RU2569018C1 - Feed additive with phytobiotic activity on mineral basis - Google Patents

Abstract

FIELD: agriculture.

SUBSTANCE: feed additive comprises a mixture of essential oils of eucalyptus, thyme, garlic and lemon in a ratio of 1:2:1:2, respectively, applied on diatomite in the form of burnt crumbs at a ratio of 1:10 and dried to obtain a dry concentrate of mixture of essential oils in the form powder, and also the filler which is used as diatomite in the form of burnt crumbs. All the components of the feed additive are taken in certain quantities. The feed additive is added into the feed composition at a ratio of 0.001:1. The feed additive provides immunomodulating and anti-oxidant effect, has antimicrobial activity and anti-inflammatory effect.

EFFECT: feeding the feed additive provides the normalization of digestion processes.

4 tbl, 3 ex

Description

The invention relates to agricultural biotechnology, namely to a feed additive with phytobiotic activity on a mineral basis, and can be used in the preparation of feed for farm animals and poultry.

Known organic-mineral feed additive containing a filler and a siliceous material, the additive of which contains diatomite from the Inza deposit of the Ulyanovsk region with a silica content of 81.30-85.60% or flask of the Dubinsky deposit of the Ulyanovsk region with a silica content of 84.10-89.62%, having high porosity and hygroscopicity with the possibility of accumulating physiologically active substances from the filler, RU No. 2199883 C1, A23K 1/16, A23K 1/175, 03/10/2003.

Known feed additive for cattle, including vegetable and grain components and a mineral additive in the form of blue clay, which is a natural sorbent and a cheap source of vital macro- and microelements and has high adsorption and ion exchange properties, RU No. 2238659 C2, A23K 1/16 A23K 1/175, 10.27.2004.

Known feed additive for animals and birds, including natural zeolite, RU No. 2484640 C1, A23K 1/00, 06/20/2013; RU No. 2467591 C1, A23K 1/16, A23K 1/00, 11.27.2012; RU No. 2448472 C2, A23K 1/175, 04/27/2012; RU No. 2390254 C1, A23K 1/00, A23K 1/16, A23K 1/175, 05/27/2010; RU No. 2385623 C2, A23K 1/16, A23K 1/175, 04/10/2010; RU No. 2374896 C1, A23K 1/00, A23K 1/175, 12/10/2009; RU No. 2262863 C2, A23K 1/16, A23K 1/175, 10.27.2005.

Known feed additive to stimulate the growth of pigs containing filler and antibiotics, while as a filler it contains the adsorbent "Bazhedin", RU No. 2386343 C2, A23K 1/00, A23K 1/17, A23K 1/175, 04/20/2010.

Known medicinal feed additive from peat of the Bastyanovsky peat enterprise of the Sverdlovsk region with the addition of an alkaline component, RU No. 2475038 C2, A23K 1/00, 02/20/2013.

Known feed additive for pigs, which is a natural mineral of the Vodinsky deposit of the Krasnoyarsk district of the Samara region, containing 47.37% sulfur and 21.4% calcium, RU No. 2480025 C2, A23K 1/175, 04/27/2013.

Known feed additive for young cattle, including bentonite Donguz deposits, sunflower fuz and inorganic sodium selenite, and as a filler - wheat bran, RU No. 2497382 C2, A23K 1/16, A23K 1/175, 10.11.2013.

Known active coal feed additive to increase the productivity of laying hens, including a sorbent, which is used activated carbon obtained from softwood, having a particle size of from 0.1 to 2 mm, in an amount of 400 g per 1 ton of feed, RU No. 2505069 C1, A23K 1/00, 01/27/2014.

Known feed additives contain siliceous natural material, or mineral additives in the form of clay or peat, or sorbent fillers in the form of activated carbon or natural zeolite (the most common), which require special treatment for each particular use.

Known feed additive for poultry containing biologically active substances, which are used as an extract from plants: ginseng, nettle and other similar plants that contribute to the restoration of the reproductive function of the organism of farm birds, RU No. 2202223 C2, A23K 1/16, A23K 1 / 175, 04/20/2003.

Known feed additive containing a biologically active substance - extracts of coniferous herbs, RU No. 2304397 C1, A23K 1/00, A23K 1/12, A23K 1/14, A23K 1/16, 08/20/2007.

Known feed additive for poultry and animals, containing sorbent and plant stimulant, including oregano, St. John's wort, coltsfoot, plantain, tansy, celandine, sweet clover, wormwood, yarrow, chamomile, pharmacy, nettle, RU, 2355187 C1 , A23K 1/14, A23K 1/16, 05.20.2009.

