RU2702755C1 - Method for molecular-genetic diagnosis of hereditary breast cancer - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention relates to medicine. What is presented is a method for molecular genetic diagnosis of hereditary breast cancer. Isolated DNA is tested for 5382insC mutation in the BRCA1 gene by real-time allele-specific PCR. In case of positive result, this mutation is searched for among blood relatives of the patient. If 5382insC mutation is absent, the patient's whole coding part of BRCA1/2 genes with adjoining sections of introns and regulatory regions is analyzed by a new generation sequencing method. If pathogenic mutations are absent, no mutations in BRCA1/2 genes are observed in the patient. If a pathogenic mutation is found, the patient is diagnosed with a genetic predisposition to breast cancer and similar mutations are sought for in blood relatives. If pathogen mutation is absent, blood relatives conclude that they do not have mutations in BRCA1/2 genes.

EFFECT: invention provides higher diagnostic efficiency.

3 cl, 1 dwg, 2 tbl, 2 ex

Description

The invention relates to medicine and can be used to diagnose hereditary forms of breast cancer based on the identification of genetic mutations.

Breast cancer ranks first among all malignant diseases in women. According to modern data, the incidence of breast cancer in Russia over the past 15 years has more than doubled. According to world literature, 5-10% of cases of breast cancer (breast cancer) are hereditary. In the 90s of the last century, genes associated with breast cancer-BRCA1 and BRCA2 were discovered. They play an important role in maintaining the stability of the genome, helping to restore double-stranded DNA breaks. BRCA1 and BRCA2 are large genes in which many different mutations have been found that lead to the loss of their functions [1, 2].

The BRCA1 gene is a highly polymorphic gene that plays a major role in DNA repair and control of cell proliferation. The BRCA2 gene stimulates homologous recombination, which includes one of the main biochemical pathways for repairing double-stranded DNA breaks and, therefore, can function to maintain the integrity of the genome and suppress the malignancy of proliferating cells [3-6].

For these genes, mutations with the "founder effect", i.e. mutations occurring in a population with an increased frequency. For example, in the East European and Russian populations, the founder effect is manifested by the 5382insC mutation in the BRCA1 gene, and among Ashkenazi Jews, the common mutations are BRCA1 185delAG and BRCA2 6174delT [7-10]. Often found pathogenic mutations in the BRCA2 gene in Russia at the moment not found. Mutations with the founder effect are successfully detected using a highly sensitive and economical method - allele-specific real-time PCR. However, most mutations are individually rare, dispersed over extended coding regions of the BRCA1 / 2 genes, and many of them have been registered only in individual families. The total frequency of rare mutations is comparable or even exceeds the frequency of mutations with the founder effect. These mutations remain costly to diagnose because of the high cost and low productivity of the Sanger sequencing method that is most suitable in such a situation.

Today in the USA, a number of European countries and China, it is customary to conduct genetic analysis to search for familial forms of cancer. To do this, collect pedigree data, often the family is observed by one doctor. A search for pathogenic genetic variants in a patient with signs of a hereditary form of cancer is carried out, and in case of detection, an analysis is made of the found variants in relatives. In the presence of a mutation, careful monitoring is performed by an oncologist and mammologist, which allows the patient to be diagnosed and removed in the early stages of the disease [11-13]. However, with this approach, there is a significant drawback - when using the pedigree analysis, more than 30% of mutation carriers are not detected [8]. In Russia, this practice is not accepted due to the fact that information about family pathologies is often absent or extremely fragmented. The practice of family doctors is also not accepted in Russia. Moreover, timely diagnosis of hereditary forms can significantly reduce the incidence and mortality in breast cancer.

A known method for identifying factors of hereditary predisposition to breast cancer, including the detection of repeated mutations 5382insC, 185delAG in BRCA1 and 6174delT in BRCA2 using PCR [14].

A known method for predicting a hereditary predisposition to breast cancer by detecting mutations in the BRCA1 / 2 and CHEC2 gene [15]. This method consists in using a total analysis of common mutations in all breast cancer patients who are on an outpatient or inpatient treatment. This method involves diagnosing a narrow list of mutations in hot spots using allele-specific real-time PCR.

