RU2456606C1 - Method for prediction of renal survival in patients suffering chronic glomerulonephritis - Google Patents
Method for prediction of renal survival in patients suffering chronic glomerulonephritis Download PDFInfo
- Publication number
- RU2456606C1 RU2456606C1 RU2011112704/15A RU2011112704A RU2456606C1 RU 2456606 C1 RU2456606 C1 RU 2456606C1 RU 2011112704/15 A RU2011112704/15 A RU 2011112704/15A RU 2011112704 A RU2011112704 A RU 2011112704A RU 2456606 C1 RU2456606 C1 RU 2456606C1
- Authority
- RU
- Russia
- Prior art keywords
- chronic glomerulonephritis
- patients
- pon2
- renal
- survival
- Prior art date
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к области медицинской диагностики, может быть использовано для прогнозирования почечной выживаемости у больных хроническим гломерулонефритом.The invention relates to the field of medical diagnosis, can be used to predict renal survival in patients with chronic glomerulonephritis.
Среди болезней почек хронический гломерулонефрит (ХГН) является одним из самых серьезных заболеваний по своей медицинской и социальной значимости, из-за высокой распространенности и прогрессирующего течения, приводящего к развитию хронической почечной недостаточности, требующей проведения программного гемодиализа или трансплантации почки [1, 2, 3]. Хронический гломерулонефрит занимает доминирующее место в группе хронических болезней почек и составляет более 35% [4]. Следует отметить также увеличение числа пациентов, получающих заместительную почечную терапию, что требует дополнительных экономических расходов на ее проведение [5, 6, 7].Among kidney diseases, chronic glomerulonephritis (CGN) is one of the most serious diseases in its medical and social significance, due to the high prevalence and progressive course leading to the development of chronic renal failure, requiring programmed hemodialysis or kidney transplantation [1, 2, 3 ]. Chronic glomerulonephritis occupies a dominant place in the group of chronic kidney diseases and makes up more than 35% [4]. It should also be noted the increase in the number of patients receiving renal replacement therapy, which requires additional economic costs for its implementation [5, 6, 7].
Как свидетельствуют данные литературы, важное значение в развитии и прогрессировании ХГН отводится системе антиоксидантной защиты [8, 9], среди компонентов которой интерес вызывает гормон параоксоназы-2.According to the literature, an important role in the development and progression of CGN is given to the antioxidant defense system [8, 9], among which the hormone paraoxonase-2 is of interest.
Уменьшение продукции данного фермента способствует снижению резервов антиоксидантной защиты, прогрессированию гломерулосклероза, а также снижению почечной функции [9].A decrease in the production of this enzyme helps to reduce the reserves of antioxidant protection, the progression of glomerulosclerosis, and also reduce renal function [9].
Изучению генетических основ хронического гломерулонефрита посвящен ряд работ [10, 11, 12]. В России такие исследования затрагивают лишь узкий набор локусов: интегральных мембранных белков [13], факторов некроза опухоли [14], интерлейкинов [15, 16]. Следует отметить, что результаты исследований разных авторов не дают однозначного ответа о патогенетической роли отдельных полиморфизмов генов системы антиоксидантной защиты при хроническом гломерулонефрите. Это диктует необходимость проведения дальнейших исследований в данной области.The genetic basis of chronic glomerulonephritis has been studied in a number of works [10, 11, 12]. In Russia, such studies affect only a narrow set of loci: integral membrane proteins [13], tumor necrosis factors [14], interleukins [15, 16]. It should be noted that the results of studies by various authors do not give an unambiguous answer about the pathogenetic role of individual polymorphisms of the antioxidant defense system genes in chronic glomerulonephritis. This necessitates further research in this area.