Known means for the prevention of colibacteriosis of birds, containing a biologically active substance, including plant extracts from the leaves of buckthorn buckthorn (Hippophae rhamnoides L.), and / or the extract of the herb Macleaya cordate (Macleaya cordata Will L.) or small fruity (M. microcarpas), and / or the extract of milk thistle (Silybum marianum (L.) Gaertn), and / or the extract of the roots and grass of Echinacea purpurea (Echinacea purpurea L.), RU No. 2355410 C2, A61K 36/00, 05.20.2009.

Known means for preventing the development and treatment of inflammatory processes in animals, characterized by the fact that it is a mixture of medicinal plants: dry stems, leaves, peppermint flowers, dry chamomile flowers, dry plantain leaves of large, dry flower baskets of tansy, dry stems, leaves, flowers, fruits of melilotus officinalis, dry grass of St. John's wort perforated, dry flowers of medicinal marigolds (calendula), dry grass of yarrow, dry grass of thyme, dry stems, leaves, color s, the fruits of large celandine, dry leaves of eucalyptus, dry leaves and flower baskets of coltsfoot, dry leaves of medicinal sage, dry leaves of nettle, dry grass of highlander, dry flowers of corolla of mullein (scepter), chopped fruits of anise and scepter brown, crushed kernels of walnut fruit, seedless flesh of sea buckthorn fruit, RU No. 2395290 C1, АКК 36/00, 07/27/2010.

Known drug for increasing the viability of chickens, which is a water-ammonia extract from a mixture of plant components, containing birch buds, immortelle flowers, calendula petals, umbelliferous grass, dioecious nettle, St. John's wort, small-leaved linden flowers, coltsfoot leaves, coltsfoot leaves, officinalis, large plantain, heartwort, pine buds, fennel fruits, thyme ordinary, three-part series, cinnamon and kelp, prickly root eleutherococcus, rasto murmur, tansy flowers, corn stigmas and coriander fruits, RU No. 2428998 C1, A61K 36/00, 09/20/2011.

Known phytomineral composition for increasing the immunity of birds in industrial poultry, consisting of a solution of sea salt, to which are added dried and crushed immortelle, calendula, nettle, buds of birch, pine buds, yarrow, sea kale, RU No. 2462257 C1, A61K 36/00, 09/27/2012.

Known silicon-containing feed additive, including vegetable raw materials containing rice husk, RU No. 2473244 C1, A23K 1/14, 01/27/2013.

Known feed additive for farm animals and poultry based on plant materials obtained after industrial processing of cereal crops, RU No. 2491832 C2, A23K 1/14, A23K 1/16, 09/10/2013.

The use of plant materials in known feed additives is very diverse and requires individual selection of its introduction into the composition of the feed additive for therapeutic and prophylactic purposes.

A known method of producing a biological product with probiotic properties for feeding farm animals and poultry, containing in its composition a mixture of essential oils of garlic, eucalyptus, rosemary and thyme, RU No. 2458527 C1, A23K 1/165, 08/20/2012.

A known method of obtaining a biological product with probiotic properties involves obtaining a uterine culture by breeding bacteria for resistance to a mixture of essential oils of garlic, eucalyptus, rosemary, thyme, for which bacteria are seeded on agar media containing a mixture of essential oils of these plants, and seeded in a nutrient medium consisting of from sunflower (soybean) meal and 98-93% tap water, cultivated and mixed with wheat bran, followed by applying a mixture of essential oils of garlic, eucalyptus, rosem Rina, thyme.

In the known method, the use of a mixture of essential oils of garlic, eucalyptus, rosemary, thyme is close in direction and composition to the claimed feed additive, but they are used to obtain a biological product with probiotic properties.

Known feed additive to increase the resistance and productivity of farm animals and poultry, containing essential oil of vegetable raw materials and filler, RU No. 2297775 C1, A23K 1/16, A23K 1/14, 04/27/2007.

This technical solution is made as the closest analogue of the present invention.

The feed additive of the closest analogue has a simple composition and consists of oregano essential oil, an organic solvent (1.2 propanediol) and distilled water. In an organic solvent, the molecules of oregano essential oil are evenly distributed and contribute to the uniform distribution of oregano oil in the volume of water and in the body of animals and birds.

Oregano essential oil improves appetite, activates enzymes, fights a large number of pathogens, its use as part of a feed additive is due to improved appetite and activation of enzymes.

