PT1771474E - Inhibitors of angiopoietin-like 4 protein, combinations, and their use - Google Patents

Inhibitors of angiopoietin-like 4 protein, combinations, and their use Download PDF

Info

Publication number
PT1771474E
PT1771474E PT05790352T PT05790352T PT1771474E PT 1771474 E PT1771474 E PT 1771474E PT 05790352 T PT05790352 T PT 05790352T PT 05790352 T PT05790352 T PT 05790352T PT 1771474 E PT1771474 E PT 1771474E
Authority
PT
Portugal
Prior art keywords
angptl4
antagonist
antibody
amp
quot
Prior art date
Application number
PT05790352T
Other languages
Portuguese (pt)
Inventor
Napoleone Ferrara
Hans-Peter Gerber
Xiao Huan Liang
Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
Priority to US58978204P priority Critical
Application filed by Genentech Inc filed Critical Genentech Inc
Publication of PT1771474E publication Critical patent/PT1771474E/en
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=35787710&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=PT1771474(E) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2839Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the integrin superfamily
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Description

ΕΡ 1 771 4 7 4 / EN

DESCRIPTION " Angiopoietin type 4 protein inhibitors, combinations and their use "

FIELD OF THE INVENTION

This invention relates generally to the treatment of human diseases and pathological conditions, such as cancer. The invention relates to angiopoietin type 4 inhibitors (ANGPTL4), combinations of ANGPTL4 inhibitors with other therapeutic agents, and to methods of using such compositions for the diagnosis and treatment of diseases or pathological conditions.

BACKGROUND OF THE INVENTION Cancer is one of the leading causes of death in the United States. Various types of therapies have been used to treat cancer. For example, surgical methods are used to remove cancerous or necrotic tissue. Radiation therapy, which works by reducing solid tumors, and chemotherapy, which kill cells in rapid division, are used as cancer therapies.

In 1971, Folkman proposed that anti-angiogenesis may be an effective anticancer strategy. Folkman, N. Engl. J. Med. 285, 1182-1186 (1971). Angiogenesis is the development of new vasculature from preexisting blood vessels and / or circulating endothelial stem cells (see, e.g., Ferrara and Alitalo, Nature Medicine 5 (12) 1359-1364 (1999)). Angiogenesis is a cascade of processes consisting of 1) degradation of the extracellular matrix of a local venule after protease release, 2) capillary endothelial cell proliferation and 3) migration of capillary tubules to angiogenic stimulus. Ferrara et al. Endocrine Rev. 13: 18-32 (1992). Growth of new blood vessels is a prerequisite during normal physiological processes of embryonic and postnatal development, e.g., embryogenesis, wound healing, and menstruation. See, e.g., Folkman and Klagsbrun 2 ΕΡ 1 771 474 / ΡΤ

Science 235: 442-447 (1987). This proliferation of new blood vessels from pre-existing capillaries further plays a key role in the pathological development of various disorders, including but not limited to eg tumors, proliferative retinopathies, age-related macular degeneration, psoriasis, inflammation, diabetes, and rheumatoid arthritis (RA). See, e.g., Ferrara, Recent Prog. Horm. Res. 55: 15-35 (2000), discussion 35-6.

Taking into account the extraordinary physiological and pathological importance of angiogenesis, much effort has been devoted to elucidating the factors capable of regulating this process. It has been suggested that the angiogenesis process is regulated by a balance between pro-angiogenic and antiangiogenic molecules and that it is deregulated in various diseases, especially cancer. See, e.g., Carmeliet and Jain Nature 407: 249-257 (2000).

For example, angiogenesis is dependent on excreted factors, such as vascular endothelial growth factor A (VEGF, also called vascular permeability factor (VPF)) and fibroblast growth factor (FGF). See, e.g., Ferrara and Davis-Smyth Endocrine Rev. 18: 4-25 (1997); and Ferrara J. Mol. Med. 77: 527-543 (1999). In addition to being an angiogenic factor in angiogenesis and vasculogenesis, VEGF, as a pleiotropic growth factor, exhibits various biological effects in other physiological processes, such as endothelial cell survival, vessel permeability and vasodilation, monocyte chemotaxis and calcium influx. Ferrara and Davis-Smyth (1997), supra. In addition, some studies have reported mitogenic effects of VEGF on some types of non-endothelial cells, such as retinal pigment epithelial cells, pancreatic duct cells and Schwann cells. See, e.g., Guerrin et al. J. Cell Physiol. 164: 385-394 (1995); Oberg-Welsh et al. Mol. Cell. Endocrinol. 126: 125-132 (1997); and Sondell et al. J. Neurosci. 19: 5731-5740 (1999). VEGF belongs to a family of genes including placental growth factor (PIGF), VEGF-B, VEGF-C, VEGF-D and VEGF-E. These ligands bind to and coordinate with tyrosine kinase receptors expressed on endothelial cells. For example, the family of VEGF tyrosine kinase receptors includes Flt1 (VEGF-R1) (linking the VEGF, VEGF-B and PIGF ligands), Flk1 / KDR (VEGF-R2) (which VEGF-C, VEGF-D and VEGF-E) and Flt 4 (VEGF-R3) (which binds VEGF-C and VEGF-D). See, e.g., Ferrara et al., Nature Medicine 9 (6): 669-676 (2003); and Robinson and Stringer, Journal of Cell Science, 114 (5): 853-65 (2001).

Angiopoietins are another group of growth factors for the vascular endothelium. See, e.g., Davis et al., Cell, 87: 1161-1169 (1996); Suri et al., Cell, 87: 1171-1180 (1996); Maisonpierre et al. Science 277: 55-60 (1997); and Valenzuela et al., Proc. Natl. Acad Sci. USA 96: 1904-1909 (1999). Angiopoietins appear to function in a complementary and coordinated fashion with VEGF, in which VEGF acts on vascular development, whereas angiopoietins most likely act in modulating vasculature remodeling, maturation, and stabilization. See, e.g., Holash et al., Oncogene 18: 5356-5362 (1999). Angiopoietin 1, angiopoietin 2, angiopoietin 3 and angiopoietin 4 bind to Tie 2 tyrosine kinase receptors (also called Tek), which are receptors present on endothelial cells. See, e.g., Ward and Dumont, Seminars in Cell & Developmental Biology, 13: 19-27 (2002). There is also an orphan Tiel receiver. Angiogenesis does not only depend on growth factors but is also influenced by cell adhesion molecules (CAMs), including integrins, binding to their ligands present within the extracellular matrix. See, e.g., Ferrara and Alitalo, Nature Medicine 5 (12) 1359-1364 (1999); and Carmeliet, Nature Medicine, 6 (3): 389-395 (2000). Integrins facilitate cell adhesion and migration of extracellular matrix proteins present in intercellular spaces and basement membranes. The integrin family of the cell adhesion proteins is composed of at least 18 α subunits and 8 β subunits that are expressed in at least 22 αβ heterodimeric combinations. See, e.g., Byzova et al., Mol. Cell., 6 (4): 851-860 (2000); and Hood and Cheresh, Nature Reviews, 2: 91-99 (2002). Of these, at least six of the combinations (ανβ3, ανβ5, α5βι, α2βι, ανβι and αιβι) were implicated in angiogenesis (see, e.g., Hynes and 4

ΕΡ 1 771 4 7 4 / EN

Bader, Thromb. Haemost., 78 (1): 83-87 (1997); and Hynes et al.

Braz. J. Med. Biol. Res., 32 (5): 501-510 (1999)). Inactivation of several genes encoding specific adhesion receptors or administration of blocking antibodies in animal models has profound effects on the angiogenic response of endothelial cells. See, e.g., Elicieri and Cheresh, Mol. Med., 4: 741-750 (1998).

These molecules have been targeted for cancer therapies. For example, recognition of VEGF as a primary regulator of angiogenesis under pathological conditions has led to numerous attempts to block the activities of VEGF. Anti-VEGF receptor inhibitory antibodies, soluble receptor constructs, antisense strategies, VEGF RNA aptamers, and low molecular weight VEGF receptor tyrosine kinase (RTK) inhibitors have all been proposed for use for interference in signaling VEGF. See, e.g., Siemeister et al. Metastasis Cancer Rev. 17: 241-248 (1998). Anti-VEGF neutralizing antibodies have been shown to suppress the growth of several human tumor cell lines in nude mice (Kim et al., Nature 362: 841-844 (1993); Warren et al., J. Clin. Invest. 1789-1797 (1995), Borgström et al., Cancer Res. 56: 4032-4039 (1996) and Melnyk et al., Cancer Res. 56: 921-924 (1996)) and also inhibit intraocular angiogenesis in models of ischemic retinal disorders (Adamis et al., Arch. Ophthalmol 114: 66-71 (1996)). In fact, a humanized anti-VEGF antibody, bevacizumab (AVASTIN®, Genentech) has been approved by the US Food and Drug Administration as a first-line therapy for metastatic colorectal cancer. See, e.g., Ferrara et al., Nature Reviews Drug Discovery, 3: 391-400 (2004).

However, current cancer treatment methods are not always optimal. Often, a single type of therapy can not completely suppress a pathological condition. For example, using surgical procedures it is often not possible to remove all cancerous growth. Other cancer treatments, such as chemotherapy, have numerous side effects and / or the therapy becomes ineffective, e.g., because the cancer develops resistance to the drug or treatment. Inhibition of VEGF or a VEGR receptor or the Tie2 receptor system has sometimes not suppressed

And completely tumor growth. See, e.g., Gerber et al., Cancer Research, 60: 6253-6258 (2000); Ferrara et al.,

Nature Reviews: Drug Discovery, 3: 391-400 (2004); Millauer et al., Nature 367, 576-579 (1994); Kim et al., Nature 362: 841-84 (1993); Millauer et al., Cancer Res. 56: 1615-1620 (1996);

Goldman et al., Proc. Natl. Acad. Know. USA 95: 8795-8800 (1998); Asano et al., Cancer Research, 55: 5296-5301 (1995); Warren et al, J. Clin. Invest., 95: 1789-1797 (1995); Fong et al., Cancer Res. 59: 99-106 (1999); Wedge et al., Cancer Res. 60: 970-975 (2000); Wood et al. Cancer Res. 60: 2178-2189 (2000); Siemeister et al., Cancer Res. 59: 3185-3191 (1999); Lin et al., J. Clin. Invest. 103: 159-165 (1999); Lin et al.,

Proc. Natl. Acad. Know. USA 95: 8829-8834 (1998); and Siemeister et al., Cancer Res. 59, 3185-3191, (1999).

Thus, there is an urgent need for new, more effective therapies to regulate cancers. The invention focuses on these and other needs, as will be apparent from review of the following disclosure.

The invention relates to angiopoietin-type protein 4 inhibitors (ANGPTL4) and methods of using such inhibitors to treat diseases and pathological conditions, eg, to block or reduce tumor growth or growth of cancer cells, to block or reduce relapses of tumor growth, etc. The invention provides combinations of ANGPTL4 inhibitors and anticancer agents and methods of using such combinations, to inhibit tumor growth. The invention also provides combinations of ANGPTL4 inhibitors and angiogenesis inhibitors and methods of using such combinations, to inhibit the growth of cancer and / or disorders involving angiogenesis, e.g., neoplastic (e.g., tumor growth) and non-neoplastic disorders.

ANGPTL4 modulators are provided, e.g., antagonists or agonists of ANGPTL4. The ANGPTL4 antagonists of the invention are molecules that inhibit or reduce the activity of ANGPTL4. An ANGPTL4 inhibitor may include a low molecular weight substance, a polynucleotide, antisense molecules, RNA aptamers, ribozymes against ANGPTL4 or their receptor polypeptides, a polypeptide, ANGPTL4 antagonist variants, a protein a recombinant protein, an antibody or conjugates thereof, or fusion proteins thereof, which inhibit an activity of ANGPTL4, directly or indirectly. In certain embodiments, an ANGPTL4 antagonist includes an antibody that binds to ANGPTL4. In certain embodiments of the invention, an ANGPTL4 antagonist antibody is an antibody that inhibits or reduces the activity of ANGPTL4 by binding to a specific subsequence or region of the ANGPTL4 protein, eg, N-terminus, N-terminally coiled helix domain, C-terminus, C-terminal fibrinogen-like domain or the amino acid subsequences ANGPTL4 (1-183), ANGPTL4 (23-183), ANGPTL4 (1 to about 162), ANGPTL4 (about 162-406), ANGPTL4 (23-406) or angPTL4 (184-406) of human ANGPTL4 and / or amino acid subsequences mANGPTL4 (1-183), mANGPTL4 (23-183), mANGPTL4 (1 to about 165), mANGPTL4 (23 to about 165), mANGPTL4 ( 23-410) or murine ANGPTL4 mANGPTL4 (184-410). Other subsequences also include, but are not limited to, eg, 40-183, 60-183, 90-183, 100-183, 120-183, 140-183, 40-406, 60-406, 80-406, 100- 406, 120-406, 140-406 and 160-406 of hANGPTL4 and, eg, 40-183, 60-183, 80-183, 100-183, 120-183, 140-183, 40-410, 60-410 , 80-410, 100-410, 120-410, 140-410 and 160-410 of mANGPTL4.

In certain embodiments of the invention, an ANGPTL4 antagonist includes an anti-avPs antibody, e.g., an anti-avPs antagonist antibody. In certain embodiments, the antibodies of the invention are humanized antibodies. In certain embodiments of the invention, an ANGPTL4 antagonist is a siRNA molecule. In one embodiment, the siRNA molecule is an ANGFTL4-siRNA molecule, wherein the molecule targets a DNA sequence (e.g., GTGGCCAAGCCTGCCCGAAGA, SEQ ID NO: 3) of a nucleic acid encoding ANGPTL4.

Methods are provided for blocking or reducing tumor growth or growth of a cancer cell. In certain embodiments, the methods include administering to the tumor or cancer cells an effective amount of an angiopoietin 4 antagonist (ANGPTL4). In another embodiment, the ANGPTL4 antagonist is an anti-Î ± v β5 antagonist antibody. The effective amount blocks or reduces tumor growth or cancerous cell growth. Also provided are methods for inhibiting migration of tumor cells. For example, a method includes administering an effective amount of an ANGPTL4 antagonist to tumor cells, thereby inhibiting their migration. In one embodiment of the invention, administration of the ANGPTL4 antagonist inhibits metastasis.

An additional therapeutic agent, eg, one or more anti-cancer agents, multiple antibodies to the same antigen or to different antigens, one or more antiangiogenic agents or inhibitors, medication for the anti-angiogenic agents may be combined and / or administered with an ANGPTL4 antagonist. pains, etc. Additional therapeutic procedures, e.g., surgical procedures, irradiation, etc., may also be performed or administered to the tumor and / or cancer cells in the methods or compositions of the invention. The invention also provides combination compositions, e.g., a composition that includes an anticancer agent (e.g., antiangiogenic agent, etc.), an ANGPTL4 antagonist and a carrier (e.g., pharmaceutically acceptable carrier).

An anticancer agent includes, but is not limited to, e.g. anticancer agents known in the art and those described herein. In certain embodiments, an anticancer agent comprises one or more antiangiogenic agents, e.g., an antagonist or inhibitor of VEGF, etc. In one embodiment, a VEGF antagonist comprises an anti-VEGF antibody or its active fragment (e.g., humanized A4.6.1, Avastin, etc.). In certain embodiments, an anticancer agent comprises one or more chemotherapeutic agents.

Combination methods are provided to block or reduce tumor growth or growth of a cancer cell. In certain embodiments, the methods include administering to the tumor or cancer cell an effective amount of anticancer agent and administering to the tumor or cancer cell an effective amount of ANGPTL4 antagonist. Alternatively or in addition, a combination composition comprising an effective amount of an anticancer agent (e.g., antiangiogenic agent, etc.) and an effective amount of an ANGPTL4 antagonist may be administered. The combined effective amounts block or reduce tumor growth or the growth of cancer cells.

Methods of blocking or reducing relapses of tumor growth or relapse of cancer cell growth are also provided. In certain embodiments of the invention, the subject has been subjected to cancer therapy or is concurrently performing cancer therapy with at least one anticancer agent and administering to the subject an effective amount of an ANGPTL4 antagonist. Administration of the effective amount of ANGPTL4 antagonist blocks or reduces relapse of tumor growth or relapse of growth of cancer cells. In certain embodiments, the subject has been on therapy or is concurrently in therapy with an ANGPTL4 antagonist and the subject is administered an effective amount of an anticancer agent (eg, an antiangiogenic agent), wherein administering the effective amount of the anticancer agent blocks or reduces relapse of tumor growth or relapse of cancer cell growth.

Typically, the tumor or cancer cell is in an individual. In certain embodiments, the subject has been in cancer therapy or is or will be concurrently in cancer therapy with at least one anti-cancer agent.

Typically, the subject is a mammal (e.g., a human). In certain embodiments, the agents of the invention are administered to a subject. The administration or steps of the procedure may be performed in any order. In one embodiment, they are performed sequentially. In another embodiment, they are performed concomitantly. Alternatively or in addition, the steps may be performed as a sequential and concomitant combination, in any order.

ANGPTL4 modulator kits are also provided. In certain embodiments, a kit includes an ANGPTL4 antagonist, a pharmaceutically acceptable carrier, diluent or carrier and a container. In one embodiment, a kit includes a first amount of an anticancer agent (eg, an antiangiogenic agent, etc.), a second amount of an ANGPTL4 antagonist and a pharmaceutically acceptable carrier, vehicle or diluent and a pharmaceutically acceptable carrier. container. In another embodiment, a kit includes an amount of an anticancer agent (e.g., an antiangiogenic agent, etc.) and a pharmaceutically acceptable carrier, vehicle or diluent in a first unit dosage form; an amount of an ANGPTL4 antagonist and a pharmaceutically acceptable carrier, vehicle or diluent in a second unit dosage form; and a container. Instructions for use may also be included.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows a nucleic acid sequence of human ANGPTL4 (SEQ ID NO: 1). Figure 2 shows an amino acid sequence of human ANGPTL4 (SEQ ID NO.2). Figure 3, panel A depicts purified recombinant murine ANGPTL4 (23-410) separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (4-20%) in the presence of dithiothreitol (DTT) (10 mM) or its absence. Figure 3, panel B shows wild-type hUGPTL4 (lane 1) and variant (lane 2) separated on an SDS gel and detected by " Western " hybridization, wherein the hANGPTL4 variant has a R162G and R164E substitution. Figure 4, panels A, B and C illustrates schematically that ANGPTL4 stimulates the proliferation of A673 tumor cells (panel A and B) and U87MG tumor cells (panel B) by transducing tumor cells with an ANGPTL4 expression construct and with medium conditioning of COS (C) cells transduced with an ANGPTL4 (2) expression construct (panel C). In panel B, tumor cells are transduced with (1), which is an expression construct control of

AdLacZ, (2), which is the expression construct of Ad-ANGPTL4 or (3), which is the Ad-ARNpi construct ANGPTL4. In panel C, proliferation of the A673 tumor cells is performed with Hepa (A), HMVEC (B) or COS (C) cell conditioned media transduced with (1) a LacZ expression construct, (2) 10Î ± 1 771 474 / ΡΤ an ANGPTL4 expression construct or (3) an ANGPTL3 expression construct. Figure 5 illustrates schematically that mANGPTL4 stimulates the proliferation of A673 when coating culture plates. Figure 6, panels A and B schematically illustrates various forms (panel A) of binding of ANGPTL4 to tumor cells A673 and under various conditions (panel B). Figure 7, panels A and B illustrates schematically the proliferation of A673 with medium containing ANGPTL4 when cultured for 7 days (panel A) or 4 days (panel B). In panel A (1) is an expression construct control of AdLacZ, (2) is an Ad-hANGPTL4 expression construct and (3) is an expression construct of AdLacZ and rmANGPTL4. In panel B, (1) is without any addition, (2) is a buffer control, (3) mANGPTL4 (2.5 pg / ml), (4) is hANGPTL4 (2.5 pg / ml), (5 ) is hIgG-hANGPTL4 (2.5 pg / ml) and (6) hIgG-mANGPTL4 (2.5 pg / ml). Figure 8, panels A, B and C schematically illustrates that ANGPTL4 promotes tumor growth in vivo (panel A and panel B) and the tendency to escape antitumor treatment, eg, with an anti-VEGF antibody (AVASTIN® (Genentech, South San Francisco)), in tumors with intratumoral administration of adenovirus-Angptl4 constructs (panel C). Panels A and C illustrate tumor size in cm 3 as a function of days after tumor implantation. Panel B shows the weight of xenoxerted A673 tumor 20 days post-implant. Figure 9 illustrates that ANGPTL4 induces cell migration of tumor cells, A673 and 4T-1, wherein (1) is without serum addition, (2) is 10% fetal calf serum (FCS), (3) is PDGF -BB and (4) ANGPTL4. Figure 10, panels A and B, illustrates that anti-hANGPTL4 antibodies inhibit the growth of tumor cells, eg, panel A (HeLa-S3 and Caki cells) and panel B (U87MG, 293 and A693 cells), wherein 1) are anti-hANGPTL4 antibodies, (2) is critical region 1 anti-protein control antibody of 11 Î »771 474 / ΡΤ Down syndrome (Dscr) and (3) is without any addition, wherein the numbers by below the bar graph indicate the antibody concentration in (æg / ml). Figure 11 shows adhesion of 293-1953 cells (ανβδ) to a plate coated with ANGPTL4 or vitronectin at the concentration indicated below (pg / ml), where BSA is used as a control. Figure 12 illustrates that the anti-oestrus and anti-hANGPTL4 antibodies eliminate the cell adhesion activity of ANGPTL4, wherein (1) is BSA, (2) is vitronectin and (3) is ANGPTL4.

Figure 13, panels A, B and C, illustrate the binding of ANGPTL4 to ανβ5 integrin. Panel A illustrates protein binding (mANGPTL4, hANGPTLA-Nterminin or hANGPTL4-Cterminmin), using the indicated amount, to plates coated with ανβ5 Panel B shows the inhibition of protein binding (mANGPTL4, hANGPTL4-Nterminin or hANGPTL4-Cterminmin) to ανβδ-coated plates with anti-hANGPTL4 antibodies. Panel C illustrates the binding of ANGPTL4 and ανβδ, wherein (1) is hANGPTL4-Cterminal as plate coating, (2) is hANGPTL4-Cterminal as plate coating and incubated with anti-hANGPTL4, (3) is hANGPTL4-Cterminal as plate coating and incubated with anti-Dscr, (4) is vitronectin as plate coating and (5) is BSA as plate coating, before addition of ανβ5 · DETAILED DESCRIPTION Definitions

Before describing the invention in detail, it should be understood that this invention is not limited to certain specific biological compositions or systems, which may of course vary. It should also be understood that the terminology used herein is for the sole purpose of describing certain embodiments and is not intended to be limiting. As used in this specification and the appended claims, the singular forms " a ", " " " and " a " include the plural references unless the specific content otherwise determines otherwise. Thus, for example, the reference to " a molecule " optionally includes a combination of two or more such molecules and the like. 12 ΕΡ 1 771 474 / ΡΤ

Unless defined otherwise, all scientific and technical expressions are interpreted with the meaning commonly used in the art to which they relate. For the purposes of the invention, the following expressions are defined below. The expression " ANGPTL4 " or " Angptl " refers to angiopoietin-like polypeptide or protein 4, together with its naturally occurring allelic, excreted and processed forms. For example, human ANGPTL4 is a 406 amino acid protein, while mouse ANGPTL4 is a 410 amino acid protein. The expression " ANGPTL4 " is also used to refer to fragments (eg, subsequences, truncated forms, etc.) of the polypeptide comprising, eg, N-terminal fragment, coiled helix domain, C-terminal fragment, fibrinogen-like domain, amino acids 1-183, 183, 1 to about 162, 23 to about 162, 23-406, 184-406, about 162-406 or 23-184 of the human angiopoietin-like protein 4 and amino acids 1-183, 23-183, 1 to about 165, 23 to about 165, 23-410 or 184-410 of murine angiopoietin-like protein 4. Other fragments include, without limitation, eg, 40-183, 60-183, 80-183, 100-183, 120-183, 140-183, 40-406, 60-406, 80-406, 100-406, 120 -406, 140-406 and 160-406 of HANGPTL4 and, eg, 40-183, 60-183, 80-183, 100-183, 120-183, 140-183, 40-410, 60-410, 80- 410, 100-410, 120-410, 140-410 and 160-410 of mANGPTL4. Reference to any such forms of ANGPTL4 may also be identified in the application, eg, by " ANGPTL4 (23-406) ", " ANGPTL4 (184-406) ", " ANGPTL4 (23-183) " , " mANGPTL4 (23-410) ", " mANGPTL4 (184-410) ", etc., where m denotes murine sequence. The amino acid position for a native ANGPTL4 fragment is numbered as indicated in the native ANGPTL4 sequence. For example, amino acid position 22 (Ser) in a fragment of ANGPTL4 is also position 22 (Ser) in native human ANGPTL4, e.g., refer to figure 2. In general, the native ANGPTL4 fragment has biological activity. The expression " ANGPTL4 modulator " refers to a molecule that can activate, e.g. an agonist, ANGPTL4 or its expression, or which can inhibit, e.g. an antagonist (or inhibitor) the activity of ANGPTL4 or its expression. ANGPTL4 agonists include antibodies and active fragments. An ANGPTL4 antagonist refers to a molecule capable of neutralizing, blocking, inhibiting, abolishing, reducing or interfering with the activities of ANGPTL4, eg, proliferation or growth, migration, cell adhesion or metabolic modulation , eg, lipid, or expression thereof including binding to an ANGPTL4 receptor, eg, ανβ5. ANGPTL4 antagonists include, eg, anti-ANGPTL4 antibodies and antigen-binding fragments thereof, receptor molecules and derivatives that specifically bind the ANGPTL4 thus sequestering its binding to one or more receptors, anti-ANGPTL4 receptor antibodies and ANGPTL4 receptor antagonists, such as small receptor-inhibitory molecules. Other ANGPTL4 antagonists also include ANGPTL4 antagonist variants, antisense molecules (e.g., ANGPTL4-siRNA), RNA aptamers and ribozymes against ANGPTL4 or its receptor. In certain embodiments, the ANGPTL4 antagonist antibodies are antibodies that inhibit or reduce the activity of ANGPTL4 by binding to a specific subsequence or region of ANGPTL4, eg, N-terminal fragment, coiled-helix domain, C-terminal fragment, type domain fibrinogen, amino acids 1-183, 23-183, 1 to about 162, 23 to about 162, 23-406, 184-406 or 23-184 of human angiopoietin-like protein 4 and amino acids 1-183, 23-183 , 1 to about 165, 23 to about 165, 23-410 or 184-410 of murine angiopoietin-like protein 4. Other fragments include, without limitation, eg, 40-183, 60-183, 80-183, 100-183, 120-183, 140-183, 40-406, 60-406, 80-406, 100-406, 120 -406, 140-406 and 160-406 of hANGPTL4 and, eg, 40-183, 60-183, 80-183, 100-183, 120-183, 140-183, 40-410, 60-410, 80- 410, 100-410, 120-410, 140-410 and 160-410 of mANGPTL4. The term " anti-ANGPTL4 antibody " is an antibody that binds to ANGPTL4 with sufficient affinity and specificity. The anti-ANGPTL4 antibody of the invention may be used as a therapeutic agent to target and interfere with diseases or conditions in which ANGPTL4 activity is involved. In general, an anti-ANGPTL4 antibody will not usually bind to other homologs of ANGPTL4, e.g., ANGPTL3.

The terms " VEGF " and " VEGF-A " are used interchangeably to refer to vascular endothelial cell growth factor of 165 amino acids and related vascular endothelial cell growth factors of 121, 145, 183, 189 and 206 amino acids, as described by Leung et al. Science, 246: 1306 (1989), Houck et al. Mol. Endocrin., 5: 1806 (1991) and Robinson and Stringer, Journal of Cell Science, 144 (5): 853-865 (2001), together with their naturally occurring and processed allelic forms. The expression " VEGF " is also used to refer to fragments of the polypeptide, e.g., comprising amino acids 8 to 109 or 1 to 109 of 165 amino acid human vascular endothelial cell growth factor. Reference to any such such VEGF forms can be identified in the present application, e.g., by " VEGF (8-109) ", " VEGF (1-109) " or " VEGF165 ". Amino acid positions for a " fragment " of native VEGF are numbered as indicated in the native VEGF sequence. For example, amino acid position 17 (methionine) in the native VEGF fragment is also position 17 (methionine) in native VEGF. The native VEGF fragment may have binding affinity for KDR and / or Flt-1 receptors comparable to native VEGF.

An " anti-VEGF " is an antibody that binds to VEGF with sufficient affinity and specificity. The anti-VEGF antibody of the invention may be used as a therapeutic agent to target and interfere with diseases or conditions in which VEGF activity is involved. An anti-VEGF antibody will not usually bind to other VEGF homologues, such as VEGF-B or VEGF-C, nor to other growth factors such as PIGF, PDGF or bFGF. See, e.g., U.S. Patents 6,882,959, 6,703,020; WO 98/45332 WO 96/30046; WO 94/10202; ΕΡ 0666868B1; U.S. patent applications 20030206899, 20030190317, 20030203409 and 20050112126; Popkov et al., Journal of Immunological Methods 288: 149-164 (2004); and process of agent number P2072R1. Anti-VEGF antibody " Bevacizumab (BV) " also referred to as " rhuMAb VEGF " or " Avastin ™ " is a recombinant humanized anti-VEGF monoclonal antibody generated according to Presta et al. Cancer Res. 57: 4593-4599 (1997). It comprises mutated human IgG1 backbone regions and antigen binding complementarity determining regions of the anti-hVEGF murine monoclonal antibody A.4.6.1 which blocks the binding of human VEGF to its receptors. Approximately 93% of the amino acid sequence of Bevacizumab, including most skeletal regions, is derived from human IgG1 and about 7% of the sequence is 15

ΕΡ 1 771 4 7 4 / PT derived from murine antibody A4.6.1. Bevacizumab has a molecular mass of about 149,000 daltons and is glycosylated. Bevacizumab and other humanized anti-VEGF antibodies are further described in U.S. Patent 6884879 issued February 26, 2005.

A " VEGF antagonist " refers to a molecule capable of neutralizing, blocking, inhibiting, abolishing, reducing or interfering with VEGF activities including their binding to one or more VEGF receptors. VEGF antagonists include anti-VEGF antibodies and antigen-binding fragments thereof, receptor molecules and derivatives that specifically bind to VEGF thus sequestering their binding to one or more receptors, anti-VEGF receptor antibodies, and VEGF receptor antagonists such as VEGFR tyrosine kinase small molecule inhibitors and fusion proteins, eg, VEGF-Trap (Regeneron), VEGF2β-gelonin (Peregine). VEGF antagonists also include variant VEGF antagonists, VEGF-directed antisense molecules, RNA aptamers and ribozymes against VEGF or VEGF receptors.

