NZ622594B2

NZ622594B2 - Pyrazoloquinoline derivative

Info

Publication number: NZ622594B2
Application number: NZ622594A
Authority: NZ
Inventors: Koji Hagiwara; Yuki Ishihara; Yoshihiko Norimine; Nobuaki Sato; Yuichi Suzuki; Kunitoshi Takeda
Original assignee: Eisai R&D Management Co Ltd
Priority date: 2011-10-07
Filing date: 2012-10-04
Publication date: 2015-09-29

Abstract

The disclosure relates to a pyrazoloquinoline derivatives or pharmacologically acceptable salt of formula (I). These compounds have an inhibitory effect on PDE9 and may have use in treating Alzheimer's disease. Example compounds include: (-)-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-IHpyrazolo[4,3-c]quinolin-4(5H)-one, (S)-8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one (S)-7-(6-ethoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1Hpyrazolo[4,3-c]quinolin-4(5H)-one (S)-8-fluoro-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-I-(tetrahydrofuran-3-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one and (S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1Hpyrazolo[4,3-c]quinolin-4(5H)-one. -3-yl)-IHpyrazolo[4,3-c]quinolin-4(5H)-one, (S)-8-fluoro-7-(2-methoxy-4,6-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one (S)-7-(6-ethoxy-2,4-dimethylpyridin-3-yl)-1-(tetrahydrofuran-3-yl)-1Hpyrazolo[4,3-c]quinolin-4(5H)-one (S)-8-fluoro-7-(6-methoxy-2,4-dimethylpyridin-3-yl)-I-(tetrahydrofuran-3-yl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one and (S)-7-(2-methoxy-3,5-dimethylpyridin-4-yl)-1-(tetrahydrofuran-3-yl)-1Hpyrazolo[4,3-c]quinolin-4(5H)-one.

Description

FP1100 PTION Title ofInvention PYRAZOLOQUINOLlNE TIVE Technical Field The present ion relates to pyrazoloquinoline derivatives having inhibitory activity against phosphodiesterase 9 (PDE9), and phannacologically acceptable salts thereof, and pharmaceutical applications thereof.

Background Art Cyclic guanosine monophosphate (hereinafter, referred to as cGMP) functioning as a second messenger in cells is lmown to play an important role in various physiological ﬁmctions including learning and memory behaviors.

On the postsynaptic site ofthe brain neural circuits, nitrogen monoxide (hereinafter, referred to as NO) biosynthesized by a nitrogen monoxide synthetase activates a guanylate cyclase, which is a cGMP synthetase. The activated guanylate cyclase biosynthesizes cGMP from guanosine triphosphate. The cGMP activates a cGMP-dependent protein kinase nafter, referred to as PKG) to phosphorylate various ns ipating in synapse plasticity. The activation ofthe NO/cGMP/PKG cascade is known to participate in the induction of synapse plasticity (Long Term Potentiation; hereinafter, ed to as LTP) of the hippocampus known as a neural substrate for learning and memory behaviors (for e, see Non Patent Literature 1). Amedicine activating the signal transmission ofthe cascade is known to improve LTP ofthe hippocampus and the learning behavior ofanimals, while a medicine ting the cascade is known to exhibit the opposite action (Non Patent Literature 2). Therefore, from these ﬁndings, an increase in cGMP in the brain is anticipated to lead to an improvement oflearning and memory behaviors.

[0004] cGMP is metabolized to 5'—GMP having no PKG activation action by a phosphodiesterase nafter, ed to as PDE). The PDE is known to have 11 families, and PDE9 is known to metabolize speciﬁcally cGMP, and to be expressed in the brain, the , the small ine and the like (for example, see Non Patent Literature 3). That is, inhibition of PDE9 is anticipated to increase cGMP in brains. It is reported that a PDE9 inhibitor actually enhances hippocampus LTP, and improves the learning and memory behaviors in a novel-object recognition test/passive avoidance ng test or the like in animals (Non Patent Literature 4). Clinically, guanylate cyclase activity decreases and possibility of a decrease in the cGMP level is indicated in the superior temporal cortex of FPll00 Alzheimer’s e ts, (Non Patent ture 5). Therefore, the PDE9 has a possibility of having many close relations with pathologies of neurodegenerative diseases and psychiatric diseases, particularly with pathologies of cognitive dysﬁmctions and the like in the Alzheimer’s e, such as Alexander's disease, Alpers' disease, Alzheimer‘s e, arnyotrophic lateral sis (ALS; known as Lou Gehrig's disease or motor neuron disease), ataxia-telangiectasia, Batten's disease (known also as Spielmeyer—Vogt—Sjogren—Batten’s disease), Binswanger’s ia (subcortical angiosclerotic encephalopathy), bipolar disorder, bovine spongiform encephalopathy (BSE), Canavan's disease, chemotherapy induction dementia, Cockayne's syndrome, corticobasal degeneration, Creutzfeldt—Jakob's disease, depression, Down's syndrome, frontotemporal lobe degeneration (including frontotemporal dementia, semantic dementia and progressive nonﬂuent aphasia), Gerstmarm—Straussler—Scheinker’s e, glaucoma, Huntington's disease (chorea), HIV related dementia, hyperkinesis, Kennedy's disease, Korsakoﬂ’s syndrome (amnesic confabulation syndrome), Krabbe's disease, Lewy—bodies dementia, progressive logopenic aphasia, Machado—Joseph's disease (spinocerebellar ataxia type 3), multiple sclerosis, multiple atrophy (olivopontocerebellar atrophy), myasthenia gravis, Parkinson's disease, Pelizaeus—Merzbacher's e, Pick's disease, dementia ‘presenilis (slight cognitive impairment), primary lateral sclerosis, primary progressive aphasia, ion—induced dementia, Refsum's disease (phytanic acid storage disease), Sandhoﬂ's disease, Schilder's disease, phrenia, semantic ia, senile dementia, Shy-Drager syndrome, spinocerebellar ataxia, spinal muscle y, Steele-Richardson—Olszewsld's e (progressive supranuclear palsy), and vascular amyloidosis and vascular dementia (multiple infarct dementia).

Recently, the following compound has been known which has PDE9 inhibitory activity and has a purpose ofprevention or therapy of Alzheimer's disease (Patent Literature R2 (a; The above compound is a pyrazolopyrimidine derivative, and a compound having FP1100 a structure y diﬂ'erent from a pyrazoloquinoline skeleton.

On the other hand, as a compound having a pyrazoloquinoline skeleton, the following compound described in Patent Literature 2 is known (RQPMRE.3}:is); wherein a ringA is a benzene ring or the like; and R6 is a direct bond or the like.

However, a ring B in the above compound s a benzene ring or the like.

Although it is stated that the above compound has inhibitory activity against PDE4 and is used for various types ofinﬂammatory diseases, there is no description nor implication ofthe inhibitory activity against PDE9, and the like.

[0008] As compounds having PDE9 inhibitory activity, the following compounds described in Patent Literature 3 and Patent Literature 4 are known.

Any of the above compounds is a quinoxaline derivative, and is a compound having a structure totally ent from a pyrazoloquinoline on.

As a compound having a pyrazoloquinoline skeleton and having PDE9 inhibitory ty, the following compound described in Patent Literature 5 is known.

R4 ‘N/N R2 \ R6 R1 N o H (I) 553-00 wherein either R1 or R2 is a group represent by the formula “hr, (I I) Rb o The structure ofthe above compound is restricted in R1 and R2, thus the compound is a compound having a structure totally djﬂemnt from the compound of the present ion.

Citation List Patent Literature t Literature 1] W0 2008/139293 [Patent Literature 2] W0 2007/032466 [Patent Literature 3] W0 2008/072779 [Patent Literature 4] W0 2010/101230 [Patent Literature 5] W0 33144 Non Patent Literature

[0013] [Non Patent Literature 1] Domek-Lopacinska et a1., "Cyclic GMP metabolism and its role in brain physiology", J Physiol Pharmacol, vol. 56, Suppl 2: pp. 15-34, 2005 [Non Patent Literature 2] Wang X., "Cyclic GMP-dependent protein kinase and cellular signaling in the s system", J. Neurocem., v01. 68, pp. 443—456, 1997 [Non Patent Literature 3] Fisher et al., "Isolation and characterization A, a novel human cGMP-speciﬁc phosphodiesterase", J. Biol. Chem, vol. 273: pp. 15559- 1 5564, 1998 [Non Patent Literature 4] van der Staay et a1, "The novel selective PDE9 inhibitor BAY 73-6691 improves learning and memory in rodents", Neuropharmacology, vol. 55: pp. 908-918, 2008 [Non Patent ture 5] Bonkale et al., "Reduced nitric oxide responsive soluble guanylyl cyclase activity in the superior temporal cortex of patients with Alzheimer’s disease", Neurosci. Lett, vol 187, pp. 5-8, 1995 Summary ofInvention 3O Technical Problem It is an object of the present invention to provide a novel nd or cologically acceptable salt thereof having PDE9 inhibitory action, and a pharmaceutical composition containing the same, or to at least provide the public with a useful alternative.

Solution to Problem As a result of exhaustive studies to solve the above-mentioned problems, the present inventors have found a novel pyrazoloquinoline derivative or cologically acceptable salt thereof having PDE9 inhibitory action.

