed three times with washing buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween) to remove residual SDS. The beads were separated from the supernatant by magnetic capture and washed further with 100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween 20.

[0129] Step 4: Release labeled fragments. After the third wash, the beads were resuspended in a buffer containing 50 mM potassium acetate, 20 mM tris acetate, 10 mM magnesium acetate and 100 μg/ml BSA. 5 μl of an enzyme mixture containing uracil DNA glycosylase and endonuclease VIII was added and the libraries were incubated at 37°C for 30 min. The enzymes worked together to cleave the U' at the attachment oligonucleotides and release the library fragments into solution. The library was purified by adding 100 µl of the supernatant directly to the SPRI beads according to the standard SPRI size purification protocol (0.5x right and 0.7-0.8x left) and eluting in 15 µl Illumina resuspension buffer. The resulting libraries were quantified by qPCR (FIG. 2B).

Example 5 Modified Extension and Ligation Protocol

[0130] You can use an alternative protocol for the reaction of extension and ligation with indexed variations (example 2C). In some cases, i7 index extension is inefficient due to secondary structure in certain index sequences. Thus, for the design shown in Fig. 6C, eight different index pairs were examined. As shown in FIG. 9A, the % CV for the index pool was 76%. It has been found that the addition of the P7' oligonucleotide during the extension and indexing reaction enhances the performance of certain index pairs, possibly due to hybridization with the P7 sequence, which may disrupt or prevent secondary structure formation. In this case, the reaction of elongation and indexing also includes ligation. P7' (with 5'-phosphate for ligation) is added during the extension-ligation-indexing reaction at 2.5 μM. For the design shown in Fig. 6D, in FIG. 9B shows % CV for eight index pairs less than 30%.

[0131] The addition of DMSO to the extension-ligation-indexing reaction of the P7 oligonucleotide further increases the % CV. In this example, in the design shown in Fig. 6D, DMSO is added to the extension-ligation-indexing reaction at 5%. The extension and ligation reaction contains all the enzymes and components required for extension and ligation. The reaction mixture is incubated at 37° C. for 30 min, after which work is continued in the normal workflow. As shown in FIG. 9C, % CV for eight different pairs of indices was less than 20%. This result makes it possible to use the system without quantifying the yield of DNA from the library for each sample in order to correct for variations in indexing characteristics.

Example 6: Immobilized transposome in a tube without PCR

[0132] This example demonstrates a method and system for immobilizing transposome complexes in a test tube, such as a PCR tube, for whole genome sequencing without PCR. The methods are carried out similarly to the method described in example 2, and all processing can be performed in the same tube.

[0133] Preparation of immobilized transposome complexes in vitro. A mixture of: (1) a first transposon having a 3' mosaic end (ME) sequence (SEQ ID NO: 6), a first tag sequence (A14) and a 5' primer sequence (P5) (final concentration 25 μM); (2) a second transposon with a 5' complementary terminal mosaic sequence (ME'; SEQ ID NO: 3) and a second tag sequence (B15') (final concentration 37.5 μM); and (3) an attachment polynucleotide comprising a 3' sequence complementary to the second tag sequence (B15), an index sequence and a 5' primer sequence (P7) with biotin at the 5' end (final concentration 25 μM) was annealed by treatment with 10 mM Tris-HCl (pH 8.0), 1 mM EDTA and 25 mM NaCl, heated at 95°C for 10 min and then cooled to 10°C for approximately 15 min. The attachment polynucleotide included a 5' sequence complementary to the first tag sequence (A14') and a 3' primer sequence (P5') with biotin at the 3' end (for single indexing). In some embodiments, the attachment polynucleotide included an intermediate universal nitroindole sequence (for double indexing). The annealed transposons/attachment polynucleotides (final concentration 2 μM based on the attachment polynucleotide) were then mixed with transposase enzyme (final concentration 6.1 μM) and incubated at 37° C. overnight to form transposome complexes in the dissolution phase. Then, the transposome complexes in the dissolution phase were immobilized on the surface of the PCR tube by mixing the complexes (having biotin) in a PCR tube coated with streptavidin. In some examples, immobilization can be performed in the presence of HT1 buffer (Illumina, San Diego, CA), which is a high salt buffer that promotes the formation of biotin-streptavidin bonds. After incubation for 1 hour, the PCR tube was washed in a mixture of TWB buffer (Illumina, San Diego, CA). The resulting tubes with immobilized transposomes were used in agmentation protocols with single indexing and double indexing.

[0134] The workflow for obtaining the library, including the steps of tagmentation, extension, ligation and indexing, was performed as described in example 2. After completing the steps described in example 2, library fragments immobilized on the surface of the tube were created. The tubes were washed with 50 µl of 0.2 N. NaOH to denature library fragments and release them from the surface of the tubes. Libraries were quantified by qPCR method and then prepared for sequencing on MiSeq® by diluting to 5 µl at about 3200 pM and denaturing 5 µl with 0.2N. NaOH at room temperature for 5 minutes. Chilled Illumina HT1 buffer (990 μl) was added and the entire 1 ml of the mixture was loaded into a MiSeq® cartridge.

[0135] The sequencing results are shown in FIG. 10, which shows the extent of coverage in a region of the genome that is notoriously difficult to sequence (the RNPEPL1 gene). Two methods of obtaining libraries using PCR (Nextera Flex and Nextera tube-based) showed a gap in which none of the sequences covered the region of the gene marked with a rectangular bounding box. The two non-PCR methods were found to have good coverage in this area, as shown in the sections labeled in FIG. 10 as "PCR-free Flex" and "Nextera tube-free PCR".