Наиболее близким аналогом по своим признакам, принятым за прототип, является «Способ оценки почечной выживаемости у больных хроническим гломерулонефритом на основе данных о полиморфизме генов интерлейкинов» по заявке на патент РФ №2009101480, опубликованной 27.07.2010 г. Способ оценки почечной выживаемости у больных хроническим гломерулонефритом, включающий выделение ДНК из периферической венозной крови, выявление аллелей и генотипов генов интерлейкинов, отличающийся тем, что делают вывод о снижении почечной выживаемости у больных хроническим гломерулонефритом в следующих случаях: выявлении носительства аллеля - 889С гена интерлейкина 1А - 889С/Т IL-1A или аллеля - 592А гена интерлейкина 10-592С/А IL-10 или выявлении носительства аллеля - 511 Т гена интерлейкина 1В - 511 С/Т IL-1B в сочетании с нефротическим синдромом на момент первого обследования и наличия артериальной гипертензии в течение ХГН, или выявления генотипа 4R/4R гена антагониста рецептора интерлейкина 1 VNTR IL-1Ra.The closest analogue in its characteristics adopted for the prototype is “A method for assessing renal survival in patients with chronic glomerulonephritis based on data on polymorphism of interleukin genes” according to patent application RF No. 2009101480, published July 27, 2010. A method for assessing renal survival in patients with chronic glomerulonephritis, including the isolation of DNA from peripheral venous blood, the identification of alleles and genotypes of interleukin genes, characterized in that they conclude that there is a decrease in renal survival in patients with chronic m glomerulonephritis in the following cases: the identification of an allele carrier - 889C of the interleukin 1A gene - 889C / T IL-1A or the 592A allele of the interleukin gene 10-592C / A IL-10 or the detection of the allele carrier - 511 T of the interleukin 1B gene - 511 C / T IL-1B in combination with nephrotic syndrome at the time of the first examination and the presence of arterial hypertension during CGN, or the identification of the 4N / 4R genotype of the interleukin 1 VNTR IL-1Ra receptor antagonist gene.
Недостатком данного способа является использование для прогнозирования почечной выживаемости у больных хроническим гломерулонефритом лишь данных о полиморфизме генов интерлейкинов (трех генов интерлейкинов IL-1A, IL-1B, IL-1Ra).The disadvantage of this method is the use to predict renal survival in patients with chronic glomerulonephritis only data on the polymorphism of the interleukin genes (three interleukin genes IL-1A, IL-1B, IL-1Ra).
Задачей настоящего исследования является разработка способа прогнозирования почечной выживаемости у больных хроническим гломерулонефритом на основе данных о полиморфизме гена параоксоназы-2 (S311C PON2).The objective of this study is to develop a method for predicting renal survival in patients with chronic glomerulonephritis based on data on the polymorphism of the paraoxonase-2 gene (S311C PON2).
Технический результат использования изобретения - получение критериев прогноза характера течения хронического гломерулонефрита, позволяющих в кратчайшие сроки определить клинический прогноз и стратегию терапии данного заболевания.The technical result of using the invention is to obtain criteria for predicting the nature of the course of chronic glomerulonephritis, which allows to determine the clinical prognosis and treatment strategy for this disease in the shortest possible time.
Поставленная задача решается предлагаемым способом прогнозирования почечной выживаемости у больных хроническим гломерулонефритом, включающим выделение ДНК из периферической венозной крови, выявление генотипов и аллелей гена параоксоназы-2 (S311 С PON2) и прогнозирование снижения почечной выживаемости у больных хроническим гломерулонефритом при выявлении аллеля 311S PON2.The problem is solved by the proposed method for predicting renal survival in patients with chronic glomerulonephritis, including the extraction of DNA from peripheral venous blood, the identification of genotypes and alleles of the paraoxonase-2 gene (S311 C PON2) and the prediction of a decrease in renal survival in patients with chronic glomerulonephritis in the detection of P allele1.
Новизна и изобретательский уровень заключаются в том, что из уровня техники не известна возможность определения особенностей течения хронического гломерулонефрита по наличию аллелей гена параоксоназы-2 (S311 C PON2).The novelty and inventive step consists in the fact that the possibility of determining the characteristics of the course of chronic glomerulonephritis by the presence of alleles of the paraoxonase-2 gene (S311 C PON2) is not known from the prior art.
Способ осуществлялся следующим образом.The method was carried out as follows.
Материалом для исследования послужила венозная кровь в объеме 8-9 мл, взятая из локтевой вены пробанда. Забор венозной крови производили в пробирки с консервантом, содержащим 0,5М раствор ЭДТА (рН=8.0), тщательно перемешивали и хранили при температуре 4°С не более одной недели.The material for the study was venous blood in a volume of 8-9 ml, taken from the ulnar vein of proband. Venous blood was collected in test tubes with a preservative containing 0.5 M EDTA solution (pH = 8.0), thoroughly mixed and stored at 4 ° C for no more than one week.