However, in the closest analogue, the use of essential oils of other plant materials and a carrier on a mineral basis for producing feed additives is not provided for in the closest analogue.

The present invention is based on the solution of the problem, allowing to identify a new feed additive with high phytobiotic activity on a mineral basis for use in feed for farm animals and poultry.

The technical result of the present invention is to provide immunomodulating and antioxidant effects, antimicrobial activity and anti-inflammatory effect by introducing a mixture of essential oils of eucalyptus, thyme, garlic and lemon and to normalize digestion by using diatomite as a carrier in the form of burnt chips when interacting with dry concentrate of a mixture of essential oils of eucalyptus, thyme, garlic and lemon in the form of a powder in the composition of the feed additive.

According to the invention, this problem is solved due to the fact that a feed additive with phytobiotic activity on a mineral basis is used as a feed for farm animals and poultry.

The feed additive contains a mixture of essential oils of eucalyptus, thyme, garlic and lemon in a ratio of 1: 2: 1: 2, respectively, applied to diatomite in the form of burnt chips at a ratio of 1:10 and dried to obtain a dry concentrate of a mixture of essential oils in the form of a powder.

The feed additive contains a filler, which is used diatomite in the form of burnt chips.

The components of the feed additive are taken in the following quantities, g:

dry concentrate of a mixture of essential oils of eucalyptus, thyme, garlic and lemon in the form of a powder - 40-180; filler - 960-820, the feed additive in the composition of the feed was taken at a ratio of 0.001: 1.

The applicant has not identified sources containing information about technical solutions identical to the present invention, which allows us to conclude that it meets the criterion of "novelty."

Due to the implementation of the distinguishing features of the invention (together with the features indicated in the restrictive part of the formula), important new properties of the object are achieved.

The identification of a mixture of essential oils of eucalyptus, thyme, garlic and lemon, which have an immunomodulatory effect, and the use of a dry concentrate of this mixture in the form of powder with diatomite in the form of burnt chips allows you to get a new feed additive with high phytobiotic activity.

The applicant is not aware of any publications that would contain information on the influence of the distinguishing features of the invention on the achieved technical result. In this regard, according to the applicant, it can be concluded that the claimed technical solution meets the criterion of "inventive step".

The present invention is carried out as follows.

A feed additive with phytobiotic activity is used as feed for farm animals and poultry.

In the feed additive, diatomite from the Inza deposit of the Ulyanovsk region was used as a filler.

Diatomite - sedimentary rock, loose or weakly cemented, consisting of the remains of diatoms and having a gray or yellow color of weak tones.

Chemically, diatomite is more than 80% composed of aqueous silica.

Diatomite in the form of burnt chips is supplied by the Diatom Plant, Inza, Ulyanovsk Region.

In the feed additive, diatomite was used in the form of burnt chips of fractions of 0.3-0.7 mm with a moisture content of not more than 9%.

The feed supplement contains a mixture of essential oils of eucalyptus, thyme, garlic and lemon.

Eucalyptus oil has anti-inflammatory, antiseptic, anti-infectious properties. Strengthening the immune system, eucalyptus essential oil actively fights against viral infections and inflammatory processes. Beneficially, eucalyptus oil also affects the functioning of the gastrointestinal tract.

Thyme essential oil enhances immunity, has anti-inflammatory properties, normalizes the fermentation of the stomach, is an antiseptic.

Garlic oil has a powerful antiseptic effect, as well as antimicrobial, antitoxic, antiviral, bactericidal and tonic. The antiseptic, bactericidal and antitoxic properties of garlic make it a valuable tool in the fight against infection.

Lemon oil has a pronounced antiviral activity, helps fight infections and strengthens the immune system. The main properties possessed by lemon oil: antiseptic, bactericidal, disinfectant and immunostimulating.

A mixture of essential oils of eucalyptus, thyme, garlic and lemon was taken at a ratio of 1: 2: 1: 2, respectively.

Thyme and lemon essential oils were taken in doubled amounts to increase the antiseptic properties of the feed additive, which was confirmed by experimental studies.

A dry concentrate in the form of a powder is prepared from a mixture of essential oils of eucalyptus, thyme, garlic and lemon.

Preparation of a dry concentrate of a mixture of essential oils

A mixture of essential oils of eucalyptus, thyme, garlic and lemon is applied to diatomite in the form of burnt chips, placed in a mixer SM-150, at a ratio of 1:10. The wet preparation is laid out on trays.

Drying of the drug is carried out in drying cabinets RT-ShS. Trays with the drug spread on them are imported into the cabinets.