A polypeptide of " native sequence " comprises a polypeptide having the same amino acid sequence as a polypeptide derived from nature. Thus, a native sequence polypeptide may have the amino acid sequence of the naturally occurring polypeptide of any mammal. This native sequence polypeptide may be isolated from nature or may be produced by recombinant or synthetic means. The term polypeptide of " native sequence " specifically encompasses truncated or excreted forms of naturally occurring polypeptide (e.g., an extracellular domain sequence), naturally occurring variant forms (e.g., " alternative " forms) and naturally occurring allelic variants of the polypeptide.

A " polypeptide chain " is a polypeptide wherein each of its domains is linked to another domain (s) by peptide bonds and not by non-covalent interactions or disulfide bonds.

A " variant " polypeptide means a biologically active polypeptide with at least about 80% of 16Î ± 1 771 474 / ΡΤ amino acid sequence identity to the corresponding native sequence polypeptide. Such variants include, for example, polypeptides in which one or more amino acid residues (naturally occurring amino acids and / or non-naturally occurring amino acids) are added or removed at the N-terminus and / or C of the polypeptide. Usually, a variant will have at least about 80% amino acid sequence identity, or at least about 90% amino acid sequence identity, or at least about 95% or more amino acid sequence identity to the polypeptide of native sequence. Variants also include polypeptide fragments (e.g., subsequences, truncations, etc.), typically biologically active, of the native sequence. " Percent (%) amino acid sequence identity " is defined herein as the percentage of amino acid residues in a candidate sequence that are identical to the amino acid residues in a selected sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percentage sequence identity and not considering any conservative substitutions as part of sequence identity. Alignment for purposes of determining the percentage amino acid sequence identity may be effected in various ways known to those skilled in the art, for example, using publicly available computer software such as BLAST software, BLAST-2, ALIGN, ALIGN -2 or Megalign (DNASTAR). Those skilled in the art may determine suitable parameters for measuring alignment, including any algorithms necessary to achieve maximum alignment over the full length of the sequences to be compared. For the present purposes, however,% amino acid sequence identity values are obtained as described below using the ALIGN-2 sequence comparison computer program. The ALIGN-2 sequence comparison computer program was designed by Genentech, Inc. and was presented with documentation for the user " U.S. Copyright Office, Washington D.C., 20559, where it is registered under registration number TXU510087 of " U.S. Copyright " and is available to the public through Genentech, Inc., South San Francisco, California. The ALIGN-2 program must be compiled to be 17

ΕΡ 1 771 4 7 4 / PT used in a UNIX operating system, e.g., UNIX digital V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

For the present purposes, the% amino acid sequence identity of a given amino acid sequence A to, with, or against a particular B amino acid sequence (which may alternatively be expressed as a given amino acid sequence A having or comprises a determined% amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows:

100 times the fraction X / Y wherein X is the number of amino acid residues classified as identical matches by the sequence alignment program ALIGN-2 in the program alignment of A and B, and wherein Y is the total number of residues of amino acids in B. It will be appreciated that when the length of amino acid sequence A is not equal to the length of amino acid sequence B, the% amino acid sequence identity of A with B will not equal% identity amino acid sequence of B with A. The term " variant of ANGPTL4 " as used herein refers to a variant as described above and / or an ANGPTL4 which includes one or more amino acid mutations in the native ANGPTL4 sequence. Optionally, the mutation or amino acid mutations include substitution (s) of

amino acid (s). ANGPTL4 and its variants for use in the invention may be prepared by various methods well known in the art. The amino acid sequence variants of ANGPTL4 can be prepared by mutations in the ANGPTL4 DNA. Such variants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence of ANGPTL4, eg, a human amino acid sequence encoded by the nucleic acid deposited with ATCC with the deposition number 209284, or as shown in the figure 2. Any combination of deletion, insertion and substitution may be performed to achieve the final construction with the desired activity. The mutations that will be made in DNA 18

And encoding the variant can not place the sequence outside the reading frame and preferably will not create complementary regions that could produce a secondary mRNA structure. EP 75 444A.

ANGPTL4 variants are optionally prepared by site-directed, nucleotide mutagenesis in DNA encoding native ANGPTL4 or by phage display techniques, thereby producing DNA encoding the variant, and subsequently expression of the DNA in recombinant cell culture.

Although the site for introducing a variation in the amino acid sequence is predetermined, the mutation alone does not have to be predetermined. For example, to optimize the performance of a mutation at a given site, random mutagenesis can be performed at the codon or target region and the expressed ANGPTL4 variants are screened for the optimal combination for the desired activity. Techniques for making substitution mutations at predetermined sites in DNA with a known sequence are well known, such as, for example, site-specific mutagenesis. The preparation of the ANGPTL4 variants described herein can be achieved with phage display techniques, such as those described in PCT publication WO 00/63380.

After selection of such a clone, the mutated protein region can be removed and placed into a vector suitable for protein production, generally an expression vector of the type that can be used for transformation of a suitable host.

Amino acid sequence deletions are generally in the range of about 1 to 30 residues, optionally 1 to 10 residues, optionally 1 to 5 residues or less and typically are contiguous.

Amino acid sequence insertions include fusions at the amino and / or carboxyl terminus from a residue to polypeptides of essentially unlimited length, such as intra-sequence insertions of single or multiple amino acid residues. Intra-sequence insertions (ie, insertions within the native ANGPTL4 sequence) may be in the range of about 1 to 10, optionally 1 to 5, or optionally 1 to 3, residues. of a terminal insert includes a fusion of a signal sequence, either heterologous or homologous to the host cell, at the N-terminus, to facilitate secretion of recombinant hosts. Additional ANGPTL4 variants are those in which at least one amino acid residue has been removed on native ANGPTL4 and a different residue is inserted in its place. In one embodiment of the invention, the ANGPTL4 variant includes a 162 and / or 164 substitution of ANGPTL4 or a 169 substitution of mANGPTL4. Such substitutions may be made according to those shown in Table 1. Variants of ANGPTL4 may also be unnatural amino acids, as described herein.

Amino acids can be grouped according to the similarities of the properties of their side chains (in AL Lehninger, in Biochemistry, 2nd ed., Pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Val (V), Leu (L), Ile (I), Pro (P),

(G), Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Phe (F), Trp (3) acids: Asp (D), Glu (E) (4) basic: Lys (K), Arg (R), His (H)

Alternatively, naturally occurring residues can be divided into groups based on common side chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) hydrophilic neutrals: Cys, Ser, Thr, Asn, Gin; (3) acids: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6): Trp, Tyr, Phe. 20 ΕΡ 1 771 474 / ΡΤ

Table 1

Original residue Examples of substitutions Preferred substitutions Ala (A) Val; Leu; Ile Val Arg (R) Lys; Gin; Asn Lys Asn (N) Gin; His; Asp, Lys; Arg Gin Asp (D) Glu; Asn Glu Cys (C) Ser; Ala Ser Gin (Q) Asn; Glu Asn Glu (E) Asp; Gin Asp Gly (G) Ala His His (H) Asn; Gin; Lys; Arg Arg He (I) Leu; Go; Met; Allah; Phe; Norleucine Leu Leu (L) Norleucine; Ile; Go; Met; Allah; Phe Ile Lys (K) Arg; Gin; Asn Arg Met (M) Leu; Phe; Ile Leu Phe (F) Trp; Leu; Go; Ile; Allah; Tyr Tyr Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Val; Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) Ile; Leu; Met; Phe; Allah; Norleucine Leu

"Naturally occurring amino acid residues " (i.e., amino acid residues encoded by the genetic code) may be selected from the group consisting of: alanine (Ala); arginine (Arg); asparagine (Asn); aspartic acid (Asp); cysteine (Cys); glutamine (Gin); glutamic acid (Glu); glycine (Gly); histidine (His); isoleucine (Ile): leucine (Leu); lysine (Lys); methionine (Met); phenylalanine (Phe); proline (Pro); serine (Ser); threonine (Thr); tryptophan (Trp); tyrosine (Tyr); and valine (Val). &Quot; Non-naturally occurring " amino acid residue " refers to a residue, other than the naturally occurring amino acid residues listed above, which is capable of covalently binding to the adjacent amino acid residue (s) in a polypeptide chain. Examples of non-naturally occurring amino acid residues include, e.g., norleucine, ornithine, norvaline, homoserine and other 21E-amino acid residues 771 474 / ΡΤ amino acids such as those described in Ellman et al. Meth. Enzym. 202: 301-336 (1991) and U.S. Patent Application Serial No. 20030108885 and 20030082575. Briefly, these procedures involve the activation of a suppressor tRNA with an unnatural occurring amino acid residue followed by in vitro or in vivo transcription and translation of the RNA. See, e.g., U.S. Patent Application Publication Nos. 20030108885 and 20030082575; Noren et al. Science 244: 182 (1989); and Ellman et al., supra.

An " isolated " is a polypeptide that has been identified and separated and / or recovered from a component of its natural environment. The contaminating components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the polypeptide and may include enzymes, hormones and other proteinaceous and nonproteinaceous solutes. In certain embodiments, the polypeptide will be purified (1) to greater than 95% by weight of the polypeptide as determined by the Lowry method or greater than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues from the sequence (3) to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or silver staining. The isolated polypeptide includes the polypeptide in situ within recombinant cells, since at least one component of the natural environment of the polypeptide will not be present. However, usually the isolated polypeptide will be prepared through at least one purification step. The " antibody " is used in the broadest sense and includes monoclonal antibodies (including full length or intact monoclonal antibodies), polyclonal antibodies, multivalent antibodies, multispecific antibodies (eg, bispecific antibodies) and antibody fragments (see below) provided they exhibit biological activity desired.

Unless otherwise noted, the term " multivalent antibody " is used throughout this specification to denote an antibody comprising three or more sites of 22

Binding to the antigen. The multivalent antibody is typically engineered to have three or more antigen binding sites and is generally not a native sequence IgM or IgA antibody.

&Quot; Antibody fragments " comprise only a part of an intact antibody, generally including an antigen binding site of the intact antibody and thereby maintaining the ability to bind the antigen. Examples of antibody fragments encompassed by the present definition include: (i) the Fab fragment, with VL, CL, VH and CHI domains; (ii) the Fab 'fragment, which is a Fab fragment with one or more cysteine residues at the C-terminus of the CHI domain; (iii) the Fd fragment with VH and CHI domains; (iv) the Fd 'fragment with VH and CHI domains and one or more cysteine residues at the C-terminus of the CHI domain; (v) the Fv fragment with the VL and VH domains of a single arm of an antibody; (vi) the dAb fragment (Ward et al., Nature 341, 544-546 (1989)) consisting of a V H domain; (vii) isolated CDR regions; (viii) F (ab ') 2 fragments, a bivalent fragment including two Fab' fragments attached by a disulfide bridge in the hinge region; (ix) single chain antibody molecules (eg single chain Fv; scFv) (Bird et al., Science 242: 423-426 (1988); and Huston et al., PNAS (USA) 85: 5879-5883 1988)); (x) " diabodies " with two antigen binding sites, comprising a heavy chain (VH) variable domain linked to a light chain variable domain (VL) in the same polypeptide chain (see, eg, EP 404 097; WO 93/11161; and Hollinger et al. al., Proc Natl Acad Sci USA, 90: 6444-6448 (1993)); (xi) " linear antibodies " comprising a pair of Tandem Fd segments (VH-CH1-VH-CH1) which together with complementary light chain polypeptides form a pair of antigen binding regions (Zapata et al., Protein Eng. 8 (10): 1057 1995), and U.S. Patent 5,641,870). The term " monoclonal antibody " as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies constituting the population are identical except for possible naturally occurring mutations that may be present in minority amounts. The monoclonal antibodies are highly specific, with a single antigen being directed against 23Âμl 1 771 474. In addition, unlike polyclonal antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. 0 adjective " monoclonal " should not be understood as requiring production of the antibody by any particular method. For example, the monoclonal antibodies used according to the invention may be prepared by the hybridoma method, first described by Kohler et al., Nature 256: 495 (1975), or may be prepared by recombinant DNA methods (see, eg, U.S. Patent 4,816,567). &Quot; Monoclonal antibodies " may also be isolated from phage antibody libraries using the techniques described, for example, in Clackson et al., Nature 352: 624-628 (1991) or Marks et al., J. Mol. Biol. 222: 581-597 (1991).

Monoclonal antibodies specifically include " chimeric " in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequences in antibodies derived from a particular species or belonging to a particular class or subclass of antibody, while the remainder of the chain (s) is identical or homologous to the corresponding sequences in antibodies derived from another species or belonging to another class or subclass of antibodies, as well as fragments of such antibodies, provided they exhibit the desired biological activity (U.S. Patent No. 4,816,567, and Morrison et al., Proc. Natl. Acad Sci USA 81: 6851-6855 (1984)).

The " humanized " of non-human (e.g., murine) antibodies are chimeric antibodies that contain the minimal sequence derived from non-human immunoglobulin. For the most part, the humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or non-human primate, with the desired specificity, affinity and capacity. In some cases, human immunoglobulin skeletal (FR) region residues are replaced by corresponding non-human residues. In addition, the humanized antibodies may comprise residues which are found neither in the recipient antibody nor in the donor antibody. These modifications are made to further refine the performance of the antibody. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a sequence of human immunoglobulin. The humanized antibody will also optionally comprise at least a part of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature 321: 522-525 (1986); Riechmann et al., Nature 332: 323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2: 593-596 (1992).

A " human antibody " is an antibody having an amino acid sequence that corresponds to that of an antibody produced by a human and / or has been prepared using any of the techniques for preparing human antibodies, as disclosed herein. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen binding residues. Human antibodies can be produced using various techniques known in the art. In one embodiment, the human antibody is selected from a phage library, wherein said phage library expresses human antibodies (Vaughan et al., Nature Biotechnology 14: 309-314 (1996): Sheets et al., PNAS (USA) 95: 6157 -6162 (1998)); Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581 (1991)). Human antibodies can also be prepared by introducing human immunoglobulin sites into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. After challenge, the production of human antibody, which closely resembles human production in all respects, including gene rearrangement, assembling and repertory of antibodies is verified. This approach is described, for example, in U.S. Patents 5,545,807; 5,545,806; 5,596,925; 5,625,126; 5,633,425; 5661016 and in the following scientific publications: Marks et al., Bio / Technology 10: 779-783 (1992); Lonberg et al., Nature 368: 856-859 (1994); Morrison, Nature 25, 771-474 / ΡΤ 368: 812-13 (1994); Fishwild et al., Nature Biotechnology 14: 845-51 (1996); Neuberger, Nature Biotechnology 14: 826 (1996);

Lonberg and Huszar, Intern. Rev. Immunol. 13: 65-93 (1995).

Alternatively, the human antibody may be prepared by immortalizing human B lymphocytes which produce an antibody directed against a target antigen (these B lymphocytes may be recovered from an individual or may have been immunized in vitro). See, e.g., Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R Liss, p. 77 (1985); Boerner et al., J. Immunol., 147 (1): 86-95 (1991); and U.S. Patent 5,750,373. The " variable " refers to the fact that certain portions of the variable domains have sequences that differ widely between antibodies and are used in the binding and specificity of each specific antibody to its specific antigen. However, the variability is not evenly distributed throughout the variable antibody domains. It is concentrated in three segments called hypervariable regions in the variable domains of the light chain and the heavy chain. The most highly conserved parts of the variable domains are called the skeletal (FR) regions. The variable domains of the native heavy and light chains each comprise four FRs, which mostly adopt a beta sheet configuration, linked by three hypervariable regions, forming loops that bind, and in some cases forming part of the structure in beta sheet. The hypervariable regions of each chain are held closely together by the RF and, together with the hypervariable regions of the other chain, contribute to the formation of the antigen binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th Public Health Service, National Institutes of Health, Bethesda, MD, (1991)). The constant domains are not directly involved in the binding of an antibody to an antigen, but exhibit various effector functions, such as the participation of the antibody in antibody dependent cell-mediated cytotoxicity (ADCC). The expression " hypervariable region " when used herein refers to the amino acid residues of an antibody that are responsible for antigen binding. The hypervariable region 26A-1 771 474 / ΡΤ generally comprises amino acid residues of a " complementarity determining region " or " CDR " (eg residues 2-34 (Ll), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (HI), 50-65 (H2) and 95-102 (H3 ) in the heavy chain variable domain, Kabat et al., Seguins of Proteins of Immunological Interest, 5th Ed. Public Health Service,

National Institutes of Health, Bethesda, MD. (1991)) and / or the residues of a " hypervariable loop " (eg residues 26-32 (Ll), 50-52 (L2) and 91-96 (L3) of the light chain variable domain and 26-32 (HI), 53-55 (H2) and 96-101 (H3) of the heavy chain variable domain: Chothia and Lesk J. Mol. Biol. 196: 901-917 (1987)). Residues of " squirrel region " or " FR " are the residues of the variable domain which are not residues of the hypervariable region, as defined herein.

Depending on the amino acid sequence of the constant domain of their heavy chains, the intact antibodies can be classified into different " classes ". There are five major classes of intact antibodies: IgA, IgD, IgE, IgG and IgM, and several of these can be further divided into " subclasses " (isotypes), e.g., IgG1 (including non-A and A alotypes), IgG2, IgG3, IgG4, IgA and IgA2. The heavy chain constant domains that correspond to the different classes of antibodies are called α, δ, ε, γ and μ, respectively. The subunit structures and the three-dimensional configurations of the different classes of immunoglobulins are well known.

The light chains of antibodies of any vertebrate species can be assigned to one of two distinctly distinct types, called layer 6 and lambda 8, based on the amino acid sequences of their constant domains. The expression " Fc region " is used to define the C-terminal region of an immunoglobulin heavy chain that can be generated by digestion of an intact antibody with papain. The Fc region may be a native sequence Fc region or a variant Fc region. Although the Fc region borders of an immunoglobulin heavy chain may vary, the Fc region of the human IgG heavy chain is usually defined as extending from an amino acid residue at about the Cys226 position, or from about the position Pro230, to to the carboxyl terminus of the Fc region. The Fc region of an immunoglobulin comprises generally two constant domains, a CH 2 domain and a CH 3 domain and optionally comprises a CH 4 domain.

Here, " Fc region string " means one of the two polypeptide chains of an Fc region. 0 " CH2 domain " of a human IgG Fc region (also referred to as " Cg2 " domain) usually extends from an amino acid residue at about position 231 to an amino acid residue at about position 340. The CH2 domain is unique in that be in close proximity to another domain. Instead, two N-linked branched carbohydrate chains are interposed between the two CH2 domains of an intact native IgG molecule. It has been speculated that carbohydrate can provide a substitute for domain-domain pairing, and help stabilize the CH2 domain. Burton, Molec. Immunol. 22: 161-206 (1985). Here, the CH2 domain may be a native sequence CH2 domain or a variant CH2 domain. &Quot; CH3 domain " comprises the residue part of the C-terminus to a CH2 domain in an Fc region (i.e. from an amino acid residue at about position 341 to an amino acid residue at about position 447 of an IgG). Here the CH3 region may be a native sequence CH3 domain or a CH3 variant domain (eg a CH3 domain with a " protrusion " introduced into one of its strands and a corresponding " cavity " introduced into its other strand; The "hinge region" is generally defined as extending from about Glu216 or about Cys226 to about Pro230 of IgG1 The flanking regions of other IgG isotypes may be aligned with the IgG1 sequence by placing the first and last cysteine residues which form inter-chain SS bonds (Burton, Molec Immunol 22: 161-206 (1985) The hinge region here may be a native sequence hinge region or a variant hinge region. The two 28 Ε 1 1 771 474 / Poli polypeptide chains of a variant hinge region generally retain at least one cysteine residue per polypeptide chain, so that the two polypeptide chains of the variant hinge region may form a disulfide bridge between the two chains. Here, the preferred hinge region is a native sequence human hinge region, e.g. a native sequence human IgG1 hinge region.

A " functional Fc region " has at least one " effector function " of a native sequence Fc region. Examples of " effector functions " include bond to Clq; complement dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; negative regulation of cell surface receptors (e.g., B cell receptor; BCR), etc. Such effector functions generally require that the Fc region is combined with a binding domain (e.g., an antibody variable domain) and can be evaluated using various assays known in the art to evaluate such effector functions of the antibody.

A " native sequence Fc region " comprises an amino acid sequence identical to the amino acid sequence of an Fc region found in nature.

An " variant Fc region " comprises an amino acid sequence that differs from that of a native sequence Fc region by virtue of the modification of at least one amino acid. In certain embodiments, the variant Fc region has at least one amino acid substitution compared to a native sequence Fc region or the Fc region of a parent polypeptide, eg from about one to about ten amino acid substitutions and, preferably, from about one to about five amino acid substitutions in a native sequence Fc region or the Fc region of the parent polypeptide. Here, the variant Fc region will typically have, eg, at least about 80% sequence identity with a native sequence Fc region and / or an Fc region of a parent polypeptide, or at least about 90% sequence thereof, or at least about 95% or more sequence identity thereto. 29 Ε 1 771 474 / ΡΤ " Antibody-dependent cell-mediated cytotoxicity " and " ADCC " (Antibody-Dependent Cell-mediated Cytotoxicity ") refer to a cell-mediated reaction in which non-specific cytotoxic cells expressing FcR receptors (eg, natural killer (NK) cells, neutrophils and macrophages) recognize bound antibody in a target cell and subsequently cause lysis of the target cell. Primary cells to mediate ADCC, NK cells, express only FcyRIII, while monocytes express FcyRI, FcyRII and FcyRIII. Expression of FcR in hematopoietic cells is summarized in table 3 of page 464 of Ravetch and Kinet, Annu. Rev. Immunol 9: 457-92 (1991). To evaluate the ADCC activity of a molecule of interest, an in vitro ADCC assay may be performed, such as that described in U.S. Patent 5,500,362 or 5,821,337. Effector cells useful for such assays include peripheral blood mononuclear cells (PBMC) and natural killer (NK) cells. Alternatively or additionally, the ADCC activity of the molecule of interest can be evaluated in vivo, e.g., in an animal model such as disclosed in Clynes et al. PNAS (USA) 95: 652-656 (1998).

&Quot; human effector cells " are leukocytes which express one or more FcR and perform effector functions. Typically, the cells express at least FcyRIII and perform the effector function of ADCC. Examples of human leukocytes mediating ADCC include peripheral blood mononuclear cells (PBMC), natural killer (NK) cells, monocytes, cytotoxic T cells and neutrophils; with PBMCs and NK cells being preferred. The effector cells can be isolated from a native source, e.g. from blood or PBMC, as described herein.

The terms " Fc receptor " and " FcR " are used to describe a receptor that binds to the Fc region of an antibody. The preferred FcR is a native sequence human FcR. In addition, a preferred FcR is one that binds to an IgG antibody (a gamma receptor) and includes receptors of the subclasses FcyRI, FcyRII and FcyRIII, including allelic variants and alternative splicing forms of these receptors. FcyRII receptors include FcyRIIA (an " activation receptor ") and FcyRIIB (a " inhibition receptor "), which have similar amino acid sequences that differ primarily in their cytoplasmic domains. The FcyRIIA activation receptor contains a tyrosine immunoreceptor activation (ITAM) motif in its cytoplasmic domain. The FcyRIIB inhibition receptor contains an inhibitory motif of tyrosine-based immunoreceptors (ITIM) in its cytoplasmic domain (reviewed in Daà © rron, Annu Rev. Immunol 15: 203-234 (1997)). The FcRs are reviewed in Ravetch and Kinet, Annu. Rev. Immunol 9: 457-92 (1991); Capei et al., Immunomethods 4: 25-34 (1994); and Haas et al., J. Lab. Clin. Med. 126: 330-41 (1995). Other FcRs, including those that will be identified in the future, are covered by the term " FcR ". The expression also includes the neonatal receptor, FcRn, which is responsible for the transfer of maternal IgG to the fetus (Guyer et al., J. Immunol 117: 587 (1976); and Kim et al., J. Immunol. 24: 249 (1994)). " Complement dependent cytotoxicity " and " CDC " refer to lysis of a target in the presence of complement. The complement activation pathway is initiated by the binding of the first component of the complement system (Clq) to a molecule (e.g., an antibody) complexed with a cognate antigen. To evaluate complement activation, a CDC assay may be performed, e.g. as described in Gazzano-Santoro et al., J. Immunol. Methods, 202: 163 (1996).

An " affinity matured " is an antibody which contains one or more changes in one or more of its CDRs which result in an improvement in the affinity of the antibody to the antigen compared to the parent antibody lacking such alteration (s). Preferred affinity matured antibodies will have nanomolar or even picomolar affinities toward the target antigen. Affinity matured antibodies are produced by procedures known in the art. Marks et al. Bio / Technology 10: 779-783 (1992) describe affinity maturation by exchange of VH and VL domains. Random mutagenesis of CDR and / or skeletal residues is described in: Barbas et al. Proc Nat. Acad. Sci, USA 91: 3809-3813 (1994); Schier et al. Gene 169: 147-155 (1995); Yelton et al. J. Immunol. 155: 1994-31 ΕΡ 1 771 474 / ΡΤ 2004 (1995); Jackson et al., J. Immunol. 154 (7): 3310-9 (1995); and Hawkins et al., J. Mol. Biol. 226: 889-896 (1992).

Here, a " flexible binder " refers to a peptide comprising two or more amino acid residues linked by peptide bond (s) and which provide greater rotational freedom for the two polypeptides (such as the two Fd regions) so ligated. Such rotational freedom allows each of two or more antigen-binding sites linked by the flexible linker to more effectively access the target antigen (s). Examples of suitable flexible peptide linker sequences include gly-ser, gly-ser-gly-ser, ala-ser and gly-gly-gly-ser.

A " dimerization domain " is formed by the combination of at least two amino acid residues (usually cysteine residues) or at least two peptides or polypeptides (which may have the same amino acid sequence or different amino acid sequences). The peptides or polypeptides may interact with each other through covalent (s) and / or non-covalent association (s). Here, examples of dimerization domains include an Fc region; a hinged region; a CH3 domain; a CH4 domain; a CH1-CL pair; an " interface " with a " or " bulge " designed by genetic engineering as described in U.S. Patent 5,821,333; a " zip " of leucines (e.g. a zipper of leucines jun / fos, see Kostelney et al., J. Immunol., 148: 1547-1553 (1992); or a zipper of yeast GCN4 leucines); an isoleucine zipper; a dimeric receptor pair (e.g., interleukin-8 receptor (IL-8R), and integrin heterodimers such as LFA-1 and GPIIIb / IIIa) or their dimerization region (s); (NGF), neurotrophin-3 (NT-3), interleukin-8 (IL-8), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D, polypeptides, PDGF and brain derived neurotrophic factor (BDNF), see Arakawa et al., J. Biol. Chem. 269 (45): 27833-27839 (1994) and Radziejewski et al., Biochem 32 (48): 1350 (1993)). or its dimerization region (s); a pair of cysteine residues capable of forming a disulfide bridge; a pair of peptides or polypeptides, each comprising at least one cysteine residue (eg from about one, two, 32 ÅΡ¹ 771 474 / ΡΤ three to about ten cysteine residues) so that one can m) forming disulfide bond (s) between the peptides or polypeptides (hereinafter " a synthetic hinge "); and variable antibody domains. Here, the most preferred dimerization domains are an Fc region or a hinge region.

A " functional antigen binding site " of an antibody is a site capable of binding to a target antigen. The antigen binding site affinity of the antigen binding site is not necessarily as strong as that of the parent antibody from which the antigen binding site is derived, but the antigen binding capacity must be measurable using any of a number of methods known to assess the binding of antibodies to an antigen. Further, herein the antigen binding affinity of each of the antigen binding sites of a multivalent antibody need not be quantitatively the same. Here, for multimeric antibodies, the number of functional antigen binding sites can be evaluated using ultracentrifugation analysis. According to this method of analysis, different ratios of target antigen to multimeric antibody are combined and the average molecular weight of the complexes is calculated assuming different numbers of functional binding sites. These theoretical values are compared with the de facto experimental values obtained in order to evaluate the number of functional binding sites.

An antibody with a " biological feature " of a particular antibody is an antibody having one or more of the biological characteristics of that antibody which distinguish it from other antibodies which bind to the same antigen.

In order to screen antibodies that bind to an epitope on an antigen bound by an antibody of interest, a routine cross-blocking assay, such as described in Antibodies, A Laboratory Manual, Cold-Spring Harbor Laboratory, Ed Harlow and David Lane (1988). Administration " in combination with " one or more additional therapeutic agents includes simultaneous (concomitant) and / or consecutive administration in any order. 33 ΕΡ 1 771 474 / ΡΤ " Mammal ", for the purposes of treatment, refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sport or pet animals, such such as dogs, horses, cats, cows, sheep, pigs, etc. Typically, the mammal is a human.

A " disorder " is any condition that would benefit from treatment with the molecules of the invention. This includes chronic and acute disorders or diseases including the pathological conditions predisposing the mammal to the disorder in question. Non-limiting examples of disorders to be treated herein include any form of tumor, benign and malignant tumors; vascularized tumors; hypertrophy; leukemias and lymphoid malignancies; neuronal, glial, astrocytic, hypothalamic and other glandular, macrophagic, epithelial, stromal and blastocereal disorders; and inflammatory disorders; angiogenic and immunological disorders, vascular disorders resulting from inadequate, aberrant, excessive and / or pathological vascularization and / or vascular permeability. The " effective amount " or " therapeutically effective amount " refer to an amount of a drug effective to treat a disease or disorder in a mammal. In the case of cancer, the effective amount of the drug may reduce the number of cancer cells; reduce tumor size; inhibit (i.e., decelerate to some extent or typically stop) the infiltration of cancer cells into peripheral organs; inhibit (i.e., decelerate to some extent and typically stop) tumor metastases; inhibit, to some extent, tumor growth; and / or alleviating to some extent one or more of the symptoms associated with the disorder. To the extent that the drug can prevent growth and / or kill existing cancer cells, it may be cytostatic and / or cytotoxic. For cancer therapy, in vivo efficacy can be measured, for example, by evaluation of survival duration, time to disease progression (TAP), response rates (TR), duration of response and / or quality of life. " Treatment " refers to both therapeutic treatment and prophylactic or preventive measures. Those who need treatment include those who already have the disorder as well as those in whom the disorder is intended to be prevented.

Here, the " biological activity " and " biologically active " relative to ANGPTL4 molecules refer to the ability of a molecule to specifically bind and regulate cellular responses, e.g., proliferation, adhesion, migration, lipid modulation, etc. Cell responses also include those mediated through an ANGPTL4 receptor, e.g., an ανβ 5 integrin receptor, including but not limited to adhesion, migration and / or proliferation. In this context, the " modular " includes both promotion and inhibition. The molecules of the invention also include agonists and antagonists of an ANGPTL4 receptor, e.g., ανβ5 integrin receptor. " Hypertrophy " as used herein is defined as an increase in the mass of an organ or structure independent of natural growth that does not involve tumor formation. Hypertrophy of an organ or tissue is due either to an increase in the mass of individual cells (true hypertrophy) or to an increase in the number of cells constituting the tissue (hyperplasia), or both.