Выделение геномной ДНК из периферической крови осуществлялось методом фенольно-хлороформной экстракции в два этапа. На первом этапе к 4 мл крови добавляли 25 мл лизирующего буфера, содержащего 320 мМ сахарозы, 1% тритон Х-100, 5 мМ MgCl2, 10 мМ трис-НСl (рН=7,6). Полученную смесь перемешивали и центрифугировали при 4°С, 4000 об./мин в течение 20 минут. После центрифугирования надосадочную жидкость сливали, к осадку добавляли 4 мл раствора, содержащего 25 мМ ЭДТА (рН=8,0) и 75 мМ NaCl, ресуспензировали. Затем прибавляли 0,4 мл 10% SDS, 35 мкл протеиназы К (10 мг/мл) и инкубировали образец при 37°С в течение 16 часов.Genomic DNA was isolated from peripheral blood by phenol-chloroform extraction in two stages. At the first stage, 25 ml of lysis buffer containing 320 mM sucrose, 1% Triton X-100, 5 mM MgCl 2 , 10 mM Tris-Hcl (pH = 7.6) was added to 4 ml of blood. The resulting mixture was stirred and centrifuged at 4 ° C, 4000 rpm./min for 20 minutes. After centrifugation, the supernatant was decanted, 4 ml of a solution containing 25 mM EDTA (pH = 8.0) and 75 mM NaCl were added to the precipitate, and resuspended. Then, 0.4 ml of 10% SDS, 35 μl of proteinase K (10 mg / ml) were added and the sample was incubated at 37 ° C for 16 hours.
На втором этапе из полученного лизата последовательно проводили экстракцию ДНК равными объемами фенола, фенол-хлороформа (1:1) и хлороформа с центрифугированием при 4000 об/мин в течение 10 минут. После каждого центрифугирования производили отбор водной фазы. ДНК осаждали из раствора двумя объемами охлажденного 96% этанола. Сформированную ДНК растворяли в бидистиллированной, деионизованной воде и хранили при -20°С. Выделенную ДНК использовали для проведения полимеразной цепной реакции синтеза ДНК.At the second stage, DNA was sequentially extracted from the obtained lysate in equal volumes of phenol, phenol-chloroform (1: 1) and chloroform with centrifugation at 4000 rpm for 10 minutes. After each centrifugation, the aqueous phase was selected. DNA was precipitated from solution in two volumes of chilled 96% ethanol. The formed DNA was dissolved in bidistilled, deionized water and stored at -20 ° C. Isolated DNA was used to carry out the polymerase chain reaction of DNA synthesis.
Анализ локуса S311 С PON2 осуществлялся методом полимеразной цепной реакции (ПНР) синтеза ДНК. ПЦР проводили на амплификаторе «Терцик-МС4» производства компании "ДНК-технология" с использованием ДНК-полимеразы Thermus aquaticus производства фирмы "Силекс-М" и олигонуклеотидных праймеров, синтезированных фирмой «Синтол»:The analysis of the S311 C PON2 locus was carried out by polymerase chain reaction (NDP) of DNA synthesis. PCR was performed on a Tertsik-MS4 thermocycler manufactured by DNA Technology using Thermus aquaticus DNA polymerase manufactured by Sileks-M and oligonucleotide primers synthesized by Syntol:
F: 5'-аса tgc atg tac ggt ggt ctt ata-3'F: 5'-asa tgc atg tac ggt ggt ctt ata-3 '
R: 5'-agc aat tca tag aaa att aat tgt ta-3'R: 5'-agc aat tca tag aaa att aat tgt ta-3 '
Реакция проводилась в 12,5 мкл общего объема смеси, содержащей 33,5 мМ трис-НСl (рН=8,8), 1,25 мМ MgCl2, 0,5 мкг геномной ДНК, по 5 пМ каждого праймера, по 100 мкМ dATP, dGTP, dCTP, dTTP и 1 единицу активной Taq-полимеразы. После денатурации (5 мин при 95°С) выполняли 35 циклов амплификации по схеме: денатурация - 1 мин при 95°С; отжиг праймеров - 1 мин при 63°С; элонгация - 1 мин при 72°С. Затем пробы выдерживали 6 мин при 72°С и охлаждали.The reaction was carried out in 12.5 μl of the total volume of the mixture containing 33.5 mm Tris-Hcl (pH = 8.8), 1.25 mm MgCl 2 , 0.5 μg of genomic DNA, 5 pM of each primer, 100 μM dATP, dGTP, dCTP, dTTP and 1 unit of active Taq polymerase. After denaturation (5 min at 95 ° C), 35 amplification cycles were performed according to the scheme: denaturation - 1 min at 95 ° C; primer annealing - 1 min at 63 ° C; elongation - 1 min at 72 ° C. Then the samples were kept for 6 min at 72 ° C and cooled.
