RU2321638C2 - Method for preparing multifunctional multichip, multichip for successive or parallel screening biopolymers, method for analysis of biopolymers and set for realization of method - Google Patents

Abstract

FIELD: molecular biology.

SUBSTANCE: method for preparing a multichip involves a multilevel system of identification. The first identifying agent is placed on surface of individual chips comprising the first code, and the second identifying agent comprising the second code. The third identifying agent is placed on surface of the common multichip zone comprising the third and the second code. Multichip prepared by method is used for DNA diagnosis by hybridization of amplification products of analyzed DNA with probes localized on surface of indicated multichip or on surface of chips prepared by separation from indicated multichip. Also, multichip is used in a set used for identification of biopolymers in common with reagents for preparing a sample and carrying out identification of biopolymers. Invention provides enhancing effectiveness and deceasing cost of analysis of biopolymers. Invention can be used in medicine, pharmacology and environment guard.

EFFECT: improved preparing method, improved method of analysis.

25 cl, 10 dwg, 12 ex

Description

FIELD OF THE INVENTION

The invention relates to molecular biology, pharmacology, medicine and environmental protection. In particular, to a method of manufacturing and using a multichip, which allows both sequential and parallel diagnostic procedures, for example, based on protein or DNA probes using different types of tags and methods for processing the results.

State of the art

Two approaches are known for choosing the type of biochips used in molecular biology, pharmacology, medicine, and environmental protection. The first is based on the production of individual chips with a high point density - up to 10,000 per cm ² [1]. These chips are expensive and are mainly used in scientific research for scanning libraries of DNA fragments, in the development of drugs or are used in large medical centers. Another type of chip is problem-oriented for testing in small medical centers or laboratory conditions where it is necessary to diagnose no more than 100 DNA fragments or proteins on a separate chip. The main requirement for such chips is associated with the maximum simplicity of obtaining the result and low analysis cost.

Well-known chips made on the basis of slides, despite their wide distribution [2, 3], have drawbacks due to the fact that when preparing a slide for diagnostics, a large number of operations are required to install and mount individual slides in different devices at different stages of manufacture chips, which include: surface modification, surface cleaning and washing, applying oligonucleotides, DNA or proteins, hybridization, installation in a scanner for analysis of diagnostic results. Moreover, due to the inaccurate installation of the chips and the displacement of the chips relative to each other and relative to the base on which they are installed, errors may occur during the deposition of oligonucleotides on the selected area of the chip and errors in the interpretation of the results.

To eliminate these errors, methods have been developed for more accurate chip installation [4], which complicate the mounting device and do not allow fixing a large number of chips on the working surface of robots for drawing points. Known technical solutions that allow you to take into account the offset of the chips, for example, due to the introduction of a large number of reference points on each chip and on the common surface of the multichip [5], either through the use of complex devices having large overall dimensions [6], or through monitoring in real-time installation of each individual chip on a common platform [7], which greatly complicates the structure of robots.

Closest to the present invention relates to a method of manufacturing chips, in accordance with which the working surface, made in the form of a rectangle [8] or a circle [9], is divided into sectors in which the working areas related to individual chips are placed. In the texts of patents, it is possible to separate individual chips from a common carrier [10]. However, in other patents this technical solution is criticized because the separation of a multichip made of glass, for example, from a carrier element is associated with a large number of defects due to its fragility [11]. In addition, the areas belonging to individual chips and separated from the multichip may not contain identifiers and other information identifying the chip [12]. In this case, each separated area of the multichip is glued into an individual holder, which requires additional costs, which may exceed the cost of manufacturing individual chips according to standard procedures.

There are many examples of the use of identifiers to identify biochips. For example, the invention is known [25], in which the chip has two barcodes for identifying two working areas. The invention is known [10], in which each individual zone with its encoded information in the form of a single identifier can be separated from the multichip and used individually. The invention is known [26], which discusses the use of identifiers in conjunction with a computer to control the quality of chip manufacturing.

The invention is known [31], in which options for manufacturing biochips with a large number of identifiers are considered, made in the form of alphanumeric digital or color graphic images that identify individual clusters or groups of clusters located on the working surface of the biochip. For this purpose, a lot of alphanumeric codes or codes combined with color dots located next to the corresponding clusters are applied to the surface of the biochip. Such a technical solution makes it possible to increase the reliability of identification of the set of DNA under study relative to each other, but placing a large number of identifiers on the working field of the biochip sharply limits the useful working area of the biochip on which clusters can be placed.

The use of multichips based on the well-known inventions [10] with individual chips placed on a smooth, even surface of a multichip carrier element can lead to erroneous diagnostic results due to cross-contamination by samples of neighboring zones of individual chips when the hybridization flows from chip to chip.

It is known that in order to eliminate the problems of cross-contamination, depressions are formed in the surface of individual chips into which the hybridization mixture is applied, or separators made in the form of hollow cylinders are glued or mechanically attached [13], or the common flat surface of the chip base is separated using rectangular gratings [ 20], or chips made in the form of flat plates are glued onto a solid or flexible base [28], thereby creating a pedestal for the formed individual clusters.

Known multichip [30], which eliminates the problems of cross-contamination. The multichip consists of a stand and several biochips, which are sequentially connected microcuvettes in which proteins are immobilized. Microcuvettes are interconnected by “bridges” that can be broken and divided into cuvettes. Each microcuvette is equipped with its own separate space for carrying out reactions, that is, the use of one microcuvette does not interfere with the use of another. In the stand, made as an independent node, mounting holes are made in which microcuvettes are connected in series. On the side surface of the stand there are digital and alphabetic identifiers, with the help of which they determine the location of microcuvettes with protein samples.

However, this technical solution does not imply the identification of individual microcuvettes related to individual chips, and does not imply a relationship between the temporary position of individual chips and the characteristics of these chips for identification tasks. Instead, a simple alphanumeric identification of the position of individual microcuvettes at the time the chips were placed in the stand was used, which is widely known and used in the design of various types of microplates.

Protection against cross-contamination is addressed through the formation of recesses in microcuvettes. The design of the multichip consists of separate units. Such a solution makes it possible to introduce operator error into the diagnostic process due to the simplicity of changing the position of microcuvettes that are not provided with identifiers relative to each other on the surface of the stand.

Solving chip identification problems, reducing cross-contamination or providing the ability to separate individual chips from each other are not considered in conjunction with each other and are solved as different technical problems.

The objective of the present invention is to improve the efficiency of diagnostics by creating a new design of a multichip and creating an inexpensive method for serial or parallel diagnostics based on a multichip

Another objective of the present invention is the creation of a multichip for sequential or parallel diagnostic screening of biopolymers with improved identification of both the multichip and individual chips separated from the multichip, which allows the identification of an individual chip relative to the group of chips included in the multichip.

SUMMARY OF THE INVENTION

One of the objects of the invention is a multi-chip for sequential or parallel diagnostic screening of biopolymers containing a carrier element, on the surface of which an array containing N individual chips is placed, on the surface of each of which are placed clusters with biological probes and identifiers. The multichip further comprises a common zone, which is planar with respect to an array of N chips and is located at the boundary of the array or in the center of the chip array, the common zone being in the form of a rectangle or a cross and containing at least two technological holes. The connection between each of the multi-chip chips with each other and / or the connection of the chips with a common area is arranged to be separated, with the first identifier containing the first code placed on the surface of the individual chips, the second identifier containing the second code, and placed on the surface of the common area of the multi-chip a third identifier that has a third code or a code identical to the second code.