All the above methods for predicting a hereditary predisposition to breast cancer are focused on the search for hot spots, while mutations with a low frequency of occurrence in the population remain problematic for diagnosis and are not detected.

Closest to the claimed method, the prototype, is a method for the diagnosis of hereditary forms of breast cancer, including peripheral blood sampling, isolation of white blood cells from DNA by the standard salt-chloroform method. Next, DNA samples are selected that do not contain known breast cancer associated mutations (in the genes BRCA1, BRCA2, CHEK2, NBS1, BLM, PALB2, RAD50, BRIP1, ATM, TP53, BLM). Then, genetic markers are registered by mass parallel sequencing on the Illumina MiSeq System platform, followed by selection and detailed analysis of only harmful mutations among patients with breast cancer in a homozygous state. Malicious mutations are understood as mutations, whose influence on gene function seems to be undeniable - shifts of the reading frame, nonsense mutations, damage to splice sites, etc. [16].

The disadvantages of the prototype are limited functionality and lack of effectiveness of the method, since: the search for malicious mutations is carried out only in the homozygous state, which excludes the detection of mutations in the heterozygous state; selection of patients for signs of hereditary cancer (early age of onset of the disease, primary multiple cancer) is also carried out only in a homozygous state, which makes it difficult to find patients with a genetic predisposition to breast cancer that do not fit these criteria. Additionally, in the prototype, filtering is performed for the absence of relatives in the patient’s family with breast cancer or ovarian cancer.

The present invention is the creation of a new method of molecular genetic diagnosis of hereditary forms of breast cancer using sequencing of a new generation.

The technical result of the present invention is to increase the efficiency of diagnosis.

The problem is achieved by the proposed method, which consists in the following.

All patients with a diagnosis of breast cancer who are being treated or monitored in an oncology institution are sampled for biological material (blood or buccal epithelium). DNA obtained from biological material is first tested for the most common pathogenic mutation in Russia in the BRCA1-5382insC gene - using allele-specific real-time PCR. In the case of a positive result, conduct a search for this mutation among the blood relatives of the patient. In the absence of the 5382insC mutation in the patient, the entire coding portion of the BRCA1 / 2 genes with adjacent intron regions and regulatory regions is analyzed by a new generation sequencing method.

When a pathogenic mutation is found in a patient, a similar search is carried out in blood relatives. If the result is negative, conclude that there are no pathogenic mutations in the BRCA1 / 2 genes, if the result is positive. - conclude that the patient has a hereditary predisposition to

Breast cancer and search for the detected mutation among the blood relatives of the patient.

Next-generation sequencing refers to the determination of the nucleotide sequence of DNA using the Ion PGM genetic analyzer.

The differences of the proposed method, compared with the prototype, are:

1. The diagnosis of mutations is carried out by all breast cancer patients undergoing treatment or observed in a cancer institution, without taking into account the anamnesis;

2. At the first stage, the pathogenic mutation 5382insC in the BRCA1 gene is analyzed using allele-specific real-time PCR, which allows us to establish the presence or absence of the most common 5382insC mutations in the patient and, in case of a positive result, not to further search for mutations by sequencing new generation;

3. In the case of a positive result, a search is made for this mutation among the blood relatives of the patient, which allows us to establish the presence or absence of the 5382insC mutation in the BRCA1 gene.

4. In the absence of the 5382insC mutation in the patient, the entire coding part of the BRCA1 / 2 genes with adjacent intron regions and regulatory regions is analyzed by a new generation sequencing method, which allows to determine the presence or absence of mutations in the BRCA1 / 2 genes.

5. When a pathogenic mutation is found in the patient, a similar search is carried out in blood relatives and if the result is negative, they conclude that there are no pathogenic mutations in the BRCA1 / 2 genes, and if the result is positive, they conclude that the patient's relative (s) are hereditarily predisposed to breast cancer.

The proposed method can be used in medicine for the purpose of medical diagnostics aimed at identifying the carrier of mutations in the BRCA1 and BRCA2 genes.