The terms " cancer " and " cancerous " refer to or describe the physiological condition in mammals which is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia or lymphoid malignancies. More specific examples of such cancers include kidney or renal cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, lung cancer, including small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma and squamous cell carcinoma of the lung, squamous cell cancer (eg epithelial squamous cell cancer), cervical cancer, ovarian cancer, prostate cancer, liver cancer, bladder cancer, peritoneal cancer, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, head and neck cancer, glioblastoma, retinoblastoma, astrocytoma, tecomas, arrenoblastomas, hepatoma, hematologic malignancies including non-Hodgkin's lymphoma (NHL), multiple myeloma and

Acute endometrial or uterine carcinomas, endometriosis, fibrosarcomas, choriocarcinoma, carcinoma of the salivary glands, vulvar cancer, thyroid cancer, esophageal carcinomas, hepatic carcinoma, anal carcinoma, penile carcinoma, carcinoma of the larynx, Kaposi's sarcoma, melanoma, skin carcinomas, Schwannoma, oligodendroglioma, neuroblastomas, rhabdomyosarcoma, osteogenic sarcoma, leiomyosarcomas, urinary tract carcinomas, thyroid carcinomas, Wilm's tumor, as well as B-cell lymphoma ( including low grade / follicular NHL, low lymphocytic NHL (SL), intermediate / follicular NHL, intermediate grade diffuse NHL, high grade immunoblastic NHL, high grade lymphoblastic NHL, non small cell NHL high-grade cleavage, bulky disease NHL, mantle cell lymphoma, AIDS-related lymphoma, and Wal's macroglobulinemia denstrom); chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); hairy cell leukemia; chronic myeloblastic leukemia; and posttransplant lymphoproliferative disorder (LPT), as well as anomalous vascular proliferation associated with facomatoses, edema (such as associated with brain tumors), Meigs's syndrome. The term " antineoplastic composition " refers to a composition useful in the treatment of cancer comprising at least one therapeutically active agent, e.g. " anticancer agent ". Examples of therapeutic agents (anticancer agents) include, but are not limited to, eg chemotherapeutic agents, growth inhibitors, cytotoxic agents, agents used in radiation therapy, antiangiogenic agents, apoptotic agents, anti-tubulin agents, toxins and the like agents for treating cancer, eg, anti-VEGF neutralizing antibody, VEGF antagonist, anti-HER-2, anti-CD20, an epidermal growth factor receptor (EGFR) antagonist (eg, a tyrosine kinase inhibitor) (eg, celecoxib), interferons, cytokines, antagonists (eg, neutralizing antibodies) that bind to one or more of the ErbB2, ErbB3, ErbB4 or VEGF receptors, such as an inhibitor of HER1 / EGFR, erlotinib, inhibitors for platelet-derived growth factor (PDGF) receptor tyrosine kinases and / or stem cell factor (SCF) (eg, imatinib mesylate (Gleevec® 36

ΕΡ 1 771 4 7 4 / EN

Novartis)), TRAIL / Apo2 and other bioactive and organic chemicals, etc. Also included in the invention are combinations thereof. The term " cytotoxic agent " as used herein refers to a substance that inhibits or avoids cell function and / or causes destruction of cells. It is intended to include radioactive isotopes (eg, At, I, 125I, 90Y, 186Re, 188Re, 153Sm, 212Bi, 32P and Lu radioactive isotopes), chemotherapeutic agents and toxins, such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including fragments and / or variants thereof.

&Quot; growth inhibitory agent " when used herein refers to a compound or composition which inhibits the growth of a cell in vitro and / or in vivo. Thus, the growth inhibitory agent may be an agent that significantly reduces the percentage of cells in the S phase. Examples of growth inhibitory agents include agents that block the progression of the cell cycle (at a site other than the S phase), such as agents which induce G1 arrest and M-phase arrest. Classical M phase blockers include vincristine and vinblastine, TAXOL and top-II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide and bleomycin. Agents stopping G1 also extravasate for S-phase stopping, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil and ara-C. Additional information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, ed., Chapter 1, entitled " Cell cycle regulation, oncogenes, and antineoplastic drugs " by Murakami et al. (WB Saunders: Philadelphia, 1995), especially p. 13.

A " chemotherapeutic agent " is a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include alkylating agents, such as thiotepa and CYTOXAN® cyclosphosphamide; alkylsulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemonelamine, triethenethiophosphoramide, triethenethiophosphoramide and trimethylolomelamine; acetogenins (especially bulatacin and bulatacinone); delta-9-tetrahydrocannabinol (dronabinol, MARINOL®, beta-lapachone, lapachol, colchicines, betulinic acid, camptothecin (including synthetic analogue topotecan (HYCAMTIN®), CPT-11 (irinotecan, CAMPTOSAR®), acetylcamptothecin, (including its synthetic analogues adozelesine, carzelesine and bizelesin), podophyllotoxin, podophylinic acid, teniposide, cryptophytics (especially cryptophycin 1 and cryptophycin 8), dolastatin, duocarmycin (including analogues of aminocamptothecin) Kw-2189 and CB1-TM1), eleutherobin, pancratistatin, a sarcodictine, spongistatin, nitrogen mustards such as chlorambucil, clomafazine, colophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembiquine, fenesterin, prednimustine , trophosphamide, uracil mustard, nitrosureas such as carmustine, chlorozootocin, fotemustine, lomustine, nimustine and ranimustine; optical agents such as enediin antibiotics (e.g., calicheamicin, especially calicheamicin gamma II and calicheamicin omega II (see, e.g., Angew. Chem Intl. Ed. Engl., 33: 183-186 (1994)); dinemicin, including dinemicina A; an esperamicin; as well as neocarzinostatin chromophore and chromoprotein antibiotic chromoprotein enedine), aclacinomisins, actinomycin, autramycin, azasserin, bleomycins, cactinomycin, carabicin, carminomycin, carzinoophyline, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine , doxorubicin (including ADRIAMYCIN®, morpholinodoxorubicin, cyanomorpholodoxorubicin, 2-pyrrolinodoxorubicin, injection of doxorubicin HCl liposomes (DOXIL®) and deoxidoxorubicin), epirubicin, esorubicin, idarubicin, marcelomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, porfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate, gemcitabine (GEMZAR®), tegafur (UFTORAL®), capecitabine (XELODA®), an epothilone and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogues 38 Ρ 371 474 / ΡΤ such as fludarabine, 6-mercaptopurine, thiamiprin, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenergic agents such as aminoglutethimide, mitotane, trilostane; folic acid reconstituent such as folic acid; aceglatone; aldofosfamide glycoside; aminolevulinic acid; enyluracil; amsacrine; bestrabucilo; bisantrene; edatraxate; defofamina; demecolcin; diaziquone; elfornitine; elliptinium acetate; etoglyceride; gallium nitrate; hydroxyurea; lentinane; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; fenamet; pyarubicin; losoxantrone; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, OR); reasonable; rhizoxin; sizofiran; spirogermânio; tenuazonic acid; triaziquone; 2,2 ', 2 "-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethane; vindesine (ELDISINE®, FILDESIN®); dacarbazine; manomustine; mitobronitol; mitolactol; pipobroman; gacitosine; arabinoside (" Ara-C ");thiotepa; taxoids, e.g., paclitaxel (TAXOL®), formulation in nanoparticles manipulated with paclitaxel albumin (ABRAXANETM) and doxetaxel (TAXOTERE®); chlorambucil; 6-thioguanine; mercaptopurine; methotrexate; platinum analogues such as cisplatin and carboplatin; vinblastine (VELBAN®); platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine (ONCOVIN®); oxaliplatin; leucovovin; vinorelbine (NAVELBINE®); daunomycin; aminopterin; topoisomerase RFS 2000; retinoids such as novantrone acid; edatrexate; ibandronate; difluoromethylornithine inhibitor (DMFO); retinoic acid: pharmaceutically acceptable salts, acids or derivatives of any of the foregoing; as well as combinations of two or more of the above, such as CHOP, an abbreviation for a combination therapy of cyclophosphamide, doxorubicin, vincristine and prednisolone, and FOLFOX, an abbreviation for the oxaliplatin treatment regimen (ELOXATINTM) combined with 5-FU and leucovovin. 39

ΕΡ 1 771 4 7 4 / EN

Also included in this definition are antihormonal agents which act to regulate, reduce, block or inhibit the effects of hormones which can promote the growth of cancer, and are often in the form of systemic or whole body treatment. These may be the hormones themselves. Examples include antiestrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including NOLVADEX® tamoxifen), raloxifene (EVISTA®), droloxifene, 4-hydroxytamoxifene, trioxifene, queoxifene, LY117018, onapristone and toremifene (FARESTON®); anti-progesterones; estrogen receptor negative (ERD) regulators; agents which work by suppressing or deactivating the ovaries, for example, luteinizing hormone releasing hormone (LHRH) agonists such as leuprolide acetate (LUPRON® and ELIGARD®), goserelin acetate, buserelin acetate and tripterelin; other anti-androgens such as flutamide, nilutamide and bicalutamide; and aromatase inhibitors which inhibit the aromatase enzyme, which regulates the production of estrogen in the adrenals, such as, for example, 4 (5) -imidazoles, aminoglutethimide, megestrol acetate (MEGASE®), exemestane (AROMASIN®), formestane, fadrozole, vorozole (RIVISOR®), letrozole (FEMARA®) and anastrozole (ARIMIDEX®). In addition, this definition of chemotherapeutic agents includes bisphosphonates such as clodronate (eg BONEFOS® or OSTAC®), etidronate (DIDROCAL®), NE-58095, zoledronic acid / zoledronate (ZOMETA®), alendronate (FOSAMAX®), pamidronate (AREDIA®), tiludronate (SKELID®) or risedronate (ACTONEL®); as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analogue); antisense oligonucleotides, in particular those which inhibit gene expression in signaling pathways implicated in aberrant cell proliferation such as, for example, PKC-alpha, Raf, H-Ras and epidermal growth factor receptor (EGF-R); vaccines such as the THERATOPE vaccine, gene therapy vaccines, for example, ALLOVECTIN vaccine, LEUVECTIN vaccine and VAXID vaccine; topoisomerase 1 inhibitor (e.g., LURTOTECAN®); rmRH (e.g., ABARELIX®); lapatinib ditosylate (a small ErbB-2 and EGFR tyrosine kinase small molecule inhibitor also referred to as GW572016); COX-2 inhibitors such as celecoxib (CELEBREX®, 4- (5- (4-methylphenyl) -3- (trifluoromethyl) -1H-pyrazol-1-yl) benzenesulfonamide, and salts, The term " cytokine " is a generic expression for proteins released by a cell population that act on another cell as intercellular mediators. Examples of such cytokines are lymphokines, monokines and traditional polypeptide hormones. Included in the cytokines are growth hormones, such as human growth hormone, N-methionyl human growth hormone and bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, pro-relaxin, hormones of glycoprotein such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH) and luteinizing hormone (LH), hepatic growth factor, fibroblast growth factor; placental lactogen; alpha factor and tumor necrosis factor beta; Mullerian inhibitory substance; peptide associated with mouse gonadotropin; inhibin; activin; vascular endothelial growth factors (e.g., VEGF, VEGF-B, VEGF-C, VEGF-D, VEGF-E); placental derived growth factor (PIGF); platelet-derived growth factors (PDGF, e.g., PDGFA, PDGFB, PDGFC, PDGFD); integrin; thrombopoietin (TPO); nerve growth factors such as NGF-alpha; platelet growth factor; transforming growth factors (TGFs) such as TGF-alpha and TGF-beta; factor I and insulin-like growth factor II; erythropoietin (EPO); osteoinductive factors; interferons such as interferon alpha, beta and gamma, colony stimulating factors (CSF) such as macrophage CSF (M-CSF); CSF of granulocyte-macrophage (GM-CSF); and granulocyte CSF (G-CSF); interleukins (IL) such as IL-1, IL-1 alpha, IL-1 beta, IL-2, IL-3, IL-4, IL-5, IL-β, IL-7, IL- 9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-30; secretaglobin / uteroglobin; oncostatin M (OSM); a tumor necrosis factor such as TNF alpha or TNF beta; and other polypeptide factors including LIF and ligand kit (KL). As used herein, the term "cytokine" includes proteins from natural sources or from recombinant cell culture and biologically active equivalents of native sequence cytokines. 41 ΕΡ 1 771 474 / ΡΤ The term " prodrug " as used in this application refers to a precursor or derivative form of a pharmaceutically active substance which is less cytotoxic to tumor cells compared to the parent drug and is capable of being activated enzymatically or converted into the more active parent form. See, e.g., Wilman, " Prodrugs in Cancer Chemotherapy " Biochemical Society Transactions, 14, p. 375-382, 615 ° Meeting Belfast (1986) and Stella et al., &Quot; Prodrugs: A Chemical Approach to Targeted Drug Delivery, " Directed Drug Delivery, Borchardt et al. (Ed.), P. 247-267, Humana Press (1985). The prodrugs of this invention include, but are not limited to, phosphate-containing prodrugs, thiophosphate-containing prodrugs, sulfate-containing prodrugs, peptide-containing prodrugs, D-amino acid-modified prodrugs, glycosylated prodrugs , prodrugs containing beta-lactam, prodrugs optionally containing substituted phenoxyacetamide or prodrugs optionally containing substituted phenylacetamide, prodrugs of 5-fluorocytosine and other prodrugs of 5-fluorouridine which may be converted into the free drug form cytotoxic activity. Examples of cytotoxic drugs that may be derivatized in a prodrug form for use in this invention include, but are not limited to, the chemotherapeutic agents described above.

An " angiogenic factor or agent " is a growth factor that stimulates the development of blood vessels, e.g., promotes angiogenesis, endothelial cell growth, blood vessel stability and / or vasculogenesis, etc. For example, angiogenic factors include, but are not limited to, eg VEGF and members of the VEGF family, PIGF, PDGF family, fibroblast growth factor (FGF) family, TIE ligands (angiopoietins), ephrin, ANGPTL3, ANGPTL4, etc. . Also included would include factors that accelerate the healing of wounds, such as growth hormone, insulin-like growth factor-I (IGF-I), VIGF, epidermal growth factor (EGF), CTGF and members of their family and TGF-α and TGF-β. See, e.g., Klagsbrun and D'Amore, Annu. Rev. Physiol., 53: 217-39 (1991); Streit and Detmar, Oncogene, 22: 3172-3179 (2003); Ferrara and Alitalo, Nature Medicine 5 (12): 1359-1364 42 ΕΡ 1 771 4 7 4 / PT (1999); Tonini et al., Oncogene, 22: 6549-6556 (2003) (e.g., table 1 showing a list of angiogenic factors); and Sato Int. J. Clin. Oncol., 8: 200-206 (2003).

An " antiangiogenic agent " or " angiogenesis inhibitor " refer to a low molecular weight substance, a polynucleotide, a polypeptide, an isolated protein, a recombinant protein, an antibody, or conjugates or fusion proteins thereof, which inhibit direct, undesirable angiogenesis, vasculogenesis or vascular permeability or indirectly. For example, an antiangiogenic agent is an antibody or other antagonist for an angiogenic agent as defined above, eg, antibodies to VEGF, antibodies to VEGF receptors, small molecules that block VEGF receptor signaling (eg, PTK787 / ZK2284, SU6668). Antiangiogenic agents also include native angiogenesis inhibitors, e.g., angiostatin, endostatin, etc. See, e.g., Klagsbrun and D'Amore, Annu. Rev. Physiol., 53: 217-39 (1991); Streit and Detmar, Oncogene, 22: 3172-3179 (2003) (e.g., table 3 which lists antiangiogenic therapies in malignant melanoma); Ferrara and Alitalo, Nature Medicine 5 (12): 1359-1364 (1999); Tonini et al., Oncogene, 22: 6549-6556 (2003) (e.g., table 2 showing a list of antiangiogenic factors); and Sato Int. J. Clin. Oncol., 8: 200-206 (2003) (e.g., table 1 showing a list of antiangiogenic agents used in clinical trials). The " label " when used herein refers to a detectable compound or composition which is directly or indirectly conjugated to the polypeptide. The label may itself be detectable (e.g., radioisotope markers or fluorescent labels) or, in the case of an enzymatic label, may catalyze a chemical change of a substrate compound or composition that is detectable.

An " isolated nucleic acid molecule " is a nucleic acid molecule that is identified and separated from at least one contaminating nucleic acid molecule with which it is usually associated in the natural source of the nucleic acid of the polypeptide. An isolated nucleic acid molecule is in a form other than the form or configuration as it is found.

ΕΡ 1 771 4 7 4 / PT in nature. Thus, isolated nucleic acid molecules are distinguished from the nucleic acid molecule as it exists in natural cells. However, an isolated nucleic acid molecule includes a nucleic acid molecule contained in cells which usually express the polypeptide in which, for example, the nucleic acid molecule is in a different chromosomal location than that in the natural cells. The phrase " control sequences " refers to the DNA sequences necessary for the expression of a coding sequence operably linked in a given host organism. Control sequences which are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers. The nucleic acid is " operably linked " when placed in a functional relationship with another nucleic acid sequence. For example, the DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a pre-protein which participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence, if positioned so as to enhance translation. In general, " operably linked " means that the DNA sequences that are attached are contiguous and, in the case of a secretion command, contiguous and in reading phase. However, the enhancers do not have to be contiguous. Binding is achieved by binding at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide linkers or adapters are used according to conventional practice.

As used herein, the terms " cell ", " " cell line " and " cell culture " are used interchangeably and all these denominations include the progeny. Thus, the expressions " transformation products " and " transformed cells " include the primary cell in question and its derived cultures without regard to the number of transfers. 44 ΕΡ 1 771 474 / ΡΤ

It should also be considered that not all offspring have to be precisely identical in DNA content due to deliberate or inadvertent mutations. Mutant progeny having the same biological function or activity as that traced in the originally transformed cells are included. When different names are intended, it will be evident from the context. ANGPTL4 Angiopoietin-like protein 4 (ANGPTL4) is an excreted protein and is a member of the angiopoietin family. It is also known as hepatic fibrinogen / angiopoietin (HFARP) related protein (Kim et al., Biochem., 346: 603-610 (2000)), PGAR (PPARy angiopoietin-related protein) (Yoon et al., Mol Cell Biol, 20: 5343-5349 (2000)), fasting induced adipose factor (FIAF) (Kerten et al., J. Biol. Chem., 275: 28488-28493 (2000)); angiopoietin-related protein (ARP-4); NL2 (see U.S. Patent 6,348,350; 6,372,491; and 6,455,496); and Ang6. The human ANGPTL4 protein is a 406 amino acid protein (eg, U.S. Patent Nos. 6,348,350, 6,317,241 and 6,455,496), while mouse ANGPTL4 is a 410 amino acid protein (Kim et al., Biochem J. 346: 603-610 (2000)). The mouse and human proteins share about 75% sequence identity at the amino acid level. Kim et al., Biochem. J. 346: 603-610 (2000). ANGPTL4 has a signal peptide, three potential N-glycosylation sites and four cysteines that may be involved in intramolecular disulfide bonds. For example, ANGPTL4 forms larger molecular structures, e.g., as indicated in Figure 3, panel A. See also, e.g., Ge et al., J. Biol. Chem., 279 (3): 2038-2045 (2004); Ge et al., J. Lipid Res. 45: 2071-2079 (2004); and Mandard et al., J. of Biol. Chem., 279 (33): 34411-34420 (2004). ANGPTL4 can also be proteolytically processed. See also, e.g., Ge et al., J. Biol. Chem., 279 (3): 2038-2045 (2004); and Mandard et al., J. of Biol. Chem., 279 (33): 34411-34420 (2004). As described herein, the R162G and R164E substitutions of ANGPTL4 result in the ANGPTL4 variant which runs at a molecular weight on a higher SDS gel

(Or native) protein (see Figure 3, panel B).

The conserved regions of the angiopoietin family include a coiled-helix domain and a fibrinogen-like C-terminal domain (FBN). See, e.g., Kim et al., Biochem. J. 346: 603-610 (2000). It has been suggested that ANGPTL4 is proteolytically processed in a regulated fashion to release a fibrinogen-like C-terminal domain. See, e.g., Ge et al., J. Biol. Chem., 279 (3): 2038-2045 (2004). Other members of the angiopoietin family include angiopoietin 1, angiopoietin 2 and angiopoietin 3 / angiopoietin 4, which bind to the Tie 2 receptor. See, e.g., Davis et al., Cell 87, 1161-1169 (1996); Maisonpierre et al., Science 277, 55-60 (1997); Valenzuela et al., Proc. Natl.

Acad. Know. USA 96, 1904-1909 (1999); and U.S. Patents 5,521,073; 5,650,490; and 5814464. Angiopoietins 1 and 4 appear to be agonists for the Tie2 receptor, whereas angiopoietins 2 and 3 appear to be an antagonist (and possibly an agonist) for the Tie2 receptor. See, e.g., Folkman and D'Amore, Cell, 87: 1153-1155 (1996); Suri et al., Cell, 87: 1171-1180 (1996); Masionpierre et al., Science 277: 55-60 (1997); and Ward and Dumont, Seminars in Cell & Developmental Biology, 13: 19-27 (2002).

Another family member, angiopoietin-like protein 3 (ANGPTL3) is an angiogenic factor that binds ανβ3 integrin. See, eg, U.S. Patent Application 20030215451, published November 20, 2003 and Camenisch et al., J. Biol. Chem., 277 (19): 17281-17290 (2002). ANGPTL3 does not appear to bind to the Tie2 receptor. Camenish et al., Journal of Biol. Chem. 277 (19): 17281-17290 (2002). ANGPTL3 is also a regulator of plasma lipid levels. See, e.g., Koishi et al., Nat. Genetics 30: 151-157 (2002). ANGPTL4 binds ανβ5 integrin. See, eg, Figures 11, 12 and 13. Integrin ανβ5 is a receptor for extracellular matrix proteins including vitronectin and Del-1 (see, eg, Stupack and Cheresh, Journal of Cell Science 115: 3729-3738 (2002)). . Alpha v-integrins were implicated in tumor progression and metastasis. See, e.g., Marshall, JF and Hart, I R Semin. Cancer Biol. 7 (3): 129-46 ΕΡ 1 771 474 / ΡΤ 38 (1996). In addition, a role of alpha v-integrins has also been demonstrated during angiogenesis. See, e.g., Eliceiri, B P and Cheresh, D A Molecular Medicine 4: 741-750 (1998). For example, a monoclonal antibody to ανβ5 has been shown to inhibit VEGF-induced angiogenesis in rabbit cornea and chorioallantoic membrane model of chicken. See, e.g., M.C. Friedlander, et al., Science 270: 1500-1502 (1995). Ανβ5 and ανβ5 antagonists have also been shown to inhibit growth factor-induced and tumor-induced angiogenesis. See, e.g., Eliceiri and Cheresh, Current Opinion in Cell Biology, 13: 563-568 (2001). The invention provides compositions of modulators, e.g. agonists or antagonists, of angiopoietin-like protein 4 (ANGPTL4) and combinations of such modulators with other therapeutic agents. For example, combinations of ANGPTL4 antagonists with anticancer agents and methods for their use to block or reduce tumor growth or the growth of cancer cells. The invention also provides methods for blocking or reducing relapses of tumor growth or relapses of growth of cancerous cells with ANGPTL4 antagonists and / or other anticancer agents. Also provided are compositions of ANGPTL4 antagonists and combinations of antiangiogenic agents and methods for their use in blocking or reducing neovascularization in neoplastic or non-neoplastic disorders.

ANGPTL4 modulators and their uses.

ANGPTL4 modulators are molecules that modulate the activity of ANGPTL4, e.g., agonists and antagonists. The phrase " agonist " is used to refer to the peptide and non-peptidic analogs of ANGPTL4 and antibodies that specifically bind to these ANGPTL4 molecules, as long as they have the ability to signal through a native ANGPTL4 receptor (e.g., ανβ5 integrin). The phrase " agonist " is defined in the context of the biological role of an ANGPTL4 receptor (e.g., ανβ5). In certain embodiments, the agonists possess the biological activities of a native ANGPTL4, as defined above, such as promoting proliferation, migration and / or cell adhesion and / or modulation of lipid homeostasis. The phrase " antagonist " is used to refer to molecules which have the ability to inhibit the biological activity of ANGPTL4 independently of having the ability to bind to ANGPTL4 or its receptor, eg, ανβ5. Thus, antagonists having the ability to bind to ANGPTL4 or its receptor include anti-ANGPTL4 and anti-γνβδ antibodies. ANGPTL4 antagonists can be evaluated, eg, by inhibition of ANGPTL4 activity, eg, adhesion, migration, proliferation and / or modulation of lipPTH4 lipid homeostasis activity. Regarding ανβ5 integrin receptor activity, a modulator of an ανβ5 integrin receptor can be determined by methods known in the art. For example, the method described by J.W. Smith et al. in J. Biol. Chem. 265: 12267-12271 (1990).

Therapeutic uses ANGPTL4 is implicated as a cancer target. When expressed in some tumor cells, ANGPTL4 causes proliferation of tumor cells, in vitro and in vivo (see, e.g., Figure 4, Figure 5, Figure 7 and Figure 8, Panel A and Panel B). When ANGPTL4 is expressed in tumors to be treated with an antiangiogenic factor, e.g., anti-VEGF antibody, the tumor can maintain the ability to grow (see, e.g., Figure 8, panel C). ANGPTL4 also causes migration of tumor cells (see, e.g., Figure 9). It has also been shown to be upregulated in renal cancers. See, e.g., process of the agent number P5032R1; WO 02107941; and Le Jan et al., American Journal of Pathology, 162 (5): 1521-1528 (2003). In addition, ANGPTL4 is a pro-angiogenic factor (see, eg, S. Le Jan et al., Am. J. Pathol., 162 (5): 1521-1528 (2003)), which are targets for therapy of cancer. Similar to VEGF (Shweiki et al., Proc. Natl Acad Sci, USA 92: 768-772 (1995), ANGPTL4 expression is increased in response to hypoxia See, eg, Le Jan et al., American AngptL4 binds to tumor cells, eg, A673 cells, under various conditions (eg, Figure 6, panel A and B). As 48 Ρ Ρ 1 771 474 / ΡΤ shown in Figure 4, panel A and panel B, ANGPTL4 stimulates some growth of tumor cells in vitro when cells are transduced with an expression construct expressing ANGPTL4. Figure 4, panel C also illustrates that addition of medium conditioned by ANGPTL4-transduced C0S7 cells induces proliferation of A673 cells. See also Figure 7, panel A and B. ANGPTL4 induces A673 proliferation cell proliferation when coating culture plates with ANGPTL4 (see Figure 5) , but does not induce cellular proliferation of kidney epithelial cells, renal mesangial or HUVEC. ANGPTL4 also induces the cell migration of tumor cells. See, eg, figure 9. ANGPTL4 is predominantly expressed in adipose tissue, placenta, liver and kidney and is also upregulated in ob / ob mice (" knockout " for leptin) and db / db (" knockout " of leptin). See, e.g., Yoon et al., Mol. Cell. Biol. 20: 5343-5349 (2000); Kim et al., Biochem. J., 346: 603-610 (2000); Kersten et al., J. Biol. Chem., 275: 28488-28493 (2000); and Le Jan et al., American Journal of Pathology 162 (5): 1521-1528 (2003). It has also been reported that ANGPTL4 is a lipid modulator and lipoprotein-lipase inhibitor. See, e.g., Yu et al., PNAS USA 102 (5): 1767-1772 (2005); Yoshida et al., J. Lipid Res. 43: 1770-1772 (2002); and Wiesner et al., J. Endocrinology 180: R 1 -R 6 (2004). The expression of ANGPTL4 is also induced by PPAR gamma and alpha in adipose tissue and is induced by fasting. It also modulates preadipocyte and hepatocyte proliferation and / or preadipocyte cell migration along with modulation of triglyceride and serum cholesterol levels. See, U.S. Provisional Application Serial No. 60/589875 and P2156R1 Agent Process filed concomitantly and published as WO 2006/014678. The researchers reported the existence of links between angiogenesis and adipogenesis. See, e.g., Sierra-Honigmann et al., &Quot; Biological Action of Leptin as an Angiogenic Factor " Science 281: 1683-1686; (1998); Rupnick et al., &Quot; Adipose tissue mass can be regulated through the vasculature " Proc. Nat. Acad. Know. USA, 99 (16): 10730-10735 (2002); and Fukumura et al., " Paracrine Regulation of Angiogenesis and Adipocyte Differentiation During In Vivo Adipogenesis. " Circ. Res. 93: 88-97 (2003). 49 ΕΡ 1 771 474 / ΡΤ

It is contemplated that in accordance with the invention, ANGPTL4 modulators and / or combinations of ANGPTL4 modulators and other therapeutic agents may be used to treat various neoplastic and non-neoplastic diseases. In one embodiment, ANGPTL4 modulators, e.g., ANGPTL4 antagonists, are used in inhibiting the growth of cancer cells or tumors. For example, as can be seen in Figure 10, panel A and B, anti-ANGPTL4 polyclonal antibodies inhibited the growth of tumor cells in a dose-dependent manner. ANGPTL4 may cause migration of tumor cells (see, e.g., FIG. 9). It is contemplated that, according to the invention, ANGPTL4 antagonists may also be used to inhibit metastases from a tumor. ANGPTL4 also induces preadipocyte migration. See U.S. Patent Application Serial No. 60/589875 and P2156R1 Agent Process filed concomitantly and published as WO 2006/014678. In certain embodiments, one or more anticancer agents may be administered with ANGPTL4 antagonists to inhibit the growth of cancer cells or tumors. Consult here the section entitled Combined Therapies.

Examples of neoplastic disorders to be treated include, but are not limited to, those described herein by the terms " cancer " and " cancerous ". Non-neoplastic diseases that are amenable to treatment with antagonists of the invention include, but are not limited to, undesirable or aberrant hypertrophy, arthritis, rheumatoid arthritis (RA), psoriasis, psoriatic plaques, sarcoidosis, atherosclerosis, atherosclerotic plaques, edema due to myocardial infarction, diabetic retinopathies and other proliferative retinopathies including retinopathy of prematurity, retrolenticular fibroplasia, neovascular glaucoma, age-related macular degeneration, diabetic macular edema, corneal neovascularization, corneal graft neovascularization, corneal graft rejection, neovascularization retinal / choroidal neovascularization, neovascularization of the angle (rubeose), ocular neovascular disease, vascular restenosis, AVM, meningioma, hemangioma, angiofibroma, thyroid hyperplasias (including Grave's disease), corneal and other tissue transplantation, inflammation chronic inflammation pulmonary effusions, cerebral edema (eg, associated with acute stroke / closed head injury / trauma), synovial inflammation, formation of pulmonary edema, osteoarthritis (OA), refractory ascites, polycystic ovarian disease, endometriosis, third-stage fluid diseases (pancreatitis, compartment syndrome, burns, intestinal disease), uterine fibroids, premature labor, chronic inflammation such as IBD (Crohn's disease and ulcerative colitis), renal allograft rejection, inflammatory bowel disease, nephrotic syndrome, undesirable or aberrant (non-cancerous) tissue mass growth, obesity, adipose tissue mass growth , hemophiliac joints, hypertrophic scars, inhibition of hair growth, Osler-Weber syndrome, fibroplasias ren scleroderma, trachoma, vascular adhesions, synovitis, dermatitis, preeclampsia, ascites, pericardial effusion (such as associated with pericarditis), and pleural effusion.