Another object of the invention is a method for manufacturing a multichip for sequential or parallel screening of biopolymers based on a flat solid carrier element, on which N individual chips with many clusters containing selected types of probes are placed. The method is characterized in that the first and optionally the second identifiers are applied to the surface of the individual chips, characterizing the parameters of the individual chip included in the multichip, and on the carrier element of the multichip, an additional common area is formed on which mounting holes are made and a third identifier is applied, the first identifier being associated with the first code, the second identifier is associated with a second code different from the first code, the third identifier has a third code or code identical to the second code, wherein These codes form unique N pairs of codes characterizing a multifunctional chip.

Another object of the invention is a method for the diagnosis of biopolymers, including providing test samples of the studied DNA, direct and reverse primers, conducting multiplex PCR, hybridization of amplified products on the surface of the multichip, detection of diagnostic results and identification of the results. In this method, a multichip is used containing the first, second and third identifiers, and before the identification step, the diagnostic data and the parameters of the first, second and third identifiers are entered into the database for quick search and identification of the parameters of individual chips or groups of individual chips relative to each other.

Identification and interpretation of diagnostic results is carried out using software and databases by comparing data obtained by scanning the chip.

Another object of the invention is a kit for identifying biopolymers based on DNA or protein probes, including: a) a biological multichip, b) reagents for sample preparation and identification, and the kit may additionally contain a scanner that uses diode laser light as an exciting source of fluorescence and equipped with a CCD camera or scanner for measuring light absorption, and also include a device for interpreting and storing identification results based on a computer.

List of figures

Figure 1. Placement of the main elements of the multichip on the surface of the supporting element:

a) and b) - distribution of zones on the bearing element of the multichip;

c) a multi-chip variant with a combination of recesses and through holes between the chips with the placement of two identifiers;

d) a variant of a multichip with recesses between the chips with the placement of one identifier.

Figure 2. The cross-section of the carrier element of a multichip for different options of notches:

a) a triangular recess, b) a spherical recess, c) a rectangular recess, d) a polygonal recess, e) a recess option from both sides of the supporting element.

Figure 3. Placement of the main elements of the multichip on the surface of the bearing element with the formation of a common zone on the bearing element:

a) the distribution of zones on the supporting element of the multichip;

b) a multi-chip variant with a combination of recesses and through holes between the chips with the placement of three identifiers;

c) a multi-chip variant with a combination of recesses and through holes between the chips with the placement of two identifiers.

Figure 4. Placement of the main elements of the multichip on the surface of the supporting element with different options for the location of the common zone of the multichip:

a) lateral, b) central, c) cruciform, d) upper placement of the common zone.

Figure 5. An isometric view of the cross section of the bathtub to modify the surfaces of several load-bearing elements made in a rectangular shape, with the placement of a common fastening zone on the upper side of the multichip.

6. View of the assembly of two options for individual biochips and a frame for installation in the scanner.

7. A block diagram of a system for collecting, processing, and transmitting information about data read from multichips to individual user computers.

Fig. 8. Image of points during the detection of fluorescently labeled probes.

Fig.9. Image of points during the detection of chromogenic probes.

Figure 10. Image of a medical chip.

Enumeration of abbreviations.

1. PMMA - polymethylmethacrylate.

2. PVC - polyvinyl chloride.

3. EDC - dimethylaminopropylethylcarbodiimide hydrochloride.

4. FAM - 6-carboxyfluorescein.

5. APTES - 3-aminopropyltriethoxysilane.

6. Positions 100 - relate to the structural elements of a multichip.

7. Position 200 - refers to a system for analyzing diagnostic results.

Description of the invention

One of the objects of the present invention relates to a multichip for sequential or parallel diagnosis of biopolymers, the group of which includes DNA, antibody peptides and other biologically active substances. Such analyzes are carried out in medicine, veterinary medicine, in food production, in monitoring environmental parameters and in forensics.

The main aspect of this invention is to increase the reliability of the results of the analysis by developing a new design of a multichip,

It was found that the solution of the technical problems posed is possible with the help of a new multi-chip design, which implements a technical solution related to improving the identification of biochips and reducing cross-contamination, which affect the increase in the reliability of the obtained analysis results.

In contrast to the known solutions, which, to increase the reliability of the obtained results, provided either a better identification of individual chips [31], or provided a decrease in the level of cross-contamination between individual clusters located on the surface of the biochip [30], the proposed technical solution allows us to perform the tasks based on a common technical solution.

It was found that the introduction into the structure of a multichip of a common zone, coupled with a part of the outer boundary of at least one chip that is part of the multichip, with the possibility of easily disconnecting the common zone from individual biochips, allows us to implement the technical tasks, providing a synergistic contribution provided by the capabilities the common zone contain a third identifier common to all individual biochips, and recesses and / or recesses in combination with through holes, with which individuals are attached ualnye chips with each other and / or with a common area, and provides reduction of cross-contamination due to run-off excess in the hybridization mixture recesses or holes.

A common zone is a part of the general planar surface of a multichip, on the main part of which there are N individual chips. The inclusion of the common area in the multichip allows you to place additional structural elements on it, such as an identifier and holes for attaching the multichip during its manufacture, or fastenings in the diagnostic process. In addition, the element separated from the chips, containing a common area with a third identifier located on its surface, and at least one hole, can perform an additional function of identification of diagnostic objects. Such objects include storage objects for the studied samples, for example, boxes to which an element with an identifier is attached. An element with a third identifier can be placed next to the patient being diagnosed and fixed, for example, on the bed next to information about the patient or placed on the patient’s map for quick search in databases of information about previously diagnosed patients.

Another problem solved by the present invention, associated with increasing the reliability of the results obtained, is to reduce or eliminate cross-contamination during hybridization. In the present invention, the problem of cross-contamination is solved simultaneously with the formation of the possibility of disconnecting the common area from the array of chips and / or disconnecting the chips from each other.

The possibility of disconnecting the common area from individual biochips or detaching the chips from each other is achieved by forming recesses on the front planar surface of the multichip or a combination of recesses and through holes made in the form of perforations, slots, gaps or intervals between the lateral boundaries of the chips. In this case, excess hybridization mixture will drain into the recesses and / or through holes.

The formation of a planar surface, on which a common zone and an array of chips are placed, which are capable of being disconnected from each other by recesses or recesses and through holes, are carried out by standard and simple procedures that are selected from the group including but not limited to stamping, thermoforming, casting, machining, laser cutting, or a combination of these processing methods.

Thus, the introduction of a common zone into a multichip allows increasing the reliability of diagnostic results due to the formation of two- or three-level data identification.

At the same time, at least one first identifier related to the identification of data about the object of study and, optionally, a second identifier on which the manufacturer’s data on the date of manufacture, type and parameters of the probes are placed on each of the individual chips. In the common mounting area of all the chips, the multichip additionally contains a third identifier, which has a third code or a code identical to the second code.

The first identifier is associated with the first code, the second identifier is associated with the second code, different from the first code. These codes form unique N pairs of codes characterizing a multifunctional chip. The identifier may be made in the form of digital and / or letter designations that serve as a code, or in the form of bar codes or combinations thereof.

As an example, including but not limited to the scope of the present invention, the following are the parameters that can be entered into the parameters of the first identifier in the determination or diagnosis of mammalian diseases.

The first identifier of an individual chip may include the following data included in the group consisting of: a) the disease code, b) the code characterizing the object from which the sample was taken (blood, lymph, scraping, saliva, etc.), ) a patient code or a data code identifying the patient (name, age), d) the code of the medical institution and / or insurance company, e) the date of diagnosis.