That is, the present invention relates to the following <1> to <20>. <1> A compound or pharmacologically acceptable salt thereof represented by the formula (I): wherein R1 is a hydrogen atom; R2 is an aromatic ring group selected from the group consisting of a phenyl group, a pyridinyl group, and a pyrimidinyl group, where the two atoms on the aromatic ring which are adjacent to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring each independently has a substituent selected from Group A1, and the other atoms on the aromatic ring independently ally have a substituent selected from Group B1; R3 is a hydrogen atom, or a fluorine atom; R4 is a hydrogen atom; R5 is an yl group, a dioxepanyl group, a tetrahydropyranyl group, or a tetrahydrofuranyl group ally having a methoxy group; R6 is a en atom; Group A1 consists of a halogen atom, a C1-6 alkyl group optionally having 1 to 3 halogen atoms, and a C1-6 alkoxy group; and Group B1 consists of a halogen atom, a cyano group, a C1-6 alkyl group optionally having 1 to 3 n atoms, a C1-6 alkoxy-C1-6 alkyl group, a C1-6 alkoxy group optionally having 1 to 3 halogen atoms, and a tetrahydropyranyl group, with the proviso that when R2 is a 3-pyridinyl group, the substituent at the 4- FP11—0553-00 position is a halogen atom, or a C1-6 alkyl group optionally having 1 to 3 halogen atoms. <2> The compound or pharmacologically acceptable salt thereof according to <1>, wherein R2 is an aromatic ring group ed ﬁom the group consisting of a phenyl group, a 3-pyridinyl group, a 4-pyridinyl group, and a midinyl group, where the two atoms on the ic ring which are adjacent to the carbon atom attached to the pyrazclo[4,3— c]quinoline ring each independently has a substituent selected ﬁom Group A2, and the other atoms on the aromatic ring independently optionally have a substituent selected from Group R5 is a 4-oxepanyl group, a 1,4—dioxepan—6—y1 group, a 3,4,5,6-tetrahydro-2H—3- l group, a 3,4,5,6-tetrahydro-2H—4—pyranyl group, or a 3-tetrahydroﬁnanyl group; Group A2 consists ofa chlorine atom, and a methyl group optionally having 1 to 2 ﬂuorine atoms, an ethyl group, a methoxy group, and an ethoxy group; and Group B2 consists of a ﬂuorine atom, a ne atom, a cyano group, a methyl group optionally having 1 to 3 ﬂuorine atoms, an ethyl group, a ymethyl group, a methoxy group optionally having 1 to 3 ﬂuorine atoms, an ethoxy group, an isopropyloxy group, and a 3,4,5,6-tet1ahydro-2H—4—pyranyl group. <3> The compound or pharmacologically acceptable salt thereof according to <2>, wherein R3 is a ﬂuorine atom. <3.1> The compound or pharmacologically acceptable salt thereof according to Q>, wherein R5 is a 3,4,5,6-tetrahydro-2H-4—pyranyl group, or a 3-tetrahydrofuranyl group. <4> The compound or pharmacologically acceptable salt thereof according to <1>, wherein R3 is a en atom; and R5 is a tetrahydropyranyl group, or a tetrahydroﬁiranyl group optionally having a methoxy group. <5> The nd or pharmacologically acceptable salt f according to <2>, wherein R3 is a hydrogen atom; and 3O R5 is a 3,4,5,6-tetrahydro—2H—3-pyranyl group, a 3,4,5,6—tetrahydro—2H—4—pyranyl group, or a 3-tetrahydrofuranyl group. <6> The compound or pharmacologically acceptable salt thereof according to <1>, wherein _ FP1100 R2 is an aromatic ring group selected from the group ting ofa phenyl group, a 3-pyridinyl group, and a 4-pyridinyl group, Where the two atoms on the aromatic ring which are adjacent to the carbon atom attached to the pyrazolo[4,3—c]quinoline ring each independently has a substituent selected from Group A3, and the other atoms on the aromatic ring independently optionally have a substituent selected ﬁom Group B3; R3 is a hydrogen atom; R4 is a hydrogen atom; R5 is a 3,4,5,6-tetrahydro—2H—4—pyranyl group, or a 3-tetrahydroﬁ1ranyl group; GroupA3 consists ofa methyl group, and a methoxy group; and Group B3 consists of a methyl group, a methoxy group, and a ymethyl group. <7> A compound or pharmacologically acceptable salt thereof selected from the following group: 1) 7-(6-methoxy—2,4-dimethy1pyridin—3-yl)(tetrahydro—2H—pyran—4—yl)—1H— pyrazolo[4,3-c]quinolin—4(SI-I)-one, 2) 7-(2—methoxy—4,6—dimethylpyridin—3-yl)—l-(tettahydro-2H—pyran—4—yl)—1H- pyrazolo[4,3-c]quinolin—4(5H)—one, 3) (S)(6-isopropyloxy—2,4-dimethylpyridin—3-yl)-1—(tetrahydroﬁnan—3-yl)—1H— pyrazolo[4,3-c]quinolin—4(SI-I)-one, 4) o(2-methoxy—4,6-dimethylpyridin—3-yl)-l—(tetrahydro-ZH—pyran—4—yl)— azolo[4,3-c]quinolin—4(5H)—one, ) l-(l ,4-dioxepanyl)-7—(2—methoxy—3,5—dimethylpyridin—4—yl)—lH- pyrazolo[4,3-c]quinolin—4(5H)—one, 6) 1-(l,4-dioxepany1)(2-methoxy—4,6-dimethylpy1idin—3-yl)-lH- pyrazolo[4,3-c]quinolin—4(SI-I)-one, 7) (S)ﬂuoro—7—(2—methoxy—3,5—dimethylpyridin—4—yl)—1-(telrahydroﬁ11an—3—yl)— 1H—pyrazolo[4,3-c]quinolin—4(51-I)—one, 8) 7-(2-methoxy-3,5-dimethy1pyridin—4—yl)—1 -(tetrahydro—2H—pyran—4-yl)—1H- lo[4,3-c]quinolin—4(SI-I)-one, 9) (-)(2-methoxy—4,6—dimethylpyridin—3-yl)(tetrahydroﬁnan—3-yl)-lH- pyrazolo[4,3-c]quinolin—4(5H)-one, ' ) (-)—7—(6-methoxy—2,4—dimethylpyridin—3-yl)-l—(te11ahydroﬁ1ran—3—yl)-1H- pyrazolo[4,3-c]quinolin—4(5H)—one, FP1100 1 1) ﬂuoro(2—methoxy—4,6-dimethylpyridin—3-yl)-l -(tetrahydroﬁ1ran—3-y1)- lH—pyrazolo[4,3-c]quinolin—4(5H)-one 12) (S)(6-eﬂ10xy—2,4—dimethylpyridin—3-yl)-l-(tettahydroﬁnan—3-yl)-1H- pyrazolo[4,3-c]quinoljn-4(5H)-one 1 3) (S)ﬂuoro-7—(6-methoxy-2,4—dimethylpyﬁdin—3-yl)-l -(tetrahydroﬁ1ran—3-yl)- 1H—pyrazolo[4,3-c]quinolin—4(5H)—one and 14) (S)(2-methoxy—3,S—dimethylpyﬁdjnyl)(tetrahydroﬁ1ran—3—yl)—1H— pyrazolo[4,3-c]q11jrlolin-4(51-I)-one. <8> 7-(6—isopropyloxy—2,4-dimethylpyridinyl)(tetrahydroﬁ1ran—3-yl)—1H- pyrazolo[4,3-c]quinolin—4(5H)—one or a pharmacologically acceptable salt thereof. <9> (S)—7-(6-isopropyloxy—2,4-dimeﬂ1ylpyridin—3-yl)-l-(tetxahydroﬁ1ran—3—yl)-1H- pyrazolo[4,3—c]quinoljn-4(5H)—one or a phaxmacologically acceptable salt thereof <1O> 8-ﬂuoro(2-methoxy—3,5-djmethylpyridjnyl)-1 —(tetrahydroﬁ1ran—3-yl)-1H— pyrazolo[4,3—c]quinoljn-4(SI-I)-one or a pharmacologically acceptable salt thereof. <11> (S)ﬂuom(2—methoxy—3,5—dimetl1ylpyridin—4—yl)— 1-(tetrahydroﬁ1ran—3-yl)—1H- pyrazolo[4,3-c]qujnoljn-4(5H)-one or a pharmacologically acceptable salt thereof: <12> 7-(2-methoxy—3,5-dimethylpy1idin—4—yl)— l -(tettahydroﬁnan—3-yl)- 1H- pyrazolo[4,3—c]quinolin—4(51-I)-one or a pharmacologically acceptable salt f. <13> (2-methoxy—3,5-dimeﬂ1ylpyridin—4—yl)— l -(tetrahydroﬁ11an—3-y1)-1H- pyrazolo[4,3—c]qujnolin-4(SI-I)-one or a pharmacologically able salt thereof: FPll00 <14> 1-(1,4-dioxepan—6-y1)(2-methoxy—3,5-dimethylpy1idin—4—yl)—1H—pyrazolo[4,3— c]quinolin—4(5H)—one or a pharmacologically able salt thereof: <14. l> 8—ﬂuoro(6-meﬂ10xy—2,4—djmethylpyridjn—3—yl)-l —(tetrahydroﬁ1tan—3—yl)—1H— pyrazolo[4,3—c]quinolin—4(SI-I)—one or a pharmacologically acceptable salt Thereof. <14.2> (S)ﬂuoro-7—(6-methoxy-2,4—djmethylpyridin-3—y1)—1-(tehahydroﬁ1ran—3-yl)—1H— pyrazolo[4,3-c]quinolin—4(5H)—one or a phannacologically acceptable salt thereof: <14.3> 8-ﬂuoro-7—(2-methoxy—4,6—dimeﬂ1ylpyridin—3—yl)-l-(tetrahydroﬁJran—3—yl)-1H- pyrazolo[4,3-c]quinoljn-4(5H)—one or a pharmacologically acceptable salt thereof. <l4.4> (S)ﬂuoro(2-metl10xy—4,6-djmeﬂ1ylpy1idi11yl)(tetrahydroﬁnan—3-yl)—1H— pyrazolo[4,3-c]qujnohn-4(SI-I)-one or a cologically able salt thereof: <14.5> 7—(6-eﬂ10xy—2,4—dimeﬂ1ylpyﬁdin—3-y1)(tettahydrofuran—3-yl)-1H-pyrazclo[4,3- c]quinolin—4(SI-I)-one or a pharmacologically acceptable salt thereof. <14.6> (S)(6-ethoxy-2,4—dimethylpyridjnyl)-1 -(tetrahydroﬁ1ran—3-y1)—1H— FPll00 pyrazolo[4,3-c]quinolin—4(51-I)—one or a pharmacologically acceptable salt thereof: <15> A pharmaceutical composition comprising ﬂie compound or pharmacologically able salt faccording to <1> as an active ingredient. <16> The pharmaceutical composition according to <15> which is a PDE9 inhibitor. <17> The ceutical composition according to <15> for increasing the intracerebral cGMP concentration <18> A ive ment improving agent in Alzheimer’s disease, comprising the compound or pharmacologically acceptable salt thereofaccording to <l>. <19> Amethod for improving cognitive ment in mer’s disease, sing administering the compound or pharrnacologically acceptable salt thereof according to <l> to a patient <20> The compound or pharmacologically acceptable salt thereof according to <l> for use for improving cognitive impairment inAlzheimer's disease.