ANGPTL4 modulators, e.g., ANGPTL4 agonists or activators may be used for treating pathological disorders. AngPTL4 modulators, eg, ANGPTL4 agonists, may be used in the treatment of pathological disorders in which angiogenesis or neovascularization and / or hypertrophy are desired, which include, but are not limited to, vascular traumatism, wounds, lacerations, incisions, burns, ulcers (eg, diabetic ulcers, pressure ulcers, hemophilia ulcers, varicose ulcers), tissue growth, weight gain, peripheral arterial disease, labor induction, hair growth, epidermolysis bullosa, retinal atrophy, bone fractures of the spinal cord, tears of the meniscus, etc. See also, U.S. Provisional Application Serial No. 60/589875 and P2156R1 Agent Process Presented Simultaneously and Published as WO 2006/014678.

Combination Therapies

As previously indicated, the invention provides combined therapies wherein an ANGPTL4 antagonist is administered with another therapy. For example, ANGPTL4 antagonists are used in combinations with anti-cancer therapies or anti-neovascularization therapies to treat various neoplastic or non-neoplastic conditions. In one embodiment, the neoplastic or non-neoplastic condition is characterized by pathological disorder associated with aberrant or unwanted angiogenesis. The ANGPTL4 antagonist may be administered in series or in combination with another agent that is effective for such purposes, either in the same composition or in independent compositions. Alternatively or in addition, multiple ANGPTL4 inhibitors may be administered. Administration of the antagonist and / or agents of the invention may be effected simultaneously, e.g. as a single composition or as two or more distinct compositions using the same or different route of administration. Alternatively or additionally, the administration may be carried out sequentially in any order. In certain embodiments, there may be intervals between administrations of two or more compositions which may range from minutes to days, from weeks to months. For example, the anticancer agent followed by the ANGPTL4 inhibitor may be administered first. However, simultaneous administration or initial administration of the ANGPTL4 antagonist is also considered.

Effective amounts of therapeutic agents administered in combination with an ANGPTL4 antagonist will be decided by the attending physician or the attending veterinarian. Administration of the dosage and its adjustment are performed to obtain maximum control of the diseases to be treated. The dose will further depend on factors such as the type of therapeutic agent to be used and the specific patient to be treated. Suitable dosages for the anticancer agent are those presently used and may be decreased due to the combined action (synergy) of the anticancer agent and the ANGPTL4 antagonist. In certain embodiments the combination of the inhibitors potentiates the efficacy of a single inhibitor. The " power " refers to an improvement in the efficacy of a therapeutic agent at its usual or approved dose. See also the section entitled Pharmaceutical Compositions. 52 ΕΡ 1 771 474 / ΡΤ

Typically, ANGPTL4 antagonists and anti-cancer agents are suitable for the same disease or for similar diseases to block or reduce a pathological disorder such as tumor growth or the growth of a cancer cell. In one embodiment the anticancer agent is an antiangiogenic agent. Cancer antiangiogenic therapy is a cancer treatment strategy directed to inhibit the development of tumoral blood vessels necessary to provide nutrients to support tumor growth. Because angiogenesis is involved in primary tumor growth and metastasis, the antiangiogenic treatment provided by the invention is capable of inhibiting neoplastic tumor growth at the primary site as well as preventing tumor metastasis at secondary sites, thus allowing the tumor to be attacked by other therapies .

Many antiangiogenic agents have been identified and are known in the art, including those presented herein, e.g., set forth in Definitions and by, e.g., Carmeliet and Jain, Nature 407: 249-257 (2000); Ferrara et al., Nature Reviews (DPR Discovery, 3: 391-400 (2004); and Sato Int. J. Clin. Oncol., 8: 200-206 (2003). See also, patent application US20030055006. In one embodiment, the ANGPTL4 antagonist is used in combination with an anti-VEGF neutralizing antibody (or fragment) and / or another VEGF antagonist or a VEGF receptor antagonist, including but not limited to, for example, the receptor (eg, VEGFR-1, VEGFR-2, VEGFR-3, fragments of neuropepins (eg, NRP1, NRP2)), aptamers capable of blocking VEGF or VEGFR, anti-VEGFR neutralizing antibodies, low molecular weight tyrosine kinases (RTK) VEGFR, antisense strategies for VEGF, ribozymes against VEGF or VEGF receptors, VEGF antagonist variants; and any of its combinations. Alternatively or in addition, two or more angiogenesis inhibitors may be co-administered to the patient. In one embodiment, one or more additional therapeutic agents, e.g., anticancer agents may be administered in combination with an ANGPTL4 antagonist and an antiangiogenic agent. 53 ΕΡ 1 771 474 / ΡΤ

In certain aspects of the invention, other therapeutic agents useful for tumor therapy in combination with an antagonist of the invention include other cancer therapies, (eg, surgery, radiological treatments (eg, involving irradiation or administration of radioactive substances), chemotherapy, treatment with agents anticancer agents disclosed herein and known in the art or combinations thereof). Alternatively or in addition, two or more antibodies that bind to the same or two or more different antigens disclosed herein may be co-administered to the patient. It may sometimes be beneficial to also administer one or more cytokines to the patient.

Chemotherapeutic agents

In certain aspects the invention provides a method of blocking or reducing tumor growth or growth of a cancer cell by administering effective amounts of an ANGPTL4 antagonist and / or one or more angiogenesis inhibitors and one or more chemotherapeutic agents to one a patient who is susceptible to cancer or who has been diagnosed as having cancer. Various chemotherapeutic agents may be used in the combined treatment methods of the invention. It is provided here in " Definition " a non-limiting example of the chemotherapeutic agents considered.

As will be apparent to those skilled in the art, suitable doses of chemotherapeutic agents will generally be around those already used in clinical therapies where the chemotherapy products are administered alone or in combination with other chemotherapy products. There will probably be a dosage variation depending on the disease being treated. The attending physician administering the treatment will be able to determine the appropriate dose for the particular individual.

Relapse of Tumor Growth The invention also provides methods and compositions for inhibiting or preventing relapse of tumor growth or relapse of growth of cancer cells. For example, Panel C of Figure 54 schematically illustrates the ability of a tumor being treated with an anti-VEGF antibody (AVASTIN) to escape the treatment (eg, a type of relapse) when the tumor also expresses ANGPTL4.

Tumor growth relapse or relapse of cancer cell growth is used to describe a condition in which patients being treated or who have been treated with one or more of the currently available therapies (eg, cancer therapies such as chemotherapies, radiation therapy , surgery, hormone therapy and / or biological therapy / immunotherapy, in particular a standard therapeutic regimen for the specific cancer) is not clinically appropriate to treat patients or patients are no longer enjoying any beneficial effect of the therapy so that such patients need additional effective therapy. As used herein, the phrase may also refer to a " non-sensitive / refractory " patient condition, eg, which describes patients who are sensitive to therapy but who suffer from side effects, develop resistance, are not sensitive to therapy, are not satisfactorily sensitive to therapy, etc. In various embodiments, cancer is relapsed from tumor growth or relapse of cancer cell growth where the number of cancer cells has not been significantly reduced or increased or tumor size has not been significantly reduced or increased or failed any further size reduction or of the number of cancerous cells. It can be determined whether the cancer cells are relapsed from tumor growth or relapse of cancer cells growth in vivo or in vitro by any method known in the art to test the efficacy of treatment of cancer cells using the meanings accepted in the art in such context for " relapse " or " refractory " or " non-sensitive ". The invention provides methods for blocking or reducing relapse of tumor growth or relapse of growth of cancer cells in an individual by administration of one or more of the ANGPTL4 antagonists of the invention to block or reduce relapse of tumor growth or relapse of growth of cancer cells in the individual. In certain embodiments, the ANGPTL4 antagonist 557 474 / subsequ can be administered subsequent to cancer therapy. In certain embodiments, ANGPTL4 is administered concurrently with cancer therapy. Alternatively or in addition, ANGPTL4 antagonist therapy alternates with other cancer therapy, which may be performed in any order. The invention also encompasses methods for administering one or more ANGPTL4 inhibitory antibodies to prevent the onset or recurrence of cancer in cancer predisposed patients. In general, the subject has been, or is, undergoing simultaneous cancer therapy.

In one embodiment the cancer therapy is treatment with an antiangiogenic agent. The antiangiogenic agent includes those known in the art and those found herein in Definitions. In one embodiment, the antiangiogenic agent is an anti-VEGF neutralizing antibody or fragment (e.g., humanized A4.6.1, AVASTIN® (Genentech, South San Francisco, CA), Y0317, M4, G6, B20, 2C3, etc.). See, e.g., U.S. Patents 6582959, 6884879, 6703020; WO 98/45332; WO 96/30046; WO 94/10202; ΕΡ 0666868B1; U.S. patent applications 20030206899, 20030190317, 20030203409 and 20050112126; Popkov et al., Journal of Immunological Methods 288: 149-164 (2004); and process of authorized representative No PR2072-4. Additional agents may be administered in combination with ANGPTL4 antagonists to block or reduce relapse of tumor growth or relapse of growth of cancer cells, e.g. see the section herein entitled Combination Therapies.

In one embodiment, the ANGPTL4 antagonists of the invention or other therapeutic products are administered that reduce the expression of ANGPTL4 to reverse the resistance or reduced sensitivity of cancer cells to certain biological, hormonal, radiation and chemotherapeutic agents thus making the cancer cells sensitized to one or more of these agents, which can then be administered (or continue to be administered) to treat or manage the cancer, including avoiding metastases.

Antibodies

Antibodies of the invention include anti-ANGPTL4 antibodies and anti-ANGPTL4 fragment antibodies, antibodies that are antiangiogenic agents or angiogenesis inhibitors, antibodies that are anti-cancer agents, antibodies to an ANGPTL4 receptor, eg, antibody anti-Î ± v β5 or other antibodies described herein. Examples of antibodies include, e.g., polyclonal, monoclonal, humanized, fragmented, multispecific, heteroconjugate, multivalent, effector, etc. antibodies.

Polyclonal antibodies

Antibodies of the invention may include polyclonal antibodies. The person skilled in the art knows methods for preparing polyclonal antibodies. For example, polyclonal antibodies against an antibody of the invention are developed in animals through one or more subcutaneous (sc) or intraperitoneal (ip) injections of the relevant antigen and an adjuvant. It may be useful to conjugate the relevant antigen to a protein which is immunogenic in the species to be immunized, eg, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin or soybean trypsin inhibitor using a bifunctional or derivatising agent, for example, maleimidobenzoyl ester of sulfosuccinimide (conjugation through flush residues), N-hydroxysuccinimide (via lysine residues), glutaraldehyde, succinic anhydride, SOCI2 or R1N = C = NR, wherein R and R1 are different alkyl groups.

Immunogenic conjugates or derivatives are immunized against a molecule of the invention, eg, 100æg or 5æg of the protein or conjugate (for rabbits or mice respectively) with 3 volumes of Freund's complete adjuvant and intradermal injection of solution in multiple locations. One month later the animals receive boosters with 1/5 to 1/10 of the original amount of peptide or conjugate in complete Freund's adjuvant by subcutaneous injection at multiple sites. Seven to 14 days later the animals are bleed and serum is assayed for antibody titer. The animals receive reinforcements until stabilization of the titer. Typically, the animal is boosted with a conjugate of the same antigen but which is conjugated to a different protein and / or through a different cross-linking reagent. Conjugates can also be produced in recombinant cell culture in the form of protein fusions. Also, aggregation agents such as alum are used to increase the immune response. 57 ΕΡ 1 771 474 / ΡΤ

Monoclonal antibodies

Monoclonal antibodies can be produced against an antigen described herein using the hybridoma method, first described by Kohler et al., Nature, 256: 495 (1975), or can be produced by recombinant DNA methods (U.S. Patent 4,816,567).

In the hybridoma method a mouse or other suitable host animal, such as a hamster or macaque monkey, is immunized as previously described to elicit lymphocytes that produce or are capable of producing antibodies that specifically bind to the protein used for immunization. Alternatively, lymphocytes can be immunized in vitro. The lymphocytes are then fused to myeloma cells using a suitable fusion agent such as polyethylene glycol to form a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, p.593 (Academic Press, 1986)).

The hybridoma cells thus prepared are inoculated and cultured in a suitable culture medium which typically contains one or more substances that inhibit the growth or survival of unfused progenitor myeloma cells. For example, if the progenitor myeloma cells are free of the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for the hybridomas will typically include hypoxanthine, aminopterin and thymidine (HAT medium), substances that prevent growth of HGPRT.

Typical myeloma cells are those that fuse efficiently, maintain stable antibody production at high levels by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. Among these, preferred myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, California, USA, and SP- 2 or X63-Ag8-653 available from the American Type Culture Collection, Rockville, Maryland, USA. Human myeloma and human mouse heteromyeloma cell lines have also been described for the production of human monoclonal antibodies ( Kozbor, J. Immunol., 133: 3001 (1984), Brodeur et al., Monoclonal Antibody Production Tehniques and Applications, pp. 51-63 (Mareei Dekker, Inc., New York, 1987).

The culture medium in which hybridoma cells are grown for the production of monoclonal antibodies directed against, e.g., ANGPTL4, ανβδ or an angiogenesis molecule is assayed. The binding specificity of monoclonal antibodies produced by hybridoma cells can be determined by immunoprecipitation or by in vitro binding assay such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA). These techniques and assays are known in the art. The binding affinity of the monoclonal antibody can be determined, for example, by the Scatchard analysis of Munson and Pollard, Anal. Biochem., 107: 220 (1980).

After identification of the hybridoma cells that produce antibodies with the desired specificity, affinity and / or activity, clones can be subcloned by limiting dilution procedures and cultured by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, p. 59-103 (Academic Press, 1986)). Suitable culture media for this purpose include, for example, D-MEM or RPMI-1640 medium. In addition, hybridoma cells may be grown in vivo as ascitic tumors in an animal.

The monoclonal antibodies excreted by the subclones are suitably separated from the culture medium, ascites fluid or serum by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose chromatography, hydroxylapatite, gel electrophoresis, dialysis or affinity.

Monoclonal antibodies can also be produced by recombinant DNA methods such as those described in U.S. Patent No. 4,816,567. DNA encoding monoclonal antibodies is readily isolated and sequenced using standard procedures (eg, using oligonucleotide probes which are capable of binding specifically genes encoding the heavy and light chains of the monoclonal antibodies). Hybridoma cells serve as a source of that DNA. After isolation, DNA can be inserted into expression vectors which are then transfected into host cells such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells or myeloma cells that would not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. Recombinant antibody production will be described in more detail below.

In another embodiment, antibodies or antibody fragments may be isolated from antibody phage libraries generated by using the techniques described in McCafferty et al., Nature, 348: 552-554 (1990). Clackson et al., Nature, 352: 624-628- (1991) and Marks et al., J. Mol. Biol. 222: 581-597 (1991) describe the isolation of murine and human antibodies, respectively, using phage libraries. Subsequent publications describe the production of high affinity human antibodies (nM range) by chain shuffling (Marks et al., Bio / Technology, 10: 779-783 (1992)), as well as by combinatorial infection and in vivo recombination as a strategy to construct very large phage libraries (Waterhouse et al., Nuc. Acids Res., 21: 2265-2266 (1993)).

Thus, such techniques are viable alternatives to traditional monoclonal antibody hybridoma techniques for isolation of monoclonal antibodies. The DNA may also be modified, for example, by substitution for the coding sequence of the human heavy and light chain constant domains in place of the homologous murine sequences (U.S. Patent 4,816,567; Morrison, et al., Proc.Natl Acad Sci USA, 81: 6851 (1984)) or by covalent attachment of the immunoglobulin coding sequence to all or part of the coding sequence of a non-immunoglobulin polypeptide.

Typically, the constant domains of an antibody or the variable domains of a site of combination with the antigen of an antibody by these non-immunoglobulin polypeptides are substituted for creating a chimeric bivalent antibody comprising a site of combination with the antigen with specificity for one antigen and the other 60 ÅΡ 1 771 474 / ΡΤ combination with the antigen with specificity for a different antigen.

Humanized and human antibodies

Antibodies of the invention may comprise humanized antibodies or human antibodies. A humanized antibody has one or more amino acid residues introduced therefrom from a non-human source. These non-human amino acid residues are often referred to as " import residues " which are typically taken from an import " variable domain ". Humanization can essentially be carried out followed by the method of Winter et al. (Jones et al., Nature, 321: 522-525 (1986);

Riechmann et al., Nature, 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)), by substituting the sequences of a human antibody for the corresponding rodent CDR sequence (s). Accordingly, such " humanized " are chimeric antibodies (U.S. Patent 4,816,567) wherein substantially less than an intact human variable domain has been replaced by the corresponding sequence of a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are replaced by residues from analogous sites in rodent antibodies. The choice of human variable domains, both light and heavy, for use in the production of humanized antibodies is very important in reducing antigenicity. According to the method called " best fit ", the variable domain sequence of a rodent antibody is screened against the complete library of known human variable domain sequences. The human sequence closest to the rodent sequence is then accepted as the human skeleton (FR) for the humanized antibody (Sims et al., J. Immunol., 151: 2296 (1993); Chothia et al., J. Mol Biol., 196: 901 (1987)). Another method uses a specific framework derived from a consensual sequence of all human antibodies of a specific subgroup of light or heavy chains. The same framework can be used for a number of different humanized antibodies (Carter et al., Proc Natl Acad Sci USA 89: 4285 (1992); Presta et al., J. Immunol., 151: 2623 (1993) )). It is further important that the antibodies are humanized with high affinity retention towards the antigen and other favorable biological properties. To achieve this aim, according to a typical method, humanized antibodies are prepared by a process of analysis of the progenitor sequences and various conceptual humanized products using three-dimensional models of the progenitor and humanized sequences. Three-dimensional immunoglobulin templates are usually available and are familiar to those skilled in the art. Computer programs are available which illustrate and show probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these presentations allows the analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the candidate immunoglobulin's ability to bind its antigen. In this way, FR residues of the recipient and import sequences can be selected and combined so as to achieve the desired character of the antibody, such as increased affinity for the target antigen (s). Generally, CDR residues are directly and more substantially involved in the influence of antigen binding.

Alternatively, it is now possible to produce transgenic (e.g., mice) animals that are capable, upon immunization, of producing a complete repertoire of human antibodies in the absence of endogenous immunoglobulin production. For example, homozygous deletion of the antibody heavy chain flanking (JH) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of the human germline immunoglobulin gene matrix in these germline mutant mice will result in the production of human antibodies upon challenge with antigen. See, e.g., Jakobovits et al., Proc. Natl. Acad Sci. USA, 90: 2551 (1993); Jakobovits et al., Nature, 362: 255-258 (1993); Bruggermann et al., Year in Immun., 7: 333 (1993); and Duchosal et al. Nature 355: 258 (1992). Human antibodies can also be derived from phage display libraries (Hoogenboom et al., J. Mol. Biol., 227: 381

ΕΡ 1 771 4 7 4 / PT (1991); Marks et al., J. Mol, Biol., 222: 581-597 (1991);

Vaughan et al. Nature Biotech 14: 309 (1996)).

Human antibodies can also be produced using various techniques known in the art, including phage display libraries (Hoogenboom and Winter, J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol. , 222: 581 (1991)). According to this technique, antibody V domain genes are cloned in frame into a major or minor coat protein gene of a filamentous bacteriophage such as M13 or fd and are displayed as functional fragments of antibody on the surface of a particle phage. Because the filamentous particle contains a single stranded DNA copy of the phage genome, selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties. Thus, phage mimics some of the properties of cell B. Phage display in various formats reviewed in, eg, Johnson, K S. and Chiswell, DJ, Cur Opin in Struct Biol 3: 564-571 (1993). Various sources of V gene segments can be used for phage display. For example, Clackson et al., Nature, 352: 624-628 (1991) isolated a diverse array of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the spleens of immunized mice. A repertoire of V genes from unimmunized human donors can be constructed and antibodies can be isolated to a varied array of antigens (including autoantigens), eg, following essentially the techniques described by Marks et al., J. Mol. Biol. 222: 581-597 (1991), or Griffith et al., EMBO J. 12: 725-734 (1993). See also U.S. Patents 5,565,332 and 5,573,905. Also available are the techniques of Cole et al. and Boerner et al. for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, 77 (1985) and Boerner et al., J. Immunol., 147 (1): 86-95 1991)). Human antibodies can also be generated by activated B cells in vitro (see U.S. Patents 5,567,610 and 5,229,275).

Antibody fragments

Antibody fragments are also included in the invention. Various techniques have been developed for the production of antibody fragments. Traditionally, these fragments were derived by proteolytic digestion of intact antibodies (see, e.g., Morimoto et al., Journal of Biochemical and Biophysical Methods 24: 107-117 (1992) and

Brennan et al., Science, 229: 81 (1985)). However, such fragments can now be produced directly by recombinant host cells. For example, the antibody fragments can be isolated from the phage libraries of antibodies discussed above. Alternatively, Fab'-SH fragments can be recovered directly from E. coli and coupled gimmically to form F (ab ') 2 fragments (Carter et al., Bio / Technology 10: 163-167 (1992)). . In another approach, F (abf) 2 fragments can be isolated directly from the recombinant host cell culture. Other techniques for the production of antibody fragments will be obvious to the person skilled in the art. In other embodiments, the antibody of choice is a single chain Fv fragment (scFv). Refer to WO 93/16185; U.S. Patent 5,571,894; and U.S. Patent 5,587,458. Fv and sFv are the only species with intact combination sites that are free of constant regions; thus, are suitable for reducing non-specific binding during in vivo use. SFv fusion proteins can be constructed to provide fusion of an effector protein with the amino or carboxyl termini of an sFv. See Antibody Engineering, ed. Borrebaeck, supra. The antibody fragment may also be a " linear antibody ", e.g., as described in U.S. Patent 5,641,870 for example. Such linear antibody fragments may be monospecific or bispecific.

Multispecific (e.g., bispecific) antibodies

Antibodies of the invention also include, e.g., multispecific antibodies, which have binding specificities for at least two different antigens. Although these molecules normally bind only two antigens (i.e., bispecific antibodies, BsAb), in this expression when used herein, antibodies with additional specificities such as trispecific antibodies are included. Examples of BsAbs include those having one arm directed against a tumor cell antigen and the other arm directed against a cytotoxic trigger molecule such as anti-FcYRI / anti-CD15, anti-p85HER2 / FcYRIII (CD16), anti-CD3 / anti-CD3 / anti-p97, anti-CD3 / anti-renal cell carcinoma, anti-CD3 / anti-OVCAR antibody, anti-CD3 / anti-p85HER2 Anti-CD3 / L-D1 (anti-carcinoma of the colon), anti-CD3 / anti-melanocyte stimulating hormone analogue, anti-EGF / anti-CD3 receptor, anti-CD3 / anti-CAM Anti-CD3 / anti-CD19, anti-CD3 / MoV18, anti-neural cell adhesion molecule (NCAM) / anti-CD3, anti-folate binding protein (FBP) / anti-CD3, pan- carcinoma (AMOC-31) / anti-CD3; BsAb antibodies which binds specifically to a tumor antigen and an arm that binds to a toxin such as anti-saporin / anti-Id-1, anti-CD22 / anti-saporin, anti-CD7 / anti-saporin, anti -CD38 / anti-saporin, anti-CEA / anti-ricin A chain, anti-interferon-α (IFN-Î ±) / hybridoma anti-idiotype, anti-CEA and vinca alkaloid; BsAb to convert enzyme-activated prodrugs such as anti-CD30 / anti-alkaline phosphatase (which catalyzes conversion of the prodrug of mitomycin phosphate into mitomycin alcohol); BsAbs which can be used as fibrinolytic agents such as antifibrin / anti-tissue plasminogen activator (tPA), anti-fibrin / anti-urokinase plasminogen activator (uPA); BsAb so that immune complexes target cell surface receptors such as low density anti-lipoprotein (LDL) / anti-Fc receptor (e.g. FcyRI, FcyRII or FcyRIII); BsAb for use in therapy of infectious diseases such as anti-CD3 / herpes simplex anti-virus (HSV), anti-T cell receptor: CD3 / anti-influenza complex, anti-FcYR / anti-HIV; BsAbs for tumor detection in vitro or in vivo such as anti-CEA / anti-EOTUBE, anti-CEA and anti-DPTA, anti-p85HER2 / anti-hapten; BsAb as adjuvants for vaccines; and BsAb as diagnostic tools such as rabbit / anti-ferritin anti-IgG, horseradish peroxidase / anti-hormone, anti-somatostatin / anti-substance P, anti-HRP / anti-FITC, anti- CEA / anti-β-galactosidase. Examples of trispecific antibodies include anti-CD3 / anti-CD4 / anti-CD37, anti-CD3 / anti-CD5 / anti-CD37 and anti-CD3 / anti-CD8 / anti-CD37. Bispecific antibodies may be prepared in the form of whole antibodies or antibody fragments (e.g. bispecific F (ab ') 2> antibodies.

Methods for producing bispecific antibodies are known in the art. The traditional production of complete bispecific antibodies is based on the co-expression of two 65

And immunoglobulin light chain-heavy pairs in which the two chains have different specificities (Millstein et al., Nature, 305: 537-539 (1983)). Due to the random distribution of heavy and light immunoglobulin chains these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules of which only one has the correct bispecific structure. Purification of the correct molecule, which is usually effected by affinity chromatography steps, is quite complicated and yields of product are reduced. Similar procedures are disclosed in WO 93/08829 and in Traunecker et al., EMBO J., 10: 3655-3659 (1991).

In a different approach, variable antibody domains with the desired binding specificities (antibody-antigen-combining sites) are fused to immunoglobulin constant domain sequences. The fusion is preferably with an immunoglobulin heavy chain constant domain comprising at least part of the hinge, CH2 and CH3 regions. It is preferred to have the first heavy chain constant region (CHI) containing the site necessary for light chain binding, present in at least one of the fusions. DNA encoding the immunoglobulin heavy chain fusions and if desired, the immunoglobulin light chain, are inserted into separate expression vectors and co-transfected into a suitable host organism. This provides great flexibility in adjusting the relative proportions of the three polypeptide fragments in embodiments in which the use of disparate proportions of the three polypeptide chains in the constructions provides optimum yields. It is, however, possible to insert the coding sequences for two or all three polypeptide chains into an expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios have no special significance.

In one embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain having a first binding specificity in one arm and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity of Ρ Ρ Ρ 1 771 474 / ΡΤ ) on the other arm. This asymmetric structure has been found to facilitate separation between the desired bispecific compound and unintended immunoglobulin chain combinations since the presence of an immunoglobulin light chain in only half of the bispecific molecule provides an easy mode of separation. This approach is disclosed in WO 94/04690. For additional details on the generation of bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121: 210 (1986).

According to another approach described in WO96 / 27011, the interface between a pair of antibody molecules can be manipulated to maximize the percentage of heterodimers that are recovered from the recombinant cell culture. The preferred interface comprises at least a part of the Ch3 domain of an antibody constant domain. In this method, one or more small amino acid side chains of the interface of the first antibody molecule are replaced by larger side chains (e.g., tyrosine or tryptophan). They are created "cavities " (s) at the interface of the second antibody molecule by replacing the large amino acid side chains with smaller ones (e.g., alanine or threonine). This provides a mechanism for increasing the heterodimer yield relative to unintended end products such as homodimers.

Techniques for generating bispecific antibodies from antibody fragments have also been disclosed in the literature. For example, bispecific antibodies may be prepared using chemical binding. Brennan et al., Science, 229: 81 (1985) describes a procedure in which intact antibodies are cleaved proteolytically to generate F (ab ') 2 fragments. These fragments are reduced in the presence of the dithiol complexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent formation of intermolecular disulfide. The Fab 'fragments generated are then converted to thionitrobenzoate derivatives (TNB). One of the Fab'-TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific 67E-1 771 474 / anticor antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes. Recent progress has facilitated the direct recovery of Fab'-SH fragments from E. coli that can be chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med., 175: 217-225 (1992) disclose the production of a fully humanized bispecific antibody F (ab ') 2 molecule. Each Fab 'fragment was independently excreted from E. coli and subjected to direct chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed was capable of binding to cells expressing the VEGF receptor and normal human T cells as well as triggering lytic activity of human cytotoxic lymphocytes against human breast tumor targets.

Several techniques have been described for preparing and isolating bispecific antibody fragments directly from the recombinant cell culture. For example, bispecific antibodies were produced using leucine zippers. Kostelny et al., J. Immunol., 148 (5): 1547-1553 (1992). The leucine zipper peptides of the Fos and Jun proteins were ligated to the Fab 'portions of two different antibodies by gene fusion. The antibody homodimers were reduced in the hinge region to form monomers and thereafter re-oxidized to form the antibody heterodimers. This method can also be used for the production of antibody homodimers. The technology of " diabodies " described by Hollinger et al., Proc. Natl. Acad Sci. USA, 90: 6444-6448 (1993) provided an alternative mechanism for producing bispecific antibody fragments. The fragments comprise a heavy chain (VH) variable domain linked to a light chain variable domain (VL) by a linker that is too short to allow pairing between the two domains on the same chain. Thus, the VH and VL domains of a fragment to be coupled with the complementary VL and VH domains of another fragment are thus formed thereby forming two antigen binding sites. Another strategy for producing bispecific antibody fragments by the use of single-stranded Fv dimers (sFv) has also been described. See Gruber et al., J. Immunol., 152: 5368 (1994).

Antibodies with more than two valences are contemplated. For example, trispecific antibodies may be prepared. Tutt et al. J. Immunol. 147: 60 (1991).

Heteroconjugated antibodies

Bispecific antibodies include cross-linked or "heteroconjugated" antibodies, which are antibodies of the invention. For example, one of the antibodies in the heteroconjugate can be coupled to avidin and the other to biotin. Such antibodies have been proposed, for example, to target cells of the immune system to unwanted cells (U.S. Patent No. 4676980) and for the treatment of HIV infection (WO 91/00360, WO 92/200373 and EP 03089). Heteroconjugate antibodies can be produced using any convenient crosslinking methods. Suitable crosslinking agents are well known in the art and are disclosed in U.S. Patent 4,677,680 together with various crosslinking techniques.

Multivalent antibodies

Antibodies of the invention include a multivalent antibody. A multivalent antibody can be internalized (and / or catabolized) faster than a bivalent antibody by a cell expressing an antigen to which the antibodies bind. Antibodies of the invention may be multivalent antibodies (which are of a different class of IgM) with three or more antigen binding sites (eg tetravalent antibodies), which can be readily produced by recombinant expression of nucleic acid encoding the polypeptide chains of the antibody. The multivalent antibody may comprise a dimerization domain and three or more antigen binding sites. The preferred dimerization domain comprises (or consists of) an Fc region or a hinge region. In this scenario, the antibody will comprise an Fc region and three or more antigen binding domains in the amino-terminal position relative to the Fc region. The multivalent antibody preferred herein comprises (or consists of) three to about eight, but preferably four, antigen binding sites. The multivalent antibody comprises at least one polypeptide chain (and preferably two polypeptide chains), wherein the polypeptide chain (s) comprise two or more variable domains. For example, the polypeptide chain (s) may comprise VD1- (XI) n -VD2- (X2) n-Fc, wherein VD1 is a first variable domain, VD2 is a second variable domain, Fc is a polypeptide chain of an Fc region, XI and X2 represent an amino acid or polypeptide and n is 0 or 1. For example, the polypeptide chain (s) may comprise: VH-CH 1 -b flexible linker- CH1-chain of the Fc region; or VH-CH2-CH2-CH2-chain of the Fc region. Herein, the multivalent antibody further preferably comprises at least two (and preferably four) light chain variable domain polypeptides. Herein, the multivalent antibody may comprise, for example, from about two to about eight light chain variable domain polypeptides. The light chain variable domain polypeptides encompassed herein comprise a light chain variable domain and optionally additionally comprise a CL domain.