In FIG. 1 is a schematic diagram of a method for molecular genetic diagnosis of hereditary forms of breast cancer.

The inventive method was analyzed by a sample of 445 patients of the Novosibirsk Regional Clinical Oncology Center with a diagnosis of breast cancer. Blood samples were taken between April 2013 and June 2016. Due to the fact that one of the signs of a hereditary form of cancer is young age, in order to increase the likelihood of detecting pathogenic mutations, patients were selected who, at the time of diagnosis, were between the ages of 19 and 40

Using sequencing of a new generation, 40 carriers of pathogenic mutations in the BRCA1 gene were identified. A mutation with the “founder effect” of 5382ins was detected in 35 of 40 patients (7.9%), in 5 of 40 patients other pathogenic mutations were found that were different from each other.

Of the 445 samples in the BRCA1 gene, 16 mutations with an unclear clinical effect and 14 clinically insignificant mutations that can be attributed to polymorphisms were also found. The analysis revealed 7 (1.6%) carriers of various pathogenic mutations in the BRCA2 gene. In addition, 29 genetic variants with missing or unclear clinical significance in the BRCA1 gene and 14 in the BRCA2 gene were detected in 445 breast cancer patients.

Thus, as a result of the analysis of mutations in the BRCA1 / 2 genes among 445 patients with breast cancer, 35 carriers of the BRCA1 5382insC mutation and 12 carriers of other pathogenic mutations that differ from each other were revealed.

The costs of molecular genetic diagnostics, subject to a constant flow of patients, will amount to about several thousand rubles. If a mutation is detected, the patient is recommended 2 times more often to visit doctors of the appropriate profile. If we combine the costs of molecular genetic diagnostics and additional supervision by a mammologist and oncologist, they will amount to about 50 thousand rubles. When cancer is detected at stages 1-2, the costs increase by an order of magnitude, but when cancer is detected at stages 3-4, the costs increase by more than 30 times. This does not take into account the social component, such as the quality and life expectancy of patients.

The invention is illustrated by the following examples of specific performance of the method.

Example 1

A blood sample of patient K. was analyzed with a diagnosis of breast cancer for mutations.

For this, a peripheral blood sampling was performed in a patient with breast cancer. DNA was isolated using a commercial express kit. Next, using real-time allele-specific PCR, a sample was analyzed for the presence of the 5382insC mutation in the BRCA1 gene using DNA obtained from the patient's blood sample K as a template. The 25 μl reaction mixture contained: from 5-500 ng genomic DNA fluorescently labeled oligonucleotides (5'-FAM-AGTGCTATCCGAGGGAACAAAGCGAGCAAGAGAATCCTAG-3 '; 5'-FAM-AGTGCTATCCGAGGGAAAAAGCGAGCAAGAGAATCCTCA-3'; 5'-TTATGGGTCGTGTAGTAGTAGTAGTAGTGTAGTGTAGTAGTGTAGTGTAGTGTAG fluorophore; BHQ1 - Black Hole Quencher 1, fluorescence quencher) (400 nM); deoxynucleoside triphosphates (0.32 mM); magnesium chloride (3 mM); ammonium sulfate (16 mM); Tris-HCl (67 mM; pH = 8.8); 1.25 units of Taq DNA polymerase activity. PCR was carried out under the following conditions: initial denaturation - 3 min. at 95 ° C, then 40 cycles: denaturation 10 seconds (95 ° C), hybridization of primers 15 seconds (61 ° C), chain elongation 30 seconds (72 ° C), fluorescence registration - 15s (50 ° C). Real-time allele-specific PCR was performed using a CFX96 instrument (Bio-Rad USA). Patient K. was not found to have a 5382insC mutation. Next, we analyzed the entire coding part of the BRCA1 / 2 genes with adjacent intron regions and regulatory regions by a new generation sequencing method. For this, we used the DNA obtained from the sample of patient K. as the template, and the product was produced using the target pairs of primers shown in Table 1 (Structure of primers BRCA1) and in Table 2 (Structure of primers BRCA2). A 25 μl reaction mixture contained: 5-100 ng of genomic DNA; formed pool of primers (10 mM); deoxynucleoside triphosphates (0.25 mM); magnesium chloride (3 mM); ammonium sulfate (16 mM); Tris-HCl (67 mM; pH = 8.8); 1.25 units of Taq DNA polymerase activity. PCR was performed under the following conditions: denaturation step 15 seconds (95 ° C), annealing step 30 seconds (60 ° C), elongation step 40 seconds (72 ° C). For optimal production of the product, 23 cycles for the BRCA1 gene and 28 cycles for the BRCA2 gene are necessary. Multiplex PCR was performed in a BIS-N thermocycler M111-02 (Russia). Agencourt AMPure XP magnetic particles were cleaned. The sample was then prepared for sequencing using a commercial DNA target library preparation kit. The prepared sample was brought to the required concentration and loaded into an Ion OneTouch 2 device for emulsion PCR. For this, a reagent kit was used to prepare the library for sequencing of the Ion PGM Hi-Q OT2 Kit (Life Technologies, USA) in accordance with the manufacturer's protocol. The emulsion PCR product was purified using an Ion OneTouch ES instrument according to the protocol, loaded onto a chip, which was placed in a PGM Ion Torrent instrument. For this, Ion PGM Hi-Q Sequencing Kit reagent kit was used. Bioinformatic analysis of the initial data was performed using the PRINSEQ method [17]. The nucleotide sequences obtained as a result of the analysis were compared with the reference sequence of the human genome GRCh37 / hg19 using BWA-MEM software version 0.7.5 [18]. The search for genetic variants was performed using SAM tools software version 0.1.19 [19]. Patient K. did not find clinically significant mutations and concluded that there were no mutations in the BRCA1 / 2 genes.