In turn, the parameters of the second and third identifiers identifying the multichip can contain: a) the code of the batch number and / or date of manufacture, b) the code of the manufacturer’s company, c) the code identifying the method of surface modification, d) the screening type code (serial, parallel ), e) the code of the number of individual chips, e) the code of the number of clusters.

Such information can be useful for determining the qualitative characteristics of not only a multichip, but also its constituent components. Moreover, the combination of the first and second code or the first, second and third code should provide a unique code that corresponds to only one multichip. An appeal to such a unique code will provide a quick search of information in the databases of all samples during parallel screening or information on sequential measurements.

When casting or stamping the carrier element of a multi-chip, it is possible to form additional recesses with a depth of 0.1 to 4.5 mm (depending on the thickness of the chip), which allows you to freely separate individual chips or a group of chips from the multi-chip for scanning in the selected scanner or scan the entire multi-chip on a flatbed scanner while reading all identifier data.

Figure 1 shows the placement options of the main elements of the multichip on the surface of the supporting element without a section with a formed common zone. Figure 1 (a) and figure 1 (b) shows the distribution of zones on the carrier element of the multichip for different options. In the general case, the multichip contains a carrier element 100, on the surface of which N chips are placed in sectors 102, the number N of individual chips in the multichip is selected at least 2. On the surface of each sector 102 belonging to an individual chip, a group of zones is formed: a) the working area of the chip for applying probes 103, b) a zone for applying the first identifier 104 and optionally the second identifier 105. Moreover, the working area of an individual chip consists of a group of clusters 106, each of which is formed by its own probe. The group of probe types that are selected for placement on the working surface of the chip, in addition to probes related to the diagnosis of samples, includes a group of probes related to positive or negative controls, as well as a group of probes made in the form of marks, for example, marks identifying the position of the chip. Additionally, each sector is in contact with a zone 107 in contact with the boundaries of at least two individual chips adjacent to the outer contour of each sector. In the zone 107, recesses 108 and / or through holes between the chips 109 are made. Figure 1 (c) shows a multi-chip variant with a combination of recesses and through holes between the chips with two identifiers. Figure 1 (g) shows a variant of a multichip with one identifier. The recesses and / or through holes between the chips facilitate the separation of the individual chips 110 from the carrier 100 or relative to each other. If you use a combination of recesses and through holes in the zone 107, then the ratio between the lengths of the recesses and through holes between the chips is selected in the range from 1:10 to 10: 1. The ratio of the width of the recess to the width of the through hole can be selected in the range from 1:10 to 10: 1. The width of the recess is selected in the range from 0.1 mm to 5 mm.

The ability to easily separate individual chips from a multichip allows sequential screening using a single multichip, in which all individual chips are performed under the same conditions, which allows you to compare individual chips during sequential diagnostics, for example, in the treatment of a patient. Figure 1 (a) shows a variant of a multichip with the formation on the surface of the multichip of one notch without through holes between the chips and with the placement of two identifiers. Such a solution is preferable during mass screenings, when all the multichip chips must undergo parallel processing and after diagnostics can be simultaneously separated from the multichip. Figure 2 shows examples of cross-sectional shapes of the multi-chip carrier element for different recesses: a) a triangular recess 120, b) a spherical recess 121, c) a rectangular recess 122, d) a polygonal recess 123, e) a recess option from both sides of the carrier 124 Moreover, the recesses, preferably during stamping or casting, can be arranged both on one or both sides of the multichip. The thickness of the supporting element is selected from 0.5 to 5 mm. In this case, the ratio of the thickness of the layer of the bearing element to the depth of the recess of the multichip is selected based on the mechanical and physical parameters of the selected material (hardness, brittleness) for the multichip and can range from 2: 1 to 100: 1.

Figure 3 shows the placement options of the main elements of the multichip on the surface of the carrier element on which the common area 111 is formed. The common area 111 of the carrier element of the multichip 100 can be located at the boundary or in the center of the chip array. It may be in the shape of a rectangle or, for example, in a cruciform shape. The common zone has two functions. The first is related to its use for forming mounting and fixing holes 112 on it, which facilitate the fastening of multi-chip blanks during surface modification, numerous washing and surface cleaning before applying probes. The second function of the common area is the placement on its surface of the third identifier 113, on which information useful for subsequent analysis of diagnostic data during parallel or sequential screening of biopolymers can be placed. Figure 3 (a) shows the distribution of zones on the carrier element of the multichip. In the general case, the multichip contains a carrier element 100, on the surface of which N chips are placed in sectors 102, a group of zones is formed on the surface of each sector: a) the working area of the chip for applying the probes 103, b) the zone for applying the first identifier 104 and optionally the second identifier 105. Moreover, the working area of an individual chip consists of a group of clusters 106, each of which is formed by its own probe. The group of probes placed on the surface of the working area, in addition to probes related to the diagnosis of samples, includes a group of probes related to positive or negative controls, as well as a group of probes made in the form of marks, for example, marks identifying the position of the chip. Each sector 102 is in contact with a zone 107 in contact with the boundaries of at least two individual chips adjacent to the outer contour of each sector and the boundary of the common area of the multichip. In the zone 107, recesses 108 and / or through holes between the chips 109 are made. Figure 3 (b) shows a multi-chip variant with a combination of recesses and through holes between the chips with three identifiers. The recesses and / or through holes between the chips allow the chips 110 to be separated from the carrier 100 or relative to each other. Figure 3 (b) shows a variant of a multichip with recesses between the chips and with the placement of two identifiers.

Figure 4 shows the options for placing the common area of the chip 111 on the surface of the multichip. Figure 4 (a) shows a variant of the lateral placement of the common area. Figure 4 (b) shows a variant of the central location of the zone. Figure 4 (c) shows the cruciform shape of the common area. Figure 4 (d) shows the location of the common zone in the upper part of the multichip.

The above examples include, but are not limited to other options for placing individual chips and the common area relative to each other. Holes 112 are placed in the common area, by means of which several blanks of multi-chips can be fixed before installation in devices in which one of the steps of surface preparation takes place, for example, the step of surface modification or the step of applying DNA or protein probes.

As an example, which includes, but is not limited to other options, figure 5 shows an isometric view of the transverse section of the bath 114 to modify or to flush the surfaces of many multi-chips made in a rectangular shape, with the mounting area on the upper side of the multi-chip.

When using laser or machining to form recesses and / or through holes between the chips, it is preferable to simultaneously apply recesses or through holes between the chips on the surface of several undivided carrier elements. To do this, a rectangular blank is cut from a plastic sheet on which several multichips can be placed. After the formation of through holes between the chips and / or recesses, the multichips are separated from each other.

Stamping, thermal stamping or die casting is most preferred, during which through holes between the chips and / or recesses are formed simultaneously with the formation of the surface of the carrier with zones for individual chips.

Multi-chip shape

It is known to perform a multichip in the form of rectangular platforms [13], rectangular sheets [10] or in the form of a flat disk [9]. The preferred form of the multichip is a flat sheet of different thicknesses. In the framework of the present invention, the shape of the multichip is selected on the basis of preliminary information about the type of material for the multichip, about the proposed method of surface modification, information about the proposed method of processing the analysis data and the choice of equipment for acquiring and processing information. The satisfactory shape of the multichip can be a rectangle, square, disk, polygon. The thickness of the carrier may be from 0.5 to 5 mm.