После проведения ПЦР анализировали фрагменты длиной 265 п.н. Нуклеотидная последовательность полученного амплификата представлена ниже:After PCR, fragments of 265 bp in length were analyzed. The nucleotide sequence of the obtained amplification is presented below:
acatgcatgt acggtggtct tatattcata ctttgtatcc cctgaatagg ttctccgcat ccagaacatt ctat c^tgag a agcctacagt gactacagtt tatgccaaca atgggtctgt tctccaagga agttctgtag с c^tcag tgta tgatgggaag ctgctcatag gcactttata ccacagagcc ttgtattgtg aactctaaat tgtacttttg gcatgaaagt gcgataact taacaattaattttctatgaa ttgctacatgcatgt acggtggtct tatattcata ctttgtatcc cctgaatagg ttctccgcat ccagaacatt ctat c ^ tgag a agcctacagt gactacagtt tatgccaaca atgggtctgt tctccaagga agttctgtag with c ^ tcag tgta tgatgggaag ctgctcatag gcactttata ccacagagcc ttgtattgtg aactctaaat tgtacttttg gcatgaaagt gcgataact taacaattaattttctatgaa ttgct
При ПДРФ-анализе использовалась рестриктаза BstDEI (сайт рестрикции C↑TNAG), продукты рестрикции анализировали в 2%-ном агарозном геле, окрашенном бромистым этидием, в течение 20 мин при 200V.For the RFLP analysis, BstDEI restriction enzyme (restriction site C ↑ TNAG) was used, the restriction products were analyzed on a 2% ethidium bromide stained gel for 20 min at 200V.
Был исследован полиморфизм (S311 С PON2), связанный с заменой аминокислоты серина на цистеин в 311 кодоне полипептида. В качестве электрофорезного буфера применяли 1xTAE (трис-ацетатный буфер). Затем пробы идентифицировали в проходящем УФ-свете. Фрагменты длиной 142 и 123 п.н. соответствовали аллелю 311 C гена PON2; 123, 75 и 67 п.н. - аллелю 311S, фрагменты длиной 142, 123, 75 и 67 п.н. наблюдались у гетерозигот 311SC. На фиг.1. показано электрофоретическое разделение продуктов амплификации локуса S311 С PON2, где 1, 3, 4, 6, 8, 11 - гомозиготы 311SS; 2, 5, 7, 10, 13 - гомозиготы 311СС; 9, 12 - гетерозиготы 311SC.The polymorphism (S311 C PON2) was studied, associated with the replacement of the amino acid serine with cysteine in the 311 codon of the polypeptide. As electrophoresis buffer, 1xTAE (Tris-acetate buffer) was used. Samples were then identified in transmitted UV light. Fragments 142 and 123 bp long corresponded to the 311 C allele of the PON2 gene; 123, 75 and 67 bp - 311S allele, fragments 142, 123, 75 and 67 bp long. observed in heterozygotes 311SC. In figure 1. electrophoretic separation of amplification products of the S311 C PON2 locus is shown, where 1, 3, 4, 6, 8, 11 are 311SS homozygotes; 2, 5, 7, 10, 13 - homozygotes 311СС; 9, 12 - 311SC heterozygotes.
Формирование базы данных и статистические расчеты осуществляли с использованием программы «STATISTICA 6.0» [19]. Для оценки соответствия наблюдаемого распределения генотипов ожидаемому, исходя из равновесия Харди-Вайнберга, использовали критерий χ2, наблюдаемую гетерозиготность, ожидаемую гетерозиготность, индекс фиксации Райта. Влияние генетических и средовых факторов на почечную выживаемость изучали с помощью метода множительных оценок Каплан-Майера и монофакторного анализа с использованием регрессионной модели Кокса.Database formation and statistical calculations were performed using the STATISTICA 6.0 program [19]. To assess the compliance of the observed distribution of genotypes with the expected, based on Hardy-Weinberg equilibrium, the χ 2 criterion, the observed heterozygosity, the expected heterozygosity, and the Wright fixation index were used. The effect of genetic and environmental factors on renal survival was studied using the Kaplan-Meier Multiple Assessment Method and monofactor analysis using the Cox regression model.