Example 7: Preparation without cleavable linker without using PCR

[0136] The following example demonstrates a method and system for immobilizing transposome complexes in a test tube, such as a PCR tube, for whole genome sequencing without PCR. The methods are carried out similarly to the method described in example 2, but without the addition nucleotide containing a cleavable linker or linker cleavage step. This method uses three separate oligonucleotides. Additional components of this method include a Tn5 transposon, SDS, an intensive ligation mixture (ELM), and a streptavidin-coated surface (such as beads or a plate).

[0137] A mixture of (1) a first transposon having an ME sequence, a first tag sequence (A14), an i5 sequence, and a 5' primer sequence (P5); (2) a second transposon with a 5' complementary terminal mosaic sequence (ME'), a second tag (B15'), an i7' sequence and a 3' primer sequence (P7'); and (3) an attachment polynucleotide containing a P7 sequence and a binding element (such as biotin) can be prepared and attached to a surface (such as a streptavidin-coated plate or bead). Transposomes can be constructed and attached to a surface in a single step in the presence of a template nucleic acid in a tag buffer.

[0138] Tagging is performed for 5 minutes at 55°C. PEG can be included in the tagmentation reaction. The mixture is treated with SDS to remove the Tn5 transposase. Perform ELM and remove the supernatant. Using this method, no SPRI capture beads are required, and therefore there is no need to adjust the size of the insert through the loading density of the beads. Fragments can be eluted in NaOH to prepare for sequencing.

Example 8 Obtaining 96 Well Libraries Without PCR

[0139] The following example demonstrates a method and system for obtaining up to 96 paired end libraries after double indexing from a DNA sample. The methods are carried out similarly to the method described in example 2, but using two stages of incubation with immobilized beads to ensure the preparation without the final qPCR step. Because qPCR can take a long time (up to two hours), this protocol has the advantage of being easy to use and less time consuming. This method was compatible with DNA administration amounts of 25-1000 ng. In human DNA samples and other large complex genomes, the amount of DNA injected can be over 200 ng. For an input amount of DNA from 200 to 1000 ng, no quantitation and normalization of the original DNA sample is required. Prior to sequencing, libraries were quantitated and normalized for an input amount of 25 to 200 ng of DNA.

[0140] This method uses the first transposon as described in FIG. 6D, wherein the X sequence in the first transposon is ATCTGACTATCCCCTGCG (SEQ ID NO: 23) and the X' sequence in the attachment polynucleotide is CGCAGGGGATAGTCAGAT (SEQ ID NO: 24). The anchor sequence is A14 and the spacer region consists of 2 carbon spacers C18 and 1 C9 (non-DNA sequences).

[0141] Tagging. DNA in 10 mM Tris-HCl (approximately 2-30 μl) was added to each well of a 96-well PCR plate such that the total amount injected (ng) was within the desired range. If the DNA volume is less than 30 µl, nuclease-free water is added to the DNA samples to bring the total volume to 30 µl. A suspension of bead-bound transposomes (Blt) (10 µl) was added to each well followed by 10 µl of tag buffer. BLT was loaded onto the beads at a concentration of from about 50 to 1000 nM. They were resuspended in 15% glycerol standard storage buffer, which consists of 15% glycerol, 100 mM NaCl, 50 mM Tris HCl pH 7.5, 0.1 mM EDTA, 1 mM DTT, 0.1% Triton X-100. The samples were pipetted for mixing until the pellets were completely resuspended, the plate was sealed and placed in a thermal cycler at 41°C for 5 min, and then kept at 10°C. Tagging times of 15 s, 30 s, 45 s, 60 s, 75 s, 90 s, 105 s, 120 s, and 300 s provide a similar yield with a longer insert length shift at a shorter incubation time (e.g., 15 s provided longer insert sizes than 60 s). , 120 or 300 s). In some examples, the tag time is reduced to 1 minute.

[0142] 10 μl of tag stop buffer containing SDS was added to each well, the resulting mixture was pipetted until the pellets were completely reconstituted, and the mixture was incubated for 1-5 minutes. The plate was placed on a magnetic stand for 2-5 min, the supernatant was removed and removed. The plate was removed from the magnet and 150 µl of tagmentation wash buffer was added to each well directly on the beads. The samples were mixed with a pipette and the plate was placed on a magnetic stand until the solution became clear (approximately 2-5 min). At this stage, SDS was removed from the samples.

[0143] Extension/ligation. Index 1 (i7) adapters, index 2 (i5) adapters, and sequences needed to generate a sequencing cluster are added via extension/ligation. While the plate was on the magnetic stand, the supernatant was removed and discarded. The plate was removed from the magnetic rack and 45 μl of the extension and ligation mixture was added to each well, followed by resuspension of the beads. Then the appropriate index adapters (5 μl) were added to each sample, the plate was sealed and placed in a thermal cycler at 37°C for 5 min, at 50°C for 5 min, and then kept at 10°C. Each of the periods of incubation at 37°C and 50°C can be performed for 1, 3 or 5 min, and all variations give a similar output of the library. Shorter incubation times produce libraries with increased fragment size, while longer incubations result in higher concentrations of ligation products. Then the plate was placed on a magnetic stand for 2-5 min and the supernatant was removed.