In an embodiment where the shape of the multichip is a rectangle, it is preferred that the ratios between the width and length of the multichip lie in the range from 1: 1 to 1:50. In some embodiments, it is preferable to select the sizes of the multichip within the dimensions of standard sheets of paper, for example, A4 size for which scanners are designed. Given the high resolution characteristics of modern scanners and the perfection of methods for applying probes to the surface of chips, it is more preferable to use not only standard sizes of individual chips 25 mm × 75 mm, but also other sizes. For example, to reduce the cost of preparing individual chips as part of a multichip, it is possible to use chips whose dimensions are 12.5 mm × 75 mm, or mini-chips measuring 25 mm × 37.5 m or 12.5 mm × 37.5 mm . Figure 6 shows the options for placing individual chips in a standard framework (15) for subsequent scanning. 6 (a) shows the placement of the chip with a width of 25 mm, and FIG. 6 (b) shows the placement of the chip with a width of 12.5 mm.

Carrier Material

The material of the supporting element should provide several functions that facilitate reliable analyzes. The material should provide sufficient mold stability during the preparation of the surface, for example, its modification in order to more effectively immobilize the probes to the surface of the chip. The material must withstand the treatment of its surface with aqueous and other solutions. The choice of material depends on the method of detection and registration of the signal. When choosing a method for detecting a signal by the fluorescence level, it is necessary to take into account the properties of the intrinsic fluorescence of some materials and the need to compensate for the background signal and increase the signal-to-noise ratio.

It is known [10] that nitrocellulose, glass, silicones, plastics, teflons, metals, and combinations thereof can be used as the basis for creating multichips. However, as already mentioned, not all materials listed in the group have the ability to covalently immobilize probes, which are modified or unmodified oligonucleotides. It is proposed to use polymers, glass, ceramics or their compositions as the material of the supporting element for creating a multichip.

For a material such as glass, a large number of surface modification methods have been developed for the subsequent immobilization of probes. However, the massive use of glass multi-chips is limited by the fragility of this material, a sufficiently large weight and the need to perform steps to protect the chips during transportation. The implementation of bilateral recesses or recesses and through holes between the chips makes it possible to separate the glass slides from each other without violating the base of the chip.

Polymers are not fragile and can be manufactured using various technologies, including but not limited to stamping, casting, and machining methods. The group of polymers used includes, but is not limited to, polymethyl methacrylate, polybutyl methacrylate, polyvinyl chloride, polycarbonate, copolymers of methyl methacrylate and / or copolymers of butyl methacrylate with other monomers, such as styrene, acrylonitrile, etc. It is more preferable to use less polymethyl methacrylate which is more the basis of composite bearing surfaces. Polyvinyl chloride allows you to effectively modify the surface and is the basis for the manufacture of individual chips and multichips.

Methods for modifying the surface of a multichip carrier element

Known patents that describe methods for modifying the surface of glass, polymers, metals. Most often, a variety of organosilicon compounds are used to modify the surface, including derivatives of trialkoxysilanes.

In some cases, the glass substrate is coated with APTES in the gas phase [14, 15]. It should be noted that when alkoxysilanes derivatives are used for coating glass, they are covalently sutured due to the formation of siloxane bridges. Modification of the surface of polymers by the action of various trialkoxysilanes or their derivatives is known [16], for example, a method of modifying the surface of polymers by the action of a sol gel obtained by hydrolysis of a trialkoxysilane carrying the desired functional group together with tetraalkoxysilane [17]. There is a method of modifying ester groups on the surface of polymers, which consists in their aminolysis under the action of polyamines [18, 19]. On the thus obtained aminated surface, the probe is immobilized in the presence of a condensing agent and / or a heterobifunctional cross-linker. As an example, including, but not limiting the scope of the present invention, the use of methods for modifying glass substrates using functional organosilicon compounds is considered. At the modification stage, a solution of a compound of the formula YX-Si (OR) _{3 is} applied to the glass substrate, where X is an alkyl, aryl or alkylaryl bridge, R is alkyl or aryl, Y is the desired functional group, in a suitable solvent. As modifying agents, trialkoxysilanes containing the functional group necessary for the further immobilization of biomolecules, for example, epoxy, mercapto, amino, acryloyl, etc. can be used. Suitable modifying agents may be:

3- (glycidyloxy) propyltriethoxysilane, 3- (glycidyloxy) propyltrimethoxysilane, 3-mercaptopropyltriethoxysilane, 3-aminopropyltriethoxysilane, 3-aminopropyltrimethoxysilyloxy, 3- (acinopropyltrimethoxysilloyloxy) As a solvent, ethanol, methanol, propanol, water or mixtures thereof can be used.

During the process, water causes the hydrolysis of alkoxy groups in solution and on the surface of the substrate, which then undergo spontaneous polycondensation. As a result, a large number of alkoxysilane molecules carrying the required functional groups are bound to the surface of the substrate by siloxane bridges. The concentration of the modifying agent may vary from 0.1 to 20% by volume. The temperature of the modification is selected in the range from 15 to 30 ° C. It is preferable to use room temperature. The duration of the modification step is selected from 30 minutes to 2 hours, preferably 1 hour.

For covalent modification of polymer substrates, including electrophilic fragments (ester groups, halogen-alkane fragments, etc.), it is necessary to use only compounds of this formula with Y = NH ₂ . In this case, the modifying agent should be used in hydrolyzed form. As a result of the modification, amino groups are formed on the polymer surface. The temperature of the modification is selected in the range from 15 to 80 ° C. The duration of the modification step is selected from 10 minutes to 12 hours, preferably from 20 to 120 minutes.

As a probe, differentiating oligonucleotides modified at the 5 ′ or 3 ′ end with a functional group included in the kit consisting of phosphato, carboxy, amino, hydroxy, thio, hydrazo, hydrazino, aminooxy, etc. are used. In many cases, for the immobilization of oligonucleotides, it is possible to use condensing agents included in the group consisting of: dimethylaminopropylethylcarbodiimide hydrochloride, carbonyldiimidazole, mesitylenesulfonyltetrazole, mesitylenesulfonyl nitrotriazole, triisopropylphenyltetrazole, triisopropyl enilnitrotriazola, at a concentration of from 0.1 to 100 mM. It is also possible to use bifunctional cross-linkers belonging to the group consisting of dithiobis (succinimidyl propionate) Disuccinimidyl suberate, disuccinimidyl tartarate, bis [(2- (suktsinimidooksikarboniloksi) ethyl] sulfonate, ethylene glycol bis (succinimidyl succinate), disuktsinimidilglutarata, disuccinimidyl carbonate, dimethyl adipimidate hydrochloride, dimethylpimelimidate hydrochloride, dimethyl-3,3'-dithiobis (propionimidate), 1,4-bis [3 '- (2'-pyridyldithio) propionamido] butane, bismaleimidohexane, 4- (4-N-maleimido pheni hydrazide hydrochloride) l) -butanoic acid, 1,5-difluoro-2,4 dinitrobenzene, diglycidyl ether 1,4-butanediol, carbohydrazide, adipic acid dihydrazide, N-succinimidyl-3- (2-pyridyldithio) propionate, succinimidyl-4- ( N-maleimidomethyl) cyclohexane-1-carboxylate, N-m-maleimidobenzoyl-N-hydroxysuccinimide, dimethylsuberimidate dihydrochloride, succinimidyl (4-iodoacetyl) aminobenzoate, succinimidyl-4-idimide [(iodoacetyl) amino] hexanoate, succinimidyl-4 - [(iodoacetylamino) methyl] cyclohexane-1-carboxylate, p-nitrophenyl iodoacetate.