Advantageous Eﬁ‘ects ofInvention The pyrazoloquinoline derivative Grereinaﬁer, referred to as a compound (1)) represented by the formula (I) or pharrnacologically acceptable salt thereof according to the present invention has PDE9 inhibitory action as shown in activity data in Pharmacological Test Example described later. The compound (1) according to the present invention mostly exhibits an IC50 value of 1,000 nM or below as the PDE9 inhibitory action, and a compound exhibiting an IC50 value of 100 nM or belOw is preferable.

The compound (1) according to the present invention has PDE9 inhibitory action, so that the intracerebral cGMP concentration is pated to be elevated. The PDE9 inhibitory action and the increase in cGMP lead to the improvement oflearning and memory behaviors, and the compound (I) has a potential use of a therapeutic agent for cognitive dysfunctions and the like inAlzheimer’s disease.

BriefDescription ofDrawings Figure 1 is a View g a three-dimensional ure obtained by X-ray diﬂiraction ofthe compound obtained in Preparation Example 53.

FP1100 Description ofEmbodiments Hereinafter, the content ofthe present invention will be bed in detail.

Throughout the present speciﬁcation, the structural formulas for the compounds will show only one speciﬁc isomer for convenience, but the invention includes all isomers such as geometric isomers, optical s, stereoisomers and tautomers implied by the compound structures, as well as their isomer mixtures, and the compounds may ore be any ofthe s or mixtures thereofin any desired proportion, Without being limited to the formulas that are shown for convenience. Thus, for example, the compounds of the invention may exist as optically active forms or racemic mixtures, all ofwhich are included Without limitations according to the ion, and whether racemic mixtures or lly active forms, they may be used as mixtures with the optically active forms in any desired proportion. It will be tood, however, that some isomers or racemates or other mixtures ofisomers may t more activity than others.

Polymorphic crystals may also exist, and there may be used any crystal form or a mixture thereofwithout any restrictions, as well as amorphous forms, and the compounds of the invention also include both anhydrate and solvate ially hydrate).

Compounds of the compound (1) labeled with isotopes are also included in the present invention. A nd labeled with an isotope is the same as the compound (1), except that one or more atoms are replaced by atoms having atomic masses or mass numbers diﬂ‘erent from those usually found in the natural world. es which can be incorporated in the nd ing to the present invention are isotopes of, for example, hydrogen, , nitrogen, oxygen, ﬂuorine, phosphorus, sulﬁJr, iodine, and chlorine, and include 2H, 3H, 11C, 14C, rsN, 180, 18F, 32R 358, 123I and 1251.

The above e-labeled compounds, for example, compounds in which radioisotopes such as 3H, and/or 14C are incorporated, are useﬁJl for the tissue distribution assay ofmedicines and/or substrates. 3H and 14C are considered to be useful for ease ofthe preparation and detection thereof. Isotopes 11C and 18F are considered to be useﬁll for PET (positron-emission tomography); and an isotopes 12SI is considered to be useful for SPECT (single photon emission computed tomography); and all are useﬁrl for brain imaging. The replacement by a heavier isotope such as 2H causes some type of eutic advantages including an increase in the in-Vivo half-life period or a decrease in the necessary dose due to higher metabolic stability, and therefore, is considered to be useﬁJl under some situation.

The above isotope-labeled compounds can be similarly prepared by carrying out procedures FP11—0553-00 disclosed in the following es by using reagents labeled with isotopes easily utilizable in place ofreagents not labeled with an isotope.

Hereinaﬁer, the meanings of terms, symbols and the like described in the present cation will be bed, and the present invention will be described in detail.

A "halogen atom" in the present speciﬁcation means a ﬂuorine atom, a chlorine atom, a bromine atom or an iodine atom. Suitable examples ofthe "halogen atom" include a ﬂuorine atom and a chlorine atom.

A "Cl-6 alkyl group" in the present speciﬁcation means a straight-chain or branched—chain alkyl group having 1 to 6 carbon atoms, and speciﬁc examples include a methyl group, an ethyl group, a l-propyl group, a isopropyl group, a 2-methyl-1—propyl group, a 2-methylpropyl group, a l-butyl group, a 2-butyl group, a l-pentyl group, a 2- pentyl group, a 3-pentyl group, a l—hexyl group, a 2-hexyl group and a 3-hexyl group.

A "Cl-6 alkoxy group" in the present speciﬁcation means an oxygen atom to which a "Cl—6 alkyl group" deﬁned in the above is attached, and c examples include a methoxy group, an ethoxy group, a isopropyloxy group, a l-pentyloxy group and a lhexyloxy group.

A "Cl-6 alkoxy—Cl-6 alkyl group" in the present speciﬁcation means a "Cl—6 alkyl group" deﬁned in the above to which a "Cl-6 alkoxy group" deﬁned in the above is ed, and speciﬁc examples include a ymethyl group, a l-methoxyethyl group, a 2- methoxyethyl group, a l-methoxypropyl group, a 2-methoxypropyl group, a 3- methoxypropyl group, a oxy—2—propyl group, a (l —propyloxy)methyl group, an (isopropyloxy)methyl group, a l—(l—propyloxy)ethyl group, a 2—0 loxy)ethyl group, a l-(isopropyloxy)ethyl group, a 2-(isopropyloxy)ethyl group, a l-(l-propyloxy)propyl group, a 2-(l-pr0pyloxy)propyl group, a 3-(l-propyloxy)propyl group, a 2-(l—propyloxy)-2—propyl group, a l-(isopropyloxy)propyl group, a 2-(isopropyloxy)propyl group, a 3- (isopropyloxy)propyl group, and a propyloxy)-2—propyl group.

In the deﬁnition ofR2, " an aromatic ring group selected from the group consisting of a phenyl group, a pyridinyl group, and a pyrimidinyl group, where the two atoms on the aromatic ring which are adjacent to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring each independently has a substituent ed ﬁom Group Al, and the other atoms on the aromatic ring independently optionally have a substituent selected ﬁom Group Bl " means: FP1100 \X2 \ R2= II Rx3/ \X4/ Rx5 ILX4 wherein X2 to X4 is a carbon atom or a nitrogen atom to form a phenyl group, a pyridinyl group, or a pyrimidinyl group; when Xn (n = 2 to 4) is a nitrogen atom, RXII is not present; and when Xn (n = 2 to 4) is a carbon atom, Rxn is a hydrogen atom or a substituent selected from Group B1, and RXI and RXS is independently a substituent selected from Group A1.

The deﬁnitions of R1 to R6 of the compound represented by the formula (I), and preferable examples will be described hereinafter.

R1 is a hydrogen atom.

R2 is an aromatic ring group selected ﬁom the group consisting of a phenyl group, a pyridinyl group, and a pyrimidinyl group, where the two atoms on the aromatic ring which are nt to the carbon atom attached to the pyrazolo[4,3—c]quinoline ring each independently has a substituent selected from Group Al, and the other atoms on the aromatic ring independently optionally have a substituent selected ﬁrom Group B1.

R2 is preferably an aromatic ring group selected from the group ting of a phenyl group, a dinyl group, a dinyl group, and a 5—pyrimidinyl group, where the two atoms on the aromatic ring which are adjacent to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring each independently has a substituent ed ﬁom Group A2, and the other atoms on the aromatic ring independently optionally have a substituent selected ﬁom Group B2 R2 is more preferably an aromatic ring group selected from the group consisting of a phenyl group, a 3-pyridinyl group, and a 4-pyridinyl group, where the two atoms on the aromatic ring which are adjacent to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring each independently has a substituent selected from Group A3, and the other atoms on the aromatic ring ndently optionally have a substituent selected from Group B3.

R3 is a hydrogen atom, or a ﬂuorine atom.

FP1100 R4 is a hydrogen atom.

R5 is an oxepanyl group, a dioxepanyl group, a tetrahydropyranyl group, or a tetrahydrofuranyl group optionally having a methoxy group.

R5 is ably a 4-oxepanyl group, a 1,4-dioxepanyl group, a 3,4,5,6— tetrahydro—ZH—3—pyranyl group, a 3,4,5,6—tetrahydro—2H—4—pyranyl group, or a 3— tetrahydroﬁnanyl group, and more preferably is a 3,4,5,6-tetrahydro-2H—4—pyranyl group, or a 3-tetrahydroﬁiranyl group.

R6 is a hydrogen atom.

Group Al consists ofa n atom, a Cl-6 alkyl group optionally having 1 to 3 halogen atoms, and a Cl-6 alkoxy group.

Group B1 consists ofa halogen atom, a cyano group, a C1—6 alkyl group optionally having 1 to 3 halogen atoms, a Cl-6 alkoxy-Cl-G alkyl group, a Cl-6 alkoxy group optionally having 1 to 3 halogen atoms, and a ydropyranyl group.

Group A2 consists of a chlorine atom, and a methyl group optionally having 1 to 2 ﬂuorine atoms, an ethyl group, a y group, and an ethoxy group.