Drying of the drug is carried out by air-thermal method at a temperature of from 55 ° C to 60 ° C for 9 hours to a final moisture content of 7.0-7.2%.

After drying, the drug is sent for grinding to a feed mill DKR-3. The drug is ground to a powder.

Preparation of feed additives

A dry concentrate of a mixture of essential oils of eucalyptus, thyme, garlic and lemon in the form of a powder in the amount of 40 g is mixed with diatomite in the form of burnt chips in the amount of 960 g in a CM-150 mixer.

A dry concentrate of a mixture of essential oils of eucalyptus, thyme, garlic and lemon in the form of a powder in the amount of 180 g is mixed with diatomite in the form of burnt chips in the amount of 820 g in a CM-150 mixer.

The amount of a mixture of essential oils in the range of 40-180 g and diatomite in the range of 960-820 g is optimal and determined experimentally when conducting studies at the stage of preparation of the feed additive.

The feed additive in the feed is taken at a ratio of 0.001: 1.

The amount of feed additive in the feed is balanced and experimentally confirmed.

Studies on the use of feed additives in the proposed ratios are presented in examples 1-3.

Example 1

The use of feed additives with phytobiotic activity in poultry farming

The experiment was carried out on the basis of the FSUE Zagorsk EPH VNITIP of the Russian Agricultural Academy on broilers of the Cobb Avian-48 cross.

Broiler chickens were raised in a P-15 type cell battery.

2 groups of broiler chickens were formed with 35 goals each.

The first and second groups of broiler chickens received loose feeds ad libitum.

The first control group received the main ration (RR) of feed.

The second experimental group received the main diet (RR) of feed with a feed additive with phytobiotic activity (1000 g / t).

The nutritional value of compound feeds corresponded to the recommended norms for cross-country, the structure of compound feeds included sunflower meal (12.5% by weight of compound feeds) and wheat bran (5% by weight of compound feeds) during the growth and finishing periods of cultivation.

The main zootechnical indicators of experience on broiler chickens when using a feed additive with phytobiotic activity are presented in table 1.

From table 1 it is seen that the effectiveness of introducing a feed additive with phytobiotic activity in the OR in experimental group 2 is obvious: the average daily gain in live weight is 1.9% higher compared to control group 1, and the feed cost in experimental group 2 is lower by 1.6 %

The results of the balance experiment are presented in table 2 (Digestibility and use of food nutrients in broiler chickens when using feed additives with phytobiotic activity).

The results of the balance experiment confirmed the effectiveness of the feed additive with phytobiotic activity when broiler chickens are included in the feed.

Example 2

The use of feed additives with phytobiotic activity in pig farming.

The experiment was carried out at the pig farm OJSC PZ "Flame" of the Leningrad region. The duration of the experiment was 60 days.

2 groups of weaned piglets of 50 animals each were formed.

The first control group received the main ration (RR) of feed.

The second experimental group received the main diet (RR) of feed with a feed additive with phytobiotic activity.

Compound feed was prepared at the Gatchinsky feed mill, at the rate of 120 g of feed additive with phytobiotic activity per 1 ton of feed.

The results of the studies are shown in table 3 (Zootechnical indicators of the cultivation of weaned piglets when using feed additives with phytobiotic activity).

The use of a feed additive with phytobiotic activity contributed to increasing immunity in animals, normalizing digestion processes, increasing digestibility and assimilation of nutrients in the diet, which positively affected the growth and development of weaned piglets.

From table 3 it is seen that in the 2nd experimental group, the average daily gain in weaned piglets was 4.7% higher, and the feed cost per 1 kg lower by 0.28 units.

A feed supplement with phytobiotic activity in the feed stabilizes the microflora, prevents the infection from entering the gastrointestinal tract, helps the animal survive the stresses caused by feeding and cardiovascular diseases.

A feed additive with phytobiotic activity in the feed composition has a beneficial effect on the reproductive function of sows, increases the immunity and survival of weaned pigs.

Example 3

The use of feed additives with phytobiotic activity in the composition of cattle feed

The experiment was conducted at CJSC PLEMZAVOD BOLSHEVIK in the Leningrad Region. The duration of the experiment was 92 days.

2 groups of dairy cows of black-motley breed of the second and third lactation were formed. Animals were in tethered keeping.

The first control group received the main ration (RR) of feed.

The second experimental group received the main diet (OR) with a feed additive with phytobiotic activity.

The main diet contained: feed - 7 kg, silage - 30 kg, hay - 1.5 kg, beer pellet - 5 kg, sunflower meal - 1.2 kg, molasses - 0.2-1.0 kg.