Example 1 shows an example of surface modification of PMMA using hydrolyzed 3-aminopropyltriethoxysilane. The modification methods described in examples 1-5 are developed on the basis of research and have an inventive step. At the stage of surface modification of the carrier element, it is possible to carry out modification a) on the entire surface of the carrier element of the multichip, b) in the working areas of individual chips, for example, formed in the form of recesses.

Data on surface modification parameters can be entered in the identifier code, for example, in the form of a bar code. This information may allow automatic selection of the background accounting algorithm when reading and processing the data.

A method of manufacturing a multichip

Another object of the present invention is a method of manufacturing a carrier element of a multifunctional multichip. In the General case, the method of manufacturing a multifunctional multichip (in particular, to obtain individual user chips) consists of a number of stages, in accordance with which: a) choose the material of the bearing element and the method of modifying its surface, b) choose the form and method of preparing the blank of the bearing element, c) choose a multi-chip design, in which the location of sectors for forming N chips, zones for forming recesses or through holes between the chips are determined, d) a carrier element is made, forming recesses and / and whether there are through holes between the chips and optionally recesses for hybridization, and they modify the entire surface or its working part, e) choose the chemical structure of the probes included in the individual chips, and the method of immobilization (using a cross-linker, etc.), e) select the arrangement of droplets with probes inside clusters in which groups of identical probes are located; g) select the structure and arrangement of droplets with labels that perform auxiliary functions, for example, fixing the overall dimensions of the working area of the chip, h) for iruyut and applied to the surface of chips labels identifiers, i) and probes applied drops with additional marks on the surface of the processing zone of chips, k) multichip dried and stored prior to use.

Methods of drawing points (printing) clusters

Known methods for depositing probes of oligonucleotides [21] and peptides [22] on the modified and unmodified [23, 24] surface of individual chips.

The application of solutions, which include individual probes in the form of oligonucleotides, DNA or proteins, is carried out using well-known robots, for example, Affymetrix. Differentiating oligonucleotides are applied as a single point or in clusters. The number of clusters located in the working area of each individual chip can be from 1 to 1000. For diagnostics in the field of medicine, it is preferable to use from 5 to 100 clusters. Most preferably, 5 to 20 clusters are used. Figure 10 shows an example of the location of 15 clusters in the working area of an individual chip for the diagnosis of urogenital pathogens. This example includes, but is not limited to other cluster layouts on the surface of individual chips. The placement of clusters on the surface area of the individual chip is carried out taking into account the tasks of diagnostics and / or software capabilities for data processing. Each cluster contains at least 2 points formed by solutions of differentiating oligonucleotides - probes. The number of deposited probes of one type of differentiating oligonucleotide on the surface of each cluster is from 1 to 50. For medical applications, it is preferable to place 4 to 9 probes of one type of differentiating oligonucleotide in each cluster.

In the cluster, points are applied in the form of a series of points forming rectangular, square (see Fig. 10), triangular, ellipsoidal shapes or shapes in the form of a series of circles, concentric shapes, polygons. Clusters can, in turn, organize on the surface of the working area of the chip a sequence of linear structures, rectangular, square, round or other shapes, which, on the one hand, are optimal for data processing, on the other hand, add individuality to the chips. In addition, points characterizing the quality and diagnostic parameters of monitoring can be placed on the chip’s working area, for example, positive or negative samples are applied or points are indicated that characterize the position of the zone relative to the total surface of the individual chip. The ratio between the number of clusters in which the probes are placed and the clusters in which positive or negative controls are placed is selected in the range from 1: 1 to 500: 1 The volume of the drop of the applied probe with a differentiating oligonucleotide can lie in the range from 0.005 to 0.05 μl preferably 0.02 μl. The volume of auxiliary drops, for example, for the formation of reference points, which determine, for example, the boundaries of the working area of the chip, can be from 0.05 to 0.5 μl.

Multi-chip format

The format of the chip depends on the tasks for which multichips are used in research, laboratory practice or in medical institutions. In well-known multi-chips, the number of probes and clusters formed on their basis that form the working area of the chip, as well as the number of working areas located on the surface of the chip, fluctuates significantly. For example, the invention is known with two zones [25], where each zone has 100 clusters. Known multichip, formed on the basis of a die having 96 working areas [13]. The multichip can accommodate up to 4,800,000 probes on the surface and can be targeted for use in scientific research or for large specialized institutions where mass screening is required. The invention is known [10], in which the number of zones is selected from 2 or more with a density of up to 10,000 probes per square centimeter. As mentioned earlier, in [10] methods for separating individual chips from a multichip are not described, which is problematic in many cases, for example, when fragile glass is used as the basis for a multichip.

A significant difference between the multi-chip format proposed in this invention and the known analogues is that the multi-chip allows for separation from the carrier base of both individual chips and groups of chips, fixed relative to each other or fixed to parts of the common area of the multi-chip. Such mini-multichips containing from 2 to 10 chips are useful for sequential screening, for example, in diagnosing a patient’s condition and confirming the choice of therapeutic agents. During sequential screening of samples from the group of individual chips in the diagnostic process, at least one individual chip is sequentially separated, which is used for hybridization with PCR products in individual cameras.

The method of analysis

Of the many diagnostic methods using biochips, two main areas can be distinguished. The first relates to the parallel diagnosis of multiple samples during a single parallel screening. An example of such a method of measurements using a multichip is described in the invention [13]. Quite often there is a need for sequential screening of samples obtained from one object for a period of time, for example, when examining a patient’s blood before treatment, during and after treatment. For this purpose, individual chips are currently used, for example, based on glass slides. The use of individual chips can lead to the introduction of systematic measurement errors. This is due to the fact that in the manufacture of chips and their subsequent storage, it is possible to mix several batches of chips manufactured at different times in different conditions and using different methods. Since each batch of chips is carried out with a scatter of conditions, for example, during a modification, this automatically leads to systematic errors in the interpretation of data due to different densities of supported amino groups.

In this invention, the manufacture of a multichip occurs under the same conditions, this allows you to get the same individual chips made from the same material, using the same surface modification procedure, with the same probe concentrations and reagent activities. The use of shared multichips allows you to use the principle of the differential method of analysis when conducting sequential measurements of samples taken from the same object. During the measurement process, the data of the analysis parameters of the first chip can be used as reference data for comparison with other parameters obtained during the sequential measurement of other samples. For this purpose, individual chips are used, taken from the same multichip, from which the first chip was separated. As reference data, use, for example, data on the intensity of the signals of standard labels that are applied to all chips under the same conditions at the same concentration of reagents. This method eliminates errors associated with the manufacturing process and storage of chips.

To detect individual chips or multichips, fluorescence, colorimetric measurement systems, transmission, reflection, or radioactivity measurement can be used.

Hardware and software diagnostic data identification

To realize the capabilities of the multichip for conducting parallel and sequential screenings of biological objects, a complex of hardware and software is needed to process the received data, identify it and enter it into the database.