[0144] 75 µl of tagging wash buffer was added to the wells and the mixture was pipetted to resuspend the tagging beads. The supernatant was removed, the plate was centrifuged and placed on a magnet for 2–5 min. 45 µl of 0.2 N solution was added to each well. NaOH to denature fragments. The mixture in each well was pipetted to resuspend the tag pellets and the plate was incubated for 1-5 minutes at room temperature.

[0145] Clearing the library. 36 µl capture beads (such as Ampure XP beads) were added to each well and the contents of the wells were mixed to resuspend the beads and then incubated for 1, 3, or 5 minutes. The plate was placed on a magnetic stand for approximately 1-5 minutes until the supernatant became clear.

[0146] 42 µl of capture beads were added to each well of the second 96-well plate. Then, 76 μl of the supernatant from each well of the first 96-well plate was added to the second 96-well plate with capture beads. The samples were mixed with a pipette and incubated for 1, 3, or 5 min, and then placed on a magnetic rack until the supernatant became clear (approximately 1-5 min). In some examples, the second capture bead step is omitted.

[0147] Suitable bead cleaning protocols are single or double capture and incubation for 1, 3, or 5 minutes for each bead cleaning step.

[0148] After cleaning the capture beads, the supernatant was removed and the capture beads were washed twice with 180 μl of fresh 80% ethanol without stirring and incubated at room temperature, after which the supernatant was discarded. Residual ethanol was removed with a pipette and the plate was air dried and removed from the magnetic rack.

[0149] 15-22 μl of resuspension buffer was added to each well, and the contents of the well were mixed with a pipette to resuspend the beads. The plate was incubated at room temperature for 2 minutes and then placed on a magnetic stand until the supernatant became clear (approximately 2 minutes). A total of 14-20 µl of supernatant from each well was transferred to a third 96-well PCR plate. This plate is the final DNA library and was prepared for sequencing as described above.

[0150] This protocol employs two purification steps with immobilized beads and eliminates the qPCR step, which allows the library to be completed in a shorter time. For example, samples are prepared using these methods in less than 30 minutes using short magnetic incubation steps of 20 minutes.

[0151] The protocol can be carried out in other vessels such as microcentrifuge tubes.

[0152] In some embodiments, equal library volumes are pooled to achieve optimum cluster density and the pool is quantified prior to sequencing. When using injection amounts of 200-1000 ng of DNA, in some cases, libraries are pooled by mixing equal volumes of each library in a 1.7 ml microcentrifuge tube, shaking to mix, and then centrifuging. The library pool was quantified using the Qubit ssDNA pool concentration kit. Using input amounts of 25-200 ng of DNA, in some examples each library was quantified individually using the Quibit ssDNA kit.

[0153] In some examples, sequencing is performed on a NovaSeq6000 cartridge.

Example 9: Retrieving libraries through a combination of tagging and indexing

[0154] The following example demonstrates a method and system for obtaining dual-ended libraries from a DNA sample using a combined tagging and indexing step. The methods were performed similarly to the method described in example 2, but with combined tagging and indexing in one step. By avoiding separate tagging and indexing steps, this protocol has the advantage of ease of use and shorter duration. Moreover, this protocol avoids the denaturation step and obtains double-stranded libraries without the need for a separate step to obtain double-stranded samples from denatured single-stranded samples. This protocol also avoids certain washing steps, further reducing the time required for the workflow.

[0155] To demonstrate that library data can be generated using reactions performed in either long, medium, or short run times, three sets of samples can be run at normal workflow, high workflow, and ultra high speed. workflow, respectively.

[0156] In this method, a first immobilized transposon complex and a second immobilized transposon complex are used. In the first immobilized transposon complex, the X sequence in the first transposon is the anchor sequence and the X' sequence in the attachment polynucleotide is the complement of the anchor sequence. In the second immobilized transposon complex, the X sequence in the first transposon is the anchor sequence and the X' sequence in the attachment polynucleotide is the complement of the anchor sequence. The anchor sequence of the first and second immobilized transposon complexes may be non-complementary to avoid cross-hybridization. The first transposon complex may comprise an exemplary first attachment polynucleotide comprising (i) an anchor sequence complement, an A14' sequence, a spacer, and a P5' sequence, and (ii) a binding element comprising biotin, and the second transposon complex may comprise an exemplary second attachment polynucleotide comprising (i) an anchor sequence complement, a B15' sequence, a spacer and a P7' sequence, and (ii) a binding element containing biotin.

[0157] Tagging and indexing. DNA in 10 mM Tris-HCl (approximately 2-30 μl) was added to each well of a 96-well PCR plate such that the total amount injected (ng) was within the desired range. A suspension of bead-bound transpomosomes (BLT, ie, immobilized transposon complexes) containing the first and second transposome complexes was added to each well. The indexing step was performed in the same reaction solution with index 1 (i7) adapters, index 2 (i5) adapters, and sequences necessary to form sequencing clusters ligated in the same reaction solution as for tagging. In this example, the first indexing oligonucleotides contain an A14 sequence, an i5 sequence, and a P5 sequence, and the second indexing oligonucleotides contain a B15 sequence, an i7 sequence, and a P7 sequence. Conditions for the tag/ligation step include labeled buffer and E. coli DNA ligase added to target DNA mixture, first and second transposome complexes, and first and second index oligonucleotides in a total volume of 20 µl. The tagging and indexing reaction was carried out at 41°C for three different time intervals (for three different samples): 15 minutes (normal workflow), 5 minutes (fast workflow) and 1 minute (ultrafast workflow).

