RU2631004C2 - METHOD FOR Trib-2mut RECOMBINANT ELASTROMERIAL DOMAIN, PRODUCTION, GENE-ENGINEERING pGDTrib2mut CONSTRUCTION, DETERMINING Trib-2mut BIOSYNTHESIS IN E.coli CELLS, E.coli M15/pGDTrib2mut PRODUCING STRAIN AND METHOD FOR POLYMER MATERIAL OBTAINING BASED ON THIS PROTEIN - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: based on the minimal recombinant elastomeric motif (tribolin-1, Trib-1mut) insect resilinTribolium castaneum (tribolin-2, TRib-2mut), a protein structure is obtained recombinantly, which is used in aggregation methods to form the basis of a biomatrix network.

EFFECT: invention allows to obtain polymeric frame biomaterial for tissue engineering.

5 cl, 2 dwg, 2 tbl, 4 ex

Description

   The creation of new recombinant elastomeric proteins is an urgent problem of modern biomedical science, as it finds its application in developments related to the expansion of the range of universal biomaterials for tissue engineering. Despite the significant successes achieved in biomaterial science today, such materials are still severely deficient [1].

   Currently, several types of natural bioframe materials with elastomeric properties are used in the world practice of tissue engineering, among which collagen, fibrin, fibroin (spidroin) can be distinguished [2].

   The main problems facing the large-scale production and use of these materials are: the high cost of their production, the need for costly decontamination procedures to prevent possible transmission of viral and prion infections to patients (in the case of collagen and fibrin), and the low level of expression of such polypeptides in bacterial production systems , lack of pronounced elementary elastomeric motifs [3-5].

   Science, meanwhile, is aware of a class of natural biopolymers called resilins [6], which serve as hopping and fly-springs for such insects as fleas, locusts, black beetles, etc. Rezilin inserts are located in the main joints of the jumping limbs and wings of these insects, held by special chitinous “triggers”. Before the jump, the rubber elements store energy, and when the insect releases the “trigger”, the elastic protein straightens its legs or wings for one millisecond, giving the insect a powerful impulse [7-9]. Over the life of an insect, these joints work millions of times, and the resilin, which is part of these joints, without updating, does not work at all, does not get tired and does not lose its properties. When straightened, compressed resilin gives up 92% of the stored energy, while the elastin and collagen proteins that make up the ligaments in mammals make up 90%, and the best rubber only 80%. It follows from the foregoing that such proteins are valuable not only as materials for biomedicine, but also have a certain potential for technological purposes, where high elasticity is required [7].

In the databases, annotated protein of the resilin class of the blackling insect (Tribolium castaneum, T. castaneum) (NCBI Reference Sequence: NP_001182329.1). Meanwhile, it has become evident from our experience that the production efficiency of such full-sized resilin in prokaryotic expressing systems in recombinant form is also not high enough, therefore, the amino acid sequence of this protein was analyzed, during which a minimal motif consisting of 23 amino acid residues QNGG XZ SSTYGPPGQGGNGFGGGG (“X” = amino acids R, K; “Z” = amino acids P, L). This motif is periodically and sequentially repeated in the central part of the resilin molecule T. castaneum, forming its central domain, which is responsible, most likely, for the elastomeric properties.

   This minimal motif was called the minimal elastomeric motif of resilin black beetle (tribolin-1, tribolinum-1, Trib-1) (see table 1.).

   A domain consisting of at least 4 repeating minimal elastomeric motifs is called the elastomeric domain of resilin protein (tribolin-2, tribolinum-2, Trib-2) (see appendices SEQ ID NO: 4).

   We have developed an approach that was also the subject of this invention, aimed at increasing the level of expression of resilin protein in prokaryotic systems, due to its truncation to four minimal elastomeric motifs sequentially combined with each other. It is important to note that in this form resilin retains the elastomeric component, has a lower molecular weight and optimal amino acid composition, which allows it to be obtained with a high degree of efficiency by recombinant means in bacterial producing systems such as Escherichia coli.