7 shows a block diagram of an installation for conducting parallel and sequential screenings of biological objects. The structure of the block diagram includes: a computer 201, to which devices belonging to the group consisting of a display 202, a printer 203, and devices for scanning multi-chips or individual chips can be connected. Scanning devices can be selected from the group consisting of: a flatbed scanner 210, a digital CCD camera 211, a scanner 212, individual chips 110, a multi-chip scanner 213 located on a disk 140, a hand scanner 214. Data obtained by scanning from a rectangular 130 or disk 140 multi-chips, as well as from individual chips 110, are processed in a computer 201. The processed data is either provided in the form recorded on solid media, for example, on a CD disk 204, or through communication over the Internet or over a local network on a computer p 205, on the basis of which a database of many diagnostics is generated, which are stored, for example, on hard disks 206. Several users can use this information via a local network or via the Internet using their computers 207, for example, handheld computers.

It is preferable to use scanning devices for acquiring diagnostic data, which can implement at least one of three known methods: transmission measurement, reflection measurement, fluorescence measurement. The fluorescence signal is detected using, for example, an experimental setup consisting of a fluorescence microscope, a CCD camera and a computer, or a dark-field setup with a connected CCD camera [27], which uses the exciting light of laser LEDs. Colorimetric detection, for example, biotinylated DNA, is carried out using scanning devices, for example, an experimental setup consisting of a scanner and a computer, and special software.

Preferably, the hardware complex contains devices that are part of a group consisting of: hand-held barcode and image scanners, automatic flatbed scanners, scanners that provide information from individual individual chips and other scanners. The scanner converts images of the working area of the chip that is part of the multichip or specific clusters located in the working area of the chip into signals obtained by measuring fluorescence, transmittance, colorimetric measurements, reflection signals, into digital data that is sent to a computer for further processing according to different algorithms. A description of such hardware and software systems is well known in the literature.

Interpretation of the results

Figure 10 presents a variant of a medical chip in which differentiating oligonucleotides are divided into 12 (twelve) groups depending on the type of pathogen. The signal intensity of the resulting perfect or imperfect duplexes within each group is significantly higher than the signal intensity of the negative controls, which allows reliable species identification of infectious pathogens. Interpretation of the results is carried out on the basis of a hybridization picture, which is obtained using an experimental setup, including, for example, a scanner, a computer, and special software. For digital image processing, the Medskan-1 program is used.

The interpretation of the results is as follows. The intensities of fluorescent or colorimetric signals in each group of DNA probes containing oligonucleotides that are species-specific for one of the 12 infectious agents are compared using special software with the groups of probes of the positive (maximum signal intensity) and negative (minimum signal intensity) control. A hybridizable DNA sample is able to form duplexes with only one type of specific oligonucleotide in each group. As a result, a hybridization pattern is formed on the biochip, which is different for the groups of positive control, negative control and up to 15 types of infectious agents, depending on the presence of infectious agents in the test sample, which allows one to unambiguously interpret the obtained data.

Features of the hardware and software systems developed in the framework of the present invention relate to the use of multichips as an object of diagnosis. Each multichip is characterized by a list of parameters that are included in the group consisting of: a) the signal intensity in each specific cluster of the working area for each individual chip, b) the number of clusters in the working area of each individual chip and their distribution according to the objects of study, c) the number and the location of the positive and / or negative controls in the working area of each of the chips, d) the method of acquiring data on the signal intensity, e) the image of the working area of the chip in the form of a graphic image. These parameters are formed according to certain algorithms into a computer file, which is transferred to a database, for example, to a general clinic computer. In addition to these parameters, the file includes a unique identification code consisting of a combination of the first identification code of each individual chip and / or the second and third identification codes characterizing the parameters of the multichip.

A computer program identifies a unique multichip code in an automatic or interactive mode and processes the parameters recorded in a computer file when scanning a multichip or its individual components. The processing data are recorded in a file and depending on the structure of information storage in each particular medical institution are stored either on disks in the card file along with the patient’s card, or are stored in computer form on the hard drives of the hospital’s central computer. These data can be contacted by a doctor. Moreover, the search for files is performed by entering the patient code and / or scanning barcodes from the patient’s card. After receiving the diagnostic results, individual chips can be stored in the patient’s card, and when scanning the barcode of the chip and entering a request into the central computer, the latter gives complete information on a file that characterizes all the diagnostic parameters and codes. The doctor can compare the data obtained at different stages of the treatment of the disease, according to the results of independent diagnostics, and adjust the treatment or intake of certain drugs in accordance with the diagnostic data. Thus, the unique code of the multichip and its components makes it possible to simplify the program of searching for the necessary files and save diagnostic information in various forms, from computer files to storage of individual chips during the treatment of the patient.

Diagnostic kit

A kit for identifying biopolymers based on DNA probes or protein probes includes:

a) the biological multichip described in claim 1 of the claims;

b) reagents for sample preparation and identification;

The kit may further comprise a scanner using diode laser light as an exciting source of fluorescence and equipped with a CCD camera or a scanner for measuring light absorption, as well as a computer-based interpretation and storage device for identification results.

Examples

The following are examples that include, but are not limited to, the scope of the invention.

Example 1. Modification of PMMA.

Mixed 1 volume of 3-aminopropyltriethoxysilane with 9 volumes of distilled water and kept for 1 hour at room temperature. Then a PMMA sample was placed in this solution and kept for 2 hours at 40 ° C. The substrate was washed twice with water and once with ethanol. Drying was carried out at room temperature.

Example 2. Modification of PMMA.

Mixed 1 volume of 3-aminopropyltriethoxysilane with 19 volumes of distilled water and kept for 1 hour at room temperature. Then a PMMA sample was placed in this solution and kept for 3 hours at 30 ° C. The substrate was washed twice with water and once with ethanol. Drying was carried out at room temperature.

Example 3. Modification of PVC.

Mixed 1 volume of 3-aminopropyltriethoxysilane with 19 volumes of distilled water and kept for 1 hour at room temperature. Then, a polyvinyl chloride sample was placed in this solution and kept for 1 hour at 45 ° C. The sample was washed twice with water and once with ethanol. Drying was carried out at room temperature.

Example 4. Modification of polycarbonate.

Mixed 1 volume of 3-aminopropyltriethoxysilane with 15 volumes of distilled water and kept for 1 hour at room temperature. Then, a polycarbonate sample was placed in this solution and kept for 3 hours at 30 ° C. The substrate was washed twice with water and once with ethanol. Drying was carried out at room temperature.

Example 5. Modification of glass.

Microscopic glasses (Menzel, Germany) were placed for 1 hour in a 1% solution of ammonia, washed with water and filled for an hour with a chromium mixture containing up to 2% (v / v) oleum. The glasses were thoroughly washed with running, then twice distilled water, ethyl alcohol and dried in an upright position for 20 minutes at 120 ° C.

A 5% solution of 3-aminopropyltriethoxysilane in acetone was poured into a container with vertically arranged glasses and kept for one hour. The glasses were washed three times with acetone (5 minutes each), then ethanol (2 times 3 minutes) and dried at a temperature of 130 ° C for 20 minutes.

Example 6. Sewing a fluorescently labeled oligonucleotide probe to the surface of an amino-modified glass.

To check the quality of the obtained aminated surface, a fluorescence-labeled probe was covalently sewn and then the level of fluorescence of the clusters and background were recorded. As a probe, an oligonucleotide modified with a phosphate group at the 5'-position and 6-carboxyfluorescein (FAM) at the 3'-end was used:

SEQ ID: 1 TST CTT TAG GCA TTG GTT TCG AAG CGG GCA

The reaction mixture containing 1 μM oligonucleotide and 60 mm EDC in 0.1 M 1-methylimidazole, pH 7.0, was applied to the glass surface with a robot (Xpress Lane, USA), the droplet volume ranged from 10 to 50 nl. The glasses were placed in a sealed container and kept at room temperature for one hour in a humid atmosphere to prevent droplets from drying out. Then the glasses were washed on a shaker with a 1 mM NaOH solution for 10 minutes to remove non-covalently bound oligonucleotide molecules, treated with distilled water and stored at 4 ° C.