[0158] After the tagmentation and indexing reaction, 5 μl of 0.6% SDS was added to each well with incubation at 37°C to stop the agmentation reaction by washing with SDS to denature the transposase. The stop step was performed for three different time intervals (for three different samples): 5 minutes (normal workflow), 5 minutes (fast workflow) and 1 minute (ultrafast workflow). Although the stop step is performed during the same period for the normal and fast workflows, the total time for the fast workflow is still shorter due to time differences in other steps.

[0159] Extension. 75 μl of the extension mixture (DNA polymerase, dNTP and buffer) was added to each well, and the extension reaction was carried out at less than 68° C. in a reaction volume of 100 μl. The elongation step was performed for three different time intervals (for three different samples): 10 minutes (normal workflow), 2 minutes (fast workflow) and 1 minute (ultrafast workflow). The extension step allows the creation of a double-stranded DNA library in solution. Library cleanup can be done with capture beads.

[0160] In general, the outputs of the regular and fast workflow libraries are comparable to methods that include separate tagging and indexing steps, while the outputs of the ultra-fast workflow libraries are likely sufficient for many applications, especially given the added convenience of an even faster workflow. Combined tagging and indexing methods can index oligonucleotides with transposases that have not successfully fragmented the DNA sample (ie, with tagging by-products). In addition, combined tagging and indexing may provide library products having P5/P5 sequences or P7/P7 sequences at both ends, and these library products with homozygous ends may not be correctly sequenced. However, for many applications, the amount of the original DNA sample is sufficient to obtain sequencing results, even if some by-products are obtained.

[0161] A number of embodiments have been described. However, it should be understood that various modifications are possible. Accordingly, the following claims cover other embodiments.

SEQUENCE LIST

SEQ ID NO: 1 - A14-ME

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

SEQ ID NO: 2 - B15-ME

GTTCCGTGGGCTCGGAGATGTGTATAAGAGACAG

SEQ ID NO: 3 - ME'

phos-CTGTCTCTTATACACATCT

SEQ ID NO:4-A14

TCGTCGGCAGCGTC

SEQ ID NO: 5-B15

GTCTCGTGGGCTCGG

SEQ ID NO: 6 - ME

AGATGTGTATAAGAGACAG

SEQ ID NO: 7-P5

AATGATACGGCGACCCACCGAAUCTACAC

SEQ ID NO: 8-P7

CAAGCAGAAGACGGCATACGAG*A

SEQ ID NO: 9 - P5_A14_ME

AATGATACGGCGACCCACGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

SEQ ID NO: 10 - P_ME'_B15'

5Phos/CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

SEQ ID NO: 11 - Bio_P7_i701_B1_5_ddC

5Biosg/CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG/3ddC/

SEQ ID NO: 12 - A14'_P5'_bio

GACGCTGCCGACGAGTGTAGATCTCGGTGGTCGCCGTATCATT/3Bio/

SEQ ID NO: 13 - P_A14_ME

5Phos/TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

SEQ ID NO: 14 - A14'_nitro_P5'_bio

GACGCTGCCGACGACCC/i5NitInd//i5NitInd//i5NitInd//i5NitInd//i5NitInd//i5NitInd//i5NitInd//i5NitInd/GTGTAGATCTCGGTGGTCGCCGTATCATT/3Bio/

SEQ ID NO: 15 - A14'_12anc'_2sp_P5'_bio

GACGCTGCCGACGACCGAGCATATCC/iSp18//iSp18/GTGTAGATCTCGGTGGTCGCCGTATCATT/3BioTEG/

SEQ ID NO: 16-P5_i501

AATGATACGGCGACCACCGAGATCTACACTAGATCGC

SEQ ID NO: 17 - P_i701'_P7_ddC

5Phos/TAAGGCGAATCTCGTATGCCGTCTTCTGCTTG/3ddC/

SEQ ID NO: 18 - P7_i701_B15_ddC

CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG/3ddC/

SEQ ID NO: 19 - P5_i501_12anc

AATGATACGGCGACCACCGAGATCTACACTAGATCGCGGATATGCTCGG

SEQ ID NO: 20 - biotinylated oligonucleotide

/5Biosg/TTUUUAATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACA

SEQ ID NO: 21 - ME'_B15'_P7'

CTGTCTCTTATACACATCTCCGAGCCCACGAGACATCTCGTATGCCGTCTTCTGCTTG

SEQ ID NO: 22 - exemplary anchor sequence

GGATATGCTCGG

SEQ ID NO: 23: Exemplary Sequence X

ATCTGACTATCCCCTGCG

SEQ ID NO: 24: Exemplary sequence X'

CGCAGGGGATAGTCAGAT

--->

SEQUENCE LIST

<110> ILLUMINA CAMBRIDGE LIMITED

<120> COMPLEX COMPLEXES OF A SURFACE-BOUND TRANSPOSOME

<130> 01243-0011-00PCT

<150> US 62/840,610

<151> 2019-04-30

<150> US 62/791,509

<151> 2019-01-11

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative sequence used in the transposome complex

<400> 1

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210> 2

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative sequence used in the transposome complex

<400> 2

gtctcgtggg ctcggagatg tgtataagag acag 34

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative sequence used in the transposome complex

<220>

<221> other characteristics

<222> (1)..(1)

<223> 5'-phosphate group

<400> 3

ctgtctctta tacacatct 19

<210> 4

<211> 14

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary adapter connection sequence

<400> 4

tcgtcggcag cgtc 14

<210> 5

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary adapter connection sequence