   Meanwhile, in the development of 3D framework biomaterials for tissue engineering, it becomes necessary to provide the possibility of planning the step of transverse chemical “linking” of the peptide chains underlying the graft, which is used to create materials with different degrees of porosity. With all this in mind, the sequence of the Trib-1 minimal elastomeric motif has been optimized at the genetic engineering level. Moreover, a set of measures aimed at optimization, was also the subject of the present invention. For this purpose, the sequence Trib-1 was subjected to site-directed mutagenesis, in which the following amino acid substitutions were made: Q1E, N2D, Q15K (see table 1.). The need for these substitutions is dictated by the fact that for subsequent chemical crosslinking by the carbodiimide method, it is more convenient when in the “1” and “2” positions of the Trib-1 molecule are not the amides of aspartic and glutamic acids, but the acids themselves. In the case of using glutaraldehyde as a crosslinking agent, it is convenient when the amino acid lysine is located at position “15”.

Table 1

No. Title Amino Acid Sequence one native Trib-1
QN GGKPSSTYGPPG Q GGNGFGGG 2 mutant Trib-1 (Trib-1mut)
ED GGKPSSTYGPPG K GGNGFGGG

   The technical result of the present invention is to create a synthetic gene encoding a mutant elastomeric domain of resilin T. castaneum protein (tribolinum-2mut, Trib-2mut), consisting of four repeating minimal elastomeric resilin motifs (Trib-1mut), to create an expression plasmid pGDTrib2mut with the trib gene -2mut (see SEQ ID NO: 3), obtaining the actual mutant elastomeric domain of resilin T. castaneum (Trib-2mut), as well as creating a polymer material based on this protein by treating the purified recombinant Trib-2mut protein with specific reagents for chemical cross-linking of its constituent amino acids.

   The positioned technical result is achieved by creating a recombinant protein Trib-2mut with a molecular weight of about 15 kDa.

The technical result of the present invention is achieved through the use of the minimum elastomeric motif of resilin T. castaneum (Trib-1mut) as an elementary elastomeric unit of the recombinant domain Trib-2mut.

The specified technical result is achieved by the creation of recombinant plasmid DNA pGDTrib2mut 3889 bp (see SEQ ID NO: 3) containing a synthetic operon with the gene for the elastomeric domain trib-2mut (115-595 bp), including the early promoter of the bacteriophage T5, the nucleotide sequence encoding the Trib-2mut protein itself and the transcription terminator; a beta-lactamase gene that determines antibiotic resistance to ampicillin and a ColE1-type replication initiation site. Thus, the recombinant plasmid DNA pGDTrib2mut is designed to ensure efficient expression of the Trib-2mut protein in E. coli cells.

   The technical result is also achieved by the fact that the E. coli strain M15 (Qiagen), transformed with the expression plasmid vector pGDTrib2mut, is a producer of the target Trib-2mut protein.

   The technical result is also achieved by specific processing of the purified recombinant protein Trib-2mut with a chemical reagent for crosslinking amino acids (1-Ethyl-3- (3-dimethylaminopropyl) carbodiimide, glutaraldehyde) by forming covalent bonds between such amino acids as lysine, glutamic acid, aspartic acid .

DESCRIPTION OF THE PROCESS OF ACHIEVING TECHNICAL RESULTS

1. Creation of plasmid expression vector pGDTrib2mut

1.1. Chemical synthesis of oligonucleotides

All oligonucleotides were synthesized by the solid-phase amidophosphite method and purified by electrophoresis in SDS page (ZAO Eurogen).

1.2. Obtaining and cloning of the trib-2mut gene

In accordance with the concept of the present invention, there is provided a stepwise method for producing, cloning and expressing a synthetic gene encoding mutant tribolin-2 (Trib-2mut).