Example 7. Detection of a fluorescently labeled probe. Chromophore fluorescence (FAM) was excited in the spectral range 450–490 nm and recorded in the range 510–560 nm using HQ470 / 40X and HQ535 / 50M interference filters (Chroma Technology Corp., USA), respectively. The image of the glass surface was projected onto a CCD matrix of a WAT-120N monochrome television camera (Watec Co., Ltd., Japan), which converted the optical signal into an electric signal and transmitted it to a video capture card installed in the computer. The camera worked in linear mode. Then the signal was converted to digital form and processed by a computer using the original QuantA image analysis program. The program allows you to calculate the integrated brightness of the selected image areas. Fluorescence measurement data are presented in relative units on an 8-bit gray scale (256 brightness levels). The integrated spot color intensity / background intensity is 103/11. On Fig presents an image of a cluster consisting of 4 points deposited on the surface of a modified glass chip.

Example 8. Sewing an oligonucleotide probe to the surface of an amino-modified PMMA.

As a probe, an oligonucleotide modified with a phosphate group at the 5'-position was used:

SEQ ID: 1 TCT CTT TAG GCA TTG GTT TCG AAG CGG GCA

The reaction mixture containing 1 μM oligonucleotide and 60 mm EDC in 0.1 M 1-methylimidazole, pH 7.0, was applied to the surface of the substrate by a robot (Xpress Lane, USA), the droplet volume was from 10 to 50 nl. The substrate was placed in a sealed container and kept at room temperature for one hour in a humid atmosphere to prevent droplets from drying out. Then the substrate was washed on a shaker with 1 mm NaOH solution for 10 minutes to remove non-covalently bound oligonucleotide molecules, treated with distilled water and stored at 4 ° C.

Example 9. Hybridization with biotinylated primer.

Prior to hybridization, biotin-labeled PCR products containing a sequence complementary to the immobilized oligonucleotide were added with 20 × SSC buffer (not more than 5% v / v) and SDS to a final concentration of 0.1%. From 10 to 20 μl of the resulting mixture was applied to the working area of the substrate and covered with a coverslip. Hybridization was carried out at 45 ° C for one hour. At the end of the reaction, the excess mixture was washed with 5 × SSC hybridization buffer, 0.1% SDS and then thoroughly washed on a shaker with the following solutions: 2 × SSC, 0.1% SDS - 2 times for 5 minutes; 0.1 × SSC, 0.1% SDS - 2 times for 3 minutes; 0.1 × SSC - 2 shifts of 1 minute.

Example 10. The peroxidase reaction.

The initial streptavidin-peroxidase conjugate (Imbio, Russia) was diluted sequentially 200 times with 1 × SSC containing 1% BSA. The conjugate was applied to the working area of the substrate, covered with a coverslip and kept in a humid atmosphere at room temperature for 30 minutes. Unbound conjugate was washed with 2 × SSC for 5 minutes, 1 × SSC for 5 minutes and 0.1 × SSC for 1 minute.

The substrate was poured with a freshly prepared solution of the substrate dimethylaminobenzidine (DAB). For this, no more than half an hour before the reaction, 1 mg DAB was dissolved in 1 ml of 0.1 × SSC, 20 μl of a 3% hydrogen peroxide solution was added and mixed. The working area was poured with the prepared substrate solution, covered with a coverslip and kept for 10 to 30 minutes at room temperature. In the case of a positive reaction, brown spots of the oxidized substrate appeared. Then the glass was washed with distilled water and placed in a vertical position in a container for drying and further storage

Example 11. Detection of a chromogenic probe.

To obtain images of hybridization clusters, a Nikon CoolScan 9000ED slide scanner was used. Then, quantitative image processing was performed using the original AnGene program. The result of image analysis of a hybridization cluster, consisting of 9 points, placed on a substrate made of PMMA, is shown in Fig.9. Analysis of the result gives the average color intensity in the zones equal to 43.9, and the background intensity is 1.2 (in arbitrary units).

Example 12. The manufacture of a multichip from a polymer

We took a PMMA array with a size of 1500 mm × 1500 mm and a thickness of 1 mm, cut strips 210 mm wide, formed recesses and through holes between the chips on the working surface according to formula 1, cut blanks 290 mm long (A4 format) or formed recesses between individual multichips. The working surface, if necessary, was cleaned, washed and dried.

Industrial applicability

The invention relates to a multichip device and a method for its use for analysis of samples obtained in molecular biology, pharmacology, medicine and environmental protection. In particular, the invention relates to a method for manufacturing and using a multichip, which allows both sequential and parallel diagnostics based on protein or DNA probes using different types of identifiers and methods for processing the results.

The main advantages of the new design of the multichip and the method of manufacturing the multichip, as well as the method of analyzing the diagnostic results, are the low cost of producing multichips and the cheaper diagnostics, as well as the possibility of simultaneous analysis of many samples on one multichip during mass screening, as well as the expansion of the use of multichips for diagnostics in molecular biology, pharmacology, medicine and environmental protection.

Literature

1. McGall, Glenn H. Method for producing a high density nucleic acid array using activators. US Patent Applic. 20040180368 (September 16, 2004).

2. Beletsky I.P. etc. A set of primers for the detection and / or identification of transgenic DNA sequences in plant material and its containing products (options), a primer (options), a pair of primers (options), a method for detection and / or identification using them (options) and a device to implement the method. Patent RU2265668 (2005.12.10).

3. Mirzabekov A.D. et al. A method for identifying transgenic DNA sequences in plant material and products based on it, a set of oligonucleotides and a biochip for implementing this method. Patent RU 2270254 (2006.02.20).

4. Sugiyama Y. et al. Biochip substrate holding method and biochip-reader. US Patent Applic. 20050136533 (June 23, 2005).

5. Sheridan R. et al. Method and apparatus for accessing a site on a biological substrate. US Patent 6673315 (January 6, 2004).

6. Bevirt J. et al. Microarray placer unit. US Patent Applic. 20040136868 (July 15, 2004).

7. Ganz B.L. et al. Microarray dispensing with real-time verification and inspection. US Patent 6558623 (May 6, 2003).

8. Bass J.K. Feature quality in array fabrication. US Patent 6587579 (July 1, 2003).

9. Remade J. et al. Detection and / or quantification method of a target molecule by a binding with a capture molecule fixed on the surface of a disc. US Patent Applic. 20020177144 (November 28, 2002).

10. Dellinger D.J. et al. Quality control method for array manufacture. US Patent Applic. 20050186580 (August 25, 2005).

11. Lefkowitz S. M. et al. Chemical arrays. US Patent Applic. 20030077380 (April 24, 2003).

12. Schembri S.T. et al. Packaged microarray apparatus and a method of bonding a microarray into a package. US Patent Applic. 20030113724 (June 19, 2003).

13. Rava R.P. et al. Methods for concurrently processing multiple biological chip assays. US Patent 6720149 (April 13, 2004).

14. Hanzel D.K. Vapor phase method for producing silane coatings. US Patent Appl. 20040069634 (April 15, 2004).

15. Moffat W.A. et al. Silane coated substrate. US Patent Appl. 20050089695 (April 28, 2005).

16. Laguitton B. Silsesquioxane-coated substrates for immobilizing biomolecules. US Patent Appl. 20020090739 (July 11, 2002).