<400> 5

gtctcgtggg ctcgg 15

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative sequence used in the transposome complex

<400> 6

agatgtgtat aagagacag 19

<210> 7

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative primer

<400> 7

aatgatacgg cgaccaccga gauctacac 29

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative primer

<220>

<221> other characteristics

<222> (22)..(22)

<223> Optionally modified guanine, such as 8-oxoguanine

<220>

<221> other characteristics

<222> (22)..(23)

<223> Optional phosphorothioate bond

<400> 8

caagcagaag acggcatacg agat 24

<210> 9

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative 5'-transposon fragment

<400> 9

aatgatacgg cgaccaccga gatctacact cgtcggcagc gtcagatgtg tataagagac 60

ag 62

<210> 10

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative 3'-transposon fragment

<220>

<221> other characteristics

<222> (1)..(1)

<223> 5'-phosphate group

<400> 10

ctgtctctta tacacatctc cgagccccg agac 34

<210> 11

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary attachment oligonucleotide

<220>

<221> other characteristics

<222> (1)..(1)

<223> 5'-biotin

<220>

<221> other characteristics

<222> (48)..(48)

<223> 3'-dideoxy-C

<400> 11

caagcagaag acggcatacg agattcgcct tagtctcgtg ggctcggn 48

<210> 12

<211> 43

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary attachment oligonucleotide

<220>

<221> other characteristics

<222> (43)..(43)

<223> 3'-biotin

<400> 12

gacgctgccg acgagtgtag atctcggtgg tcgccgtatc att 43

<210> 13

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative 5'-transposon fragment

<220>

<221> other characteristics

<222> (1)..(1)

<223> 5'-phosphate group

<400> 13

tcgtcggcag cgtcagatgt gtataagaga cag 33

<210> 14

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary attachment oligonucleotide

<220>

<221> other characteristics

<222> (18)..(25)

<223> Int 5-nitroindole

<220>

<221> other characteristics

<222> (54)..(54)

<223> 3'-biotin

<400> 14

gacgctgccg acgacccnnn nnnnngtgta gatctcggtg gtcgccgtat catt 54

<210> 15

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary attachment oligonucleotide

<220>

<221> other characteristics

<222> (27)..(28)

<223> Int spacer 18

<220>

<221> other characteristics

<222> (57)..(57)

<223> 3'-biotin-TEG

<400> 15

gacgctgccg acgaccgagc atatccnngt gtagatctcg gtggtcgccg tatcatt 57

<210> 16

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary indexing oligonucleotide i501

<400> 16

aatgatacgg cgaccaccga gatctacact agatcgc 37

<210> 17

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary indexing oligonucleotide i701

<220>

<221> other characteristics

<222> (1)..(1)

<223> 5'-phosphate group

<220>

<221> other characteristics

<222> (33)..(33)

<223> 3'-dideoxy-C

<400> 17

taaggcgaat ctcgtatgcc gtcttctgct tgn 33

<210> 18

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary Indexing Oligonucleotide i701

<220>

<221> other characteristics

<222> (48)..(48)

<223> 3'-dideoxy-C

<400> 18

caagcagaag acggcatacg agattcgcct tagtctcgtg ggctcggn 48

<210> 19

<211> 49

<212> DNA

<213> Artificial sequence

<220>

<223> Exemplary Indexing Oligonucleotide i501

<400> 19

aatgatacgg cgaccaccga gatctacact agatcgcggga tatgctcgg 49

<210> 20

<211> 66

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative sequence used in the transposome complex

<220>

<221> other characteristics

<222> (1)..(1)

<223> 5'-biotin

<400> 20

ttuuuaatga tacggcgacc accgagatct acactcgtcg gcagcgtcag atgtgtataa 60

gagaca 66

<210> 21

<211> 58

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative sequence used in the transposome complex

<400> 21

ctgtctctta tacacatctc cgagccccg agacatctcg tatgccgtct tctgcttg 58

<210> 22

<211> 12

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative anchor sequence

<400> 22

ggatatgctc gg 12

<210> 23

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative sequence X

<400> 23

atctgactat ccctgcg 18

<210> 24

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Illustrative sequence X'

<400> 24

cgcaggggat agtcagat 18

<---

Claims (129)