Stage 1: obtaining and cloning of the gene trib-1mut in the intermediate vector pGDTrib1mut (see SEQ ID NO: 1 of the appendix);

Stage 2: obtaining and cloning of the gene trib-2mut in the final vector pGDTrib2mut (see SEQ ID NO: 3 appendices).

1.2.1. Obtaining and cloning of the gene trib-1mut

The trib-1mut gene was assembled using the LIP-free method PIPE (Polymerase Incomplete Primer Extension) [10]. This method consists in the fact that the incorporation of the target gene into the required vector is reduced to the sequential terminal growth of the enzymatically linearized plasmid vector (in our case pQE16-BamHI / BglII) using PCR with the participation of synthetic correcting primers.

As recommended in the manuals [11], the sequences of the forward and reverse correcting primers (see Table 2.) were planned so that one of their ends was complementary to the end sections of the linearized vector, while non-complementary ends served to build the gene trib-1mut (in table 2. complementary regions to the vector are underlined).

The size of these oligonucleotides was limited because the recommended overlap area of the correcting primer and the vector should be more than 20 bp [eleven]. For this reason, the process of gene synthesis by the PIPE method was divided into two stages, at each of which a new pair of correcting overlapped primers with a vector was used.

When implementing the PIPE methodology, the sequence of actions, at each of the two stages, is confirmed by the following examples:

a) the following reagents were mixed in a 0.5 ml PCR tube:

• 1 μl (approx. 5 ng) of the BQHI and BglII (Fermentas, Lithuania) pre-linearized plasmid vector pQE16 ((QIAGEN)) obtained from the E. coli strain (dam +) to methylate recognition sites for selective DpnI restriction enzyme. The initial pQE-16 vector had the following characteristics: vector size (bp) - 3996 bp, T5 promoter / lac operator element - 7–87 bp, T5 transcription initiation site - 61 bp ., the dehydrofolate reductase gene sequence is 133–690 bp (later removed from the vector), 6xHis tag - 703–720 bp, transcription termination region Lambda t0 - 743–837 bp, ColE1 replication initiation site - 2173 bp, β-lactamase gene - 3791–2931 bp

• 0.5 μl of direct FT correction primer (50 pmol / μl) (Table 2)

• 0.5 μl of RT reverse correction primer (50 pmol / μl) (Table 2)

• 2 μl dNTP mix (2.5 mM each)

• 2.5 μl of 10x DNA polymerase buffer

• sterile water up to 24.5 μl

• 0.5 μl Pfu Ultra DNA polymerase (2.5 U / μl, Agilent)

b) amplification parameters: 95 ° ^C - 2 minutes; (95 ^{° C} - 30 seconds, 55 ^{° C} - 45 sec, 68 ^{° C} - 10 min) x25tsiklov; 10 ^о С - storage. The amplification mode is accurate.

c) PCR products were incubated for 2 hours at 37 ° C with 1 μl (10U) of DpnI restriction endonuclease (Fermentas, Lithuania) in the appropriate buffer. This stage is necessary for the destruction of the original plasmid DNA pQE16 BamHI / BglII obtained from E. coli strain (dam +), because it may complicate the implementation of subsequent steps.

table 2

Title Oligonucleotide Sequences (CJSC Eurogen) (5’-3 ’) 1st stage of assembly of trib-1mut and 1st pair of primers
FT1: AAAGAGGAGAAATTAACTATGAGAGGATCC GGTACCGGACCAGGTCCTGGACCAGAAGATGGTGGTA
RT1: AGCTTAGTGATGGTGATGGTGATGAGATCT AGGACCTGGTCCTGGTCCACCACCACCAAAGCCATTG

2nd stage of assembly of trib-1mut and 2nd pair of primers

FT2: GACCAGGTCCTGGACCAGAAGATGGTGGTAAACCGTCCTCCACCTATGGCCCGCCGGGCAAAGGCGG
RT2: GGTCCTGGTCCACCACCACCAAAGCCATTG CCGCCTTTTGCCCGGCGGGCCATAGGTGGAGGACGGTT

d) 5 - 10 μl of this mixture was used later for the transformation of chemically or electrocompetent E. coli cells (M15, DH5a) in accordance with standard transformation protocols [12]. After the transformation procedure and the preliminary incubation stage, 20-100 μl of the transformed cells were transferred to LB agar with the antibiotic ampicillin for subsequent selection of transformants.

e) Plasmid DNA was isolated by SDS alkaline lysis [13], verified by restriction analysis and sequencing using an automatic sequencer.