Group B2 consists of a ﬂuorine atom, a chlorine atom, a cyano group, a methyl group optionally having 1 to 3 ﬂuorine atoms, an ethyl group, a methoxymethyl group, a methoxy group optionally having 1 to 3 ﬂuorine atoms, an ethoxy group, an isopropyloxy group, and a 3,4,5,6-tetrahydro—2H—4-pyranyl group.

Group A3 consists ofa methyl group, and a methoxy group.

Group B3 consists of a methyl group, a methoxy group, and a ymethyl group.

A "pharmacologically acceptable sal " in the present speciﬁcation is not especially limited as long as a salt formed with the compound according to the present invention, and speciﬁc examples include inorganic acid salts, organic acid salts, inorganic base salts, organic base salts, and acidic or basic amino acid salts.

If only a "pharmacologically acceptable sal " in the present cation is a salt formed in a suitable ratio unless there is any especially limiting description, the number of acid molecules per one molecule of the compound in a formed salt, although being not especially limited, is preferably about 0.1 to about 5 molecules, more preferably about 0.5 to about 2 molecules, and still more preferably about 0.5, about 1 or about 2 les, per one molecule ofthe compound Preferable es ofinorganic acid salts e hydrochlorides, hydrobromides, 553-00 es, nitrates and phosphates, and preferable examples of organic acid salts include acetates, succinates, ﬁimarates, maleates, tartrates, citrates, lactates, stearates, benzoates, methanemﬂfonates, enesulfonates and benzenesulfonates.

Preferable examples of inorganic base salts include alkaline metal salts such as sodium salts and potassium salts, ne earth metal salts such as m salts and magnesium salts, aluminum salts, and ammonium salts, and preferable examples of organic base salts include lamine salts, diethanolamine salts, meglumine salts and N,N'- dibenzylethylenediamine salts.

Preferable examples of acidic amino acid salts include ates and glutamates, and preferable examples of basic amino acid salts include arginine salts, lysine salts and omithine salts.

[General production methods] The compound according to the present invention can be produced by methods described in the below. However, production methods of the nd according to the present invention are not limited thereto.

The compound (1) according to the present invention can be produced by the following production methods A, B. C and D. <Production MethodA> O—\ Step A-1 O _ X2 1) \N_<O R1 / O O— X1 R4 R3 lRS‘MINHZ a—1_ Step A-4 N R1 wherein R1, R3, R4, R5 and R6 each have the same deﬁnitions as the above deﬁnitions; P1 means a protecting group ofan NH group, such as 2,4—dimethoxybenzyl group; and X1 and X2 denote a halogen atom 0040 S A—l This step is a step of condensation reaction of a compound represented by the FPll00 formula 2L1 (referred to as a compound a—l in some cases; hereinafter, the same applies) with DMF-DMA, and thereaﬂer allowing the resultant to react with a ine derivative a;2_ to structure a pyrazole ring to thereby obtain a compound a—3, by a well—known . The present reaction may be carried out in a gas ﬂow or an atmosphere of an inert gas such as nitrogen or argon.

The nd a;l can be synthesized according to a well—known method (for e, the description in Reurnan, Michael et al., al cinal Chemistry”, 1995, vol. 38, p. 2531-2540, or Wentland Mark P et al., ”Journal of Medicinal Chemistry", 1993, vol. 36, p. 1580-1596).

[0041] This step can be canied out speciﬁcally with reference to the reaction condition, post—reaction operation, purifying method and the like described in Preparation Examples 1, 2, 3, 4, 5, 6, 10 and 11 described later and the like.

As the compound 6:2: a commercially available one as it is may be used, or may be synthesized by means well-known by those skilled in the art. The compound can be produced by converting a corresponding ketone derivative to a hydrazideirnine, and reducing the hydrazideirnine using borane, sodium orohydride or the like. The nd a—g may also be used in a form a salt such as a hydrochloride.

With respect to a solvent used in the present on, in the condensation reaction of the compound L1 with DMF—DMA, the DMF-DMA can be used in 5 to 20 times molar equivalent as a reaction agent and concurrently solvent. A solvent used in the successive pyrazole ring formation reaction with the hydrazine derivative a;2 is not especially limited as long as it is a solvent which dissolves reaction starting raw materials to some degree, and does not inhibit the reaction, but is suitably methanol, ethanol, n-butanol, t—butanol, THF, 1,4- dioxane, water or amixed solvent thereof, and more suitably ethanol.

[0043] The reaction temperature usually s on starting raw materials, solvents to be used, and other reagents and the like used in the reaction. In the sation reaction of the compound £1 with A, the reaction temperature is suitably 0°C to a reﬂux ature ofthe solvent (internal temperature ofa reaction vessel), and more suitably room temperature. In the successive le ring formation reaction with the hydrazine tive a;2_, the reaction temperature is suitably room temperature to a reﬂux temperature ofthe solvent (internal temperature of a reaction vessel), and more suitably 70°C to a reﬂux temperature ofthe solvent.

The reaction time usually depends on starting raw materials, solvents to be used, FP1100 and other ts and the like used in the reaction In the condensation reaction of the compound £1 with DMF—DMA, the reaction time is suitably 0.5 to 24 hours, and more suitably 1 to 3 hours, at the above ature after the addition of the reagents. In the successive pyrazole ring formation reaction with the hydrazine derivative L2, the reaction time is suitably 0.5 to 24 hours, and more suitably 1 to 8 hours, at the above temperature aﬁer the addition ofthe reagents. 0045 S A—2 This step is a step of hydrolyzing the compound a;3 in the presence of a base to thereby obtain a compound 2:4-

[0046] A solvent used in the present reaction is not especially limited as long as it is a t which dissolves starting raw materials to some degree, and does not inhibit the reaction, but suitably includes methanol, ethanol, n—butanol, t-butanol, THF, 1,4-dioxane, water or mixed solvents thereof.

The base depends on starting raw materials, solvents to be used and the like, and is not especially limited, but examples thereof include sodium hydroxide, lithium ide, potassium hydroxide, lithium carbonate, sodium carbonate, potassium carbonate, sodium hydrogencarbonate, ium carbonate, cesium carbonate, lithium tetrameﬂrylsilyl oxide (TMSOLi). Abase can be used in 1 to 10 times molar equivalent with respect to the a.

The reaction temperature y s on starting raw materials, solvents to be used, and other ts and the like used in the reaction, and is suitably 0°C to a reﬂux temperature ofthe solvent (internal temperature ofa reaction vessel), and more suitably room temperature to 50°C.

The reaction time usually depends on ng raw als, solvents to be used, and other reagents and the like used in the on, and is suitably 1 to 48 hours, and more suitably 2 to 12 hours, at the above temperature after the addition ofthe reagents. 0050 S A—3 This step is a step of allowing the compound aﬂ to react with an amine derivative aﬁ by using a sing agent to thereby obtain a compound L6. The t reaction may be carried out also in a gas ﬂow or an atmosphere of an inert gas such as nitrogen or argon.

This step can be canied out speciﬁcally with reference to the reaction condition, post-reaction operation, purifying method and the like described in Preparation Example 1, 2, 4 and 5 described later and the like.

FP1100 The condensing agent depends on starting raw materials, ts to be used and the like, and is not especially limited, but DCC, EDC, PYBOP, CD1 and the like can be used.

A condensing agent can be used in l to 5 times molar lent, and suitably 1 to 2 times molar equivalent, with respect to the compound 2L4 A solvent used in the present reaction is not especially limited as long as it is a solvent which ves starting raw materials to some degree, and does not inhibit the reaction, but ly includes THF, dichloromethane, DMF or mixed solvents f.

The amine derivative 35 can be used in 1 to 10 times molar equivalent, and is suitably in 1 to 2 times molar equivalent, with respect to the compound a;4.

[0055] The reaction temperature usually depends on starting raw materials, solvents to be used, and other reagents and the like used in the reaction, and is suitably 0°C to a reﬂux temperature ofthe solvent (internal temperature of a reaction vessel), and more suitably 0°C to room temperature.

The reaction time usually depends on starting raw materials, solvents to be used, and other reagents and the like used in the reaction. After the on of the condensing agent to the nd 2L4, the reaction is carried out suitably for 1 to 48 hours, and more suitably 1 to 3 hours, at the above temperature, and thereafter the amine tive a;5 is added and the on is carried out at the above temperature for 1 to 48 hours, and more suitably for 8 to 15 hours. 005 A—4 This step is a step of intrarnolecularly cyclizing the compound a;6_ in the presence ofa base to thereby obtain a compound 51-1 The present reaction may be carried out also in a gas ﬂow or an here ofan inert gas such as nitrogen or argon.

This step can be carried out speciﬁcally With nce to the reaction condition, post-reaction operation, purifying method and the like described in Preparation Example 1, 2, 4 and 5 described later and the like.

A solvent used in the present reaction is not especially limited as long as it is a solvent which dissolves starting raw materials to some degree, and does not inhibit the reaction, but suitably includes THF, DMF or mixed solvents thereof.

[0060] The base, in the case of being used in the reaction, depends on starting raw materials, solvents to be used and the like, and is not especially limited, but examples thereof include bases such as sodium hydroxide, KTB, LDA, LHMDS, sodium hydride and potassium hydride; but preferable is sodium ide, KTB, sodium hydride or the like.

FP11-0553—00 A base can be used in 1 to 5 times molar equivalent, and preferably 1 to 3 times molar equivalent, with respect to the compound a;6.

The reaction temperature usually depends on starting raw materials, solvents to be used, and other reagents and the like used in the on, and is suitably -78°C to a reﬂux temperature of the solvent (internal temperature of a reaction vessel), and more suitably - °C to room temperature.

The on time usually depends on starting raw materials, solvents to be used, and other reagents and the like used in the reaction, and is suitably 1 to 48 hours, and more ly 1 to 5 hours, at the above ature.

[0063] <Production Method B> 0 R6 I \ R1 IN [‘25 R2 R4 R3 (I) wherein R1, R2, R3, R4, R5, R6 and P1 each have the same ions as the above deﬁnitions; X1 and X3 means a halogen atom and M means -BF3'K+, —B(OH)2, a group represented by the formula: or the like.