Handling of effector function

It may be desired to modify the antibody of the invention relative to effector function in order to improve the effectiveness of the antibody in the treatment of cancer, for example. For example, one or more cysteine residues may be introduced into the Fc region thus allowing the formation of interchain disulfide bonds in this region. The thus generated homodimeric antibody may have enhanced complement-mediated and / or complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC) capabilities. See Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, B. J. Immunol. 148: 2918-2922 (1992). Homodimeric antibodies with improved antitumor activity may also be prepared using heterobifunctional cross-linking agents as described in Wolff et al. Cancer Research 53: 2560-2565 (1993). Alternatively, an antibody having double Fc regions and thus may have increased complement lysis and ADCC capabilities can be manipulated. See Stevenson et al. Anti-Cancer Drug Design 3: 219-230 (1989). To increase the serum half-life of the antibody, a receptor-binding recovery epitope may be incorporated into the antibody (especially an antibody fragment) as described in U.S. patent 5,739,277, for example. As used herein, the term " receptor binding recovery epitope " refers to an Fc region epitope of an IgG molecule (e.g., IgG1, IgG2, IgG3, or IgG4) which is responsible for increasing the in vivo serum half-life of the IgG molecule.

Immunoconjugates The invention also relates to immunoconjugates comprising the antibody described herein conjugated with a cytotoxic agent such as a chemotherapeutic agent, a toxin (eg, an enzymatically active toxin of bacterial, fungal, plant or animal origin or fragments thereof) or a radioactive isotope (ie, a radioconjugate). Several radionuclides are available for the production of radioconjugate antibodies. Examples include, but are not limited to, e.g., 212 Bi, 131 I, 131In, 90Y and 196Re.

Chemotherapeutic agents useful in generating such immunoconjugates have been previously disclosed. For example, BCNU, streptozocin, vincristine, 5-fluorouracil, the family of agents collectively known as LL-E33288 complex described in U.S. patents 5053394, 5770710, esperamycins (U.S. patent 5,877,296), etc. may be conjugated. (see also definition of chemotherapeutic agents herein) to anti-ANGPTL4, anti-alpha Vbeta5 or antiangiogenic antibodies or fragments thereof.

For selective destruction of the tumor, the antibody may comprise a highly radioactive atom. Several radioactive isotopes are available for the production of anti-ANGPTL4 or antiangiogenic radioconjugate antibodies or fragments thereof. Examples include, but are not limited to, e.g., 211At, 131I, 125I, 90Y, 186Re, 188Re, 153Sm, 212Bi, 32P, 212Pb, ιηΙη, Lu radioactive isotopes, etc. When the diagnostic conjugate is used it may comprise a radioactive atom for scintigraphy studies, for example 99mTc or 123I or a nuclear magnetic resonance imaging (NMR) spin marker (also known as MRI), such as such as iodine-123, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron. 71 ΕΡ 1 771 474 / ΡΤ

Radioactive or other tags may be incorporated into the conjugate by known methods. For example, the peptide may be biosynthesized or may be synthesized by chemical synthesis of amino acids using suitable amino acid precursors involving, for example, fluorine-19 instead of hydrogen. Markers such as 99m Tc or I, Re, Re, and In may be linked through a cisterna residue of the peptide. Yttrium-90 can be bound through a lysine residue. The IODOGEN method (Fraker et al. (1978) Biochem. Biophys. Res. Commun. 80: 49-57) may be used to incorporate iodine-123, see, eg, Monoclonal Antibodies in Immunoscintigraphy (Chatal, CRC Press 1989). describes other methods in detail.

The enzymatically active toxins and fragments thereof which may be used include diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modecin A chain , alpha-sarcin, Aleurites fordii proteins, diatin proteins, Phytolacca americana proteins (PAPI, PAPII and PAP-S), momordica charantia inhibitor, curcina, crotina, sapaonaria officinalis inhibitor, gelonin, mitogelin, restrictocine, fenomycin, neomycin and trichothecenes. See, e.g., WO 93/21232 published October 28, 1993.

Conjugates of an antibody and cytotoxic agent are prepared using a variety of bifunctional coupling agents of proteins such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), succinimidyl-4- (N-maleimidomethyl) hexane-1-carboxylate, iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyladipimidate HCl), active esters (such as disuccinimidylsuberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p- azidobenzoyl) bis-diazonium derivatives (such as bis- (p-diazoniumbenzoyl) ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate) and bis-active fluorine compounds (such as 1,5-difluoro- 2,4-dinitrobenzene). For example, a ricin immunotoxin can be prepared as described in Vitetta et al. Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylene-7β-aminoaminopenta-acetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotides to the antibody. Refer to WO 94/11026. The linker may be a " cleavable linker " which facilitates the release of the cytotoxic drug into the cell. For example, an acid labile linker, a peptidase-sensitive linker, a photolabile linker, a dimethyl linker, or a disulfide-containing linker (Chari et al., Cancer Research 52: 127-131 (1992)) may be used. US 5208020).

Alternatively, a fusion protein comprising the anti-ANGPTL4 antibody, anti-avPs or anti-angiogenesis and the cytotoxic agent may be produced, e.g., by recombinant or peptide synthesis techniques. The DNA length may comprise respective regions that encode the two conjugate parts adjacent to each other or separated by a region encoding a linker peptide that does not destroy the desired properties of the conjugate.

In certain embodiments the antibody is conjugated to a " receptor " (such as streptavidin) for use in targeting the tumor target in which the conjugate

antibody-receptor is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearance agent followed by administration of a " binding " (e.g. avidin) which is conjugated to a cytotoxic agent (e.g. a radionucleotide). In certain embodiments an immunoconjugate is formed between an antibody and a compound having nucleolytic activity (e.g., a ribonuclease or an endonuclease DNA such as a deoxyribonuclease; DNase).

Maitansine and Maytansinoids The invention provides an antibody of the invention, which is conjugated to one or more maytansinoid molecules. Maytansinoids are mitotic inhibitors that act by inhibiting tubulin polymerization. Maytansine was initially isolated from Maytenus serrata, an East African shrub (U.S. patent 3896111). Subsequently; it has been found that certain microbes also produced maytansinoids such as maytansinol and maytansinol C-3 esters (U.S. Patent 4,155,1042). Synthetic maytansinol and its derivatives and analogs are disclosed in, for example, U.S. Patent Nos. 4,771,230; 4,248,870; 4256746; 4,260,608; 4,265,814; 4,294,757; 4307016; 4,308,268; 4,308,269; 4309428; 4,313,946; 4,315,929; 4,317,821; 4,322,348; 4,333,598; 4361650; 4364866; 4,424,219; 4,450,254; 4,366,263; and 4371533.

Anti-ANGPTL4 antibody, anti-oestrus or anti-angiogenesis is conjugated to a maytansinoid molecule without significantly diminishing the biological activity of either the antibody or the maytansinoid molecule. On average, 3-4 conjugated maytansinoid molecules per antibody molecule showed efficacy in increasing cytotoxicity of target cells without adversely affecting antibody function or solubility, although it is expected that only one toxin / antibody molecule will increase cytotoxicity relative to the use of naked antibody. Maytansinoids are well known in the art and can be synthesized by techniques known or isolated from natural sources. Suitable maytansinoids are disclosed in, for example, U.S. Patent 5,208,020 and other patents and non-patents published hereinbefore. In one embodiment, maytansinoids are maytansinol and maytansinol analogs modified on the aromatic ring or other positions of the maytansinol molecule, such as various maytansinol esters.

Many linking groups are known in the art to produce antibody-maytansinol conjugates including, for example, those disclosed in U.S. Patent 5,208,020 or in EP 0425235 BI and Chari et al., Cancer Research 52: 127-131 (1992). Binding groups include disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups or esterase labile groups as disclosed in the above-identified patents, with the preferred disulfide and thioether groups being preferred.

Antibody and maytansinoid conjugates can be produced using various bifunctional protein coupling agents such as N-succinimidyl-3- (2-pyridyldithio) propionate (SPDP), succinimidyl-4- (N-maleimidomethyl) cyclohexane-1- carboxylate, iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyladipimidate HCl), active esters (such as disuccinimidylsuberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p bis-diazonium derivatives (such as bis- (p-diazoniumbenzoyl) ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate) and bis-active fluorine compounds (such as 1,5- difluoro-2,4-dinitrobenzene). Typical coupling agents include N-succinimidyl-3- (2-pyridyldithio) propionate (SPDP) (Carlsson et al., Biochem J. 173: 723-737 [1978]) and N-succinimidyl-4- (2- pyridylthio) pentanoate (SPP) to provide a disulfide bond. The linker may bind to the maytansinoid molecule in various positions depending on the type of binding. For example, an ester linkage may be formed by reaction of a hydroxyl group using standard coupling techniques. The reaction may occur at the C-3 position having a hydroxyl group at the C-14 position modified with hydroxymethyl, at the C-15 position modified with a hydroxyl group and at the C-20 position with a hydroxyl group. The bond forms at the C-3 position of the maytansinol or a maytansinol analogue.

Calicheamicin

Another immunoconjugate of interest comprises an antibody of the invention conjugated to one or more calicheamicin molecules. The calicheamicin antibiotic family is capable of producing double stranded DNA breaks at sub-picomolar concentrations. For the preparation of conjugates of the calicheamicin family, see U.S. Patents 5712374, 5714586, 5739116, 5767285, 5770701, 5770710, 5773001, 5877296 (all of American Cyanamid Company). Structural analogs of calicheamicin that may be used include, without being limited to, γ /, α 1, α 3 Σ, N-acetyl-γι 1, PSAG and θΣχ (Hinman et al., Cancer Research 53: 3336-3342 (1993), Lode et al., Cancer Research 58: 2925-2928 (1998) and the previously mentioned US patents of American Cyanamid). Another antitumor drug with which the antibody can be conjugated is QFA which is an antifolate. Both calicheamicin and FFA have intracellular sites of action and do not readily cross the plasma membrane. Thus, the cellular uptake of these agents through antibody-mediated endocytosis greatly enhances their cytotoxic effects. 75 Ε 1 1 771 474 / ΡΤ

Other antibody modifications

Other modifications of the antibody are encompassed herein. For example, the antibody may be linked to one of several non-proteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, polyoxyalkylenes or copolymers of polyethylene glycol and polypropylene glycol. The antibody may also be entrapped in microcapsules prepared, for example, by coacervation or interfacial polymerization techniques (for example, hydroxymethylcellulose microcapsules or gelatin microcapsules and poly (methyl methacrylate) microcapsules, respectively) in colloidal drug delivery systems ( for example, liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences, 16th edition, Oslo, A., ed., (1980).

Liposomes and nanoparticles

The polypeptides of the invention may be formulated into liposomes. For example, the antibodies of the invention may be formulated as immunoliposomes. Liposomes containing the antibody are prepared by methods known in the art, as described in Epstein et al., Proc. Natl. Acad. Know. USA, 82: 3688 (1985); Hwang et al., Proc. Natl Acad Sci. USA, 77: 4030 (1980); and U.S. patents 4485045 and 4544545. Increased circulation time liposomes are disclosed in U.S. Patent 5,013,556. Liposome formulation and use are generally known to those skilled in the art:

Particularly useful liposomes can be generated by the reverse-phase evaporation method with a lipid composition comprising PEG-derivatized phosphatidyleol, cholesterol and PEG-PEG (PEG-PE). The liposomes are extruded through filters having defined porosity to provide liposomes of the desired diameter. Fab 'fragments of the antibody of the invention can be conjugated to the liposomes as described in Martin et al. J. Biol. Chem. 257: 286-288 (1982) through a disulfide exchange reaction. A chemotherapeutic agent (such as doxorubicin) is optionally included in the liposome. 76 ΕΡ 1 771 474 / ΡΤ

See Gabizon et al. J. National Cancer Inst. 81 (19) 1484 (1989).

Other Uses

Antibodies of the invention have various uses. For example, anti-ANGPTL4 antibodies may be used in diagnostic assays for ANGPTL4, e.g., detecting their expression in cells, specific tissues or in serum for the detection of cancer (e.g., in the detection of renal cancer), etc. In one embodiment, ANGPTL4 antibodies are used to select the patient population for treatment with the methods provided herein, e.g., for patients with ANGPTL4 expression, elevated ANGPTL4 levels or cancers sensitive to ANGPTL4 levels. Various diagnostic assay techniques known in the art, such as competitive binding assays, direct or indirect sandwich assays, and heterogeneous or homogeneous phase immunoprecipitation assays can be used (Zola, Monoclonal Antibodies: A Manual of Techniques, CRC Press , Inc. (1987) pp. 147-158). Antibodies used in diagnostic assays may be labeled with a detectable moiety. The detectable part must be able to produce, directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as 3H, 14C, 32P; 35S or 125I, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine or luciferin or an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase. Any method known in the art may be used to conjugate the antibody to a detectable part including the methods described by Hunter et al., Nature, 144: 945 (1962); David et al., Biochemistry, 13: 1014 (1984); Pain et al., J. Immunol. Meth., 40: 219 (1981); and Nygren, J. Histochem. and Cytochem., 30: 407 (1982).

Anti-ANGPTL4 antibodies are also useful for the affinity purification of ANGPTL4 or of ANGPTL4 fragments from recombinant cell cultures or from natural sources. In this process, the antibodies against ANGPTL4 are immobilized on a suitable carrier, such as a Sephadex resin or filter paper, using methods well known in the art. The immobilized antibody is then contacted with a sample containing the ANGPTL4 to be purified and 77Å / 1 771 474 / ΡΤ then the carrier is washed with a suitable solvent which will remove substantially all material from the sample except for ANGPTL4, which is ligated to the immobilized antibody. Finally, the carrier is washed with another suitable solvent which will release the ANGPTL4 from the antibody:

Covalent modifications of polypeptides of the invention

Included within the scope of this invention are covalent modifications of a polypeptide of the invention, e.g., a polypeptide antagonist fragment, a fusion molecule (e.g., an immunofusion molecule), an antibody of the invention. It may be produced by chemical synthesis or by chemical or enzymatic cleavage of the polypeptide, if applicable. Other types of covalent modifications of the polypeptide are introduced into the molecule by reacting target amino acid residues of the polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or with N-terminal or C-terminal residues or by incorporation of a modified amino acid or unnatural amino acid in the nascent polypeptide chain, eg, Ellman et al. Meth. Enzym. 202: 301-336 (1991); Noren et al. Science 244: 182 (1989); and patent application publications US20030108885 and 20030082575.

More usually cysteinyl residues are reacted with a haloacetate (and corresponding amines) such as chloroacetic acid or chloroacetamide to provide carboxymethyl or carboxamidomethyl derivatives. The cysteinyl residues are also derivatized by reaction with bromotrifluoroacetone, α-bromo-β- (5-imidozoyl) propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyldisulfide, methyl 2-pyridyldisulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenol or chloro-7-nitrobenzo-2-oxa-1,3-diazole.

Histidyl residues are derivatised by reaction with diethylpyrocarbonate at pH 5.5-7.0 because this agent is relatively specific for the histidyl side chain. Para-bromophenacyl bromide is also useful; the reaction is typically carried out in 0.1 M sodium cacodylate at pH 6.0. 78 ΕΡ 1 771 474 / ΡΤ

The lysinyl and amino terminal residues are reacted with succinic acid and other carboxylic acid anhydrides. Derivatization with these agents has the effect of reversing the charge of the lysinyl residues. Other suitable reagents for derivatization of α-amino containing residues include imidoesters such as methylpicolinimidate, pyridoxal phosphate, pyridoxal, chloroborohydride, trinitrobenzenesulfonic acid, O-methylisourea, 2,4-pentanedione and reaction with transaminase catalyzed glyoxylate.

The arginyl residues are modified by reaction with one or more conventional reagents, including phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione and ninhydrin. Derivatization of arginine residues requires the reaction to be performed under alkaline conditions because of the elevated pKa of the guanidine functional group. In addition, these reactants may react with the lysine groups as well as the epsilon-amino group of arginine.

Specific modification of tyrosyl residues can be carried out, with particular interest in introducing spectral labels into tyrosyl residues by reaction with aromatic compounds of diazonium or tetranitromethane. More commonly, N-acetylimidizole and tetranitromethane are used to form O-acetyltyrosyl species and 3-nitro derivatives, respectively. The tyrosyl residues are iodinated using 125 I or 131 I to prepare labeled proteins for use in radioimmunoassay.

Carboxyl (aspartyl or glutamyl) side groups are selectively modified by reaction with carbodiimides (RN = C = NR '), wherein R and R' are different alkyl groups, such as 1-cyclohexyl-3- (2-morpholinyl) -4-ethyl) carbodiimide or 1-ethyl-3- (4-azonia-4,4-dimethylpentyl) carbodiimide. In addition, aspartyl and glutamyl residues are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.

The glutaminyl and asparaginyl residues are often deamidated to the corresponding glutamyl and asparagyl residues, respectively. These residues are deamidated under neutral or basic conditions. The deamidated form of such residues is within the scope of this invention. 79 ΕΡ 1 771 474 / ΡΤ

Other modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of α-amino groups of lysine side chains, arginine and histidine (TE Creighton, Proteins: Structure and Molecular Properties, WH Freeman & Co , San Francisco, pp. 79-86 (1983)), acetylation of the N-terminal amine and amidation of any C-terminal carboxyl group.

Another type of covalent modification involves chemical or enzymatic coupling of glycosides to a polypeptide of the invention. These procedures are advantageous in that they do not require production of the polypeptide in a host cell having glycosylation capabilities for N-linked or O-linked glycosylation. Depending on the coupling mode used, the sugar (c) free sulfhydryl groups such as cysteine, (d) free hydroxyl groups such as those of serine, threonine or hydroxyproline, (e) residues (a) arginine and histidine, (b) free carboxyl groups, aromatics such as those of phenylalanine, tyrosine or tryptophan, or (f) the glutamine amide group. These methods are described in WO 87/05330 published 11 September 1987 and in Aplin and Wriston, CRC Crit. Rev. Biochem., P. 259-306 (1981).

Chemically or enzymatically the removal of any carbohydrate moieties present in a polypeptide of the invention can be obtained. Chemical deglycosylation requires exposure of the polypeptide to the trifluoromethanesulfonic acid compound or to an equivalent compound. This treatment results in the cleavage of most or all of the sugars except the binding sugar (N-acetylglucosamine or N-acetylgalactosamine) leaving the polypeptide intact. Chemical deglycosylation is described in Hakimuddin, et al. Arch Biochem. Biophys. 259: 52 (1987) and in Edge et al. Anal. Biochem., 118: 131 (1981). Enzymatic cleavage of carbohydrate moieties, e.g., in antibodies may be achieved by the use of a variety of endoglycosidases and exoglycosidases as described by Thotakura et al. Meth. Enzymol. 138: 350 (1987). 80 ΕΡ 1 771 474 / ΡΤ

Another type of covalent modification of a polypeptide of the invention comprises attaching the polypeptide to one of several non-proteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol or polyoxyalkylenes in the manner set forth in U.S. Patent Nos. 4,640,835; 4,469,689; 4,301,444; 4,670,417; 4791192 or 4179337.

Vectors, Host Cells and Recombinant Methods

The polypeptides of the invention may be recombinantly produced using readily available techniques and materials.

For recombinant production of a polypeptide of the invention, eg, an ANGPTL4 or an anti-ANGPTL4 antibody, an anti-OG-Ps antibody or anti-angiogenesis antibody, eg, anti-VEGF antibody, the nucleic acid encoding it is isolated inserts into a replicable vector for further cloning (DNA amplification) or for expression. DNA encoding the polypeptide of the invention is readily isolated and sequenced using standard procedures. For example, a DNA encoding a monoclonal antibody is isolated and sequenced, e.g., using oligonucleotide probes that are capable of specifically binding to genes encoding the heavy and light chains of the antibody. Many vectors are available. The components of the vector generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter and a transcription termination sequence.

Signal sequence component

Polypeptides of the invention may be produced recombinantly not only directly but also as a fusion polypeptide with a heterologous polypeptide, which is typically a signal sequence or other polypeptide with an N-terminal specific cleavage site of the mature protein or polypeptide . The heterologous signal sequence typically selected is one that is recognized and processed (i.e., cleaved by a signaling peptidase) by the host cell. For prokaryotic host cells that do not recognize and process the native polypeptide signal sequence, the signal sequence is replaced by a prokaryotic signal sequence selected from, for example, a group of alkaline phosphatase, penicillinase, Ipp or heat stable enterotoxin II. For yeast secretion, the native signal sequence can be replaced by, e.g., the yeast invertase leader, a factor leader (including Saccharomyces α factor controls and

Kluyveromyces) or acid phosphatase leader, the C. albicans glucoamylase leader or the signal described in WO 90/13646. In mammalian cell expression signal sequences are available as well as viral secretion controls, for example the herpes simplex gD signal. The DNA for that precursor region is ligated in reading frame to the DNA encoding the polypeptide of the invention.

Replication source component

Both the expression and cloning vectors contain a nucleic acid sequence that allows the vector to replicate in one or more selected host cells. Generally, in cloning vectors this sequence is one which allows the vector to replicate independently of the host chromosomal DNA and includes origins of replication or autonomous replication sequences. Such sequences are well known for various bacteria, yeast and viruses. The origin of replication of a plasmid pBR322 is suitable for most Gram-negative bacteria, the origin of the 2μ plasmid is suitable for yeast and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells. Generally, the source of replication component is not required for mammalian expression vectors (the SV40 origin can typically be used only because it contains the early promoter).

Selection Gene Component

The expression and cloning vectors may contain a selection gene also called a selection marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, eg, ampicillin, neomycin, methotrexate or tetracycline, (b) complement auxotrophic deficiencies, or (c) provide critical nutrients not available from complex media, eg, the gene encoding D-alanine-racemase for bacilli.

An example of a selection scheme utilizes a drug to stop the growth of a host cell. Cells that are successfully transformed with a heterologous gene produce a protein that confers resistance to a drug and thus survive the selection regimen. Examples of this dominant selection are the drugs neomycin, mycophenolic acid and hygromycin.

Another example of suitable selectable markers for mammalian cells are those that allow the identification of cells competent to absorb antibody nucleic acid such as DHFR, thymidine kinase, metallothionein I and II, typically primate metallothionein genes, adenosine deaminase, ornithine decarboxylase, etc.

For example, cells transformed with the DHFR selectable gene are first identified by culturing all transformation products in a culture medium containing methotrexate (Mtx), a competitive antagonist of DHFR. An appropriate host cell when using wild-type DHFR is the Chinese hamster ovary (CHO) cell line deficient in DHFR activity.

Alternatively, host cells (particularly endogenous DHFR-containing hosts) transformed or co-transformed with DNA sequences encoding a polypeptide of the invention, wild-type DHFR protein and other selectable marker such as aminoglycoside-3 ' (APH) by cell growth in medium containing a selection agent for the selectable marker such as an aminoglycoside antibiotic, eg, kanamycin, neomycin or G418. See U.S. Patent 4,965,199.

A suitable selection gene for use in yeast is the trp1 gene present in the Yrp7 yeast plasmid (Stinchcomb et al., Nature, 282: 39 (1979)). The trp1 gene provides a selection marker for a yeast mutant strain lacking ability to grow in tryptophan, for example, ATCC 44076 83 ΕΡ 1 771 474 / ΡΤ or ΡΕΡ 4-1. Jones, Genetics, 85:12 (1977). The presence of the trp I lesion in the yeast host cell genome then provides an environment effective to detect transformation by growth in the absence of tryptophan. Likewise, yeast strains deficient in Leu2 (ATCC 20622 or 38626) are complemented by known plasmids displaying the Leu2 gene.

In addition, vectors derived from the circular plasmid of 1.6 Âμm pKD1 may be used for transformation of Kluyveromyces yeasts. Alternatively, an expression system for large-scale production of recombinant calf chymosin was reported for K. lactis Van den Berg, Biol / Technology, 8: 135 (1990). Stable multi-copy expression vectors for mature recombinant human serum albumin secretion have also been shown by industrial Kluyveromyces strains. Fleer et al., Bio / Technology, 9: 968-975 (1991).

Promoter component

Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to a nucleic acid encoding a polypeptide of the invention. Promoters suitable for use with prokaryotic hosts include the phoA promoter, β-lactamase and lactose promoter systems, alkaline phosphatase, a tryptophan (trp) promoter system, and hybrid promoters such as the tac promoter. Other known bacterial promoters are however suitable. Promoters for use in bacterial systems will also contain a Shine-Dalgarno (S.D.) sequence operably linked to DNA encoding the polypeptide of the invention. Eukaryotic promoter sequences are known. Virtually all eukaryotic genes have an AT-rich region located approximately 25 to 30 bases upstream from where transcription begins. Another sequence present at 70 to 80 bases upstream from the start of transcription of many genes is a CNCAAT region in which N may be any nucleotide. At the 3 'end of most eukaryotic genes is found an AATAAA sequence which may be the signal for addition of the poly A tail to the 3' end of the 84E-1 771 474 / ΡΤ coding sequence. All these sequences are suitably inserted into eukaryotic expression vectors.

Examples of suitable promoter sequences for use with yeast hosts include promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6- phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase and glucokinase.

Other inducible controlled promoter phosphatase metabolism yeast promoters, which are promoters having the additional advantage of transcription by growth conditions, are the regions for alcohol dehydrogenase 2, isocytochrome C, acid, degradation enzymes associated with nitrogen, metallothionein, glyceraldehyde-3 phosphate dehydrogenase and enzymes responsible for the use of maltose and galactose. Vectors and promoters suitable for use in yeast expression are further described in EP 73657. Yeast enhancers with yeast promoters are also advantageously used. Transcription of polypeptides of the invention from vectors into mammalian host cells is controlled, for example, by promoters obtained from virus genomes such as polyoma virus, avian pox virus, adenovirus (such as adenovirus 2), virus bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis B virus and typically simian virus 40 (SV40), from heterologous mammalian promoters, eg, the actin promoter or an immunoglobulin promoter, from heat shock promoters , provided that such promoters are compatible with the cellular systems of the host.

Early and late SV40 virus promoters are conveniently obtained in the form of an SV40 restriction fragment which also contains the SV40 viral origin of replication. The human cytomegalovirus immediate early promoter is conveniently obtained as a HindIII E restriction fragment. A system for expressing DNA in 85

Mammalian hosts using the bovine papilloma virus as a vector in U.S. Patent 4,419,446. A modification of this system is described in U.S. Patent 4601978. See also Reyes et al., Nature 297: 598-601 (1982). ) on expression of human β-interferon cDNA in mouse cells under the control of a herpes simplex virus thymidine kinase promoter. Alternatively, the long terminal repeat of the Rous sarcoma virus can be used as a promoter.

Enhancer Element Component Transcription of a DNA encoding a polypeptide of this invention by higher eukaryotes is often enhanced by insertion of an enhancer sequence into the vector. Many mammalian gene enhancer sequences (globin, elastase, albumin, α-fetoprotein and insulin) are now known. Typically, a eukaryotic cell virus enhancer will be used. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the origin of replication, and adenovirus enhancers. See also Yaniv, Nature 297: 17-18 (1982) on enhancers for activating eukaryotic promoters. The enhancer may be spliced into the vector at the 5 'or 3' position of the polypeptide encoding sequence but typically located at the 5 'site of the promoter.

Transcription termination component

Expression vectors used in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans or nucleated cells of other multicellular organisms) will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5 'and, occasionally 3' untranslated regions of eukaryotic or viral DNA or cDNA. Such regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding the polypeptide of the invention. A useful transcription termination component is the 86 ÅΡ 1 771 474 / ΡΤ polyadenylation region of bovine growth hormone. See WO 94/11026 and the expression vector disclosed therein.

Selection and transformation of host cells

Herein are suitable host cells for cloning or expression of DNA encoding the polypeptides of the invention into the vectors, the above described prokaryotic, yeast or eukaryotic cells. Suitable prokaryotes for this purpose include eubacteria such as Gram-negative or Gram-positive organisms, for example Enterobacteriaceae such as Escherichia, eg, E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, eg, Salmonella typhimurium, Serratia, eg, Serratia marcesans and Shigella, as well as bacilli such as B. subtilis and B. licheni forrais (eg, B. licheniformis 41P disclosed in DD 266710 published 12 April 1989), Pseudomonas such as P. aeruginosa and Streptomyces. Typically, the E. coli cloning host is E. coli 294 (ATCC 31446) although other strains such as E. coli B, E. coli X1776 (ATCC 31537) and E. coli W3110 (ATCC 27325) are suitable. These examples are illustrative and not limiting.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for vectors encoding the polypeptide of the invention. Saccharomyces cerevisiae or common baker's yeast is the most commonly used of the lower eukaryotic host microorganisms. However, various other genera, species and strains are commonly available and are useful herein, such as Schizosaccharomyces pombe; Kluyveromyces hosts such as, eg, K. lactis, K. fragilis (ATCC 12424), K. bulgaricus (ATCC 16045), K. wickeramii (ATCC 24178), K. waltii (ATCC 56500), K. drosophilarum (ATCC 36906 ), K. thermotolerans and K. marxianus; Yarrowia (EP 402226); Pichia pastoris (EP 183070); Candida; Trichoderma reesia (EP 244234); Neurospora crassa; Schwanniomyces such as Schwanniomyces occidentalis; and filamentous fungi such as, e.g., Neurospora, Penicillin, Tolypocladium and Aspergillus hosts such as A. nidulans and A. niger. 87 ΕΡ 1 771 474 / ΡΤ

Host cells suitable for expression of the glycosylated polypeptides of the invention are derived from multicellular organisms. Examples of invertebrate cells include plant and insect cells. Several strains and variants of baculoviruses corresponding to host permissive insect host cells such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (vine fly) and Bombyx mori were identified. Various viral strains for transfection are available to the public, e.g., the L-1 variant of

Autographa californica NPV and the Bombyx mori NPV strain Bm-5 and such viruses as the viruses here according to the invention may be used in particular for transfection of Spodoptera frugiperda cells. Vegetable cell cultures of cotton, maize, potato, soybean, petunia, tomato and tobacco may also be used as hosts.

However, interest has been greater in vertebrate cells and the propagation of vertebrate cells in culture (tissue culture) has become a routine procedure. Examples of useful mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen ViroL 36:59 (1977); baby hamster kidney cells (BHK, ATCC CCL 10); (HM, Urlaub et al., Proc Natl Acad Sci USA 77: 4216 (1980)), mouse Sertoli cells (TM4, Mather,

Biol. Reprod. 23: 243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); mouse-buffalo liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse breast tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad Sci 383: 44-68 (1982)); MRC 5 cells; FS4 cells; and human hepatoma line (Hep G2).