Thus, an intermediate vector construct pGDTrib1mut (see SEQ ID NO: 1) was obtained containing a mutant nucleotide sequence trib-1mut homologous to the minimal elastomeric motif of the known sequence of the resilin gene T. castaneum.

1.2.2. Obtaining and cloning of the gene trib-2mut.

The trib-2mut gene (SEQ ID NO: 4; Scheme 0001) was assembled through a 2-step ligation based on a complex of genetic engineering techniques called fusion technology.

At the first stage, the molecules of the first intermediate vector pGDTrib1mut were processed by the BamHI / PvuI and BglII / PvuI restriction endonuclease systems (two microtubes corresponded to the two systems: No. 1 and No. 2). After 1.5 hours exposure in an oven at ³⁷ ° C, and the contents were №1 №2 applied to tracks №1 and №2 previously prepared 1% agarose gel, with, as a marker of molecular weights track №3, applied Lambda phage DNA hydrolyzed at EcoRI / HindIII restriction sites. After completion of the electrophoresis procedure, fragments of plasmid pGDTrib1mut, necessary for further ligation, were excised from the agarose gel. A 2795 bp BamHI / PvuI fragment was excised from the corresponding region of track No. 1, while a 860 bp BglII / PvuI fragment was extracted from track No. 2.

After standard procedures the cleaning isolated fragments with a set of reagents for extracting DNA from the agarose gel GeneJET ™ (Fermentas, Lithuania), the association of homologous "sticky" ends of the fragments was carried out by DNA ligase of phage T4 (SibEnzyme, Russia) at ⁴ ° C in the appropriate buffer . After 24 hours, E. coli DH5a (Qiagen) cells [fhuA2 lac (del) U169 phoA glnV44 Φ80 'lacZ (del) M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17] were transformed with a ligase mixture, which were then selected on LB agar medium antibiotics (ampicillin, nalidixic acid). Selected clones were expanded in preparative amounts, after which the target plasmid DNA was isolated by SDS alkaline lysis [13], validated by restriction analysis and sequencing using an automatic sequencer. The resulting plasmid pGDTrib1mut-2 (SEQ ID NO: 2) size 3655 bp was the primary derivative of the intermediate vector pGDTrib1mut and contained two combined trib1mut sequences.

At the 2nd stage, the restriction and ligation of fragments manipulations completely coincided with the actions carried out at the 1st stage, only with the difference that they were carried out already with two molecules of the vector pGDTrib1mut-2.

The resulting ligase mixture was also transformed with E. coli DH5a cells (Qiagen), which were then selected on LB agar medium with the necessary antibiotics. After the standard isolation procedure [13], the primary structure of the obtained plasmid DNA was identified by restriction analysis and sequencing. Thus, as a result of optimization of genetic engineering constructs, the final expression plasmid pGDTrib2mut (SEQ ID NO: 3; Scheme 0002) was obtained, having 3889 base pairs (bp) and characterized by the presence of the BglII / BamHI fragment of plasmid pQE16 (QIAGEN) and synthetic a 480 bp DNA fragment containing the trib-2mut chimeric gene (SEQ ID NO: 4; Scheme 0001) represented by four sequentially (head to tail) combined sequences of the trib-1mut minimal elastomeric motif with six histidine residues (His tag) at the C-end, which is designed to increase the efficiency the activity of isolating a recombinant protein on an affinity metal-containing sorbent.