, —Sn(n-Bu)3, -ZnBr, -ZnCl, 0064 Ste B-l This step is a step of subjecting a compound 2:7 and a compound b;1 to a coupling reaction using a transition metal catalyst to thereby convert them to a compoundbﬁ.

FP1100 This step can be canied out speciﬁcally with reference to the reaction condition, post-reaction operation, purifying method and the like described in Examples 1, 2 and 3 described later and the like.

The nd a;7 can be obtained by <Production MethodA> or the like.

The present reaction may be carried out also in a gas ﬂow or an atmosphere of an inert gas such as nitrogen or argon.

A solvent used in the present reaction is not especially limited as long as it is a solvent which dissolves starting raw materials to some degree, and does not inhibit the on; but examples thereofinclude alcoholic solvents such as methanol or ethanol, etheric solvents such as THF, DME, MTBE, 1,4-dioxane, entyl methyl ether, diethyl ether, diisopropyl ether, l ether and dicyclopentyl ether, aromatic hydrocarbon-based solvents such as benzene, toluene, xylene and mesitylene, amide-based solvents such as DMF and NMP, aliphatic arbon-based solvents such as heptane and hexane, water, or mixed solvents thereof; suitable is an aromatic hydrocarbon-based solvent, an amide-based solvent such as DMF or NMP, an etheric solvent such as 1,4-dioxane, water, or a mixture thereof, and more suitable is a mixed solvent ofDMF, NMP or 1,4-dioxane with water.

The base s on starting raw materials, solvents to be used and the like, and is not especially limited, but examples thereof e inorganic bases such as lithium hydroxide, sodium hydroxide, potassium hydroxide, lithium carbonate, sodium carbonate, potassium carbonate, sodium encarbonate, potassium hydrogencarbonate, tripotassium phosphate n—hydrate, cesium carbonate, cesium ﬂuoride and potassium ﬂuoride, and organic bases such as imidazole, pyridine, TEA and DIPEA; and able are TEA, cesium carbonate and the like. Potassium hydrogenﬂuoride may also be added.

The transition metal catalyst depends on starting raw als, solvents to be used and the like, and is not especially limited as long as not inhibiting the reaction, but suitably includes Pd(PPh3)4, PPh3)2, palladium (II) acetate/triphenylphosphine, palladium (II) acetate/Z-dicyclohexylphosphino-Z',4',6'-triisopropy1biphenyl, palladium (II) acetate/bis[2- (diphenylphosphino)pheny1]ether, palladium (ll) chloride, Pd2(dba)3/tri-t-butylphosphine, Pd2(dba)3, Pd(t-Bu3P)2, [(t-Bu)2P(OH)]2PdC12, and 1,1'—bis(diphenylphosphino)ferrocene dichloropalladiurn (II). Depending on a transition metal catalyst to be used, use ofa copper (II) iodide, lithium de or the like in combination thereof gives good s such as an improvement in the yield and a reduction in the reaction time in some cases.

The on ature usually depends on starting raw als, solvents, and FP11-0553—00 other reagents used in the reaction, and is suitably 0°C to a reﬂux temperature ofthe solvent (internal temperature of a reaction vessel), and more suitably 60 to 150°C. Use of a ave reaction apparatus gives good results such as an improvement in the yield and a reduction in the on time in some cases.

The reaction time usually depends on starting raw materials, solvents, other reagents used in the on, and the reaction temperature, and is suitably 1 to 48 hours, and more suitably 1 to 6 hours, at the above temperature after the addition ofthe reagents.

The compoundE can be used in l to 5 times molar equivalent, and is suitably in l to 3 times molar equivalent, with respect to the compound a—_7.

[0072] The base can be used in l to 10 times molar equivalent, and is ly in 2 to 5 times molar equivalent, with respect to the compound a—_7, The transition metal catalyst can be used in 0.05 to 1 time molar equivalent, and is suitably in 0.05 to 0.1 times molar equivalent, with respect to the compoundﬂ.

S_telﬂ3_-2 This step is a step of converting a compound 6:7 and bis(pinacolato)diboron or the like to a compound b—_2 by ng reaction using a transition metal catalyst. cally, this step can be performed with reference to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later- bed Preparation Examples 1, 3, 4, 5 and 6 and the like.

The compound a;7 can be obtained by the <Preparation MethodA> or the like.

This reaction can also be performed in a stream or atmosphere ofan inert gas such as nitrogen or argon.

The solvent used in this reaction is not particularly d unless it can dissolve the starting material to a certain extent and does not inhibit the reaction. Examples include ether solvents such as THE, DME, MTBE, 1,4—dioxane, cyclopentyl methyl ether, diethyl ether, diisopropyl ether, dibutyl ether and dicyclopentyl ether, aromatic hydrocarbon solvents such as benzene, toluene, xylene and mesitylene, amide solvents such as DMF and NMP, and aliphatic hydrocarbon solvents such as heptane and . Aromatic hydrocarbon solvents, amide solvents such as DMF and NMP, or ether ts such as DME and 1,4— dioxane, or mixed solvents f are preferred, and DMF, NMP or 1,4-dioxane, or mixed solvents fare more preferred.

The base varies according to the starting material, the solvent used and the like and is not particularly limited. Examples include inorganic bases such as potassium acetate, FP11—0553-00 lithium hydroxide, sodium hydroxide, potassium hydroxide, lithium carbonate, sodium carbonate, potassium carbonate, sodium bicarbonate, potassium bicarbonate, cesium carbonate, cesium ﬂuoride and potassium ﬂuoride, and c bases such as imidazole, pyridine, TEA and DIPEA. Potassium acetate or the like is preferred.

The transition metal catalyst varies according to the starting material, the solvent used and the like and is not particularly limited unless it does not inhibit the reaction.

Preferred examples include 3)4, palladium(II) acetate/triphenylphosphine, palladiumGI) acetate/2—dicyclohexylphosphino-2',4',6'—triisopropylbiphenyl, palladium(II) chloride, Pd2(dba)3/tii-t-butylphosphine, Pd2(dba)3, Pd(t-Bu3P)2 and l,l'— bis(diphenylphosphino)ferrocenedichloropalladium(ll). More preferred examples include l,l'—bis(diphenylphosphino)fe1rocenedichloropa]ladium(ll).

The reaction temperature usually varies according to the starting material, the solvent, and furthermore the reagent used in the reaction, and is preferably 0°C to the reﬂux temperature of the t (the intemal temperature in the on vessel), more preferably l5 60 to 150°C. Use of a microwave reaction apparatus gives good results such as an improvement in the yield and a reduction in the reaction time in some cases.

The reaction time usually varies according to the starting material, the solvent, and furthermore the t used in the reaction and the reaction temperature, and is preferably 1 to 48 hours, more ably 1 to 6 hours, at the above temperature after adding the reagent.

[0081] Bis(pinacolato)diboron can be used in an amount of l to 5 molar lents based on the compound 2:7. The amount is preferably 1 to 3 molar equivalents.

The base can be used in an amount of 1 to 10 molar equivalents based on the compound 9;]. The amount is preferably 2 to 5 molar equivalents.

The transition metal catalyst can be used in an amount of 0.05 to 1 molar equivalent based on the compound a—Z. The amount is preferably 0.05 to 0.1 molar equivalent.

Stew This step is a step of ting a compound Q3 and the nd b;2 to a compoundE by coupling reaction using a transition metal catalyst.

[0085] This step can be performed under the same conditions as in Step B-1.

Speciﬁcally, this step can be performed with nce to the reaction conditions, the post— reaction ion, the puriﬁcation method and the like described in the later-described Examples 4, 6, and 25 and the like.

FP1100 008 S B-4 This step is a step of removing a protecting group P1 of the compound E to thereby obtain the compound (I). The deprotection of a protecting group is described in many well-known literatures, for example, T. Greene et al., ctive Groups in c Synthesis" (John Wiley & sons. Inc., New York, 1999)(hereinafter, referred to as Synthesis Reference Literature 1). The deprotection on ofan amino group depends on the kind of a protecting group, and is not especially limited, but for example, in the case of a 2,4- dimethoxybenzyl group or the like, the deprotection can be carried out under an acidic condition

[0087] In the case Where the protecting group P1 is a 2,4-dimethoxybenzyl group, a solvent used in the t on may be any one as long as it dissolves starting raw materials to some degree and does not inhibit the on The solvent is not especially limited, but examples f include alcoholic solvents such as methanol and ethanol, etheric solvents such as THF, DME, MTBE, cyclopentyl methyl ether, diethyl ether, diisopropyl ether, l ether and dicyclopentyl ether, halogenated hydrocarbon-based solvents such as dichloromethane and chloroform, acetic acid, or mixed solvents ﬂiereof.

An acid may be used as a solvent As the acid, for example, triﬂuoroacetic acid (T'FA), hydrochloric acid and sulfuric acid can be used Preferable is TFA. An acid can be used in a 1 to 100 times volume with respect to the compound bi.

The on temperature usually depends on starting raw materials, solvents, and other reagents used in the reaction, and is ly 0°C to a reﬂux temperature ofthe solvent (internal temperature ofa reaction vessel), and more suitably 40 to 60°C.

The reaction time usually depends on starting raw materials, solvents, other reagents used in the reaction, and the reaction temperature, and is suitably 0.5 to 24 hours, and more suitably 1 to 12 hours, at the above temperature after the addition ofthe reagents. <Preparation Method C> FP11—0553-00 OJRe OJRs )(22 Step C-1 )O(2 i ;N —> I R1 R1 [:’N ha R2-M k5 X1 R4 R2 R4 R3 1-2: R3 2-; Step C—2 \ OJ / Step 0-3 )O(2 R2_x3 i \ R1 NIN E M R4 R3 L2 In the as, R1, R2, R3, R4, R5, R6 and M are as deﬁned above, respectively, and X1, X2 and X3 each represent a halogen atom.