1. An annealed transposon/polynucleotide attachment hybrid to create a labeled nucleic acid fragment library containing the following: (a) a first transposon containing a 3' transposon sequence and a 5' adapter sequence; (b) a second transposon containing a 5' transposon sequence and a 3' adapter sequence, where (i) the 5' end sequence of the second transposon is complementary to the 3' end sequence of the first transposon, (ii) the 5' adapter sequence of the first transposon is not complementary to the 3' adapter sequence of the second transposon, and (iii) the first transposon and the second transposon form a Y-shape; And (c) an attachment polynucleotide that hybridizes to a first transposon or a second transposon, containing the following: (i) a junction adapter sequence fused to a 5' adapter sequence of a first transposon or a 3' adapter sequence of a second transposon; And (ii) a binding element for binding said annealed transposon/polynucleotide attachment hybrid to a solid support. 2. A transposome complex for creating a library of labeled nucleic acid fragments containing the following: (a) transposase; (b) a first transposon containing a 3' transposon sequence and a 5' adapter sequence; (c) a second transposon containing a 5' transposon sequence and a 3' adapter sequence, where (i) the 5' end sequence of the second transposon is complementary to the 3' end sequence of the first transposon, (ii) the 5' adapter sequence of the first transposon is not complementary to the 3' adapter sequence of the second transposon, and (iii) the first transposon and the second transposon form a Y-shape; And (d) an attachment polynucleotide that hybridizes to a first transposon or a second transposon, containing the following: (i) a junction adapter sequence fused to the 5' adapter sequence of the first transposon or the 3' adapter sequence of the second transposon, and (ii) a binding element for binding said transposome complex to a solid support. 3. Immobilized transposome complex for creating a library of labeled nucleic acid fragments containing the following: solid substrate; And transposome complex immobilized on a solid support, wherein the transposome complex contains the following: (a) transposase; (b) a first transposon containing a 3' transposon sequence and a 5' adapter sequence; (c) a second transposon containing a 5' transposon sequence and a 3' adapter sequence, where (i) the 5' end sequence of the second transposon is complementary to at least a portion of the 3' end sequence of the first transposon to form a double-stranded end transposon sequence that binds to the transposase, (ii) the 5' adapter sequence of the first transposon is not complementary to the 3' adapter sequence of the second transposon, and (iii) the first transposon and the second transposon form a Y-shape; And (d) an attachment polynucleotide that hybridizes to a first transposon or a second transposon, containing the following: (i) a junction adapter sequence fused to the 5' adapter sequence of the first transposon or the 3' adapter sequence of the second transposon, and (ii) a binding element for binding said transposome complex to a solid support, moreover, the connecting element is immobilized on a solid substrate. 4. Immobilized transposome complex for creating a library of labeled nucleic acid fragments containing the following: (a) transposase; (b) a first transposon containing a 3' transposon sequence and a 5' adapter sequence; (c) a second transposon containing a 5' transposon sequence and a 3' adapter sequence, where (i) the 5' end sequence of the second transposon is complementary to at least a portion of the 3' end sequence of the first transposon to form a double-stranded end transposon sequence that binds to the transposase, (ii) the 5' adapter sequence of the first transposon is not complementary to the 3' adapter sequence of the second transposon, and (iii) the first transposon and the second transposon form a Y-shape; And (d) an attachment polynucleotide comprising: a binding element for linking said transposome complex to a solid support, wherein said connecting element is attached to the 5' adapter sequence of the first transposon via a cleavable linker; moreover, the connecting element is immobilized on the specified solid substrate. 5. The transposome complex according to any one of paragraphs. 2-4, wherein the attachment polynucleotide further comprises a spacer region, an anchor region, a primer sequence, an index tag sequence, or a combination thereof, and optionally further comprises a capture sequence, a databank sequence, a cleavage sequence, or a sequencing-related sequence, or a combination thereof. 6. The transposome complex of claim 5, wherein the first transposon further comprises a 5' primer sequence of the 5' adapter sequence of the first transposon, and the attachment polynucleotide contains (i) a portion complementary to and hybridized to the 5' adapter sequence, and ( ii) a complementary primer sequence. 7. The transposome complex of claim 5, wherein the first transposon further comprises a 5' primer sequence of a 5' adapter sequence and the attachment polynucleotide comprises an index tag sequence and a primer sequence. 8. The transposome complex of claim 5, wherein the second transposon further comprises a 3' adapter sequence and the attachment polynucleotide comprises (i) a portion complementary to and hybridized to the 3' adapter sequence of the second transposon, and (ii) an index tag sequence, and (iii) a primer sequence. 9. The transposome complex of claim 5, wherein the attachment polynucleotide comprises a spacer region, or a spacer region and an anchor region. 10. The transposome complex of claim 9, wherein the first transposon contains a 5' adapter sequence and the attachment polynucleotide contains (i) a portion complementary to and hybridized to the 5' adapter sequence of the first transposon and (ii) a spacer region, and ( iii) a primer sequence. 11. The transposome complex according to any one of paragraphs. 2-10, wherein the attachment polynucleotide contains a sequence complementary to the 5' adapter sequence of the first transposon. 12. The transposome complex according to any one of paragraphs. 9-11, in which the spacer region is not a DNA spacer. 13. The transposome complex according to any one of paragraphs. 9-12, wherein the spacer region is approximately equivalent in length to 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, or 30 base pairs, optionally the spacer region is approximately equivalent in length to 8 or 10 base pairs or nucleotides. 14. The transposome complex according to any one of paragraphs. 9-13, in which the spacer region contains universal bases, and optionally universal bases contain inosine or a nitroindole sequence. 15. The transposome complex according to any one of paragraphs. 9-13, wherein the spacer region comprises one or more 18 atom hexaethylene glycol spacers not from the nucleic acid sequence, one or more triethylene glycol spacers, or a combination thereof. 