1.3. Obtaining E. coli strain M15 / pGDTrib2mut and expression of the gene trib-2mut in E. coli cells

The cell culture of E. coli M15 (Qiagen) [F-, Φ80ΔlacM15, thi, lac-, mtl-, recA +, KmR] was transformed with the plasmid constructs pGDTrib2mut created in the previous step. Grown on an agar medium, after a chemical transformation procedure, individual colonies were isolated and inoculated in 100 ml of TB medium (1.2% bactotryptone, 2.4% yeast extract, 4% glycerin, 17 mM KH ₂ PO ₄ , 72 mM K ₂ NRA ₄ ) containing antibiotics ampicillin (50 μg / ml) and kanamycin (25 μg / ml), after which it was grown at a temperature of 37 ° C with constant shaking until the culture reached an optical density of OD ₆₀₀ = 1 - 1.2. Gene expression of the target protein was induced by the addition of isopropyl-bD-thiogalactoside (IPTG) to a final concentration of 0.2 mM. The cultures were incubated for up to 17 hours at 32-35 ° C and shaking continuously, centrifuged at 6000g for 30 minutes, the pellets were frozen at -75 ° C. The presence of the target protein was confirmed by electrophoresis on VE-20 vertical electrophoresis equipment (Helikon, Russia ), in a 12-17% polyacrylamide gel according to the standard Laemmli method [14].

The level of protein synthesis in E. coli was determined by comparing the staining intensity of the recombinant protein band with the band of the corresponding protein standard Unstained Protein Molecular Weight Marker (BioRad, USA). When comparing the spectrum of proteins in the mother strain of E. coli M15 [pREP4] and the recombinant strain of E. coli M15 [pREP4, pGDTrib2mut] (or E. coli M15 / pGDTrib2mut), the appearance of an additional protein band, the molecular weight of which is 14.5 - 15, 0 kDa was consistent with that calculated for the Trib-2mut protein.

2. Isolation of the recombinant protein Trib-2mut

The presence of His-tag at the C-terminus of the recombinant protein Trib-2mut simplifies the procedure for purification of the recombinant protein because the polyhistidine spacer specifically binds to Ni-NTA agarose. The precipitate of the induced biomass of E. coli bacteria is resuspended in 30 ml of column application buffer (15 mM Tris-HCl, pH 7.8, 10 mM imidazole) and destroyed by ultrasound at 0 - + 4 ° C. The lysate was clarified by centrifugation at 14,000 rpm for 20 minutes. The supernatant contained a soluble recombinant protein. The supernatant was additionally filtered through a 0.45 μm filter (Corning, USA), and then transferred to a 10 ml column (BioRad, USA) with Ni-NTA agarose (Invitrogen, USA), which was pre-equilibrated with application buffer. The clarified and filtered bacterial lysate is incubated with Ni-NTA agarose for 40 min at + 4 ° C. Then, the column is washed with 100 ml of a solution of the following composition: 12 mM Tris-HCl pH 7.8, 20 mM imidazole. Protein elution is carried out with 10 ml of buffer: 12 mm Tris-HCl, pH 7.8, 250 mm imidazole. The protein is dialyzed against 1 × PBS (1.7 mM KH2PO4, 5.2 mM Na2HPO4, 150 mM NaCl, pH 7.4) and concentrated to 5-10 mg / ml. The molecular weight and purity of the target protein, estimated by electrophoresis in 12-17% polyacrylamide gel (PAG), were about 15 kDa and more than 95%, respectively. Protein electrophoresis was carried out under denaturing conditions (in the presence of SDS) according to the standard Laemmli method [14]. We used 5% concentrating and 17% resolving PAGE on Tris-buffer (130 mM Tris-HCl, pH 6.8, for concentrating and 375 mM Tris-HCl, pH 8.8, for resolving), containing 0.1% SDS, 0.1% PSA and 0.08% TEMED. A solution served as electrode buffer: 25 mM Tris, 250 mM glycine and 0.1% SDS. Electrophoresis in a concentrating gel was carried out at a current of 15 mA (10-15 min), then in a resolving gel at 25 mA (45-50 min). The gel was stained using a Comassie Brilliant Blue R-250 dye (Fluka, USA).