S_tepC_-1 This step is a step of converting a compound ﬂ and a compound 3L3 to a compound c;1 by coupling reaction using a tion metal catalyst.

This step can be med under the same conditions as in Step 13-1 of the <Preparation Method B>. Speciﬁcally, this step can be performed with reference to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later-described Example 52 and the like. 31590—4 This step is a step ofconverting a compound aﬁ and nacolato)diboron or the like to a ndg by coupling reaction using a transition metal st This step can be performed under the same conditions as in Step B-2 of the <Preparation Method B>. Speciﬁcally, this step can be performed with reference to the reaction ions, the post-reaction operation, the puriﬁcation method and the like described in the later—described Preparation Examples 3 and 6 and the like.

S_tepC_-3 This step is a step of converting a compound b_-§ and the compound $2 to a compound c-_l by coupling reaction using a transition metal catalyst This step can be performed under the same conditions as in Step B—3 of the <P1epa1ation Method B>. Speciﬁcally, this step can be performed with reference to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later-described Example 26 and the like.

FP1100 This step is a step of obtaining a compoundQ by hydrolyzing the compound c;1 in the presence ofa base.

This step can be performed under the same conditions as in Step A-2 of the <Preparation Method A>. Speciﬁcally, this step can be performed with reference to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the described Example 26 and the like.

SEC—5 This step is a step ofobtaining a compound gﬁ by reacting the compoundg with s ammonia using a condensing agent. This reaction can also be performed in a stream or atmosphere ofan inert gas such as nitrogen or argon.

This step can be performed under the same conditions as in Step A-3 of the <Preparation Method A>. Speciﬁcally, this step can be performed with reference to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later-described es 5, 26, 52, 53, 54 and 55 and the like.

This step can be performed under the same conditions as in Step A—4 of the ration Method A>. Speciﬁcally, this step can be performed with reference to the reaction conditions, the post-reaction ion, the puriﬁcation method and the like described in ﬂie later-described Examples 5, 26, 52, 53, 54 and 55 and the like. <Preparation Method D> Step 0'1 Step D-6 1) SOCI2 O R5 N02 0 2) O 1 | \ ML J R N O HN \ OH I N I R1 N, x1 R4 3) k5 R3 R5-N'NH2 R2 R4 41 H R3 (I) a_—2 1) reduction 2) cyclization Step 0-5 In the formulas, R1, R2, R3, R4, R5, R6 and M are as deﬁned above, respectively, and X1 and 553-00 X3 each represent a halogen atom.

Step D—l This step is a step of obtaining a compound g; by a known method by reacting a compounddi with thionyl chloride to convert it to a ponding acid chloride derivative, and then performing condensation reaction with ethyl dimethylaminoacrylate and subsequently reacting with a hydrazine derivative L2 to form a le ring. This reaction can also be performed in a stream or here ofan inert gas such as nitrogen or argon.

Speciﬁcally, this step can be performed with nce to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later- described Preparation Example 7 and the like.

The compound L2 can be a commercially available product used as is, and can also be synthesized by a means known to a person skilled in the art The compound can be ed by converting a corresponding ketone derivative to a hydrazide irnine and reducing using borane, sodium cyanoborohydride or the like. The nd a;2 can also be used as a salt such as hydrochloride.

The solvent used in the step of reacting a nd 94;] with thionyl chloride to convert it to a corresponding acid chloride derivative in this reaction is not particularly limited unless the solvent can dissolve the reaction ng material to a certain extent and does not inhibit the reaction. The solvent is preferably "fl-IF, itrile, DMF or DMA, more preferably acetonitrile. The solvent used in the next condensation reaction with ethyl dimethylarninoacrylate is not particularly limited unless it can dissolve the reaction starting material to a certain extent and does not t the reaction. The solvent is preferably THF, acetonitrile, DMF or DMA, more preferably acetonitrile. The solvent used in the subsequent pyrazole ring-forming reaction with a hydrazine derivativeﬂ is not particularly limited unless it can ve the reaction starting material to a certain extent and does not inhibit the reaction. The solvent is preferably methanol, ethanol, n-butanol, t-butanol, THF, 1,4-dioxane, acetonitrile, water or a mixed t thereof, more preferably a mixed solvent ofacetonitrile and water.

The reaction temperature usually varies according to the starting material, the solvent used, and ﬁnthermore the reagent used in the on. The reaction temperature in the step of obtaining a corresponding acid chloride from a compound i1 and thionyl chloride is preferably 0°C to the reﬂux temperature ofthe solvent (the internal temperature in the reaction vessel), more preferably 50°C to 80°C. The reaction temperature in the next FPll00 condensation reaction with ethyl dimethylaminoacrylate is preferably 0°C to the reﬂux temperature of the solvent (the internal temperature in the reaction vessel), more preferably °C to 80°C. The on temperature in the subsequent pyrazole ring-forming on with a hydrazine derivative g2 is preferably room temperature to the reﬂux temperature of the solvent (the internal temperature in the reaction vessel), more preferably 50°C to the reﬂux temperature ofthe solvent.

The reaction time usually varies ing to the starting material, the solvent used, and rmore the reagent used in the reaction. The reaction time in the step of obtaining a corresponding acid chloride by reaction of a compound Q with thionyl chloride is preferably 0.5 to 24 hours, more ably 1 to 3 hours, at the above temperature after adding the reagent. The reaction time in the next condensation reaction with ethyl dimethylaminoacrylate is preferably 0.5 to 24 hours, more preferably 1 to 3 hours, at the above temperature after adding the reagent. The reaction time in the subsequent pyrazole ring-forming reaction with a hydrazine derivative a;2 is preferably 0.5 to 60 hours, more preferably 12 to 24 hours, at the above temperature after adding the reagent St_ep D—2 This step is a step of converting a compound ﬂ and the compound 91:2 to a compound d;4 by coupling on using a tion metal catalyst.

This step can be performed under the same ions as in Step B-1 of the 2O <Preparation Method B>. cally, this step can be performed with reference to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later-described Examples 27, and 43 and the like.

St_ep D-3 This step is a step of converting the compoundﬂ and bis(pinacolato)diboron or the like to a compound d_-3_ by coupling reaction using a transition metal catalyst.

This step can be performed under the same conditions as in Step B—2 of the <Preparation Method B>. Speciﬁcally, this step can be performed with nce to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later-described Preparation Examples 7 and 9 and the like.

[0113] Step D-4 This step is a step of converting a compound b_-§ and the compound @ to a compound d_—_4 by coupling on using a transition metal catalyst This step can be performed under the same conditions as in Step B-3 of the 553-00 <Preparation Method B>. Speciﬁcally, this step can be performed with reference to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later-described Examples 45 and 51 and the like.

This step is a step of obtaining a compound (I) by a known method by converting the nitro group of the compound dﬁ to an amino group using a reducing agent, and then condensing the amino group with the ester to perform intramolecular cyclization reaction.

This reaction can also be performed in a stream or atmosphere of an inert gas such as nitrogen or argon. Speciﬁcally, this step can be performed with reference to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later-described Examples 27, 41, 43, 45, 51, and 62 and the like.

Examples of the reducing agent in this step include iron, tin(II) chloride and sodium hydrosulﬁte. Iron and tin(lI) chloride are preferred, and iron is more preferred.

The intrarnolecular cyclization reaction proceeds by g Without using a reagent in particular.

The solvent used in the step of converting the nitro group of the compound d;4 to an amino group using a reducing agent in this reaction is not particularly limited unless the solvent can dissolve the reaction starting material to a certain extent and does not inhibit the reaction. The solvent is ol, ethanol, n—butanol, t—butanol, ethyl e or a mixed solvent thereof, more preferably methanol or ethanol. The t used in the subsequent intramolecular cyclization reaction is not ularly limited unless it can dissolve the reaction starting material to a certain extent and does not inhibit the reaction. The t is acetic acid, ethanol, n—butanol, nol, THF or 1,4-dioxane, preferably acetic acid, ethanol, n-butanol or t-butanol, more preferably acetic acid.

[0118] The reaction temperature usually varies according to the starting material, the t used, and furthermore the reagent used in the reaction. The on temperature in the step of converting the nitro group of the compound E to an amino group using a reducing agent is ably 0°C to the reﬂux temperature of the solvent (the internal temperature in the reaction vessel), more preferably 80°C to the reﬂux temperature of the 3O solvent (the internal ature in the reaction ). The reaction temperature in the subsequent intramolecular cyclization reaction is preferably 0°C to the reﬂux temperature of the solvent (the internal temperature in the reaction vessel), more preferably 50°C to the reﬂux ature ofthe t (the internal temperature in the reaction vessel).

FP1100 The on time usually varies according to the starting al, the solvent used, and furthermore the reagent used in the reaction. The reaction time in the step ofconverting the nitro group ofthe compound d;4 to an amino group using a reducing agent is preferably 0.5 to 24 hours, more preferably 1 to 3 hours, at the above temperature after adding the reagent. The reaction time in the subsequent intramolecular cyclization reaction is preferably 0.5 to 24 hours, more preferably 1 to 3 hours, at the above temperature after adding the reagent.

SEQ D-6 This step is a step of obtaining a compound@ by a known method by converting the nitro group of the compound Q to an amino group using a reducing agent, and then condensing the amino group with the ester to perform olecular cyclization reaction.

This step can be performed under the same conditions as in Step D-5 of the <Preparation Method D>. Speciﬁcally, this step can be performed with reference to the reaction conditions, the post-reaction operation, the puriﬁcation method and the like described in the later-described Example 63 and the like.

St_ep D-7 This step is a step ofconverting a compound represented by compound 12:1 and the compoundQ to a compound (I) by coupling reaction using a tion metal catalyst This step can be performed under the same conditions as in Step B-l of the <Preparation Method B>. Speciﬁcally, this step can be performed with reference to the on conditions, the post-reaction ion, the puriﬁcation method and the like described in the later-described Example 63 and the like.