Host cells are transformed with the above-mentioned expression or cloning vectors to produce the polypeptide of the invention and are cultured in nutrient medium

88 ΕΡ 1 771 4 7 4 / PT promoters, desired amplification. modified as suitable for induction of selection of transformation products or genes encoding the sequences

Culture of host cells

Host cells used to produce polypeptides of the invention may be cultured in various media. Commercially available media such as Ham's FIO (Sigma), Minimum Essential Medium ((MEM), (Sigma), RPMI-1640 (Sigma) and Dulbecco's Modified Eagle's Medium (DMEM) are suitable for culturing the host cells. Sigma) In addition, any of the media described in Ham et al., Meth., 58:44 (1979), Barnes et al., Anal Biochem, 102: 255 (1980), U.S. Patent 4,767,704; 4,685,766; U.S. Patent 5,246,565; U.S. 5122469; WO 90/03430; WO 87/00195; or U.S. Patent Re. 30985. Any such media may be supplemented as necessary with hormones and / or other growth factors (such as insulin, transferrin or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics as GENTAMYCIN ™ drug), trace elements (defined as inorganic compounds usually and present at final concentrations in the micromolar range) and glucose or an equivalent energy source. Any other supplements necessary at appropriate concentrations that would be known to those skilled in the art may also be included. Culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression and will be apparent to the person skilled in the art.

Purification of polypeptides

When recombinant techniques are used, a polypeptide of the invention may be produced, eg, ANGPTL4, antibodies of the invention, eg, anti-ANGPTL4 antibody, anti-mouse antibody or anti-angiogenesis molecule antibody, intracellularly in the periplasmic space or directly excreted to the middle. Polypeptides of the invention may be recovered from the culture medium or host cell lysates. If they are 89

(Eg Triton-X 100) or by enzymatic cleavage can be liberated from the membranes using an appropriate detergent solution (e.g., Triton-X 100). Cells used in the expression of a polypeptide of the invention may be broken down by various physical or chemical means such as freeze-thaw cycles, ultrasound, mechanical disruption or cell lysing agents.

It may be desired to purify a polypeptide of the invention from recombinant cell proteins or polypeptides. The following procedures are examples of suitable purification procedures: fractionation on an ion exchange column; precipitation with ethanol; Reverse phase HPLC; silica chromatography, SEPHAROSE ™ heparin chromatography, chromatography on anionic or cation exchange resin (such as a poly (aspartic acid) column, DEAE, etc.); chromatofocation; SDS-PAGE; precipitation with ammonium sulfate; gel filtration using, for example, Sephadex G-75; A-Sepharose protein columns to remove contaminants such as IgG; and metal chelation columns to link epitope tagged polypeptide forms of the invention. Various methods of purifying proteins may be used and such methods are known in the art and described for example in Deutscher, Methods in Enzymology, 182 (1990);

Scopes, Protein Purification: Principles and Practice,

Springer-Verlag, New York (1982). The purification step (s) selected will depend, for example, on the nature of the production process used and the polypeptide of the specific invention produced.

For example, an antibody composition prepared from the cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis and affinity chromatography, with affinity chromatography being the typical purification technique. The suitability of protein A as an affinity ligand depends on the species and isotype of any immunoglobulin Fc domain that is present on the antibody. Protein A can be used to purify antibodies that are based on the human γΐ, γ2 or γ4 heavy chains (Lindmark et al., J. Immunol. Meth. 62: 1-13 (1983)). G protein is recommended for all mouse and human γ isotypes (Guss et al., EMBO J. 90

ΕΡ 1 771 4 7 4 / PT 5: 1507-1575 (1986)). The matrix to which the affinity ligand binds is most often agarose but other matrices are available. Mechanically stable matrices such as controlled porosity glass or poly (styrenodivinyl) benzene allow for faster flow rates and shorter processing times over those obtained with agarose. When the antibody comprises a CH3 domain, Bakerbond ABX ™ resin (J.T. Baker, Phillipsburg, NJ) is useful for purification. Other techniques for purifying protein, e.g., those indicated above, depending on the antibody to be recovered, are also available. See also, Carter et al., Bio / Technology 10: 163-167 (1992) which describes a procedure for isolating antibodies that are excreted into the periplasmic space of E. coli.

Pharmaceutical Compositions

Therapeutic formulations of polypeptides of the invention, molecules of the invention and combinations thereof, and uses herein are described herein by mixing one or more polypeptides of the desired purity with pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. [1980]), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations used and include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzylammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkylparabens such as methylparaben or propylparaben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol ); low molecular weight polypeptides (less than about 10 residues); proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; against salt forming ions such as sodium; 91

Metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants such as TWEEN ™, PLURONICS ™ or polyethylene glycol (PEG).

The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation or interfacial polymerization techniques, for example hydroxymethylcellulose or gelatin microcapsules and poly (methyl methacrylate) microcapsules, respectively, in colloidal drug delivery systems ( for example, liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Science 16th edition, Osol, A. Ed. (1980).

The formulations to be used for in vivo administration must be sterile. This is readily achieved by filtration through sterile filtration membranes.

Prolonged-release preparations may be prepared. Suitable examples of sustained release preparations include semipermeable matrices of solid hydrophobic polymers containing a polypeptide of the invention, which matrices are in the form of shaped articles, e.g. films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (e.g., poly (2-hydroxyethylmethacrylate) or polyvinyl alcohol), polylactides (U.S. patent 3773919), copolymers of L-glutamic acid and γ-ethyl-L-glutamate, ethylene and vinyl acetate copolymers, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT ™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate) and poly-D - (-) - 3 hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid allow the release of molecules over 100 days, certain hydrogels release proteins for shorter periods of time. When antibodies remain in the body for a long period of time, they may denature or aggregate as a result of exposure to moisture at 37 ° C resulting in loss of biological activity and possible immunogenicity changes. Rational strategies for stabilization can be planned depending on the

ΕΡ 1 771 4 7 4 / EN mechanism involved. For example, if it is found that the aggregation mechanism is the formation of intermolecular SS bonds via thiodisulfide exchange, stabilization may be obtained by modification of sulfhydryl residues, lyophilization from acidic solutions, control of moisture content, use of additives and the development of specific polymer matrix compositions. See also, e.g., U.S. Patent 6,699,501, which discloses capsules with polyelectrolyte coverage.

It is further contemplated that an agent of the invention (ANGPTL4, ANGPTL4 agonist or ANGPTL4 antagonist) may be introduced into a subject by gene therapy. Gene therapy refers to therapy effected by the administration of a nucleic acid to a subject. In gene therapy applications, genes are introduced into cells in order to obtain in vivo synthesis of a therapeutically effective gene product, for example for replacement of a defective gene. &Quot; gene therapy " includes conventional gene therapy in which a lasting effect is obtained with a single treatment and the administration of therapeutic products of gene agents, which involves single or repeated administration of a therapeutically effective DNA or mRNA. Antisense RNA and antisense DNA can be used as therapeutic agents to block the expression of certain genes in vivo. See, e.g. Ad-ANGPTL4-siRNA described herein. It has already been shown that short antisense oligonucleotides can be imported into cells where they act as inhibitors despite their reduced intracellular concentrations caused by their restricted uptake by the cell membrane. (Zamecnik et al.

Proc. Natl. Acad Sci. USA 83: 4143-4146 (1986)). Oligonucleotides can be modified to increase their uptake, e.g. by substituting their negatively charged phosphodiester groups for uncharged groups. For general reviews of gene therapy methods, see, for example, Goldspiel et al. Clinical Pharmacy 12: 488-505 (1993); Wu and Wu Biotherapy 3: 87-95 (1991); Tolstoshev Ann. Rev. Pharmacol.

Toxicol. 32: 573-596 (1993); Mulligan Science 260: 926-932 (1993); Morgan and Anderson Ann Rev. Biochem. 62: 191-217 (1993); and May TIBTECH 11: 155-215 (1993). Methods commonly known in the art of recombinant DNA technology are described and can be used in Ausubel et al. ed. 93 ΕΡ 1 771 474 / ΡΤ (1993) Current Protocols in Molecular Biology, John Wiley & Sons, NY; and Kriegler (1990) Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY. There are several techniques available to introduce nucleic acids into viable cells. The techniques vary depending on the nucleic acid to be transferred to cells cultured in vitro or in vivo into the cells of the intended host. Suitable techniques for transfer of nucleic acid to mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc. Presently preferred in vivo gene transfer techniques include transfection with viral (typically retroviral) vectors and viral envelope-liposome protein-mediated transfection (Dzau et al., Trends in Biotechnology 11, 205-210 (1993)). For example, nucleic acid transfer techniques in vivo include transfection with viral vectors (such as adenovirus, herpes simplex virus I, lentivirus, retrovirus or adeno-associated virus) and lipid-based systems (lipids useful for gene transfer mediated by are DOTMA, DOPE and DC-Chol, for example). Examples of use of viral vectors in gene therapy can be found in Clowes et al. J. Clin. Invest. 93: 644-651 (1994); Kiem et al. Blood 83: 1467-1473 (1994); Salmons and Gunzberg Human Gene Therapy 4: 129-141 (1993); Grossman and Wilson Curr. Opin. in. Genetics and Devei 3: 110-114 (1993); Bout et al. Human-Gene-Therapy 5: 3 = 10 (1994), Rosenfeld, et al. Science 252: 431-434 (1991);

Rosenfeld et al. Cell 68: 143-155 (1992); Mastrangeli et al. J. Clin Invest. 91: 225-234 (1993); and Walsh et al. Proc. Soc Exp Biol. Med. 204: 289-300 (1993).

In some situations it is intended to provide the nucleic acid source with an agent that targets the target cells, such as a cell membrane surface protein specific antibody or target cell, a ligand to a target cell receptor, etc. . When using liposomes, proteins that bind to a cell membrane surface protein associated with endocytosis may be used to target the target and / or to facilitate absorption, eg capsid proteins or their tropic fragments to a target cell. / ΡΤ specific cell type, antibodies to proteins that undergo cyclic endocytosis, proteins that target intracellular localization and improve intracellular half-life. The technique of receptor-mediated endocytosis is described, for example, in Wu et al., J. Biol. Chem. 262, 4429-4432 (1987); and Wagner et al., Proc. Natl. Acad. Know. USA 87, 3410-3414 (1990). For a review of gene labeling and gene therapy protocols, see Anderson et al., Science 256, 808-813 (1992).

Dosage and administration

The molecules of the invention are administered to a human patient according to known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, by the intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra- articular, intra-synovial, intrathecal, oral, topical, inhalation and / or subcutaneous.

In certain embodiments, the treatment of the invention involves the combined administration of an ANGPTL4 antagonist and one or more anticancer agents, e.g., antiangiogenic agents. In one embodiment, additional anticancer agents are present, e.g., one or more different antiangiogenic agents, one or more chemotherapeutic agents, etc. The invention also encompasses administration of multiple inhibitors, e.g., multiple antibodies against the same antigen or multiple antibodies to different molecules active in cancer. In one embodiment, a mixture of different chemotherapeutic agents is administered with the ANGPTL4 antagonist and / or one or more antiangiogenic agents. The combined administration includes co-administration using independent formulations or a single pharmaceutical formulation and / or consecutive administration in any order. For example, an ANGPTL4 antagonist may precede, follow, or alternate with the administration of anticancer agents or be administered concurrently with them. In one embodiment, a time period occurs in which both (or all) active agents simultaneously exert their biological activities. 95 ΕΡ 1 771 474 / ΡΤ

For prevention or treatment of disease, the appropriate ANGPTL4 antagonist dosage will depend upon the type of disease to be treated as defined above, the severity and course of the disease, whether the inhibitor is administered for preventive or therapeutic purposes, prior therapy, history clinic of the patient and the response to the inhibitor and the opinion of the attending physician. The inhibitor is suitably administered to the patient at one time or over a series of treatments. In a combination therapy regimen, the compositions of the invention are administered in a therapeutically effective amount or in a synergistic amount therapeutically. As used herein, a therapeutically effective amount is such that administration of a composition of the invention and / or co-administration of ANGPTL4 antagonist and one or more other therapeutic agents results in the reduction or inhibition of the target disease or condition. The effect of administering a combination of agents may be additive. In one embodiment, the result of administration is a synergistic effect. A therapeutically synergistic amount is the amount of ANGPTL4 antagonist and one or more other therapeutic agents, e.g., an angiogenesis inhibitor, necessary to reduce or eliminate in a synergistic or significant manner conditions or symptoms associated with a specific disease.

Depending on the type and severity of the disease, about 1 pg / kg to 50 mg / kg (eg 0.1-20 mg / kg) of ANGPTL4 antagonist or angiogenesis inhibitor is an initial candidate dosage for administration to the patient, whether , for example, by one or more separate administrations, or by continuous infusion. A typical daily dosage may range from about 1 pg / kg to about 100 mg / kg or more depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, treatment is maintained until the desired occurrence of a suppression of disease symptoms. Other dosage regimens may, however, be useful. Typically, the clinician will administer one or more molecules of the invention until a dosage that provides the desired biological effect is achieved. The progression of the therapy of the invention is easily monitored by conventional techniques and assays. 96

ΕΡ 1 771 4 7 4 / EN

For example, preparation and dosing schedules for angiogenesis inhibitors, e.g., anti-VEGF antibodies such as AVASTIN (Genentech), according to the manufacturer's instructions or determined empirically by the person skilled in the art may be used. In another example, preparation and dosing schedules for such chemotherapeutic agents may be used according to the manufacturer's instructions or as determined empirically by the person skilled in the art. Also described are schedules of preparation and dosing for chemotherapy in Chemotherapy Service Ed., M.C. Perry, Williams & Wilkins, Baltimore, MD (1992).

Efficacy of treatment

The effectiveness of the treatment of the invention can be measured by various endpoints commonly used in the evaluation of neoplastic or non-neoplastic disorders. For example, cancer treatments can be evaluated by, eg, without limitation, tumor regression, tumor weight or size decrease, time elapsed until progression, survival duration, progression-free survival, overall response rate, duration response and quality of life. Because the antiangiogenic agents described herein target the vasculature of the tumor and not necessarily the neoplastic cells themselves, they represent a unique class of anticancer drugs and therefore may require unique measurements and definitions of clinical drug responses. For example, tumor decrease by more than 50% in a two-dimensional analysis is the standard threshold for response recognition. However, the inhibitors of the invention may cause inhibition of metastatic spread without decrease of the primary tumor or may simply exert an effect of preventing tumor propagation. Thus, approaches can be used to determine the efficacy of the therapy, including for example measurement of plasma or urinary angiogenesis markers and measurement of response by radiological imaging.

In one embodiment, the invention may be used to increase the survival time of a human patient susceptible to a neoplastic or non-neoplastic disorder or to which such disease has been diagnosed, e.g., cancer. The duration of survival is defined as the time interval from the first administration of the drug to death. In one aspect, an ANGPTL4 antagonist of the invention is administered to the human patient in combination with one or more anticancer agents thus effectively increasing the duration of patient survival compared to a single type of therapy alone, eg, increases about 5% or increases about 10% or increases about 20% or increases about 30% or increases about 40% or increases about 50% or more as compared to a single type of therapy.

In another embodiment, the invention provides methods for enhancing progression-free survival of a human patient susceptible to a neoplastic or non-neoplastic disorder or to which such disease has been diagnosed, e.g., cancer. The duration to disease progression is defined as the time interval from drug administration to disease progression. In one embodiment, the combination treatment of the invention using ANGPTL4 antagonist and one or more anticancer agents significantly increases survival without progression in at least about 2 months, at least about 4 months, at least about 6 months, at least about of 8 months, one year or more, compared to a single therapy anticancer treatment.

In yet another embodiment, the treatment of the invention significantly increases the response rate in a group of human cancer-susceptible or cancer-diagnosed human patients who are treated with various therapeutic products. Response rate is defined as the percentage of treated patients who have responded to treatment. In one embodiment of the invention, the combination treatment of the invention using ANGPTL4 antagonist and one or more anticancer agents significantly increases the response rate in the treated patient group compared to the group treated with a single type of cancer therapy (eg, only chemotherapy ) said increase having a p-value of Chi-square, eg, less than 0.010 or less than 0.005 or less than 0.001.

In one aspect, the invention provides methods for increasing the duration of response in a human patient or a group of human patients susceptible to or diagnosed with cancer. The duration of the response is defined as the time interval from the initial response to the disease progression to 98 ± 1 771 474 /.. In certain embodiments of the invention, in a combination treatment of the invention using ANGPTL4 antagonist and one or more anticancer agents, a statistically significant increase of, eg, at least 2 months, at least 4 months, at least 6 months of duration of response.

Articles of manufacture

In another embodiment of the invention, there is provided an article of manufacture containing materials useful for the treatment of the disorders described above. The article of manufacture comprises a container, a label and a booklet inserted in the package. Suitable containers include, for example, bottles, vials, syringes, etc. The containers may be formed from a variety of materials such as glass or plastic. The container contains a composition which is effective for treating the disease and may have a sterile access point (for example the container may be an intravenous solution bag or a vial with a stopper pierceable by a hypodermic needle infection). At least one active agent in the composition is an ANGPTL4 modulator. The label on the containers or associated with them indicates that the composition is used to treat the disease in question. The article of manufacture may further comprise a second container comprising a pharmaceutically acceptable buffer such as phosphate buffered saline, Ringer's solution and dextrose solution. It may additionally include other materials desired from a commercial or user's point of view, including additional active agents, other buffers, diluents, filters, needles and syringes.

Storage of materials

The following materials were deposited at American Type Culture Collection, 10801 University Boulevard, Manassas, VA. 20110-2209, USA (ATCC):

Material ATCC Deposit No. Date of Deposit ANGPTL4 (NL2-DNA 22780-1078) 209284 18/9/97 Hybridoma cell line producing antibody A4.6.1 ATCC HB-10709 29/3/91 99 ΕΡ 1 771 474 Was deposited under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the Purposes of Patent Procedure and its Regulations (Budapest Treaty). This ensures the maintenance of a viable deposit culture for 30 years from the date of deposit. The deposit will be made available by the ATCC under the terms of the Budapest Treaty and subject to an agreement between Genentech, Inc. and ATCC, which ensures permanent and unlimited availability to the public of offspring from the deposit culture by granting the relevant US patent or making available to the public any US or foreign patent application that first arises and ensures the availability of offspring that the US Commissioner of Patents and Trademarks determines as having that right in accordance with 35 USC § 122 and in accordance with the respective rules of the Commissioner (including 37 CFR § 1.14 with particular reference to 886 OG 638). The transferee of the present application has agreed that if the culture of deposited materials is killed or is lost or destroyed when grown under suitable conditions, the materials will be immediately replaced by the like materials upon notification. The availability of the deposited material should not be considered as an authorization to bring the invention into practice in contravention of the rights granted under the authority of any government in accordance with its patent laws.

EXAMPLES

It is understood that the deposits, examples and embodiments described herein are for illustrative purposes only and that, in the light of the foregoing, various modifications will be suggested to those skilled in the art and may be included within the scope of the appended claims. Commercially available reagents and referred to in the examples are used according to the manufacturer's instructions unless otherwise indicated. 100 ΕΡ 1 771 474 / ΡΤ

EXAMPLE 1: ANGPTL4 STIMULATES TUMOR CELL PROLIFERATION AND CELL MIGRATION

Generation of adenoviral vectors and transduction: The adenoviral constructs were constructed by cloning the NotI-NotI cDNA insert into the polylinker site of the Stratagene Ad-easy vector construct kits (LaJolla, CA), essentially as described by the manufacturer. See, e.g., Hesser et al. Blood, 104 (1): 149-158 (2004).

Generation of tagged protein with a single flag marker (23-406) (PUR9384), mAngptI4 (184-410) -IgG (PUR938) and mAngptI4 (23-410) (PUR9452): The collected fluid was passed overnight of the cell culture on anti-M2 flag resin (Sigma # A-2220). The column was washed to the baseline with PBS and then eluted with 50 mM Na citrate, pH 3.0. This volume was concentrated in Amicon-15 of 10,000 MWO (Millipore # UFC901024). The final step was dialysis for 1mM HCl / Super H 2 O and filtration in 0.2æ. A 4-20% Tris SDS-PAGE / glycine (Invitrogen # EC6028box) + 10 mM DTT-PAGE was used to determine purity. Correct proteins were identified by mass spectrometry or by N-terminal Edman sequencing.

Generation of hAngptI4 (184-406) -IgG n-terminal marker (PUR 9441) followed in series by an n-terminal hu Fc marker: Fluid harvested from the cell culture was passed over ProSep A (Amersham # 113111835). The column was washed to the baseline with PBS. Then a washing step was performed with four column volumes of 0.5 M TMAC / PBS, pH 7.5, followed by a PBS wash to the baseline. The elution step was with a shock of 50 mM Na citrate pH 3.0. This volume was concentrated in Amicon-15 of 10,000 MWCO (Millipore # UFC901024). The final step was dialysis for 1mM HCl / Super Q H 2 O and filtration in 0.2æ. A SDS-page of 4-20% tris / glycine (Invitrogen # EC6028box) +/- 10 mM DTT was used to determine purity. Correct proteins were identified by mass spectrometry or by N-terminal Edman sequencing. Recombinant proteins may also be prepared using standard techniques known in the art. 101 ΕΡ 1 771 474 / ΡΤ

Generation of Ad-ANGPTL4-RNApi: 4 potential ANGPTL4-RNApi (Qiagen) molecules were generated based on the complete sequence of hANGPTL4. An ANGPTL4-siRNA was selected based on the ability of siRNA to inhibit hANGPTL4 expression. It targeted the following DNA sequence GTGGCCAAGCCTGCCCGAAGA (SEQ ID NO: 3) of ANGPTL4, e.g., r (GGCCAAGCCUGCCCGAAGAUU) (SEQ ID NO: 4) and / or r (UCUUCGGGCAGGCUUGGCCAC) (SEQ ID NO: 5). The RNApi was cloned into a CMVpShuttle-H1.1 transfer vector with an RNA promoter, e.g., H1 promoter (GenScript). The RNApi expression cassette was then cloned to generate an adenoviral AdhANGPTL4-ARNpi construct. For example, adenoviral constructs were constructed by cloning the NotI-NotI cDNA insert into the polylinker site of the Stratagene Ad-easy vector construct vector kits (LaJolla, CA), essentially as described by the manufacturer. See, e.g., Hesser et al., Blood, 104 (1): 149-158 (2004).

Expression of ANGPTL4 was checked by " Western blooting " using an anti-FLAG antibody. A clone with strong expression was selected and the titers amplified according to the manufacturers instructions. The viral preparations were purified by CsCl centrifugation and assayed for reversal products by PCR. Viral titers were determined by 96 well cell lysis experiments according to the manufacturers instructions. These vectors, together with supplied pShuttleCMV-lacZ, were recombined in BJ5183 electrocompetent bacteria with the AdEasy vector containing the E5 and E3 deletion of the Ad5 genome. Primary viral stock solutions were prepared by transient transfection of recombinant AdEasy plasmids into HEK293 host cells. Adenovirus stock solutions were further amplified in HEK293 cells and purified using the CsCl gradient purification method, as described by the manufacturer. Adenovirus work titers were obtained by Elisa assay.

Generation of mANGPTL4: 293 cells were transiently transfected with a construct containing a complete mANGPTL4-encoding nucleic acid (1-410). MANGPTL4 was purified from the supernatant and used for experiments. 102 ΕΡ 1 771 474 / ΡΤ

Tumor cell proliferation in vitro: ANGPTL4 stimulated the proliferation of human rhabdomyosarcoma A673 tumor cells (HTB 1598) in vitro. See Figure 4, panel A. Adenovirus constructs of Ad-Angptl4, Ad-LacZ, Ad-AngptII3 were generated as described previously (Hesser et al., Blood, 104 (1): 149-158 (2004)). .

A673 cells were transduced with a construct comprising the adenovirus-ANGPTL4 (Ad-Angptl4) construct, the adenovirus-LacZ construct (Ad-LacZ) as a control or the adenovirus-ANGPTL3 (Ad-Angptl3) construct at the multiplicity of infection ) of 100. After 3 days of culture of A6 cells 73 in DMEM with high glucose content and 5% FCS, the cells were counted. As indicated in Figure 4, panel A, Ad-Angptl4 stimulated proliferation of tumor cells. There was a greater than about 2 fold increase in the number of cells in cells treated with Ad-Angptl4 compared to the Ad-LacZ control. Ad-Angptl4 also stimulated the proliferation of MCF7 (human breast adenocarcinoma) cells about 3-fold, TK10 cells (renal cell line cancer) about 2-fold and A549 (human lung carcinoma) cells about 1, 5 times compared to the control. Ad-Angptl4 also stimulated the proliferation of U87MG cells; see figure 4, panel B, where cells (A673, U87MG, 4T-1 or Caki) were transduced with a construct comprising the adenovirus-ANGPTL4 (Ad-Angptl4 (2)) construct, the adenovirus-LacZ construct (Ad -LacZ (1)) as a control or construct of ANGPTL4-siRNA (3) adenovirus at the multiplicity of infection (MOI) of 500. After 2-3 days of culturing the cells in high glucose DMEM with 5% FCS, cells were counted. Conditioned medium from ANGPTL4 transduced COS cells also induced proliferation of A673 cells. See Figure 4, panel C. A673 (Hepa) (A), human microvascular endothelial (HMEC) (B) or COS7 (C) conditioned medium (supernatant) cells were transduced with adenovirus constructs (Ad-Angptl4- (2), Ad-LacZ (1) or Ad Angptl3 (4).) After 4 days of culture of the A673 cells in high glucose DMEM with 5% FCS, the cells were counted. in Figure 4, panel C, the supernatant of COS + Ad-Angptl4 cells stimulated the proliferation of tumor cells compared to the controls and other supernatants of other cell types that were used, eg, Hepa cells and HMVEC cells.

Angptl4 activity when coating culture plates: The proliferation of A673 cells by Angptl4 was also analyzed by coating culture plates with protein. The plates were coated with murine Angptl4, LZ-hANgptl4, fibronectin, NL4 as a control protein, IgG-hAngptl4 (184-406), mAngptl3, hAngptI3, mAngptI4 (23-410), Lz-hAngptI4 (184-406), Fc-hAngptl4 (184-406) or BSA, at various concentrations, eg, uncoated, 0.3 pg / ml, 3.0 pg / ml or 30 pg / ml. 96 well flat bottom plates (MaxiSorp, Nunc, Denmark) were coated overnight at 4 ° C. Human A673 tumor cells were harvested and diluted to 105 cells / ml in HG-DMEM medium containing 5% FCS. Cell suspensions (104 cells / well) in 200 μ Adicionar were added to the coated wells and the plates were incubated at 37 ° C for selected time intervals. The non-adherent cells were removed by PBS washes and the cell binding was measured using crystal violet or the PNAG method of Landegren. See Landegren, U. (1984) J. Immunol. Methods 67: 379-388. The results are expressed as the means of the D055o or DO405 values of triplicate wells, respectively.

Similarly, human primary umbilical vein (HUVEC), epithelial (epi) and mesangial (table) cells isolated from human umbilical cords or human kidneys (Cambrex) were harvested and assayed using the same conditions. For the proliferation assay, the medium supplied to each cell type was used by the manufacturer (Cambrex). ANGPTL4 did not appear to induce proliferation of kidney epithelial cells, renal mesangial cells or human umbilical vein endothelial cells (HUVEC), but induced proliferation of A673 (figure 5).

FACS analysis of ANGPTL4 binding to A673 cells: ANGPTL4 binding to human A673 cells was analyzed by FACS analysis. A673 cells were plated in 10cm to 500,000 culture plates at 1 x 106 cells / well of sample. Cells were cleaved the day before FACS. Cells were washed once with PBS and then 104æg -1 771 474 / ΡΤ 10 ml of 20 mM EDTA in PBS was added and incubated for 10 to 20 minutes. After 20 minutes the cells were scraped off the plate. 10 ml of 5% FCS in PBS was added and the cells were transferred to a 50 ml Falcon tube. Cells were centrifuged at 1.8 K rpm for 5 minutes at 4øC. The supernatant was removed and the cells resuspended in 1 ml of 5% FCS in PBS. 100 μl of cell suspension was dispensed into 5 ml FACS tubes containing 1 μg protein and incubated for 30 minutes or more on ice. The following proteins were used: mAngpt14 (23-410), PUR 9452, 0.428 mg / ml (2 μg / sample); hAngptl4 (23-406), PUR 9384, +/- 90æg / ml (10 μΐ / sample); hAngptl4 (184-406) -IgG, PUR 9441, 1.5 mg / ml (1 μΐ / sample); and 0.1 mg / ml FLAG-BAP (Sigma) control (2 μΐ / sample). After incubation, the tubes were filled with 5 ml of 5% FCS in PBS on ice. Cells were centrifuged for 5 minutes at 2K rpm. The supernatant was removed. Anti-FLAG-FTTC antibody (Sigma) (2 μΐ antibody (100æg / ml stock solution) was added and incubated on ice for 5 minutes or longer. The final antibody concentration was 1æg / ml. 5 ml of 5% FCS in PBS was added and the cells were centrifuged for 5 minutes at 1.8 K rpm at 4Â ° C. The supernatant was removed and the cells resuspended in 0.25 ml of PBS with 5% FCS on ice 0.05% sodium azide may also be present to avoid receptor endocytosis 1 μΐ of propidium iodide (PI) stock diluted 1:50 per sample may be added. cells were then subjected to FACS. Various forms of ANGPTL4, both human and bovine ANGPTL4, bind to A673 cells (Figure 6, panel A) under various conditions (Figure 6, panel B), normoxia, hypoxia (0% , for 24 hours or PMA (200 nM for 24 hours) For the hypoxia experiments, cells were incubated for 24 hours at 37øC in a 5% CO2, 95% N2 incubator for 24 hours. The cells were also activated in the presence of 200 nM forboLeste (PMA) in an incubator at 37 ° C, 5% CO 2 and normoxia conditions.

Conditioned medium from ANGPTL4 expressing cells: A673 cell proliferation was analyzed when conditioned medium from Angptl4 expressing cells or by addition of recombinant Angptl4. 500 μΐ of conditioned media (supernatant) of COS7 were added to A673 cells which were transduced with adenovirus constructs (Ad-Angptl4 (2), 105 ÅΡ¹ 771 474 / ΡΤ

Ad-LacZ (1) or Ad-LacZ + rmAngpt14 (23-410) (3) (5 pg / ml)).

After culturing the cells for 7 days (Figure 7, panel A) in high glucose DMEM medium containing 5% FCS, cells were counted. The A673 proliferation was also analyzed by adding recombinant Angptl4 to the medium with 5% FCS and culturing the cells for 4 days. No addition (1) or a control buffer (2), mAngpt4 (23-410) (2.5 pg / ml) (3), hAngpt14 (23-406) (2.5 pg / ml) (4), hlgG-hAngptl4 (184-406) (2.5 pg / ml) (5) or hIgG-mAngptl4 (184-410) (2.5 pg / ml) (6) indicated. After culturing the cells for 4 days (Figure 7, panel B) in high glucose DMEM medium containing 5% FCS, cells were counted. Proliferation of A673 cells by conditioned media from cells expressing ANGPTL4 or with recombinant protein added to the medium may be cell density dependent. See Figure 7, panel A (cell proliferation when cultured for 7 days under the conditions mentioned) and panel B (cell proliferation when cultured for 4 days under the conditions mentioned).