Example 2

Patient M. with a diagnosis of breast cancer was sampled for DNA extraction. DNA was isolated using a commercial express kit. Then, using the allele-specific real-time PCR method, a sample was analyzed for the presence of the 5382insC mutation using the DNA obtained from the sample of patient M as a template. Real-time allele-specific PCR and a new generation sequencing were carried out analogously to example 1. In the patient M. was found clinically significant mutation IVS 18 + 1 G> T. It was concluded that this mutation was present and an analysis was made for the presence of this mutation in the sister, brother and two daughters of the patient. For this, blood was taken from a brother, sister and daughters and DNA was isolated. Sequencing of the new generation was carried out analogously to example 1. In the brother and sister of patient M., no mutations were found, in daughters this mutation was found in a heterozygous state. The conclusion was drawn about the hereditary predisposition of the daughters of patient M. to breast cancer and the absence of mutations in the BRCA1 / 2 genes of the brother and sister.

The inventive method has increased efficiency and allows to increase the percentage of detection of individuals genetically predisposed to breast cancer, which will allow to diagnose a tumor in the early stages and increase patient survival and improve the quality of life.

Information sources

1. Mavaddat N. et al. Genetic susceptibility to breast cancer. // Mol. Oncol. Wiley-Blackwell, 2010. Vol. 4, No. 3. P. 174-191.

2. Lynch H.T., Snyder C., Lynch J. Hereditary Breast Cancer: Practical Pursuit for Clinical Translation // Ann. Surg. Oncol. Springer-Verlag, 2012. Vol. 19, No. 6. P. 1723-1731.

3. Sharan S.K. et al. Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. // Nature. 1997. Vol. 386, No. 6627. P. 804-810.

4. Xia F. et al. Deficiency of human BRCA2 leads to impaired homologous recombination but maintains normal nonhomologous end joining. // Proc. Natl. Acad. Sci. U.S.A. 2001. Vol. 98, No. 15. P. 8644-8649.

5. Moynahan M.E., Pierce A.J., Jasin M. BRCA2 Is Required for Homology-Directed Repair of Chromosomal Breaks // Mol. Cell. Cell Press, 2001. Vol. 7, No. 2. P. 263-272.

6. Davies A.A. et al. Role of BRCA2 in Control of the RAD51 Recombination and DNA Repair Protein // Mol. Cell. Cell Press, 2001. Vol. 7, No. 2. P. 273-282.