After the completion ofthe reaction in each method and each step described above, a target compound for each step can be ted from a reaction mixture according to a conventional method.

For example, in the case where the maction mixture is wholly a liquid, the reaction mixture, as desired, is returned to room temperature or cooled with ice; an acid, an alkali, an oxidizing agent or a reducing agent is suitably neutralized; an c solvent immiscible like water and ethyl acetate and not reacting with a target compound is added; and a layer containing the target compound is separated. Then, a solvent immiscible with the obtained layer and not reacting with the target nd is added to wash the layer containing the target compound, and the layer is ted Additionally, ifthe layer is an organic layer, by drying the layer using a desiccant such as anhydrous magnesium sulfate or anhydrous FP1100 sodium sulfate, and distilling out the solvent, the target compound can be ted. Ifthe layer is a water layer, by electrically desalting the layer, and thereafter lyophilizing the layer, the target compound can be collected If the reaction mixture is wholly a liquid, and if possible, only by distilling out substances (for example, a solvent and reagents) other than a target nd under normal pressure or reduced pressure, the target compound can be collected.

Further in the case where a target compound alone deposits as a solid, or in the case where the reaction mixture is Wholly a liquid and only a target compound precipitates as a solid in the procedure of collection, by ﬁrst ﬁlter-collecting the target compound by a ﬁltration method, washing the ﬁlter-collected target compound with a proper c or inorganic solvent, and drying the target compound, the target compound can be collected, and by treating the mother liquid similarly to the case where the on mixture is wholly a liquid, the target nd can further be collected.

Further in the case where only a reagent or a catalyst is present as a solid, or in the case where the reaction mixture is wholly a liquid, where a reagent or a st alone precipitates as a solid in the procedure of collection, and where a target compound is dissolved in a solution, by ﬁrst ﬁltraling out the reagent or the st by a ﬁltration method, washing the ﬁltered-out t or catalyst with a proper organic or inorganic solvent, combining the obtained washed liquid with the mother , and treating the obtained mixed liquid rly to the case Where the reaction mixture is wholly a liquid, the target compound can be collected Particularly in the case where substances other than a target compound contained in the reaction mixture do not inhibit a reaction of a next step, the reaction mixture as it is may be used in the next step t particularly isolating the target compound.

[0130] In order to improve the purity of the target compound collected in the above method, a recrystallization method, various types of chromatographies and a distillation method can be carried out suitably.

In the case where a collected target compound is a solid, the purity of the target compound can usually be ed by a recrystallization method. In the recrystallization 3O method, a single solvent or a mixed solvent of a plurality of solvents which does not react with the target compound can be used. Speciﬁcally, a target compound is ﬁrst dissolved at room ature or under heating in a single solvent or a mixed solvent of a plurality of solvents which does not react with the target compound. By cooling the obtained mixed FP1100 liquid with ice water or the like or leaving it at room temperature, the target compound can be crystallized ﬁom the mixed liquid In the case Where a collected target compound is a liquid, the purity of the target compound can be improved by various types of chromatographies. Weakly acidic silica gels such as Silica Gel 60 (70-230 mesh or 340-400 mesh) made by Merck or BW-300 (300 mesh) made by Fuji Silysia Chemical Ltd. can generally be used. In the case where a target compound has a basicity and exhibits too intense adsorption by the above silica gels, or in other cases, a propylamine—coated silica gel (200—350 mesh) made by Fuji Silysia Chemical Ltd. or ﬂie like may be used. In the case where a target compound has a bipolarity, in the case where the elution by a highly polar solvent such as methanol is ary, or in other cases, NAM-200H or NAM—300H made by NAM Laboratory may be used. A target compound improved in purity can be obtained by eluting the target compound with a single solvent or a ity of solvents which do not react with the target compound by using these silica gels, and distilling out the solvent(s).

[0133] In the case where a collected target compound is a liquid, the purity of the target compound can be improved also by a distillation method. In the distillation method, by depressurizing a target compound at room temperature or under heating, the target compound can be distilled out.

Although the above are typical examples ofproduction methods ofthe compound (1) ing to the present invention, raw material compounds and various types ofreagents in production ofthe compound according to the present invention may form salts, hydrates or solvates, and any compounds and reagents thereofdepend on starting raw materials, solvents to be used and the like, and are not especially limited as long as not ting the reactions.

Also a solvent to be used depends on starting raw materials, reagents and the like, and is not of course ally limited as long as not inhibiting the ons and dissolving ng substances to some degree. In the case where the compound (I) according to the present ion is obtained as a ﬂee body, the compound (I) can be converted to the state of a salt which the compound (I) may form or a hydrate thereofby a conventional method.

In the case where the compound (I) according to the present invention is obtained as a salt ofthe nd (I) or a e ofthe nd (I), the salt and the hydrate can be ted to a free body ofthe compound (I) by a conventional method Various types of isomers (for example, geometric isomers, optical s, onal isomers, stereoisomers and tautomers) obtained for the compound (I) according to 553-00 the present invention can be puriﬁed and isolated by using usual tion means, for example, recrystallization, a diastereomeric salt method, an enzymatic resolution method, and various types of chromatographies (for example, thin-layer chromatography, column chromatography and gas chromatography). aceutical preparation]A compound of the formula (I) according to the present invention or a pharrnaceutically acceptable salt f can be pharmaceutically prepared by a conventional , and the dosage form can be made, for example, an oral preparation, (tablet, granule, powder, capsule, syrup, or the like), an injection (for intravenous administration, for intramuscular administration, for subcutaneous administration, for intraperitoneal administration, and for others), and an external preparation rnic preparation (Ointment, patch, and the like), eyedrops, nasal drops, suppository, and the like).

In the case ofproducing an oral solid preparation, to a compound ofthe formula (I) or a pharmaceutically acceptable salt thereof, as required, an excipient, a , a disintegrant, a lubricant, a colorant and the like are added, and a , a e, a powder and a capsule can be produced by conventional methods. The tablet, granule, powder, capsule and the like, as required, may be ﬁlm-coated.

Examples of the ent include lactose, cornstarch and crystalline cellulose; examples ofthe binder include hydroxypropyl cellulose and hydroxypropyl methyl cellulose; examples of the disintegrant include carboxyrnethyl cellulose calcium and croscarmellose sodium; examples of the lubricant include magnesium stearate and calcium stearate; examples of the colorant include titanium oxide; and examples of the ﬁlm coating agent include hydroxypropyl cellulose, hydroxypropyl methyl cellulose and methyl cellulose, but these additives are ofcourse not d to these examples.

These solid preparations such as tablets, capsules, granules and powders can each contain y 0.001 to 99.5% by weight, preferably 0.01 to 90% by weight or the like, of a compound ofthe formula (I) or a pharrnaceutically acceptable salt f.

In the case of producing an injection (for intravenous administration, for intramuscular administration, for aneous administration, for intraperitoneal administration, and for others), to a compound of the formula (I) or a pharmaceutically acceptable salt thereof, as required, a pH regulator, a buﬂ'er agent, a suspending agent, a solubilizer, an antioxidant, a preservative (antiseptic), an isotonic agent, and the like are added, and an injection can be produced by a conventional method The preparations may be lized to be made extemporaneous dissolution-type lyophilized preparations.

FP11—0553-00 Examples of the pH regulator and the buffer agent e organic acids or nic acids and/or salts thereof; eXamples of the suspending agent include methyl cellulose, Polysorbate 80 and carboxymethyl cellulose ; examples of the solubilizer include Polysorbate 80 and polyoxyethylene sorbitan urate; examples of the antioxidant include oc-tocopherol; examples of the preservative e methyl paraoxybenzoate and ethyl paraoxybenzoate; and examples of the isotonic agent include glucose, sodium chloride and mannitol, but these additives are of course not d to these examples.

These injections can each contain usually 0.000001 to 99.5% by weight, preferably 0.00001 to 90% by weight or the like, of a compound of the formula (I) or a phannaceutically acceptable salt thereof.

In the case ofproducing an external preparation, a basis raw material is added to a compound of the formula (I) or a pharrnaceutically acceptable salt thereof, and as required, for e, the preservative, a stabilizer, the pH regulator, the antioxidant, the colorant and the like are added, and for example, an endermic ation (ointment, patch, and the like), eyedrops, nasal drops, itory, and the like can be ed by conventional s.

As basis raw materials to be used, various raw materials y used, for example, for medicines, quasi—drugs and cosmetics can be used. Speciﬁc examples thereof include raw materials such as animal and vegetable oils, mineral oils, ester oils, waxes, emulsiﬁers, higher alcohols, fatty acids, silicon oils, tants, phospholipids, alcohols, polyhydric alcohols, water-soluble polymers, clay minerals and puriﬁed water.

These extemal preparations can each contain usually 0.000001 to 99.5% by weight, preferably 0.00001 to 90% by weight or the like, ofa compound ofthe a (I) or a pharrnaceutically acceptable salt thereof.

[0141] The compound according to the present invention can be made a chemical probe to trap a target protein of a physiologically active low-molecular compound. That is, the compound according to the present invention can be converted to an aﬂEinity tography probe, a photoaﬁinity probe and the like by introducing a labeling group, a linker or the like to a moiety diﬁ‘erent ﬁom a structural moiety essential to develop the activity of the compound, by the technique described in J{Mass Spectrum. Soc. Jpn, Vol. 51, No. 5, 2003, p. 492-498, W02007/139149, or the like.