Метод Каплан-Майера использовали для анализа точных интервалов до наступления исхода в каждом наблюдении. В анализ включали значения двух столбцов таблицы данных: зависимым признаком являлось время до наступления изучаемого исхода, а независимым - показатель законченности наблюдения (индикатор цензурирования) [17, 18]. Результаты получали в виде медианы времени до наступления изучаемого исхода в сопоставляемых группах (пациенты с генотипами 311SC, 311SS и 311СС PON2) и точного значения уровня значимости р.The Kaplan-Meier method was used to analyze the exact intervals before the outcome in each observation. The analysis included the values of two columns of the data table: the dependent sign was the time until the studied outcome, and the independent indicator was the completeness of the observation (censorship indicator) [17, 18]. The results were obtained as the median of the time until the onset of the outcome in the compared groups (patients with genotypes 311SC, 311SS and 311SS PON2) and the exact value of the significance level p.
С использованием метода множительных оценок Каплан-Майера [17] установлено, что почечная выживаемость больных ХГН, являющихся носителями аллеля 311S PON2 (генотипы 311SS и 311SC PON2) ниже, чем у пациентов с генотипом 311СС PON2 (р=0,05).Using the Kaplan-Meier multiplier estimation method [17], it was found that the renal survival of patients with CGN who are carriers of the 311S PON2 allele (genotypes 311SS and 311SC PON2) is lower than in patients with the 311SS PON2 genotype (p = 0.05).
Монофакторный анализ почечной выживаемости с использованием регрессионной модели Кокса выявил, что аллель 311S PON2 является независимым фактором, снижающим почечную выживаемость (р=0,01).Monofactor analysis of renal survival using the Cox regression model revealed that the 311S PON2 allele is an independent factor that reduces renal survival (p = 0.01).
В качестве конкретного примера проведен анализ результатов наблюдений 238 больных хроническим гломерулонефритом. Среди больных ХГН мужчин было 127 человек (53,4%), женщин - 111 (46,6%). Средний возраст больных составил 39,58±14,58 лет (варьировал от 15 до 76 лет).As a specific example, the analysis of the results of observations of 238 patients with chronic glomerulonephritis is carried out. Among patients with CGF, men were 127 people (53.4%), women - 111 (46.6%). The average age of patients was 39.58 ± 14.58 years (ranged from 15 to 76 years).
При оценке почечной выживаемости у больных ХГН в зависимости от генетического полиморфизма гена параоксоназы-2 (S311 С PON2), проведенной с использованием метода множительных оценок Каплан-Майера [17], найдены статистически значимые взаимосвязи со скоростью прогрессирования заболевания по данному локусу. Нами установлено, что почечная выживаемость больных ХГН с генотипами 311SC и 311SS PON2 (р=0,05) ниже, чем у носителей генотипа 311СС PON2. На фиг.2. отражена зависимость почечной выживаемости у больных ХГН от генотипов полиморфного маркера S311 С PON2 (р=0,05). Медиана времени до наступления изучаемого исхода пациентов с аллелем 311S PON2 (генотипы 311SS и 311SC PON2) составила 72,00 месяца, а для больных с генотипом 311СС PON2 - 276,00 месяцев (р=0,05).When assessing renal survival in patients with CGN, depending on the genetic polymorphism of the paraoxonase-2 gene (S311 C PON2), carried out using the Kaplan-Meyer method of multiple estimates [17], statistically significant relationships were found with the rate of disease progression at this locus. We found that the renal survival of patients with CGN with genotypes 311SC and 311SS PON2 (p = 0.05) is lower than that of carriers of genotype 311SS PON2. In figure 2. the dependence of renal survival in patients with CGN on the genotypes of the polymorphic marker S311 C PON2 (p = 0.05) is reflected. The median time to the onset of the study outcome for patients with the 311S PON2 allele (genotypes 311SS and 311SC PON2) was 72.00 months, and for patients with the 311SS PON2 genotype, 276.00 months (p = 0.05).
С помощью монофакторного анализа почечной выживаемости (регрессионная модель Кокса) установлено, что наличие аллеля 311S гена PON2 ухудшает почечную выживаемость (р=0,01).Using a monofactor analysis of renal survival (Cox regression model), it was found that the presence of the 311S allele of the PON2 gene worsens renal survival (p = 0.01).
Таким образом, наличие аллеля 311S PON2 у больных хроническим гломерулонефритом ассоциировано со снижением почечной выживаемости.Thus, the presence of the 311S PON2 allele in patients with chronic glomerulonephritis is associated with decreased renal survival.
ЛитератураLiterature
1. Корякова Н.Н., Рождественская Е.В., Валамина И.Е. Прогнозирование развития хронической почечной недостаточности при хроническом гломерулонефрите // Врач. - 2006. - №6. - С.63-65.1. Koryakova NN, Christmas E.V., Valamina I.E. Prediction of the development of chronic renal failure in chronic glomerulonephritis // Physician. - 2006. - No. 6. - S. 63-65.