7. Gayther S.A. et al. Frequently occurring germ-line mutations of the BRCA1 gene in ovarian cancer families from Russia. // Am. J. Hum. Genet. Elsevier, 1997. Vol. 60, No. 5. P. 1239-1242.

8. Kwon J.S. et al. Expanding the criteria for BRCA mutation testing in breast cancer survivors. // J. Clin. Oncol. 2010. Vol. 28, No. 27. P. 4214-4220.

9. Iyevleva A.G. et al. Non-founder BRCA1 mutations in Russian breast cancer patients // Cancer Lett. Elsevier, 2010. Vol. 298, No. 2. P. 258-263.

10. Abeliovich D., Kaduri L., Lerer I., Weinberg N. A.G., Sagi M., Zlotogora J., Heching N. P.T. The founder mutations 185delAG and 5382insC in BRCA1 and 6174delT in BRCA2 appear in 60% of ovarian can_ cer and 30% of early onset breast cancer patients among Ashkenazi women // Am. J. Hum. Genet. Elsevier, 1997. Vol. 60, No. 3. P. 505-514.

11. Guo Y. et al. Identifying a BRCA2 c. 5722_5723del mutation in a Han-Chinese family with breast cancer // Biosci. Rep. 2019.P. BSR20182471.

12. Siu A.L. Screening for Breast Cancer: U.S. Preventive Services Task Force Recommendation Statement // Ann. Intern. Med. American College of Physicians, 2016. Vol. 164, No. 4. P. 279.

13. Phi X.-A. et al. Accuracy of screening women at familial risk of breast cancer without a known gene mutation: Individual patient data metaanalysis // Eur. J. Cancer. Pergamon, 2017. Vol. 85. P. 31-38.

14. Sokolenko A.P. et al. Founder mutations in early-onset, familial and bilateral breast cancer patients from Russia. // Fam. Cancer 2007. Vol. 6, No. 3. P. 281-286.

15. Paul G.A. et al. Detection of Mutations Related To Hereditary Cancer in Relatives of Breast Cancer Patients // Sib. J. Oncol. 2017. Vol. 16, No. 4. P. 84-88.

16. Kuligina E.Sh. and others. A method for identifying recessive factors of hereditary predisposition to breast cancer. 2013.

17. Schmieder R., Edwards R. Quality control and preprocessing of metagenomic datasets. // Bioinformatics. Oxford University Press, 2011. Vol. 27, No. 6. P. 863-864.

18. Li H., Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. // Bioinformatics. Oxford University Press, 2009. Vol. 25, No. 14. P. 1754-1760.

19. Li H. et al. The Sequence Alignment / Map format and SAMtools. // Bioinformatics. Oxford University Press, 2009. Vol. 25, No. 16. P. 2078-2079.

Claims (3)

1. The method of molecular genetic diagnosis of hereditary forms of breast cancer, including collecting samples of biological material in patients diagnosed with breast cancer, isolation from DNA samples, followed by DNA testing for pathogenic mutations in the BRCA1 / 2 genes, characterized in that first, the extracted DNA is tested for the presence of the 5382insC mutation in the BRCA1 gene by allele-specific PCR in real time, in case of a positive result, this mutation is searched among blood relatives patient, in the absence of a 5382insC mutation in a patient, the latter analyzes the entire coding part of the BRCA1 / 2 genes with adjacent intron regions and regulatory regions by a new generation sequencing method, in the absence of pathogenic mutations, they conclude that there are no mutations in the patient's BRCA1 / 2 genes , in the case of finding a pathogenic mutation in a patient, they conclude that he is genetically predisposed to breast cancer and conduct a similar search for mutations in blood relatives, and in the absence of a pathogenic mutations in blood relatives conclude that they do not have mutations in the BRCA1 / 2 genes. 2. The method according to p. 1, characterized in that the allele-specific PCR in real time is carried out using a CFX96 Bio-Rad device. 3. The method according to p. 1, characterized in that the sequencing of the new generation is carried out on a PGM Ion Torrent instrument using a set of reagents for high-performance sequencing Ion PGM Hi-Q Sequencing Kit.

Images