A feed additive with phytobiotic activity was introduced into the OR at the rate of 100 g per 1 ton of feed.

The results of the studies are shown in table 4 (Cow productivity and milk quality of dairy cows of black-motley breed when using a feed additive with phytobiotic activity).

From table 4 it is seen that over the period of the experiment, the number of somatic cells in the milk of cows in the 2nd experimental group decreased by 20% compared with animals in the 1st control group. The average daily milk yield of milk of natural fat content in the 2nd experimental group was 3.0 kg higher. The fat content in milk in animals in the 2nd experimental group was 0.19% higher, which made it possible to additionally obtain 4.1 kg of milk of 4% fat per 1 head per day.

The resulting difference in the amount of milk fat and protein in cows in the 2nd experimental group (96.2 kg and 79.46 kg, respectively) compared with animals in the 1st control group (81.1 kg and 67.82 kg, respectively) may be due to a change focus of interchange. A comparable analysis between the groups shows that a higher indicator of milk fat in animals in the 2nd experimental group was obtained both due to an increase in milk yield and an increase in the percentage of fat and protein in milk.

A feed supplement with phytobiotic activity as part of a feed for cattle helps normalize cicatricial digestion, improves the synthesis of volatile fatty acids. In lactating cows, a feed supplement with phytobiotic activity reduces the content of somatic cells in milk, increases milk productivity and improves milk quality. The use of a feed additive with phytobiotic activity for the prevention of mastitis allows you to get marketable milk.

A mixture of essential oils in a feed supplement with phytobiotic activity has antimicrobial activity, antioxidant effect and anti-inflammatory effect.

The results obtained on the basis of Examples 1-3 confirm the feasibility of using a new feed additive with phytobiotic activity.

Phytobiotic activity - stimulation of beneficial intestinal microflora and suppression of opportunistic microflora.

The phytobiotic activity of the feed additive was determined using the molecular genetic method based on the T-RFLP analysis.

DNA was extracted from the intestine using a commercial DNA Purification Kit (Fermentas, Lithuania).

PCR amplification of the bacteria 16S rRNA genes was performed using primers: 63F (CAGGCCTAACACATGCAAGTC) - labeled at the 5′-end (fluorophore D4 - WellRed); 1492R (TACGGHTACCTTGTTACGACTT).

The amplified fragment was isolated from agarose gel using a 3 M solution of guanidine thiocyanate.

Amplicon restriction was performed using restriction enzymes NaeIII, HhaI and MspI (Fermentas) for 2 hours at 37 ° C. After the restriction was complete, DNA from the reaction mixture was precipitated with ethanol, dissolved in SLS (Beckman Coulter), followed by the addition of a molecular weight marker of 600 bp. (Beckman Coulter). The next step in the analysis was fluorescence detection of the target DNA on a CEQ8000 automated sequencer (Beckman Coulter).

Peak sizes and their areas were calculated using the Fragment Analysis (Beckman Coulter) software unit. To identify peaks, T-RFLP grams for three endonucleases (NaeIII, HhaI, and MspI) were processed using the Fragment Sorter program (http://www.oardc.ohio-state.edu/trflpfragsort/index.php).

The proposed feed additive with phytobiotic activity was obtained according to well-known biotechnologies that are widely used in agriculture, and experimental work was carried out on the basis of the FSUE Zagorsk EPH VNITIP of the Russian Agricultural Academy, at the pig farm PZ Flame of the Leningrad Region and CJSC PLEMZAVOD BOLSHENEVLIK of the Bolsheradivik region according to the applicant, its compliance with the criterion of "industrial applicability".

The proposed feed additive with phytobiotic activity allows you to:

- increase immunity in farm animals and poultry;

- normalize digestion processes;

- increase the digestibility of feed nutrients.

Claims (1)

A feed supplement with mineral-based phytobiotic activity, used in feed for farm animals and poultry, characterized in that it contains a mixture of essential oils of eucalyptus, thyme, garlic and lemon at a ratio of 1: 2: 1: 2, respectively, applied to diatomaceous earth in the form of burnt chips at a ratio of 1:10 and dried to obtain a dry concentrate of a mixture of essential oils in the form of a powder, as well as a filler, which is used diatomite in the form of burnt chips, while the feed components additives are taken in the following amounts, g:
dry concentrate of a mixture of essential oils of eucalyptus, thyme, garlic and lemon in the form of a powder - 40-180; the filler is 960-820, and the feed additive in the feed was taken at a ratio of 0.001: 1.