Angptl4 induces cell migration: We analyzed the ability of Angptl4 to induce cell migration of murine 4T-1 tumor cells. Cellular motility was measured as described (see, eg, Camenisch, et al., J. BioL Chem, 277 (19): 17281-17290 (2002)) using HTS multi-well tissue culture inserts with porosity of 3 pm (Becton Dickinson, NJ). HANGPTL4 (1-406) was diluted in 50/50 / 0.1% BSA at 5, 1 and 0.2 pg / ml. As a positive control, the membranes were incubated with medium containing 10% fetal calf serum (FCS) or recombinant human PDGF-BB (R & D Systems) at 0.1 pg / ml). 50/50 / 0.1% BSA was used as a negative control. The mouse 4T1 tumor cells were washed three times with PBS, harvested and suspended at about 105 cells / ml in 50/50 / 0.1% BSA. The following cellular preparations were tested, wherein mANGPTL4 is indicated as NL2. 4T-1 50/50 / 0.1% BSA NL2 5æg + 10% FBS NL2 0.5æg + 10% FBS NL2 0.2æg 50/50 / 0.1% BSA PDGF-BB 0 , 1æg 106

ΕΡ 1 771 4 7 4 / EN

The preparations were added to the lower chamber and the preparations were incubated at 37 ° C for 19 hours.

The cell suspension (250 μ) was added to the upper chamber and the cells were allowed to migrate overnight at 37 ° C in a humidified 5% CO2 incubator. After incubation, the medium was aspirated from the upper and lower chambers and the cells that had migrated to the underside of the membrane were fixed with methanol (400 μM MeOH for 30 minutes at 4 ° C, remove MeOH and air dry for 40 minutes. min) and stained with YO-PRO-1 iodide (Molecular Probes, OR) (400 μl of 10 μM YO-PRO-1 iodide (1: 100 of a 1 mM stock solution)). Migration results are quantified in terms of the mean number of cells / microscopic field at a magnification of 20 times using the Openlab utility (Improvision, MA).

In another experiment, Angptl4 was found to induce migration of A673 cells in conjunction with migration of 4T-1 tumor cells. MANGPTL4 in 50/50 / 0.1% BSA at 6, 1.5 and 0.375 pg / ml was diluted. As a positive control, membranes were incubated with 10% fetal calf serum (FCS) containing recombinant human medium or PDGF-BB (R & D Systems) at 0.1 pg / ml. 50/50 / 0.1% BSA was used as the negative control. 4T-1 and A673 cells were collected and resuspended in 50/50 / 0.1% BSA (2x105) cells / ml). The following cellular preparations were tested, wherein mANGPTL4 is indicated as NL2. 4T-1 A6 73 50/50 / 0.1% BSA NL2 6 pg 50/50 / 0.1% BSA NL2 6 pg + 10% FBS NL2 1.5 pg + 10% FBS NL2 1.5 pg + 10% FBS NL2 0.375 pg + 10% FBS NL2 0.375 pg 50/50 / 0.1% BSA PDGF-BB 0.1 pg 50/50 / 0.1% BSA NL2 0.375 pg

The preparations were added to the lower chamber in 750 μΐ and the preparations were incubated at 37 ° C for 19 hours.

The cell suspension (250 μ) (5x104) was added to the upper chamber and the cells were allowed to migrate for 7 hours at 37 ° C in a 5% CO2 humidified incubator. After incubation, the medium from the upper and lower chambers was aspirated and the cells that had migrated to the underside of the membrane were fixed with methanol (400 μL MeOH for 30 minutes at 4 ° C, remove MeOH and air-dried for 40 minutes) and stained with YO-PRO-1 iodide (Molecular Probes, OR) (400 μl of 10 μM YO-PRO-1 iodide (1: 100 of a 1 mM stock solution )). Migration results are quantified in terms of the mean number of cells / microscopic field at a magnification of 20 times using the Openlab utility (Improvision, MA). Referring to Figure 9, where (1) is without serum addition, (2) is 10% fetal calf serum (FCS), (3) is PDGF-BB and (4) is ANGPTL4. Using ANGPTL4 and 10% FCS, A673 and 4T-1 cells migrated. Thus, Angptl4 antagonists can be used to inhibit metastasis, e.g., without theoretical limitation, avoiding migration of tumor cells. ANGPTL4 increases tumor size in vivo: A673 cells from human rhabdomyosarcoma (HTB 1598) were cultured as previously described (Kim et al., Nature 362: 841-844 (1993); and Gerber et al., Cancer Research, 60: 6253-6258 (2000)). 5 x 106 A673 cells were injected into 0.1 ml of Matrigel in the beige nude mouse dorsal flank region (Harlan Sprague Dawley) to establish xenografts. An adenovirus construct was injected with 1x108 plaque forming units (PFU), intratumoral (II), q7d on days 1, 7 and 14. Injections were administered directly into the tumor mass, laterally and below, using a 28 gauge needle and a 0.5 ml tuberculin syringe. The adenovirus constructs were an adenovirus-ANGPTL4 (Ad-Angptl4) construct, an adenovirus-LacZ construct (Ad-LacZ) as a control or an adenovirus-ANGPTL3 (Ad-Angptl3) construct. Tumor size was determined on different days after tumor implantation. Tumor size measurements were taken every other day, and tumor volume was calculated using the formulas of the volume of ellipsoids n / 6 x L x W x H, where L = length, W = width, and H = height; Tomayko &amp; Reynolds, Cancer Chemother. Pharmacol, 24: 148-154 (1989)). As shown in Figure 8, size (panel A) and tumor weight (panel B) increased statistically (P <0.0001) in mice injected with A673 cells and with an adenovirus-ANGPTL4 (Ad-Angptl4) compared to the Ad-LacZ or Ad-Angptl3 constructs. 108 ΕΡ 1 771 474 / ΡΤ EXAMPLE 2: TREND OF TUMORS TREATED WITH ANGPTL4

ESCAPE ANTI-VEGF TREATMENT AngPTL4 stimulated the proliferation of tumor cells in tumors treated with an antiangiogenic agent, eg, anti-VEGF (such as AVASTIN® (Genentech, South San Francisco).) See Figure 8, Panel C. Cells were cultured A673 of human rhabdomyosarcoma (HTB 1598) as previously described (Kim et al., Nature 362: 841-844 (1993); and, Gerber et al., Cancer Research, 60: 6253-6258 (2000)). 5 x 106 A673 cells in 0.1 ml Matrigel in the beige nude mouse dorsal flank region (Harlan Sprague Dawley) were used to establish xenografts. An adenovirus construct was injected with 1 x 108 plaque forming units (PFU) , intratumoral (IT), q7d at days 1,7,14,21 and 28. The adenovirus constructs were from adenovirus-ANGPTL4 (Ad-Angptl4) construct, an adenovirus-LacZ (Ad-LacZ) construct as a control or an adenovirus-ANGPTL3 (Ad-Angptl3) construct. Avastin (Ge) mice nentech) at a dose of 5 mg / kg, ip, twice a week. Injections were administered directly into the tumor mass, laterally and below the injection using a 28 gauge needle and a 0.5 ml tuberculin syringe.

Tumor size measurements were performed every other day, and tumor volume was calculated using the ellipsoid volume formulas n / 6 x L x W x H, where L = length, W = width, and H = height; Tomayko &amp; Reynolds, Cancer Chemother. Pharmacol, 24: 148-154 (1989)). As can be seen in Figure 8, panel C, tumor size increased in mice injected with an adenovirus-ANGPTL4 (Ad-Angptl4) construct despite being treated with AVASTIN®, compared to mice injected with cells containing a construct Ad-LacZ or Ad-Angptl3 in combination with AVASTIN® treatment.

EXAMPLE 3: ANTIBODIES CONNECTING ANGPTL4 INHIBIT TUMOR CELL GROWTH

The ability of anti-ANGPTL4 antibodies to inhibit a biological activity of ANGPTL4, e.g., proliferation of tumor cells, was assayed. 1x104 tumor cells (e.g., HeLa-S3, Caki, U87MG, 293, A673, HM7 and Caiu 6) / well were plated in 12-well plates in medium with 10% FCS. The cells were incubated overnight at 37 ° C in a humidified 5% CO2 incubator. The medium was changed to 5% FCS (except for Caiu 6 cells which were to 10% FCS), and anti-hANGPTL4 or anti-Dscr antibody at 1, 2.5, 5 or 10æg / ml or no antibody was added.

Plates were placed at 37øC in a humidified 5% CO2 incubator. The cells were counted on days 2 or 3 after addition of anti-hANGPTL4 antibody. Anti-ANGPTL4 antibody inhibited growth of HeLa-S3, Caki U87MG, 293, A673 and Caiu 6 cells, but not HM7 cells. Refer to figure 10, panels A and B. EXAMPLE 4: PREPARATION OF ANGPTL4 ANTIBODIES

Techniques for producing polyclonal antibodies and monoclonal antibodies are known in the art and are described herein. Antigens (or immunogens) that may be used include purified protein of the invention, protein fragments, fusion proteins containing such protein, and cells expressing recombinant protein and / or recombinant protein fragments on the cell surface. The selection of the antigen can be carried out by the skilled person in the art without undue experimentation.

Mice, such as Balb / c, are immunized with the antigen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally in an amount of 1-100 micrograms. Alternatively, the antigen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, Mont.) And injected into the plant of the animal's hind legs. Immunized mice are then boosted 10 to 12 days later with additional antigen emulsified in the selected adjuvant. Thereafter for several weeks the mice may also be boosted with additional immunization injections. Serum samples from mice can be obtained periodically by retro-orbital bleeding to assay in ELISA assays to detect the antibodies.

Upon detection of a suitable antibody titer the &quot; positive animals &quot; for antibodies with a final intravenous injection of a given ligand. Three to four days later the mice are sacrificed and spleen cells are collected. The spleen cells (using 35% polyethylene glycol) are then fused to a selected murine myeloma cell line such as P3X63AgU.1, available from ATCC, No. CRL 1597. The fusions generate hybridoma cells which can then be plated in 96-well tissue culture plates containing HAT medium (hypoxanthine, aminopterin and thymidine) to inhibit proliferation of unfused cells, myeloma hybrids and spleen cell hybrids.

Hybridoma cells will be screened in an ELISA for reactivity against the antigen. Determination of &quot; positive &quot; hybridoma cells &quot; which excrete the desired monoclonal antibodies against ANGPTL4 is well within the skill in the art.

Positive hybridoma cells may be injected intraperitoneally into syngeneic Balb / c mice to produce ascites containing anti-ANGPTL4 monoclonal antibodies. Alternatively, the hybridoma cells may be grown in tissue culture flasks or in flasks. Purification of the monoclonal antibodies produced in the ascites can be achieved by precipitation with ammonium sulfate followed by gel exclusion chromatography. Alternatively, affinity chromatography based on antibody binding to protein A or protein G. may be used.

For example, rabbit polyclonal antibodies were generated by rabbit immunization with 500 μg of recombinant human ANGPTL4 (23-406) protein generated on E. coli on days 1, 40 and 70. Serum was collected on days 80 and 120 after immunization and antibodies were purified with A-Sephadex protein columns.

EXAMPLE 5: BLOCKING OR NEUTRALIZING ANTIBODIES

Antibodies to the antigens described herein can be identified by various techniques known in the art, e.g., an ELISA. For example, plaques may be coated with the polypeptide of interest, eg, ANGPTL4 or a fragment thereof and incubated with antibodies raised against that polypeptide, eg, ANGPTL4 (see, eg, disclosure in the patents 111 ΕΡ 1 771 474 / ΡΤ US 6348350, 6372491 and 6455496). Bound antibody can be detected by various methods.

Antagonizing (e.g., blocking or neutralizing) antibodies may be identified by competition assays and / or activity assays. For example, the expression of ANGPTL4 stimulates proliferation, migration, adhesion or binding to ανβδ of tumor cells. The determination of a blocking or neutralizing antibody to ANGPTL4 by the ability of the antibody to block tumor cell proliferation (see, eg, Figure 10, panels A and B), migration, adhesion (see, eg, Figure 12) or binding to Οίνβδ (USBiological, 37K, Swampscott, Massachusetts) (see, eg, Figure 13, panels B and C) of the tumor cell. For example, rhabdomyosarcoma A673 cells can be plated and incubated with supernatant of COS7 cells transduced with Ad-hAngpt4 together with an anti-ANGPTL4 antibody or a control antibody or PBS. After several days, trypsin can be treated and the cells counted. Antibodies are identified that reduce cell numbers as blocking or neutralizing antibodies. ANGPTL4 was also shown to induce tumor cell migration and was a pro-angiogenic factor. See, e.g., Le Jan et al., American Journal of Pathology, 164 (5): 1521-1528 (2003). AngPTL4 blocking or neutralizing antibodies can thus be identified using the antibodies in combination with ANGPTL4 in tumor cell migration assays and / or angiogenesis assays, e.g., CAM assay.

Neutralizing or neutralizing antibodies to ANGPTL4 may also be identified which may be used in blocking or reducing tumor growth or blocking or reducing growth of cancer cells using tumor cells in culture as previously described and / or in studies of beige / naked For example, nude mice can be injected with tumor cells. At various time points after tumor growth has been established, the mice may be injected intraperitoneally once or twice a week with several doses of the ANGPTL4 blocking or neutralizing antibody, an antibody or PBS control. The size of the tumor can be measured weekly and at the conclusion of the study the tumor can be excised and weighed. 112 ÅΡ 1 771 474 / Identific ANGPTL4 blocking or neutralizing antibodies are identified that block or reduce tumor growth in mice.

Combinations of ANGPTL4 antibodies and antiangiogenic agent may be identified to block or reduce tumor growth or to block or reduce growth of cancer cells by use of tumor cells in culture as described above and / or studies with beige / nude mice. As previously indicated, nude mice can be injected with tumor cells. At various time points after tumor growth has been established, the mice may be injected intraperitoneally once or twice a week with various doses of the combination of an ANGPT4 antagonist and an anticancer agent, eg, antiangiogenic agent, such as an antibody anti-VEGF or an ANGPTL4 antagonist or an anticancer agent or antibody or PBS control. The size of the tumor can be measured weekly and at the conclusion of the study the tumor can be excised and weighed. Combination therapies of ANGPTL4 antagonists and anticancer agents that block or reduce tumor growth in mice or that increase blockage or reduction of tumor growth compared to a control or a single agent alone are identified. EXAMPLE 6: ANGPTL4 VARIANT

An ANGPTL4 variant was made using a standard mutagenesis kit (e.g., QuikChange XL Site-Directed Mutagenesis Kit (Invitrogen, Carlsbad, California)) following the manufacturer's protocol. Two amino acid substitutions were performed on the human ANGPTL4 sequence (see, e.g., figure 2). Substitutions were at position 162 and 164 (R162G and R164E) resulting in a RKR exchange for GKE. ANGPTL4 protein (L280 plasmid, aa 1-406) or variant ANGPTL4 was isolated from the transiently infected COS-7 cell supernatant. For purification the supernatant was loaded onto a nickel column. Protein was detected by Western blotting &quot; with an anti-FLAG-HRP antibody. See, figure 3, panel B. When substitutions were made and the variant ANGPTL4 was compared to protein 113

Native or wild-type ANGPTL4, the variant ANGPTL4 was found to have a higher molecular weight than the native ANGPTL4 by Western blotting &quot;. Replacement of RKR to GKE at position 162 and 164 of the native protein prevented proteolytic degradation of ANGPTL4. EXAMPLE 7: ANGPTL4 INTEGRIN ανβ5

Angiopoietins are excreted factors that regulate angiogenesis by binding to the endothelial cell-specific receptor tyrosine kinase Tie2 through its fibrinogen-like domain (FBN). It has been found that the helix domain coiled in the excreted ligand family is required for ligomer oligomerization (see, e.g., Procopio et al., J. Chem., 274: 30196-201 (1999)).

Similar to angiopoietins, ANGPTL3 and ANGPTL4 are excreted glycoproteins, each consisting of an N-terminal signal peptide, followed by a coiled-loop helix domain and a FBN-like domain at the C-terminus. ANGPTL3 was determined to be binds ανβ3 through the FBN-like domain. We determined that ANGPTL4 binds to avPs. The 293-1953 cell line was tested that is stably transfected with ανβ5 integrin for its ability to bind or adhere to ANGPTL4-coated plates. Cells were harvested and diluted at 105 cells / ml in serum-free medium containing PBS, 1% BSA, 1 mM CaCl2 and 1 mM MgCl2. Cells were preincubated with or without anti-3ββ integrin antibodies (MAB 1961 (Chemicon, Temecula, CA)) or peptides for 15 minutes at 37øC. Nunc Maxisorp 96 well flat bottom microtiter plates were coated with recombinant mANGPTL4, BSA or vitronectin (1æg, 3æg, 10æg or 30æg / ml) overnight at 40øC and blocked with 200æl of BSA to 3% in phosphate buffered saline (PBS), pH 7.4, for 1.5 hours at 37 ° C. Cell suspensions (5 x 10 4 cells / 100 μl / well (5 x 10 5 / ml)) were added to the coated plates and the plates were incubated at 37 ° C for 5.5 hours. The non-adherent cells were washed with PBS and cell binding measured by addition of 200 μl of CyQuant GD dye (Molecular Probes (Invitrogen detection Technologies (Carlsbad, California)) (1: 400) / lysis buffer cell and incubated for 2-5 minutes. Fluorescence of the sample was measured using 114

ΕΡ 1 771 4 7 4 / PT excitation at 480 nm and emission at 520 nm. The PNAG method of Lanndegren (see, e.g., Landegren, J. Immunol. Methods, 67: 379-388 (1984)) can also be used. Cells expressing ανβδ exhibit adherence to ANGPTL4 and vitronectin (USBiological, Swampscott, Massachusetts), a positive control, compared to BSA, a negative control. Refer to figure 11.

To determine if integrin ανβ5 was sufficient to mediate ANGPTL4 cell adhesion, blocking antibodies were tested for their ability to inhibit adhesion in the cell adhesion assay. Functional blocking antibodies (anti-mouse antibodies (MAB1961 (Chemicon, Temecula, CA)) or anti-hANGPTL4 antibodies) were added to 293-1953 cells prior to incubation with the protein coated wells (BSA (1), vitronectin (2) or ANGPTL4 (3)). See Figure 12. The anti-oes and anti-ANGPTL4 antibodies eliminated the cell adhesion activity of ANGPTL4.

Additional experiments were performed to confirm that ANGPTL4 binds ανβ5. ELISA experiments were performed to detect whether mANGPTL4, IgG-hANGPTLA-Nterminal (1-183) and / or IgG-hANGPTL4-Cterminal (184-406) bind to plates coated with θίνβδ (USBiological, 37K, Swampscott, Massachusetts ).

Ανβδ integrin diluent (1æg / ml coating buffer (50 mM carbonate / bicarbonate, pH 9.6)) and 100 μΐ / well of coating buffer were incubated overnight at 4 ° C. The plates were washed three times with wash buffer (PBS, pH 7.4, 0.05% Tween-20) and 100 μΐ / well of blocking buffer (PBS, pH 7.4, BSA at 0 ° C , 5%) for 1 hour at room temperature with gentle stirring. Various amounts of mANGPTL4, IgG-hANGPTL4-Nterminal (1-183) and / or IgG-hANGPTL4-Nortriptan (0.183 pg, 0.66 pg, 2 pg, or 6 pg) C-terminal (184-406) in sample buffer (0.5% BSA, 50 mM Tris, pH 7.4, 0.05% Tween-20, 1 mM MnCl 2, 50 pM CaCl 2, 50 pM MgCl 2, 100 NaCl mM) and incubated for 30 minutes. The samples were added to the plates (100 μl / well in the previously incubated amounts) and incubated for 2 hours at room temperature with gentle shaking. Plates were washed with buffer and 100 μl / well of anti-Flag-horseradish peroxidase (HRP) (100 ng / ml) (Jackson, # 109-036-098) in assay buffer (PBS, pH 7.4, 0.5% BSA, Tween 20 at 115Â ° F and 1 771 474 / ΡΤ 0.05%) and incubated for 1 hour at room temperature with gentle shaking. Plates were washed. 100 μΐ / well of tetramethylbenzidine (TMB) (Moss, Inc.) was added and incubated on the plates until a good color had developed at room temperature. 100 μΐ / well of stop solution (1 M H3 PO4) was added to stop the reaction. The plates were read at 630 nm. mANGPTL4, IgG-hANGPTL4-Nterminal and IgG-hANGPTL4-C-terminal bound to ανβδ-coated plates, although IgG-hANGPTL4-C-terminal ligated slightly more to the plates. Refer to figure 13, panel A.

Anti-ANGPTL4 antibodies inhibit the binding of ANGPTL4 to ανβ5-coated plates. ELISA experiments were performed. 100 μΐ / well of ανβ5 integrin diluent was incubated at 1 μg / ml of coating buffer (50 mM carbonate / bicarbonate, pH 9.6)) with coating buffer overnight at 4 ° C. The plates were washed three times with wash buffer (PBS, pH 7.4, 0.05% Tween-20) and 100 μΐ / well of blocking buffer (PBS, pH 7.4, BSA at 0 ° C , 5%) for 1 hour at room temperature with gentle stirring. 0.6 μg samples were added to 6.0 μg mANGPTL4, IgG-hANGPTL4-Nterminal (1-183) and / or IgG-hANGPTT4-Cterminal (183-406) in sample buffer (BSA at 0, 5%, 50 mM Tris, pH 7.4, 0.05% Tween 20, 1 mM MnCl 2, 50 μM CaCl 2, 50 μM MgCl 2, 100 mM NaCl) with anti-ANGPTL4 (1.5 pg) or anti- Dscr (1.5pg) for 30 minutes.

After incubation, 100 μΐ / well of the + / antibody sample was incubated with the plates for 2 hours at room temperature with gentle shaking. The plates were washed with buffer and 100μΐ / well anti-Flag-HRP (100ng / ml) in assay buffer (PBS, pH 7.4, 0.5% BSA, 0.05 Tween 20 %) and incubated for 1 hour at room temperature with gentle shaking. The plates were washed and 100 μΐ / well TMB was added and the plates incubated until a good color had developed at room temperature. 100 μΐ / well of stop solution (1M H3P04) was added to stop the reaction. The plates were read at 630 nm. Anti-ANGPTL4 antibodies reduced the amount of binding of mANGPTL4, IgG-hANGPTL4-Nterminal and IgG-hANGPTL4-Cterminal to plates coated with ανβδ compared to anti-Dscr antibody, 5G7 monoclonal antibody or medium. Refer to figure 13, panel B. 116 ΕΡ 1 771 474 / ΡΤ

In another experiment, the binding of ANGPTL4 and ανβ5 integrin was demonstrated by ELISA. In this experiment, 80 μΐ / well of HANGPTL4-C terminal, vitronectin or BSA (5 μg / ml) was added to the plates in coating buffer (50 mM carbonate / bicarbonate, pH 9.6) and incubated overnight at 4 ° C. Plates were washed (wash buffer: PBS, pH 7.4, 0.05% Tween-20) and 100 μΐ / well of blocking buffer (PBS, pH 7.4, BSA at 0, 5%) in either medium, anti-hANGPTL4 antibodies (15 pg / 100 μ) or anti-Dscr antibodies (15 pg / 100 pg) were added and incubated for 1 hour at room temperature with gentle shaking. The plates were washed and 100 μl of ανβδ (3-9 μg / ml) were added and incubated for 2 hours at room temperature with gentle shaking. The plates were washed and 1æg / ml (1: 1000) anti-oestrus antibody (Chemicon) (5æg / 100æl) was added in assay buffer (PBS, pH 7.4, 5%, 0.05% Tween 20) and incubated for 1 hour at room temperature with gentle shaking. After incubation, the plates were washed and 100 μl / well of horseradish peroxidase (HRP) anti-mouse (1: 5000) was added in assay buffer. The plates were washed and 100 μl / well of tetramethylbenzidine (TMB) was added and incubated at room temperature until a good color development. The reaction was quenched with 100 μl / well of 1 M H 3 SO 4 and the plates were read at 630 nm. ανβδ binds to plates coated with ANGPTL4 (lane 1) and vitronectin (lane 4). The binding is blocked with anti-ANGPTL4 antibodies (lane 2) but not when control anti-Dscr antibody (lane 3) is used or when plates are coated with control protein (lane 5). Refer to figure 13, panel C.

Thus, these observations demonstrate that recombinant ANGPTL4 specifically binds ανβ5 integrin

It is envisaged that the specification is sufficient to enable a skilled person to practice the invention. The examples and embodiments described herein should be considered to be for illustrative purposes only. The invention is not to be limited in scope by the deposited construction, since the deposited embodiment is merely an example of certain aspects of the invention and any functionally equivalent constructions are within the scope of the invention. The present deposit of material does not constitute an admission that the written description is unfit for practicing any aspect of the invention, including the best of it, nor should it be construed as limiting the scope of the claims to the specific illustrations it represents. In fact, various modifications will be made to the practitioners other than those set forth herein and described in the foregoing description and which are within the scope of the appended claims.

Lisbon, 2010-04-26

Claims (37)

  1. An angiopoietin-like protein 4 antagonist (ANGPTL4) for use in a method of blocking or reducing tumor growth or growth of a cancer cell in a subject, wherein said method comprises : a) administering to the tumor or cancer cell an effective amount of an anticancer agent; and b) administering to the tumor or cancer cell an effective amount of the ANGPTL4 antagonist, wherein the combined effective amounts block or reduce tumor growth or cancer cell growth.
  2. An ANGPTL4 antagonist for use in a method of blocking or reducing tumor growth or growth of a cancer cell in an individual, wherein said method comprises: administering to the subject a combination composition comprising an effective amount of antiangiogenic agent and a an effective amount of an angiopoietin type 4 antagonist (ANGPTL4), wherein the combined effective amounts block or reduce tumor growth or cancer cell growth.
  3. An ANGPTL4 antagonist for use in a method for blocking or reducing relapses of tumor growth or a relapse of growth of cancer cells in a subject, the method comprising administering to the subject an effective amount of the antagonist of ANGPTL4 wherein the subject has been or is is concurrently in cancer therapy with an anticancer agent and wherein administering the effective amount of the ANGPTL4 antagonist blocks or reduces the relapse of tumor growth or relapse of cancer cell growth.
  4. The ANGPTL4 antagonist of claim 3, wherein the anticancer agent is one or more chemotherapeutic agents. ΕΡ 1 771 474 / ΡΤ 2/5
  5. The ANGPTL4 antagonist of claim 1 or claim 3, wherein the anticancer agent comprises an antiangiogenic agent.
  6. The ANGPTL4 antagonist of claim 1 or claim 3, wherein the anticancer agent comprises an antiangiogenic agent and wherein the antiangiogenic agent is a VEGF antagonist or an anti-VEGF inhibitor, respectively.
  7. The ANGPTL4 antagonist of claim 6, wherein the VEGF antagonist or an anti-VEGF inhibitor is an anti-VEGF antibody.
  8. The ANGPTL4 antagonist of claim 7, wherein the anti-VEGF antibody is A4.6.1 humanized.
  9. The ANGPTL4 antagonist of claim 1 or claim 3, wherein the antagonist of ANGPTL4 is an anti-ANGPTL4 antibody.
  10. The ANGPTL4 antagonist of claim 1, wherein the antagonist of ANGPTL4 is an anti-ANGPTL4 antibody and wherein the anti-ANGPTL4 antibody binds to ANGPTL4 (184-406).
  11. 11. The ANGPTL4 antagonist of claim 1 or claim 3, wherein the ANGPTL4 antagonist is an anti-oestradiol antibody
  12. · 12. The ANGPTL4 antagonist of claim 7, 9 or 11, wherein the antibody is a humanized antibody.
  13. 13. The ANGPTL4 antagonist of claim 1 or claim 3, wherein the ANGPTL4 antagonist comprises an RNApi molecule.
  14. The ANGPTL4 antagonist of claim 13, wherein the RNApi molecule is an ANGPTL4-RNApi molecule.
  15. The ANGPTL4 antagonist of claim 14, wherein the ANGPTL4-ARNpi molecule targets a DNA sequence of a nucleic acid encoding ANGPTL4, wherein the sequence ΕΡ 1 771 474 / ΡΤ 3/5 DNA comprises at least GTGGCCAAGCCTGCCCGAAGA (SEQ ID NO: 3).
  16. The ANGPTL4 antagonist of claim 1, wherein the method further comprises administering to the tumor or cancer cell a third anticancer agent.
  17. The ANGPTL4 antagonist of claim 16, wherein the third anticancer agent is a chemotherapeutic agent.
  18. An ANGPTL4 antagonist of claim 16, wherein the third anticancer agent is another angiogenesis inhibitor.
  19. The ANGPTL4 antagonist of claim 1, wherein the administration steps (a) and (b) are performed sequentially.
  20. The ANGPTL4 antagonist of claim 1, wherein administration steps (a) and (b) are performed concomitantly.
  21. The ANGPTL4 antagonist of claim 1, wherein administration steps (a) and (b) are performed both sequentially and concomitantly.
  22. The ANGPTL4 antagonist of claim 1, wherein the steps of administration are performed in any order.
  23. An ANGPTL4 antagonist of claim 1, wherein the subject is a human.
  24. An ANGPTL4 antagonist of claim 1, wherein the subject has relapse of tumor growth or relapse of growth of cancer cells.
  25. The ANGPTL4 antagonist of claim 2 or claim 3, wherein the method further comprises administering an additional agent, wherein the additional agent is an anticancer agent.
  26. An ANGPTL4 antagonist for use in a method for blocking or reducing tumor growth or growth of a cancer cell, the method comprising administering to the tumor or cancer cell an amount effective antagonist of angiopoietin type 4 antagonist (ANGPTL4), wherein the ANGPTL4 antagonist is an antibody that binds to ANGPTL4 (184-406) and wherein the effective amount blocks or reduces tumor growth or growth of cancer cells .
  27. Use of an ANGPTL4 antagonist in the manufacture of a medicament for use in the treatment of cancer, wherein the ANGPTL4 antagonist and the treatment are as defined in any one of claims 1 to 26.
  28. A method of blocking or reducing the growth of a cancer cell, not carried out in the human or animal body, said method comprising: a) administering to the cancer cell an effective amount of an anticancer agent; and b) administering to the cancer cell an effective amount of an angiopoietin type 4 antagonist (ANGPTL4), wherein the combined effective amounts block or reduce the growth of the cancer cell.
  29. The method of claim 28, wherein the anticancer agent is as defined in any one of claims 5-8 and 12.
  30. The method of claim 28, wherein the ANGPTL4 antagonist is as defined in any one of claims 9-15.
  31. The method of claim 28, further comprising administering a third anticancer agent as defined in any one of claims 16-18.
  32. The method of claim 28, wherein the steps of administration are effected as defined in any one of claims 19-22.
  33. A method of blocking or reducing the growth of a cancer cell, the method comprising administering to the cancer cell an effective amount of an angiopoietin-like protein 4 antagonist (ANGPTL4) in that the ANGPTL4 antagonist is an antibody that binds to ANGPTL4 (184-406) and wherein the effective amount blocks or reduces the growth of the cancer cell, wherein said method is not performed in the human or animal body.
  34. A composition comprising an antibody that binds to ANGPTL4 (184-406) and a VEGF antagonist.
  35. A composition comprising an ANGPTL4-RNApi molecule, wherein the ANGPTL4-RNApi molecule targets a DNA sequence of a nucleic acid encoding ANGPTL4, wherein the DNA sequence comprises at least GTGGCCAAGCCTGCCCGAAGA (SEQ ID NO: 3) ).
  36. A kit comprising a first amount of an antiangiogenic agent, a second amount of an angiopoietin type 4 antagonist (ANGPTL4) and a pharmaceutically acceptable carrier, vehicle or diluent, and a container.
  37. A kit comprising an amount of an antiangiogenic agent and a pharmaceutically acceptable carrier, vehicle or diluent in a first unit dosage form; an amount of an angiopoietin-like protein 4 antagonist (ANGPTL4) and a pharmaceutically acceptable carrier, vehicle or diluent in a second unit dosage form; and a container. Lisbon, 2010-04-26
PT05790352T 2004-07-20 2005-07-19 Inhibitors of angiopoietin-like 4 protein, combinations, and their use PT1771474E (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US58978204P true 2004-07-20 2004-07-20