3. Polymerization of Trib-2mut Protein by Glutaraldehyde

Isolated recombinant polypeptides are periodically repeating motifs that contain, in a strictly defined position, the residues of the amino acid lysine (K), between which it is possible to create chemical “crosslinking” through the formation of Schiff bases using glutaraldehyde [15, 16]. The created "bridges" are able to combine disparate polypeptide chains into an ordered finely porous structure. Glutaraldehyde treatment was carried out in amine-free buffer systems. The most applicable buffers were HEPES and phosphate buffer at pH = 7.5-8.0. To conduct a peptide crosslinking reaction per 100 μg of the target protein, 5 μg of 2.3% aldehyde in a total reaction volume of 100 μl was added. The mixture was held 5 minutes at ³⁷ S.Reaktsiya interrupted by adding to the reaction mixture of 10 ul 1M Tris-HCl, pH 8,0. As the chemical reaction in the solution is completed, light agglomerating strands of the polymerized tribolin-2 protein (Trib-2mut) are formed in the test tube.

4. Polymerization of Trib-2mut Protein by 1-Ethyl-3- (3-dimethylaminopropyl) carbodiimide

Another polymerization strategy was to activate the radical carboxyl group of the aspartic and glutamic amino acids 1-Ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC) (Fluka, Germany) for subsequent binding to the radical amine of the amino acid lysine to form an amide bond. To increase the binding efficiency, EDC was used in combination with N-hydroxysuccinimide (NHS) (Fluka, Germany) [16]. This strategy can potentially lead to the creation of large-pore biomatrix.

The procedure consisted of the following steps: for 1 ml of a sample of the studied protein with a concentration of 5-10 mg / ml dissolved in 0.1 M MES activation buffer at pH = 5.5, 1 ml of reagent containing 20 mg / ml EDC and 5 mg was added / ml NHS. The reaction time was at least 2 hours at room temperature.

At the end of two hours, the reaction was stopped by adding glycine to the reaction mixture at a final concentration of 50 mM. The end of the chemical reaction was marked by the appearance in the solution of white opalescent flakes of the polymerized protein Trib-2mut.

Thus, by genetic engineering, we obtained samples of the Trib-2mut protein, a recombinant homolog of the elastomeric domain of the resilin Tribolium castaneum, which is based on the periodically repeating minimal elastomeric motif Trib-1mut, and laboratory samples of a new polymer biomaterial based on it are also created.

BIBLIOGRAPHY

1. Volova T. G. Materials for medicine, cell and tissue engineering [Electronic resource]: electron. textbook. allowance / T. G. Volova, E. I. Shishatskaya, P. V. Mironov. - The electron. Dan. (6 Mb). - Krasnoyarsk: IPK SFU, 2009.

2. Burdick J.A., Mauck R.L. Biomaterials for Tissue Engineering Applications: A Review of the Past and Future Trends Editors: Burdick J.A., Mauck R.L. (Eds.), Published: Wien; New York: Springer, 2011, P. 564.

3. Faraj K.A., Brouwer K.M., Geutjes P.J., Versteeg E.M., Wismans R.G., Deprest J.A., Chajra H., Tiemessen D.M., Feitz W.F.J., Oosterwijk E., Daamen W.F., and van Kuppevelt T.H. The Effect of Ethylene Oxide Sterilization, Beta Irradiation and Gamma Irradiation on Collagen Fibril-Based Scaffolds. Tissue Engineering and Regenerative Medicine, 2011, 8 (5): 460-70,

4. Eyrich D., Göpferich A., Blunk T. .. Fibrin in Tissue Engineering. Tissue Engineering. Advances in Experimental Medicine and Biology, 2007, 585: 379-92,

5. Gosline J.M., Guerette P.A., Ortlepp C.S., Savage K.N. The mechanical design of spider silks: from fibroin sequence to mechanical function. J Exp Biol., 1999, 202 (23): 3295-303.