16. A transposome complex according to claim 15, wherein the spacer region contains 2 tandem copies of an 18 atom hexaethylene glycol spacer (2 x sp18 synthetic linker), two 18 atom hexaethylene glycol spacers not from a nucleic acid sequence, a triethylene glycol spacer, or two 18 atom hexa-ethylene glycol spacers and one tri-ethylene glycol spacer. 17. The transposome complex according to any one of paragraphs. 5-16, wherein the anchor region is complementary to the anchor region complementary to the indexing oligonucleotide, wherein the indexing oligonucleotide contains the complement of the anchor region and an index tag sequence. 18. The transposome complex of claim 17 wherein the anchor region complement is common to a plurality of indexing oligonucleotides. 19. The transposome complex of claim 17, wherein each index tag sequence of the plurality of index oligonucleotides is the same or different. 20. The transposome complex according to any one of paragraphs. 2-19, in which the connecting element contains biotin. 21. A transposome complex according to claim 20, wherein the binding element is a 3'-biotin linker. 22. The transposome complex according to any one of paragraphs. 2-10, wherein the transposase is a Tn5 transposase, a wild-type Tn5 transposase, or a hyperactive Tn5 transposase, or a mutant thereof. 23. The transposome complex according to any one of paragraphs. 5-22, wherein the primer sequence of the attachment polynucleotide is complementary to the index primer sequence of the index polynucleotide. 24. The transposome complex according to any one of paragraphs. 3-23, wherein the solid support is a bead, paramagnetic bead, flow cell, microfluidic device surface, test tube, plate well, slide, structured surface, or microparticle. 25. The transposome complex of claim 24, wherein the solid support includes a plurality of solid supports. 26. The transposome complex of claim 25, wherein the plurality of solid supports comprises a plurality of beads. 27. Kit for creating a library of labeled nucleic acid fragments, containing the following: transposome complex according to any one of paragraphs. 2-26; And a mixture of oligonucleotides containing index sequences. 28. The kit according to claim 27, wherein the mixture of oligonucleotides contains i5 index sequences and i7 index sequences, wherein the i5 index sequences hybridize to the attachment polynucleotide and the i7 index sequences hybridize to the 3' adapter sequence of the second transposon. 29. A method for creating a library of labeled nucleic acid fragments, including bringing the immobilized transposome complex according to any one of paragraphs. 3-26 in contact with a target nucleic acid to fragment the target nucleic acid into a plurality of target fragments and to attach the 3' end of the first transposon to the 5' ends of the target fragments to obtain a plurality of 5'-labeled target fragments. 30. The method of claim 29, further comprising the following: treating the solid support to remove unbound nucleic acids; or treating the solid support to remove the transposase from the complex, optionally by: (a) heating the solid support and/or (b) washing the solid support with an enzymatic denaturant, wherein the enzymatic denaturant optionally contains sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase. 31. The method of claim 29 or 30, wherein the contacting comprises mixing the biological sample with the transposome complex. 32. The method according to p. 31, in which the specified biological sample contains a cell lysate or whole cells or is selected from blood, plasma, blood serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspiration, feces, macerated tissue and fixed FFPE fabric. 33. The method according to any one of paragraphs. 29-32, wherein the contacting further comprises hybridizing a plurality of index oligonucleotides to addition polynucleotides, wherein the plurality of index oligonucleotides contain the same or different index sequences. 34. The method according to any one of paragraphs. 29-33, further comprising treating a plurality of 5'-labeled target fragments with polymerase and ligase to extend and ligate the chains to produce fully double-stranded labeled fragments. 35. The method of claim 34, wherein the polymerase and ligase treatment is performed in the presence of a DNA secondary structure disruptor, the disruptor being optionally DMSO. 36. The method of claim 34 or 35, wherein the polymerase and ligase treatment is carried out in the presence of an oligonucleotide that is complementary to the primer sequence, said primer sequence being the P7 sequence shown in SEQ ID NO: 8, and said oligonucleotide being an oligonucleotide , which is a complement of the indicated P7 sequence shown in SEQ ID NO: 8. 37. The method according to any one of paragraphs. 34-36, in which the polymerase contains a T4 DNA polymerase mutant lacking exonuclease activity. 38. The method according to any one of paragraphs. 29-37, further comprising removing fully double-stranded labeled fragments from the solid support. 39. The method of claim 38, wherein the removal comprises the application of heat and/or a denaturant sufficient to cleave the fully double-stranded labeled fragments from the solid support. 40. The method according to any one of paragraphs. 29-39, further comprising sequencing one or more of the 5'-labeled target fragments or fully double-stranded labeled fragments. 41. The method of claim 40 wherein the fragments are not quantified by PCR after contact and prior to sequencing. 42. The method according to any one of paragraphs. 29-41, wherein the nucleic acid is DNA or RNA. 43. The method of claim 29, wherein the 3' adapter sequence of the second transposon is complementary to at least a portion of the index adapter sequence. 44. The method according to p. 29, in which the primer sequence of the polynucleotide joining the immobilized transposome complex according to any one of paragraphs. 5-26 is complementary to at least a portion of the index primer sequence. 45. A method for creating a library of labeled nucleic acid fragments, comprising the following: a) bringing the immobilized transposome complex according to any one of paragraphs. 3-26 in contact with a target nucleic acid to fragment the target nucleic acid into a plurality of target fragments and to attach the 3' end of the first transposon to the 5' ends of the target fragments to obtain a plurality of 5'-labeled target fragments; b) treating the solid support to remove unbound nucleic acids; or treating the solid support to remove the transposase from the complex, optionally by (a) heating the solid support and/or (b) washing the solid support with an enzymatic denaturing agent, the enzymatic denaturing agent optionally containing sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase; c) treating a plurality of 5'-labeled target fragments with a polymerase and ligase to extend and ligate the 5'-labeled target fragments to produce fully double-stranded labeled fragments, optionally the polymerase and ligase treatment is performed in the presence of a DNA secondary structure disruptor, the disruptor optionally being is DMSO; d) removing the fully double-stranded labeled fragments from the solid support, the removal optionally comprising the application of heat and/or a denaturant sufficient to cleave the fully double-stranded labeled fragments from the solid support, the denaturing agent being optionally NaOH; And e) selecting fully double-stranded labeled fragments using capture beads, optionally, wherein the capture beads are magnetic beads, further optionally performing two separate selection steps. 