17. But Chih-Wei et al. High density functional slide and preparation method thereof. US Patent Appl. 20020028506 (March 7, 2002).

18. Buchardt, O. et al. Polymer modification. US Patent 5,077,344 (December 31, 1991).

19. Fixe F. et al. Functionalization of poly (methyl methacrylate) (PMMA) as a substrate for DNA microarrays. Nucleic Acids Research, Vol. 32, No. 1 e9 (, 2004).

20. Duffy et al. Methods of arraying biological materials using peelable and resealable devices. US Patent 7001740 (February 21, 2006).

21. Ershov G.M. and others. A method of microdosing aqueous solutions of substances on a carrier and device for its implementation. Patent RU 2041263 (1995.08.09).

22. Mirkin C.A. et al. Protein and peptide nanoarrays. US Patent Applic. 20030068446 (April 10, 2003).

23. Zarytova V.F. et al. A method for producing DNA chips. Patent RU 2236467 (2004.09.20).

24. Garimella, V. et al. Method for attachment of silylated molecules to glass surfaces. US Patent Applic. 20040096856 (May 20, 2004).

25. Zeleny R. et al. Automatic imaging and analysis of microarray biochips. US Patent 6,215,894 (April 10, 2001).

26. Cattell H.F. Chemical array fabrication and use. US Patent 6879915 (April 12, 2005).

27. Barsky V.E. Fluorescence microscope. Patent RU 2182328 (2002.05.10).

28. Schembri C.T. Tiling process for constructing a chemical array. US Patent 6,875,620 (April 5, 2005).

29. Mao Y. et. Al. Gene chip carrier for multiple person diagnosis. CN 1314493 (2001-09-26).

30. Genghi H. Miniature reaction cup type protein chip. CN 1580770 (2005-02-16).

31. Kojima Y. et. Al. Method for preparing biochip and biochip. JP 2004028734 (2004-01-29).

Sequence listing

<110> Applicant:

Name: Molecular Medical Technologies CJSC Location: 142290, Pushchino, Prospect Nauki, 3

<120> Title of invention: "A method of manufacturing a multifunctional multichip, a multichip for sequential or parallel screening of biopolymers, a method for analyzing biopolymers using a multichip, a kit for identifying biopolymers."

<160> number of sequences: 1

<210> Sequence No.: SEQ ID NO: 1

<211> Length: 30 nucleotides

<212> Type of molecule: single-stranded linear DNA

<213> Origin: synthetic sequence

<223> Purpose: primer

<400> Sequence Description of SEQ ID NO: 1:

TCTCTTTAGGCATTGGTTTCGAAGCGGGCA

Claims (25)

1. A multichip for sequential or parallel screening of biopolymers, which is a carrier element, on the surface of which there is an array containing N individual chips with probes that can specifically bind to the desired biopolymers, and an identifier, characterized in that there is an array in the carrier element in which N individual chips contain the first and second identifiers, as well as a common zone, which is located in the same plane with the specified array and contains the third identifier, the first the th identifier contains the first code, the second identifier contains the second code, the third identifier contains the third or second code, and these codes form unique N pairs of codes characterizing the multifunctional chip, and the common zone is located on the border or in the center of the specified array, and the connection between it and individual chips are made with the possibility of separation. 2. A multichip according to claim 1, characterized in that for diagnostics in medicine, a multichip contains from 2 to 10 chips. 3. The multichip according to claim 1, characterized in that the supporting element has the shape of a rectangle, square, polygon or circle. 4. The multichip according to claim 1, characterized in that the supporting element has a thickness of 0.5-5 mm 5. The multichip according to claim 3, characterized in that the supporting element has the shape of a rectangle. 6. The multichip according to claim 5, characterized in that the ratio of the length and width of the supporting element lies in the range from 1: 1 to 1:50. 7. The multichip according to claim 1, characterized in that the supporting element is made of a material that is selected from the group consisting of polymer, glass, ceramics and their composition. 8. The multichip according to claim 7, wherein the polymer is selected from the group consisting of polymethyl methacrylate, polybutyl methacrylate, polyvinyl chloride, polycarbonate, methyl methacrylate copolymers and / or butyl methacrylate copolymers with monomers such as styrene and acrylonitrile. 9. The multichip of claim 8, wherein the polymer is polymethylmethacrylate. 10. The multichip of claim 8, wherein the polymer is polyvinyl chloride. 11. The multichip according to claim 1, characterized in that the first, second and third identifier are made in the form of digital and / or letter designations, or barcodes, or combinations thereof. 12. The multichip according to claim 1, characterized in that each individual chip contains a working area, which is divided into 1-1000 clusters. 13. The multichip according to claim 1, characterized in that each individual chip contains a working area, which is divided into 15 clusters. 14. The multichip according to claim 12, characterized in that the clusters are clusters of probes and clusters that are selected from the group consisting of a cluster of positive controls and a cluster of negative controls. 15. The multichip according to 14, characterized in that the ratio between the number of probe clusters and clusters of positive controls is from 1: 1 to 500: 1. 16. The multichip according to claim 14, characterized in that the ratio between the number of probe clusters and clusters of negative controls is from 1: 1 to 500: 1. 17. The multichip according to claim 1, characterized in that it is intended for screening nucleic acids and contains, as probes, differentiating oligonucleotides, which are presented in the form of clusters, each cluster containing from one to fifty differentiating oligonucleotides of the same type. 18. The multichip according to claim 1, characterized in that it is intended for screening nucleic acids and contains differentiating oligonucleotides as clusters, each cluster containing 4 or 9 differentiating oligonucleotides of the same type. 19. The method of manufacturing a multichip according to claim 1, comprising placing an array on the surface of the carrier element containing N individual chips with probes capable of specifically binding to the desired biopolymers and an identifier, characterized in that a common zone is formed on the surface of the carrier element, which is located in one planes with the indicated array, the first identifier containing the first code and the second identifier containing the second code are placed on the surface of individual chips, and on the surface of the common zone they place a third identifier containing a third or second code, and the common zone is formed on the border or in the center of the indicated array, the connection between it and individual chips is separable, these codes form unique N pairs of codes characterizing a multifunctional chip. 20. A method for the diagnosis of DNA, which provides for the study of DNA samples, direct and reverse specific primers, multiplex PCR, hybridization of amplification products with differentiating oligonucleotides on the surface of the multichip or on the surface of the chips obtained by disconnecting from the specified multichip, detection and identification of the results, characterized in that as a multichip use the multichip according to claim 1, which contains differentiating oligonucleotides as probes, and the identification of the result comrade performed with the first, second and third identifiers. 21. The method according to claim 20, characterized in that the identification of the results is carried out by comparing the results with database data using software tools. 22. The method according to claim 20, characterized in that when the hybridization of the amplification products is carried out on chips obtained by disconnecting from the specified multichip, the first, second and third identifier, as well as the diagnostic results, are entered into a database where they are stored in order to use for quick search and identification of parameters of individual chips or groups of individual chips relative to each other. 23. A kit for identifying biopolymers using probes, which are DNA or proteins, consisting of a multichip according to claim 1, in which the probes are DNA or proteins, and reagents for sample preparation and identification of biopolymers. 24. The kit according to item 23, which contains either a scanner using diode laser light and equipped with a CCD camera as a fluorescence source, or a scanner for measuring light absorption. 25. The kit according to claim 25, which comprises a device for interpreting and storing computer-based biopolymer identification results.

Images