Publications (1)

Publication Number Publication Date
PT1771474E true PT1771474E (en) 2010-05-03

Family

ID=35787710

Family Applications (1)

Application Number Title Priority Date Filing Date
PT05790352T PT1771474E (en) 2004-07-20 2005-07-19 Inhibitors of angiopoietin-like 4 protein, combinations, and their use

Country Status (22)

Country Link
US (2) US7740846B2 (en)
EP (3) EP2172482A1 (en)
JP (2) JP4947717B2 (en)
KR (1) KR101254815B1 (en)
CN (2) CN102641503A (en)
AT (1) AT456579T (en)
AU (2) AU2005269716B2 (en)
BR (1) BRPI0513534A (en)
CA (1) CA2574758A1 (en)
CY (1) CY1109931T1 (en)
DE (1) DE602005019167D1 (en)
DK (1) DK1771474T3 (en)
ES (1) ES2339789T3 (en)
IL (1) IL180725D0 (en)
MX (1) MX2007000784A (en)
NO (1) NO20070951L (en)
NZ (1) NZ552956A (en)
PT (1) PT1771474E (en)
RU (1) RU2392966C2 (en)
SI (1) SI1771474T1 (en)
WO (1) WO2006014729A2 (en)
ZA (1) ZA200701183B (en)

Families Citing this family (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6582959B2 (en) * 1991-03-29 2003-06-24 Genentech, Inc. Antibodies to vascular endothelial cell growth factor
US20050123925A1 (en) 2002-11-15 2005-06-09 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
WO2005007819A2 (en) * 2003-07-09 2005-01-27 Wisconsin Alumni Research Foundation Charge-dynamic polymers and delivery of anionic compounds
BRPI0513534A (en) 2004-07-20 2008-05-06 Genentech Inc protein similar to angiopoietin 4 inhibitors, combinations thereof, and their use
US8604185B2 (en) 2004-07-20 2013-12-10 Genentech, Inc. Inhibitors of angiopoietin-like 4 protein, combinations, and their use
KR20070061524A (en) 2004-07-20 2007-06-13 제넨테크, 인크. Compositions and methods of using angiopoietin-like 4 protein
ZA200705980B (en) 2005-01-07 2009-01-28 Lexicon Pharmaceuticals Inc Monoclonal antibodies against angiopoietin-like protein 4 (ANGPTL4)
US8734851B2 (en) * 2005-04-29 2014-05-27 Wisconsin Alumni Research Foundation Localized delivery of nucleic acid by polyelectrolyte assemblies
CN101802002B (en) 2006-04-07 2016-08-31 爱尔皮奥治疗有限公司 It binds to human protein tyrosine phosphatase β (HPTPβ) antibodies and uses thereof
US7622593B2 (en) 2006-06-27 2009-11-24 The Procter & Gamble Company Human protein tyrosine phosphatase inhibitors and methods of use
KR100962301B1 (en) * 2006-11-03 2010-06-11 재단법인서울대학교산학협력재단 Composition for treatment of cervix cancer
AU2007333735A1 (en) * 2006-12-19 2008-06-26 Genentech, Inc. VEGF-specific antagonists for adjuvant and neoadjuvant therapy and the treatment of early stage tumors
US8834918B2 (en) * 2007-01-22 2014-09-16 Wisconsin Alumni Research Foundation Modified multilayered film
CN101842095B (en) * 2007-07-02 2015-06-24 于明 Methods, composition, targets for combinational cancer treatments
WO2009049100A2 (en) 2007-10-09 2009-04-16 Wisconsin Alumni Research Foundation Ultrathin multilayered films for controlled release of anionic reagents
US8126437B1 (en) 2008-01-24 2012-02-28 Invent Again Ubiquitous voice messaging
US8324333B2 (en) 2008-06-05 2012-12-04 Wisconsin Alumni Research Foundation Anionic charge-dynamic polymers for release of cationic agents
DK2966091T3 (en) * 2008-07-16 2018-07-30 Baylor Res Institute Agonistic anti-CD40 antibodies
SI2361085T2 (en) 2008-11-22 2018-11-30 F. Hoffmann-La Roche Ag Use of anti-vegf antibody in combination with chemotherapy for treating breast cancer
NZ594537A (en) 2009-07-06 2014-01-31 Aerpio Therapeutics Inc Compounds, compositions, and methods for preventing metastasis of cancer cells
US20120207770A1 (en) 2009-10-14 2012-08-16 Nanyang Technological University Antiproliferative agent
US9475850B2 (en) 2010-06-05 2016-10-25 The Uab Research Foundation Methods for treatment of nephrotic syndrome and related conditions
US9139629B2 (en) * 2010-06-05 2015-09-22 The Uab Research Foundation Methods for treatment of nephrotic syndrome and related conditions
CA2803675A1 (en) * 2010-07-12 2012-01-19 Threshold Pharmaceuticals, Inc. Administration of hypoxia activated prodrugs and antiangiogenic agents for the treatment of cancer
WO2012088254A1 (en) 2010-12-22 2012-06-28 Genentech, Inc. Autophagy inducer and inhibitor combination therapy for the treatment of neoplasms
BR112014001430A2 (en) * 2011-07-22 2017-02-21 Pacylex Pharmaceuticals Inc Synthetic lethality and cancer treatment
US20140242084A1 (en) * 2011-08-08 2014-08-28 Nanyang Technological University Angiopoietin-Like 4 and Its Use in Modulating Cell Leakiness
AU2012323856B2 (en) 2011-10-13 2017-05-25 Aerpio Therapeutics, Inc. Methods for treating Vascular Leak Syndrome and cancer
JP6280546B2 (en) 2012-06-26 2018-02-14 デル マー ファーマシューティカルズ Dianhydro galactitol, diacetyl dianhydrosorbitol galactitol, dibromo nozzle sheet Torr, or using these analogs or derivatives, for the treatment of tyrosine kinase inhibitors resistance malignancies in patients with dysregulation or variant of a gene polymorphism or ahi1 way to
US20150210758A1 (en) * 2012-08-14 2015-07-30 Nanyang Technological University Angiopoietin-like 4 antibody and a method of its use in cancer treatment
US9259435B2 (en) 2012-08-31 2016-02-16 W. L. Gore & Associates, Inc. Reactive oxidative species generating materials and methods of use
SG10201703505VA (en) * 2012-10-30 2017-06-29 Pacylex Pharmaceuticals Inc Synthetic lethality and the treatment of cancer
KR101407730B1 (en) * 2012-11-23 2014-06-12 인하대학교 산학협력단 Composition for preventing or treating erectile dysfunction comprising Angiopoietin-4 protein
GB201301313D0 (en) * 2013-01-25 2013-03-06 Univ Singapore Respiratory Tract Infections
US20150050277A1 (en) 2013-03-15 2015-02-19 Aerpio Therapeutics Inc. Compositions and methods for treating ocular diseases
CN106456614A (en) 2014-03-14 2017-02-22 爱尔皮奥治疗有限公司 Hptp-beta inhibitors
SG11201700473QA (en) 2014-08-07 2017-02-27 Novartis Ag Angiopoietin-like 4 antibodies and methods of use
US9988443B2 (en) 2014-08-07 2018-06-05 Novartis Ag Angiopoetin-like 4 (ANGPTL4) antibodies and methods of use
CN106596979B (en) * 2017-02-28 2018-10-09 汉氏联合(天津)干细胞研究院有限公司 Detecting one kind of Parkinson's disease and kits for detecting method

Family Cites Families (149)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
US3896111A (en) 1973-02-20 1975-07-22 Research Corp Ansa macrolides
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4151042A (en) 1977-03-31 1979-04-24 Takeda Chemical Industries, Ltd. Method for producing maytansinol and its derivatives
US4137230A (en) 1977-11-14 1979-01-30 Takeda Chemical Industries, Ltd. Method for the production of maytansinoids
USRE30985E (en) 1978-01-01 1982-06-29 Serum-free cell culture media
FR2413974B1 (en) 1978-01-06 1982-12-03 David Bernard
US4265814A (en) 1978-03-24 1981-05-05 Takeda Chemical Industries Matansinol 3-n-hexadecanoate
US4307016A (en) 1978-03-24 1981-12-22 Takeda Chemical Industries, Ltd. Demethyl maytansinoids
JPS5562090A (en) 1978-10-27 1980-05-10 Takeda Chem Ind Ltd Novel maytansinoid compound and its preparation
US4256746A (en) 1978-11-14 1981-03-17 Takeda Chemical Industries Dechloromaytansinoids, their pharmaceutical compositions and method of use
JPS5566585A (en) 1978-11-14 1980-05-20 Takeda Chem Ind Ltd Novel maytansinoid compound and its preparation
JPS55102583A (en) 1979-01-31 1980-08-05 Takeda Chem Ind Ltd 20-acyloxy-20-demethylmaytansinoid compound
JPS55162791A (en) 1979-06-05 1980-12-18 Takeda Chem Ind Ltd Antibiotic c-15003pnd and its preparation
JPS55164685A (en) 1979-06-08 1980-12-22 Takeda Chem Ind Ltd Novel maytansinoid compound and its preparation
JPS55164687A (en) 1979-06-11 1980-12-22 Takeda Chem Ind Ltd Novel maytansinoid compound and its preparation
JPS55164686A (en) 1979-06-11 1980-12-22 Takeda Chem Ind Ltd Novel maytansinoid compound and its preparation
JPS6023084B2 (en) 1979-07-11 1985-06-05 Ajinomoto Kk
US4309428A (en) 1979-07-30 1982-01-05 Takeda Chemical Industries, Ltd. Maytansinoids
JPS6253158B2 (en) 1979-09-19 1987-11-09 Takeda Chemical Industries Ltd
JPH0115514B2 (en) 1979-09-21 1989-03-17 Takeda Chemical Industries Ltd
EP0028683A1 (en) 1979-09-21 1981-05-20 Takeda Chemical Industries, Ltd. Antibiotic C-15003 PHO and production thereof
WO1982001188A1 (en) 1980-10-08 1982-04-15 Takeda Chemical Industries Ltd 4,5-deoxymaytansinoide compounds and process for preparing same
US4450254A (en) 1980-11-03 1984-05-22 Standard Oil Company Impact improvement of high nitrile resins
US4419446A (en) 1980-12-31 1983-12-06 The United States Of America As Represented By The Department Of Health And Human Services Recombinant DNA process utilizing a papilloma virus DNA as a vector
US4313946A (en) 1981-01-27 1982-02-02 The United States Of America As Represented By The Secretary Of Agriculture Chemotherapeutically active maytansinoids from Trewia nudiflora
US4315929A (en) 1981-01-27 1982-02-16 The United States Of America As Represented By The Secretary Of Agriculture Method of controlling the European corn borer with trewiasine
JPH0114918B2 (en) 1981-05-20 1989-03-14 Takeda Chemical Industries Ltd
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
NZ201705A (en) 1981-08-31 1986-03-14 Genentech Inc Recombinant dna method for production of hepatitis b surface antigen in yeast
NZ201918A (en) 1981-09-18 1987-04-30 Genentech Inc N-terminal methionyl analogues of bovine growth hormone
US4640835A (en) 1981-10-30 1987-02-03 Nippon Chemiphar Company, Ltd. Plasminogen activator derivatives
US4601978A (en) 1982-11-24 1986-07-22 The Regents Of The University Of California Mammalian metallothionein promoter system
US4560655A (en) 1982-12-16 1985-12-24 Immunex Corporation Serum-free cell culture medium and process for making same
US4657866A (en) 1982-12-21 1987-04-14 Sudhir Kumar Serum-free, synthetic, completely chemically defined tissue culture media
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
DD266710A3 (en) 1983-06-06 1989-04-12 Ve Forschungszentrum Biotechnologie Process for the biotechnical production of alkaline phosphatase
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
US4767704A (en) 1983-10-07 1988-08-30 Columbia University In The City Of New York Protein-free culture medium
US4496689A (en) 1983-12-27 1985-01-29 Miles Laboratories, Inc. Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer
US4965199A (en) 1984-04-20 1990-10-23 Genentech, Inc. Preparation of functional human factor VIII in mammalian cells using methotrexate based selection
US4879231A (en) 1984-10-30 1989-11-07 Phillips Petroleum Company Transformation of yeasts of the genus pichia
EP0206448B1 (en) 1985-06-19 1990-11-14 Ajinomoto Co., Inc. Hemoglobin combined with a poly(alkylene oxide)
GB8516415D0 (en) 1985-06-28 1985-07-31 Celltech Ltd Culture of animal cells
US4676980A (en) 1985-09-23 1987-06-30 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Target specific cross-linked heteroantibodies
AU597574B2 (en) 1986-03-07 1990-06-07 Massachusetts Institute Of Technology Method for enhancing glycoprotein stability
US4927762A (en) 1986-04-01 1990-05-22 Cell Enterprises, Inc. Cell culture medium with antioxidant
GB8610600D0 (en) 1986-04-30 1986-06-04 Novo Industri As Transformation of trichoderma
US4791192A (en) 1986-06-26 1988-12-13 Takeda Chemical Industries, Ltd. Chemically modified protein with polyethyleneglycol
US5567610A (en) 1986-09-04 1996-10-22 Bioinvent International Ab Method of producing human monoclonal antibodies and kit therefor
IL85035D0 (en) 1987-01-08 1988-06-30 Int Genetic Eng Polynucleotide molecule,a chimeric antibody with specificity for human b cell surface antigen,a process for the preparation and methods utilizing the same
US5606040A (en) 1987-10-30 1997-02-25 American Cyanamid Company Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methyl-trithio group
US5770701A (en) 1987-10-30 1998-06-23 American Cyanamid Company Process for preparing targeted forms of methyltrithio antitumor agents
US5053394A (en) 1988-09-21 1991-10-01 American Cyanamid Company Targeted forms of methyltrithio antitumor agents
AU632065B2 (en) 1988-09-23 1992-12-17 Novartis Vaccines And Diagnostics, Inc. Cell culture medium for enhanced cell growth, culture longevity and product expression
GB8823869D0 (en) 1988-10-12 1988-11-16 Medical Res Council Production of antibodies
FR2646437B1 (en) 1989-04-28 1991-08-30 Transgene Sa New DNA sequences, their application as a sequence encoding a signal peptide for secretion of mature proteins by recombinant yeast expression cassettes, transformed yeasts and method of preparation of proteins corresponding
EP0402226A1 (en) 1989-06-06 1990-12-12 Institut National De La Recherche Agronomique Transformation vectors for yeast yarrowia
DE3920358A1 (en) 1989-06-22 1991-01-17 Behringwerke Ag Bispecific, oligo, mono- and oligovalent antikoerperkonstrukte, their production and use
DE69029036T2 (en) 1989-06-29 1997-05-22 Medarex Inc Bispecific reagents for AIDS Therapy
US5013556A (en) 1989-10-20 1991-05-07 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5208020A (en) 1989-10-25 1993-05-04 Immunogen Inc. Cytotoxic agents comprising maytansinoids and their therapeutic use
CA2026147C (en) 1989-10-25 2006-02-07 Ravi J. Chari Cytotoxic agents comprising maytansinoids and their therapeutic use
US5229275A (en) 1990-04-26 1993-07-20 Akzo N.V. In-vitro method for producing antigen-specific human monoclonal antibodies
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
DK0546073T3 (en) 1990-08-29 1998-02-02 Genpharm Int Making and using transgenic non-human animals capable of producing heterologous antibodies
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5661016A (en) 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5625126A (en) 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5122469A (en) 1990-10-03 1992-06-16 Genentech, Inc. Method for culturing Chinese hamster ovary cells to improve production of recombinant proteins
CA2095633C (en) 1990-12-03 2003-02-04 Lisa J. Garrard Enrichment method for variant proteins with altered binding properties
US5571894A (en) 1991-02-05 1996-11-05 Ciba-Geigy Corporation Recombinant antibodies specific for a growth factor receptor
US6582959B2 (en) 1991-03-29 2003-06-24 Genentech, Inc. Antibodies to vascular endothelial cell growth factor
US20030206899A1 (en) 1991-03-29 2003-11-06 Genentech, Inc. Vascular endothelial cell growth factor antagonists
WO1992020373A1 (en) 1991-05-14 1992-11-26 Repligen Corporation Heteroconjugate antibodies for treatment of hiv infection
LU91067I2 (en) 1991-06-14 2004-04-02 Genentech Inc Trastuzumab and its variants and derivatives chemical immuno including immotoxines
ES2136092T3 (en) 1991-09-23 1999-11-16 Medical Res Council Procedures for the production of humanized antibodies.
US5587458A (en) 1991-10-07 1996-12-24 Aronex Pharmaceuticals, Inc. Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof
WO1993008829A1 (en) 1991-11-04 1993-05-13 The Regents Of The University Of California Compositions that mediate killing of hiv-infected cells
DE69233528D1 (en) 1991-11-25 2005-07-14 Enzon Inc A process for the production of multivalent antigen-binding proteins
DE69334351D1 (en) 1992-02-06 2011-05-12 Novartis Vaccines & Diagnostic Biosynthetic binding protein for tumor markers
US5573905A (en) 1992-03-30 1996-11-12 The Scripps Research Institute Encoded combinatorial chemical libraries
ZA9302522B (en) 1992-04-10 1993-12-20 Res Dev Foundation Immunotoxins directed against c-erbB-2(HER/neu) related surface antigens
CA2140280A1 (en) 1992-08-17 1994-03-03 Avi J. Ashkenazi Bispecific immunoadhesins
JP3398382B2 (en) 1992-10-28 2003-04-21 ジェネンテク,インコーポレイテッド Vascular endothelial cell growth factor antagonists
RU2139731C1 (en) 1992-11-13 1999-10-20 Айдек Фармасьютикалс Корпорейшн (US Methods of treatment, antibodies, hybridoma
US5641756A (en) 1993-07-27 1997-06-24 Hybridon, Inc. Modified VEGF oligonucleotides
US5773001A (en) 1994-06-03 1998-06-30 American Cyanamid Company Conjugates of methyltrithio antitumor agents and intermediates for their synthesis
US5650490A (en) 1994-10-07 1997-07-22 Regeneron Pharmaceuticals, Inc. Tie-2 ligand 2
US5814464A (en) 1994-10-07 1998-09-29 Regeneron Pharma Nucleic acids encoding TIE-2 ligand-2
US5643755A (en) 1994-10-07 1997-07-01 Regeneron Pharmaceuticals Inc. Nucleic acid encoding tie-2 ligand
US5731168A (en) 1995-03-01 1998-03-24 Genentech, Inc. Method for making heteromultimeric polypeptides
IL117645A (en) 1995-03-30 2005-08-31 Genentech Inc Vascular endothelial cell growth factor antagonists for use as medicaments in the treatment of age-related macular degeneration
US5739277A (en) 1995-04-14 1998-04-14 Genentech Inc. Altered polypeptides with increased half-life
US5641870A (en) 1995-04-20 1997-06-24 Genentech, Inc. Low pH hydrophobic interaction chromatography for antibody purification
US5714586A (en) 1995-06-07 1998-02-03 American Cyanamid Company Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates
US5712374A (en) 1995-06-07 1998-01-27 American Cyanamid Company Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates
US20020137890A1 (en) 1997-03-31 2002-09-26 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20030170891A1 (en) * 2001-06-06 2003-09-11 Mcswiggen James A. RNA interference mediated inhibition of epidermal growth factor receptor gene expression using short interfering nucleic acid (siNA)
NZ500077A (en) 1997-04-07 2001-10-26 Genentech Inc Humanized antibodies to vascular endothelial growth factor (VEGF) and methods for their preparation.
US6884879B1 (en) 1997-04-07 2005-04-26 Genentech, Inc. Anti-VEGF antibodies
DE122007000021I1 (en) 1997-04-07 2007-05-24 Genentech Inc Anti-VEFG Antibodies
US20030207375A1 (en) 1997-10-24 2003-11-06 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20020032315A1 (en) 1997-08-06 2002-03-14 Manuel Baca Anti-vegf antibodies
US20030144498A1 (en) 2000-10-16 2003-07-31 Audrey Goddard TIE ligand homologues
US6348350B1 (en) 1997-09-19 2002-02-19 Genentech, Inc. Ligand homologues
AU1931599A (en) 1997-12-19 1999-07-12 Zymogenetics Inc. Angiopoietin homolog, dna encoding it, and method of making it
EP1058737A4 (en) 1998-03-02 2003-01-02 Millennium Pharm Inc Novel fdrg protein and nucleic acid molecules and uses therefor
EP1088071A4 (en) 1998-06-16 2005-03-02 Human Genome Sciences Inc 94 human secreted proteins
WO1999067382A2 (en) 1998-06-24 1999-12-29 Compugen Ltd. Angiopoietin-like growth factor sequences
WO2000003797A1 (en) 1998-07-15 2000-01-27 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Polyelectrolyte coverings on biological templates
US6375447B1 (en) 1998-09-29 2002-04-23 Cq Inc. Apparatus for dewatering and pelletizing particulate fuel
JP2000308488A (en) 1999-02-23 2000-11-07 Herikkusu Kenkyusho:Kk Protein which is related to blood vessel neogenesis and gene coding for the protein
AU3391200A (en) 1999-03-04 2000-09-21 Corixa Corporation Compositions and methods for breast cancer therapy and diagnosis
EP1175439A4 (en) 1999-04-09 2002-10-09 Human Genome Sciences Inc 49 human secreted proteins
JP2002541849A (en) 1999-04-16 2002-12-10 ジェネンテック・インコーポレーテッド Vascular endothelial growth factor mutants and their uses
US6703020B1 (en) 1999-04-28 2004-03-09 Board Of Regents, The University Of Texas System Antibody conjugate methods for selectively inhibiting VEGF
AU5979300A (en) 1999-07-02 2001-01-22 Bayer Aktiengesellschaft Angiopoietin-6 and uses thereof
WO2001005825A2 (en) 1999-07-16 2001-01-25 Hyseq, Inc. Nucleic acid sequences encoding putative angiopoietin proteins
US20030207348A1 (en) 1999-07-20 2003-11-06 Shimkets Richard A. Polypeptides and polynucleotides encoding same
WO2001005971A2 (en) 1999-07-20 2001-01-25 Curagen Corporation Secreted polypeptides and corresponding polynucleotides
US20040038230A1 (en) 2001-11-05 2004-02-26 Alsobrook John P. Therapeutic polypeptides, nucleic acids encoding same, and methods of use
WO2001053455A2 (en) 1999-12-23 2001-07-26 Hyseq, Inc. Novel nucleic acids and polypeptides
EP1285084A1 (en) 2000-01-25 2003-02-26 Hyseq, Inc. Novel nucleic acids and polypeptides
AU4314201A (en) 2000-02-03 2001-08-14 Hyseq Inc Novel nucleic acids and polypeptides
WO2002081628A2 (en) * 2001-04-05 2002-10-17 Ribozyme Pharmaceuticals, Incorporated Modulation of gene expression associated with inflammation proliferation and neurite outgrowth, using nucleic acid based technologies
CN1315451A (en) 2000-03-29 2001-10-03 上海博德基因开发有限公司 Polypeptide-human vascular formin-analogic factor 45 and polynucleotide for coding it
AU4992901A (en) 2000-04-07 2001-10-23 Millennium Pharm Inc Novel fdrg protein and nucleic acid molecules and uses therefor
AT363291T (en) 2000-06-23 2007-06-15 Bayer Schering Pharma Ag interfere compositions / VEGF with VEGF and angiopoietin / Tie receptor function
US6673545B2 (en) 2000-07-28 2004-01-06 Incyte Corporation Prostate cancer markers
CN1170850C (en) 2000-09-19 2004-10-13 上海市肿瘤研究所 Human angiogenin-like protein and coding sequence and application thereof
EP1385380A4 (en) 2001-03-27 2005-02-02 Human Genome Sciences Inc Human secreted proteins
US7667004B2 (en) * 2001-04-17 2010-02-23 Abmaxis, Inc. Humanized antibodies against vascular endothelial growth factor
DK1456360T3 (en) 2001-04-19 2015-08-31 Scripps Research Inst Methods and composition for the preparation of orthogonal tRNA-aminoacyl-tRNA syntetasepar
IL159153D0 (en) 2001-06-08 2004-06-01 Sankyo Co Methods for testing drugs for treating or preventing diseases such as hyperlipidemia
WO2003010205A1 (en) 2001-07-26 2003-02-06 Duke University Medical Center Genes induced by hypoxia
WO2003025138A2 (en) 2001-09-17 2003-03-27 Protein Design Labs, Inc. Methods of diagnosis of cancer compositions and methods of screening for modulators of cancer
WO2003040330A2 (en) 2001-11-05 2003-05-15 Curagen Corporation Therapeutic polypeptides, nucleic acids encoding same, and methods of use
EP1451578B1 (en) 2001-11-16 2013-08-21 Genentech, Inc. Use of angptl3 antagonists for the treatment of liver diseases
US20050239706A1 (en) 2003-10-31 2005-10-27 Washington University In St. Louis Modulation of fiaf and the gastrointestinal microbiota as a means to control energy storage in a subject
AU2002359464A1 (en) 2001-11-30 2003-06-17 Genvec, Inc. Angiopioetin related factors
EP2261250B1 (en) 2001-12-21 2015-07-01 Human Genome Sciences, Inc. GCSF-Albumin fusion proteins
US20050123925A1 (en) 2002-11-15 2005-06-09 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
US20050106667A1 (en) 2003-08-01 2005-05-19 Genentech, Inc Binding polypeptides with restricted diversity sequences
WO2005044853A2 (en) 2003-11-01 2005-05-19 Genentech, Inc. Anti-vegf antibodies
CA2499791A1 (en) 2004-03-30 2005-09-30 F. Hoffmann-La Roche Ag Angptl4/fiaf as marker for ppardelta modulation
KR20070061524A (en) 2004-07-20 2007-06-13 제넨테크, 인크. Compositions and methods of using angiopoietin-like 4 protein
BRPI0513534A (en) 2004-07-20 2008-05-06 Genentech Inc protein similar to angiopoietin 4 inhibitors, combinations thereof, and their use
ZA200705980B (en) 2005-01-07 2009-01-28 Lexicon Pharmaceuticals Inc Monoclonal antibodies against angiopoietin-like protein 4 (ANGPTL4)

Also Published As

Publication number Publication date
AT456579T (en) 2010-02-15
DE602005019167D1 (en) 2010-03-18
US7740846B2 (en) 2010-06-22
NO20070951L (en) 2007-04-20
EP2361931A1 (en) 2011-08-31
RU2392966C2 (en) 2010-06-27
WO2006014729A3 (en) 2007-01-04
CY1109931T1 (en) 2014-09-10
JP2008507536A (en) 2008-03-13
CA2574758A1 (en) 2006-02-09
CN101044164A (en) 2007-09-26
AU2005269716B2 (en) 2011-01-27
RU2007106076A (en) 2008-08-27
MX2007000784A (en) 2007-04-09
AU2005269716A1 (en) 2006-02-09
EP1771474B1 (en) 2010-01-27
BRPI0513534A (en) 2008-05-06
ES2339789T3 (en) 2010-05-25
JP2012017331A (en) 2012-01-26
SI1771474T1 (en) 2010-06-30
WO2006014729A2 (en) 2006-02-09
IL180725D0 (en) 2007-06-03
KR20070043010A (en) 2007-04-24
EP1771474A2 (en) 2007-04-11
CN102641503A (en) 2012-08-22
AU2011201436A1 (en) 2011-04-21
EP2361931B1 (en) 2017-12-06
KR101254815B1 (en) 2013-09-03
NZ552956A (en) 2010-03-26
ZA200701183B (en) 2008-05-28
EP2172482A1 (en) 2010-04-07
US20070026002A1 (en) 2007-02-01
JP4947717B2 (en) 2012-06-06
US20060093607A1 (en) 2006-05-04
DK1771474T3 (en) 2010-05-31

Similar Documents

Publication Publication Date Title
AU2005230848B2 (en) Humanized anti-TGF-beta antibodies
US9522186B2 (en) M-CSF specific monoclonal antibody and uses therof
RU2398777C2 (en) HUMANISED ANTI c-met ANTAGONISTS
US7811785B2 (en) Anti-VEGF antibodies
JP5809415B2 (en) The composition of the anti-vegf antibodies and methods
CN103893759B (en) Anti-vegf antibody
US20080292630A1 (en) Treatment with anti-vegf antibodies
JP5517619B2 (en) Prlr specific antibodies and uses thereof
US20050282233A1 (en) Multivalent antibody materials and methods for VEGF/PDGF family of growth factors
US8975381B2 (en) Anti-VEGF antibodies
CN102245208B (en) Immunoglobulin variants and uses thereof
JP5197376B2 (en) Neuropilin antagonist
AU2007319672B2 (en) Anti-DLL4 antibodies and methods using same
CN101939336B (en) AXL antibodies
JP5623272B2 (en) Anti-notch1nrr antibody and how to use it
JP6273212B2 (en) Cd47 antibodies and methods of use thereof
US8603987B2 (en) Monoclonal antibodies to fibroblast growth factor receptor 2
RU2380411C2 (en) Method for inhibition of hepatocyte proliferation, method for inhibition of hepatocyte cell adhesion and method for inhibition of biological activity angptl4 in hepatocytes or hepatocyte precursors
RU2547596C2 (en) Polyspecific antibodies
WO2005044853A2 (en) Anti-vegf antibodies
CN1863818B (en) Anti--vegf antibody
US20080014196A1 (en) Compositions and methods for modulating vascular development
KR20150027135A (en) Methods of treating cancer using pd-l1 axis binding antagonists and vegf antagonists
KR101862832B1 (en) Pan-her antibody composition
RU2609658C2 (en) Composition containing antibody