2. Макарова Ю.А., Шишкин А.Н., Эрман М.В. и др. Ретроспективная оценка течения хронического гломерулонефрита, дебютировшего в детском возрасте // Нефрология. - 2006. - Т.8, №3. - С.38-42.2. Makarova Yu.A., Shishkin A.N., Erman M.V. et al. Retrospective assessment of the course of chronic glomerulonephritis, which debuted in childhood // Nephrology. - 2006. - T.8, No. 3. - S. 38-42.
3. Мовчан Е.А. Дисфункция эндотелия и тромбоцитов при хронической болезни почек: новый взгляд на старую проблему нарушений в системе гемостаза у больных гломерулонефритом // Бюллетень сибирской медицины, Приложение №2. - 2008. - С.88-96.3. Movchan EA Endothelial and platelet dysfunction in chronic kidney disease: a new look at the old problem of hemostatic disorders in patients with glomerulonephritis // Bulletin of Siberian medicine, Appendix No. 2. - 2008. - P.88-96.
4. Кутырина И.М. Применение ингибитора ангиотензин-превращающего фермента при первичных поражениях почек и диабетической нефропатии // Consilium Medicum. - 2002. - т.7, №4. - С.331-333.4. Kutyrina I.M. The use of an angiotensin-converting enzyme inhibitor in primary kidney damage and diabetic nephropathy // Consilium Medicum. - 2002. - t.7, No. 4. - S.331-333.
5. Бадаева С.В., Томилина Н.А., Бикбов Б.Т. и др. Структурно-функциональные изменения миокарда при прогрессирующей хронической почечной недостаточности // Нефрология и диализ. - 2006. - Т.8, №3. - С.232-239.5. Badaeva S.V., Tomilina N.A., Bikbov B.T. et al. Structural and functional changes in the myocardium in progressive chronic renal failure // Nephrology and dialysis. - 2006. - T.8, No. 3. - S.232-239.
6. Ткалич Л.М., Зибницкая Л.И., Калюжина Е.В. Факторы, влияющие на качество жизни больных с хронической почечной недостаточностью // Нефрология. - 2006. - Т.10, №.1. - С.40-44.6. Tkalich L.M., Zibnitskaya L.I., Kalyuzhina E.V. Factors affecting the quality of life of patients with chronic renal failure // Nephrology. - 2006. - T. 10, No. 1. - S. 40-44.
7. Rutkowski В. Highlights of the epidemiology of renal replacement therapy in Central and Eastern Europe // Nephrol Dial Transplant. - 2006. - V.21. - P.4-10.7. Rutkowski B. Highlights of the epidemiology of renal replacement therapy in Central and Eastern Europe // Nephrol Dial Transplant. - 2006. - V.21. - P.4-10.
8. Смирнов А.В. Факторы, определяющие уровень показателей липидного обмена у больных гломерулонефритом без нарушения функции почек и при ХПН на фоне консервативной терапии // Нефрология. - 2000. - Т.4, №1. - С.24-43.8. Smirnov A.V. Factors determining the level of lipid metabolism in patients with glomerulonephritis without impaired renal function and with chronic renal failure during conservative therapy // Nephrology. - 2000. - T.4, No. 1. - S. 24-43.
9. Нефрология: Руководство для врачей / Под ред. И.Е.Тареевой. - М.: Медицина, 2000. - 668 с.9. Nephrology: A Guide for Physicians / Ed. I.E. Tareeva. - M .: Medicine, 2000 .-- 668 p.
10. Белянская Т.В., Петросян.Э.К., Ильенко Л.И. Полиморфизм гена PAI-1 у детей с хроническим гломерулонефритом // Материалы четвертого Российского конгресса «Современные технологии в педиатрии и детской хирургии». - Москва. - 2005. - С.179-180.10. Belyanskaya T.V., Petrosyan.E.K., Ilyenko L.I. Polymorphism of the PAI-1 gene in children with chronic glomerulonephritis // Materials of the Fourth Russian Congress "Modern Technologies in Pediatrics and Pediatric Surgery". - Moscow. - 2005. - S.179-180.
11. Shu К.Н., Cheng С.Н., Wu M.J. et al. Interleukin 1 Receptor Antagonist and Tumor Necrosis Factor-α Gene Polymorphism in Patients with End-Stage Renal Failure // Renal Failure. - 2005. - Vol.27, №1. - P.53-57.11. Shu K.N., Cheng S.N., Wu M.J. et al. Interleukin 1 Receptor Antagonist and Tumor Necrosis Factor-α Gene Polymorphism in Patients with End-Stage Renal Failure // Renal Failure. - 2005. - Vol. 27, No. 1. - P.53-57.