46. The method of claim 45, wherein the immobilized transposome complex comprises the following: solid substrate; And transposome complex immobilized on a solid support, wherein the transposome complex contains the following: (a) transposase; (b) the first transposon containing the 3'-terminal sequence of the transposon and the anchor sequence (anchor); (c) a second transposon containing the 5'-terminal sequence of the transposon and a sequence complementary to the B15 sequence shown in SEQ ID NO: 5, where (i) the 5' end sequence of the second transposon is complementary to the 3' end sequence of the first transposon, (ii) the 5' adapter sequence of the first transposon is not complementary to the sequence complementary to the B15 sequence shown in SEQ ID NO: 5 of the second transposon, and (iii) the first transposon and the second transposon form a Y-shape; And (d) an attachment polynucleotide that hybridizes to a first transposon or a second transposon, containing the following: (i) an anchor sequence complement, a sequence complementary to the A14 sequence shown in SEQ ID NO: 4, a spacer and a sequence complementary to the P5 sequence shown in SEQ ID NO: 7; And (ii) a binding element for binding said transposome complex to a solid support, containing biotin, wherein the biotin is immobilized on said solid support. 47. The method of claim 45 or 46, further comprising sequencing one or more fully double-stranded labeled fragments. 48. A method for creating a library of labeled nucleic acid fragments, comprising the following: a) bringing into contact the first immobilized transposome complex according to any one of paragraphs. 3-26 and the second immobilized transposome complex according to any one of paragraphs. 3-26 with a target nucleic acid to fragment the target nucleic acid into a plurality of target fragments and attach the 3' end of each first transposon to the 5' ends of the target fragments to obtain a plurality of first 5'-labeled target fragments obtained from the first immobilized transposome complex, and a plurality of second 5'-labeled target fragments derived from the second immobilized transposome complex, wherein the first immobilized transposome complex comprises a solid support and the first transposome complex immobilized on a solid support, wherein the first transposome complex comprises the following: i) transposase; ii) a first transposon containing a 3' transposon sequence and an anchor sequence; iii) a second transposon containing a 5'-terminal transposon sequence, where (1) the 5'-terminal sequence of the second transposon is complementary to the 3'-terminal sequence of the first transposon, (2) the anchor sequence of the first transposon is not complementary to any part of the second transposon, and ( 3) the first transposon and the second transposon form a Y-shape; And iv) a first attachment polynucleotide that hybridizes to a first transposon or a second transposon containing (i) the complement of an anchor sequence, a sequence complementary to the A14 sequence shown in SEQ ID NO: 4, a spacer, and a sequence complementary to the P5 sequence shown in SEQ ID NO: : 7, and (ii) a binding element containing biotin, and the biotin is immobilized on a solid support, and wherein the second immobilized transposome complex comprises a solid support and a second transposome complex immobilized on a solid support, the second transposome complex comprising the following: i) transposase; ii) a first transposon containing a 3' transposon sequence and an anchor sequence; iii) a second transposon containing a 5'-terminal transposon sequence, where (1) the 5'-terminal sequence of the second transposon is complementary to the 3'-terminal sequence of the first transposon, (2) the anchor sequence of the first transposon is not complementary to any part of the second transposon, and ( 3) the first transposon and the second transposon form a Y-shape; And iv) a second attachment polynucleotide that hybridizes to a first transposon or a second transposon comprising (i) an anchor sequence complement, a sequence complementary to B15 (SEQ ID NO: 7), a spacer, and a sequence complementary to P7 (SEQ ID NO: 8) , and (ii) a binding element for binding the second transposome complex with a solid support, containing biotin, and biotin is immobilized on the specified solid support; b) treating a plurality of 5'-labeled target fragments with a ligase to ligate each 5'-labeled target fragment to either a first indexing oligonucleotide or a second indexing oligonucleotide by bringing the 5'-labeled target fragments into contact with a pool of first and second indexing oligonucleotides, wherein each first indexing oligonucleotide contains an A14 sequence, an i5 sequence, and a P5 sequence and can bind to the first 5'-labeled target fragment; and wherein each second indexing oligonucleotide contains a B15 sequence (SEQ ID NO: 5), an i7 sequence, and a P7 sequence (SEQ ID NO: 8) and can be linked to a second 5'-labeled target fragment to obtain a plurality of 5'-labeled target fragments ligated with indexing oligonucleotides; c) treating the solid support to remove the transposases from the complex, optionally by (a) heating the solid support and/or (b) washing the solid support with an enzymatic denaturant, the enzymatic denaturant optionally containing sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase ; And d) treating a plurality of 5'-labeled target fragments ligated with indexing oligonucleotides with a polymerase to extend and produce fully double-stranded labeled fragments. 49. The method of claim 48, wherein contacting the first immobilized transposome complex with the second immobilized transposome complex and treating a plurality of 5'-labeled target fragments with a ligase is performed in a single reaction. 50. The method of claim 48 or 49, wherein the double-stranded labeled fragments are obtained in solution. 51. The method according to any one of paragraphs. 48-50 further comprising selecting fully double-stranded labeled fragments using capture beads, the capture beads optionally being magnetic beads, and further optionally performing two separate selection steps. 52. The method according to any one of paragraphs. 48-51, further comprising sequencing one or more of the fully double-stranded labeled fragments.

Images