6. Wong D.C., Pearson R. D., Elvin C. M., Merritt D.J. Expression of the rubber-like protein, resilin, in developing and functional insect cuticle determined using a Drosophila anti-Rec 1 resilin antibody. Dev Dyn., 2012, 241 (2): 333-9.

7. Gosline J., Lillie M., Carrington E., Guerette P., Ortlepp C., Savage K. Elastic proteins: biological roles and mechanical properties, Philos Trans R Soc Lond B Biol Sci., 2002, 357 (1418) : 121-32.

8. Burrows M., Sutton G.P. Locusts use a composite of resilin and hard cuticle as an energy store for jumping and kicking. J. Exp. Biol., 2012, vol. 215, pp. 3501-3512.

9. Burrows M. Energy storage and synchronization of hind leg movements during jumping in planthopper insects (Hemiptera, Issidae). J. Exp. Biol., 2010, vol. 213, pp. 469–478.

10. Stevenson J, Krycer J.R., Phan L, Brown A.J. A practical comparison of ligation-independent cloning techniques. Plos. 2013; 8 (12): e83888. doi: 10.1371 / journal.pone.0083888.

11. Zhu B., Cai G, Hall E., Freeman G.J. In-fusion assembly: seamless engineering of multidomain fusion proteins, modular vectors, and mutations. Biotechniques. 2007 Sep; 43 (3): 354-9.

12. Janjua S., Younis S., Deeba F. and Naqvi S. M. S., High efficiency DNA transformation protocol for Escherichia Coli using combination of physico-chemical methods. Int. J. Agric. Biol., 2014; 16: 132-138.

13. Maniatis T., Molecular cloning: a textbook / T. Maniatis et al. - M.: Mir, 1984. - P. 450.

14. Laemmli U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970, 227 (5259): 680-5.

15. David B. McIntosh. Glutaraldehyde Cross-links Lys-492 and Arg-678 at the Active Site of Sarcoplasmic Reticulum Ca ²⁺ -ATPase. J Biol Chem, JBC, 1992, 267 (31): 22328-35.

16. Englert C, Blunk T, Müller R, von Glasser S.S., Baumer J, Fierlbeck J, Heid I.M., Nerlich M, Hammer J. Bonding of articular cartilage using a combination of biochemical degradation and surface cross-linking. Arthritis Res Ther., 2007, 9 (3): R47.

Claims (5)

1. Protein design Trib-2mut to obtain a framework material for tissue engineering, with the amino acid sequence shown in the form of SEQ ID NO: 4, which is a recombinant homolog of the elastomeric domain of resilin Tribolium castaneum, which is based on a periodically repeating minimal elastomeric motif Trib-1mut resilin T. continuum with the amino acid sequence shown as SEQ ID NO: 5. 2. The synthetic Trib-2mut gene encoding the homologue of the native elastomeric domain of resilin T. castaneum according to claim 1, with the determined nucleotide sequence of SEQ ID NO: 4. 3. Plasmid DNA pGDTrib2mut, which determines the biosynthesis of the protein Trib-2mut according to claim 1 in Escherichia coli cells and is characterized by the nucleotide sequence shown in SEQ ID NO: 3. 4. The strain Escherichia coli M15 / pGDTrib2mut is the producer of the recombinant protein construct Trib-2mut according to claim 1, obtained by transforming the cells of the mother strain of E. coli M15 plasmid DNA pGDTrib2mut according to claim 3. 5. Polymeric scaffold biomaterial for tissue engineering obtained by specific processing of the purified Trib-2mut purified recombinant protein according to claim 1 with glutaraldehyde for molecular crosslinking of the amino acid lysine or 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide for molecular crosslinking of the aspartic / glutamine amino acids.

Images