12. Шестаков А.Е., Камышова B.C., Кутырина И.М. и др. Ассоциация полиморфных маркеров D6S2414 и D6S1271, расположенных в локусе МНС (6р21.31), с хроническим гломерулонефритом среди русских г.Москвы // Генетика. - 2006. - Т.42, №12. - С.1727-1730.12. Shestakov A.E., Kamyshova B.C., Kutyrina I.M. et al. Association of polymorphic markers D6S2414 and D6S1271 located at the MHC locus (6p21.31), with chronic glomerulonephritis among Russians in Moscow // Genetics. - 2006. - T.42, No. 12. - S.1727-1730.
13. Шестаков А.Е. Исследование ассоциации ряда генов-кандидатов с хроническим гломерулонефритом // Автореферат дисс…к.м.н. - М., 2006. - 25 с.13. Shestakov A.E. A study of the association of a number of candidate genes with chronic glomerulonephritis // Abstract of thesis ... Ph.D. - M., 2006 .-- 25 p.
14. Некипелова Е.В., Калмыкова Е.В., Чурносов М.И. Клиническое и молекулярно-генетическое исследование больных с хроническим гломерулонефритом // Вестник новых медицинских технологий. - 2006. - Т.13, №6. - С.170-173.14. Nekipelova E.V., Kalmykova E.V., Churnosov M.I. Clinical and molecular genetic research of patients with chronic glomerulonephritis // Bulletin of new medical technologies. - 2006. - T.13, No. 6. - S. 170-173.
15. Петросян Э.К., Ильенко Л.И., Цыгин А.Н. и др. Полиморфизм гена CTLA-4 у детей с хроническим гломерулонефритом // Иммунология. - 2007. - Т.28, №1. - С.7-915. Petrosyan E.K., Ilyenko L.I., Tsygin A.N. et al. CTLA-4 gene polymorphism in children with chronic glomerulonephritis // Immunology. - 2007. - T.28, No. 1. - S.7-9
16. Калмыкова Е.В. Исследование ассоциаций полиморфных маркеров генов интерлейкинов с хроническим гломерулонефритом // Автореферат дисс…к.б.н. - М., 2009. - 18 с.16. Kalmykova E.V. The study of the associations of polymorphic markers of interleukin genes with chronic glomerulonephritis // Abstract of thesis ... Ph.D. - M., 2009 .-- 18 p.
17. Боровиков В. Statistica. Искусство анализа данных на компьютере. - СПб.: «Питер». - 2003. - 502 с.17. Borovikov V. Statistica. The art of analyzing data on a computer. - SPb .: “Peter”. - 2003. - 502 s.
18. Реброва О.Ю. Статистический анализ медицинских данных. Применение пакета прикладных программ STATISTICA. - М.: Медиасфера. - 2002. - 311 с.18. Rebrova O.Yu. Statistical analysis of medical data. Application of the STATISTICA application package. - M .: Media sphere. - 2002. - 311 p.
19. http://xfun.ru/soft/12288-statistica-6.0.html.19. http://xfun.ru/soft/12288-statistica-6.0.html.
Claims (1)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2011112704/15A RU2456606C1 (en) | 2011-04-04 | 2011-04-04 | Method for prediction of renal survival in patients suffering chronic glomerulonephritis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2011112704/15A RU2456606C1 (en) | 2011-04-04 | 2011-04-04 | Method for prediction of renal survival in patients suffering chronic glomerulonephritis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2456606C1 true RU2456606C1 (en) | 2012-07-20 |
Family
ID=46847532
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2011112704/15A RU2456606C1 (en) | 2011-04-04 | 2011-04-04 | Method for prediction of renal survival in patients suffering chronic glomerulonephritis |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2456606C1 (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2009101480A (en) * | 2009-01-19 | 2010-07-27 | Государственное образовательное учреждение высшего профессионального образования "Белгородский государственный университет" (RU) | METHOD FOR ESTIMATING RENAL SURVIVAL IN PATIENTS WITH CHRONIC GLOMERULONEPHRITIS BASED ON DATA WITH POLYMORPHISM OF INTERLEUKIN GENES |
-
2011
- 2011-04-04 RU RU2011112704/15A patent/RU2456606C1/en not_active IP Right Cessation
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2009101480A (en) * | 2009-01-19 | 2010-07-27 | Государственное образовательное учреждение высшего профессионального образования "Белгородский государственный университет" (RU) | METHOD FOR ESTIMATING RENAL SURVIVAL IN PATIENTS WITH CHRONIC GLOMERULONEPHRITIS BASED ON DATA WITH POLYMORPHISM OF INTERLEUKIN GENES |
Non-Patent Citations (2)
| Title |
|---|
| БАГРИЙ А.Э. и др. Сердечно-сосудистые нарушения при хронической почечной недостаточности и их прогностическая значимость // Газета "Новости медицины и фармации". - 2009, 19 (293). SANGHERA D.K. et al. DNA polymorphisms in two paraoxnase genes (PON1 and PON2) are associated with the risk of coronary heart disease // Am. J. Hum. Genet. - 1998, V.62, р.26-44. * |
| ЛОСКУТОВА С.А. Исходы и прогноз хронического гломерулонефрита, дебютировавшего в детском возрасте // Нефрология и диализ. - 2003, Т.5, N2 http://www.nephro.ru/magazine/article.php?id=17646. KELLER F, et al. Long-term treatment and prognosis of rapidly progressive glomerulonephritis // Clin Nephrol. - 1989 Apr; 31(4): 190-7, реф. PMID: 2714023 [Найдено в БД PubMed]. * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Pinedo et al. | Candidate gene polymorphisms (BoIFNG, TLR4, SLC11A1) as risk factors for paratuberculosis infection in cattle | |
| US20070281300A1 (en) | Thrombomodulin (Thbd) Haplotypes Predict Outcome | |
| Singh et al. | Gene expression changes in peripheral blood mononuclear cells from multiple sclerosis patients undergoing β-interferon therapy | |
| US20090176206A1 (en) | Toll-like receptor 2 (tlr-2) haplotypes predict outcome of patients | |
| US20190218616A1 (en) | METHODS OF PREDICTING MEDICALLY REFRACTIVE ULCERATIVE COLITIS (mrUC) REQUIRING COLECTOMY | |
| US20100326218A1 (en) | Identifying a subject with an increased risk of invasive mold infection | |
| Abed et al. | Genetic Polymorphism of TLR5 and TLP6 in Iraqi Patients with Heart Failure Disease | |
| Settin et al. | Clinical and molecular diagnosis of Familial Mediterranean Fever in Egyptian children | |
| RU2456606C1 (en) | Method for prediction of renal survival in patients suffering chronic glomerulonephritis | |
| Al-Omari et al. | Association between TNF-α (-308G→ A) Gene Polymorphism and Burn Patient with Sepsis | |
| RU2248574C1 (en) | Method for predicting the development and flow of chronic lympholeukosis | |
| KR102063486B1 (en) | Association of RNF213 single nucleotide polymorphism with the risk of Moyamoya disease in a Korean population | |
| RU2393479C1 (en) | Method of assessing clinical course of chronic glomerulonephritis | |
| RU2431149C2 (en) | Method for assessment of renal survival rate in patients with chronic glomerulonephritis by interleukin gene polymorphism values | |
| RU2508543C1 (en) | Method for prediction of risk of thrombocytopenia development accompanying clinical course of chronic lymphatic leukaemia | |
| Alharbi | Angiotensin I converting enzyme gene polymorphism in type 2 diabetes mellitus with nephropathy in Saudi population | |
| Pakzad et al. | Strong Association of Polymorphism in SPRED2 Gene with Disease Susceptibility and Clinical Characteristics of Rheumatoid Arthritis in the Iranian Population | |
| Shi et al. | Genetic analysis of chromosome 22q11. 2 markers in congenital heart disease | |
| Elshamy et al. | Assessment of Chemokine Motif Ligand 4 Gene Polymorphism in Rheumatoid Arthritis Patients and its Correlation with Disease Activity | |
| RU2775431C1 (en) | Method for predicting the risk of developing primary open-angle glaucoma in women | |
| RU2490642C1 (en) | Method for prediction of clinical form of chronic lympholeukaemia | |
| Abdelraheem et al. | The Role of Interleukin-10 and Interferon-Gamma Single Nucleotide Polymorphisms in Multi-Drug Resistant Tuberculosis. | |
| Ai-Ghalayini et al. | Identification of Genetic Variants Associated With Myocardial Infarction in Saudi Arabia | |
| RU2368325C1 (en) | Method of prognosing development of type 1 sugar diabetes in populations of bashkortostan peoples | |
| JP4649181B2 (en) | Genetic predisposition test method for asthma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20170405 |