Examples of the labeling group, the linker or the like used in a chemical probe include groups shown in the group consisting ofthe following (1) to (5): FP1100 (1) protein labeling groups such as fﬁnity labeling groups (for example, a benzoyl group, a benzophenone group, an azido group, a carbonyl azido group, a diaziridine group, an enone group, a diazo group and a nitro group), and chemoaﬁinity groups (for example, ketone groups whose alpha—carbon atom is replaced by a n atom, a carbamoyl group, an ester group, an alkylthio group, an oc,B-Unsaturated ketone, a Michael receptor of an ester or the like, and an oxirane group); (2) ble linkers such as -S-S-, -O-Si—O—, monosaccharides (a glucose group, a galactose group, and the like), and disaccharides (lactose and the like), and oligopeptide linkers cleavable by an enzymatic reaction; (3) biotin and ﬁshing tag groups such as a 3—(4,4-diﬂuoro-5,7-dimethyl—4H—3a,4a-diaza—4— bora—s—indacen—3-y1)propionyl group; (4) radioactive labeling groups of 125I, 32F, 3H, 14C or the like; ﬂuorescent labeling groups such as ﬂuorescein, rhodamine, dansyl, umbelliferone, 7-nitrofurazanyl, and 3-(4,4-diﬂuoro— ,7-dimethyl—4H-3a,4a-diaza—4-bora—s-indecen—3-yl)propionyl group; chemiluminescent groups such as luciferin and luminol; and markers capable ofdetecting heavy metal ions such as lanthanide metal ions and radium ions; and (5) groups attached to solid carriers such as glass beads, glass beds, microtiter plates, agarose beads, agarose beds, polystyrene beads, polystyrene beds, nylon beads and nylon beds.

Probes prepared by ucing labeling groups selected from the group ting of the above (1) to (5), or the like, to the compound according to the present invention by methods described in the above literatures or the like can be used as chemical probes to identify labeled ns useful for search and the like ofnew drug ery targets.

Examples The compound (I) according to the present ion can be produced, for example, by methods described in the following Examples, and the effects ofthe compound can be veriﬁed by methods described in the following Test es. However, these are only exempliﬁcations, and the t invention is not limited to the following speciﬁc examples in any case, and changes and modiﬁcations may be made without departing from the scope ofthe present invention. 3O [0144] It is indicated that nds for which literature names or the like are described wereproduced according to the literatures or the like.

Abbreviations used in the t speciﬁcation are common ones well-known by those skilled in the art. The following abbreviations will be used in the present FP1100 speciﬁcation.

Ac: acetyl BAST: bis(2-methoxyethyl)aminosulﬁ1r tn'ﬂuoride Bn: benzyl Boc: tert—butoxycarbonyl BOP: benzotn'azol—l -tris(dimethylamino)phosphonium orophosphate Bu: butyl CAN: cerium ammonium nitrate CDI: 1,l'-carbony1dijrnidazole DAST: diethylaminosulﬁlr triﬂuoride DBU: 1,8-diazabicyclo[5.4.0]undecene DCC: 1,3—dicyclohexylcarbodiimide DCM: dichloromethane DDQ: 2,3—dichloro-5,6—dicyano—1,4-benzoquinone DEAD: diethyl azodicarboxylate DIAD: ropyl azodicarboxylate DIBAL—H: diisobutylaluminium hydride DlPEA: isopropylethylamine DMAP: 4—(dimethylamino)pyridine DME: 1,2—dimethoxyethane DMF: methylfonnamide DMF-DMA: N,N-dimethy1formamide dimethyl acetal DMSO: dimethylsmfoxide DTT: dithiothreitol EDC: l-ethyl-3—(3-dimeﬂ1ylaminopropy1)carbodiimide hydrochloride EGTA: glycol ether diamine tetraacetic acid HATU: O—( -azabenzotriazol-l -yl)-N,N,N'N-tetramethyluronium hexaﬂuorophosphate HBTU: O—benzotliazole—NNN‘N—tetrameﬂiyluronium hexaﬂuorophosphate HOBT: l-hydroxybenzotn'azole 3O IPA: isopropyl alcohol KHMDS: potassium bis(trimethylsilyl)amide KTB: potassium tert—butoxide LAH: lithium aluminum hydride FP11-0553—00 LDA: lithium diisopropylamide LI-IMDS: lithium bis(h‘imethy13ﬂyl)arrﬁde mCPBA: 3-chloroperbenzoic acid m—: meta MTBE: lmethylether n—: normal NaBH(OAc)3: sodium triacetoxyborohydn'de NaI-IMDS: sodium bis(trimethy1si1yl)anﬁde NBS: N-bromosuccinimide NCS: N-chlorosuccinimide NIS: N—iodosuccinimide NMP: N—meﬂiyl-Z-pyrrolizinone 0—: ortho p—: para Pd(t-Bu3P)2: i-t—butylphosphine)palladium Pd2(dba)3: his(dibenzylideneacetone)dipalladi1nn Pd(dppf)C12 DCM complex: [1,1 diphenylphosphine)ferrocene]dichloropalladiumﬂl) DCM complex Pd(PPh3)4: tetralds(t1iphenylphosplﬁne)palladium(0) PdC12(PPh3)2: bis(triphenylphosphh1e)palladimn(ll)dichloride PYBOP: benzom'azolyloxy1:ris(py1idino)phosphonimn hexaﬂuorophosphate t—z tertiary TBAF: tettabutylammonium ﬂuoride TEA: tn'ethylamine Tf: triﬂuoromethaneSLﬂfonyl TFA: uiﬂuoroacetic acid TFAA: triﬂuoroacctic acid anhydride THF: tetrahydrofuran THP: ydropyran TMEDA: N,NN,N'-teuametl1yleﬂ1ylenedian1ine TMS: trimethylsilyl Tris: hishydroxymeﬂiylaminomethane Ts: paratolucnesulfonyl FP1100 : proton nuclear magnetic resonance spectrometry LC—MS: liquid chromatography-mass spectrometry Xantphos: 4,5-bis(dipheny1phosphino)-9,9-dimethylxanthine Z: benzyloxycarbonyl "Room temperature" in the following Examples and Preparation Examples usually indicates about 10°C to about 35°C. % indicates weight percent unless otherwise speciﬁed.

The chemical shift ofthe proton nuclear magnetic resonance spectrum is recorded in 5 units (ppm) from tetramethylsilane; and the coupling constant is recorded in hertz (Hz).

The iations of splitting patterns are as follows: s: singlet, d: doublet, t: triplet, q: quartet, m: multiplet, brs: broad singlet and brd: broad doublet In a reaction using a microwave on apparatus in the following Examples and Preparation Examples, ErnrysTM Liberator made by Personal chemistry was used.

For the optical resolution of a nd, Parallex FlexTM, made by Biotage, (column: one of CI-DRALPAK (B) AD-H, IA, IB and IC made by Daicel Corp., and CHIRALCEL (R) OD-H and OJ-H made by Daicel Corp; column size 2 cm q) x 25 cm) was used The ion time in the tables in the examples means a value when one of CHIRALPAK (R) AD-H, IA, IB and IC made by Daicel Corp, and CHIRALCEL (R) OD- H and OJ—H made by Daicel Corp. (column size: 0.46 cm (I) x 15 cm or 0.46 cm (I) x 25 cm) was used and the ﬂow rate was set at 1.00 mL/min. The optical rotation (+/-) was measured by an OR—2090 chiral detector (Hg-Xe lamp, 150W) made by JASCO. - WiIh respect to the chromatography, in the case where there is a description as silica gel column chromatography, was used a Parallel Prep, made by Yamazen Corp., (colunm: Hi—Flash (1M) Column (Silicagel), made by Yamazen Corp, size: one of S (16 x 60 mm), M (20 x 75 mm), L (26 x 100 mm), 2L (26 x 150 mm), and 3L (46 x 130 mm)) or spherical shape silica gel for tography PSQ60BTM made by Fuji Silysia Chemical Ltd, silica gel for chromatography BW-300TM made by Fuji Silysia al Ltd, Wakogel (R) C-200 made by Wako Pure Chemical Industries, Ltd. or Silica Gel 60 (R) (70-230 mesh) made by Merck Ltd. Japan. In the case where there is a ption as NH silica gel column chromatography, was used a el Prep, made by Yamazen Corp., n: Hi-Flash (TM) Column (Amino), made by Yamazen Corp., size: one of S (16 x 60 mm), M (20 x 75 mm), L (26 x 100 mm), 2L (26 x 150 mm), and BL (46 x 130 mm)) or NH silica gel (200- 350 mesh) made by Fuji Silysia Chemical Ltd (i)- indicates a te, and (+)- and (—)— indicate the (+) type and the (-) type of FP1100 an enantiomer, respectively.

The names offollowing compounds were used as those indicated in “E-notebook” ver. 12 (Perkin Elmer) except ly used reagents.

Preparation Example 1 lo 4 3-c uinolin-7— 1 boronic acid (1) S thesis ofeth l3— 4-bromo—2—chloro hen 1—3-oxo ro ionate 4-Bromochlorobenzoic acid (1 g) was suspended in DCM (10 mL). CDI (960 mg) was added to the resultant suspension, and stirred at room temperature for 4 hours. The solution is taken as ion 1". Potassium ethyl malonate (1.1 g) was ded in acetonitrile (20 mL) in another ﬂask in a nitrogen atmosphere, and TEA (1.5 mL) was added.

The resultant solution was cooled to 0°C, and magnesium chloride (805 mg) was added little by little, and thereafter stirred at room temperature for 2 hours. The reaction mixture was cooled to 0°C, and "Solution 1" prepared in the above was dropped therein. After the completion of the ng, the reaction mixture was stirred at room temperature for 17 hours. The reaction mixture was further stirred at 50°C for 9 hours. The reaction mixture was concentrated under reduced pressure and the DCM was d. The ed residue was cooled to 0°C, and eﬂiyl acetate (50 mL) and a 2N hydrochloric acid (20 mL) were added, and stirred at room temperature for 1 hour. The resultant c layer was partitioned The resultant water layer was extracted with ethyl acetate. The extract was 553-00 combined with the organic layer, and dried with anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The obtained residue was puriﬁed by silica gel column chromatography (ethyl e/n—heptane, 0% to 10%) to thereby obtain the title compound (1.2 g).

EST—MS m/z 307 [M + H] + (2) is of ethyl S-t4-bromo-2—chlorophenylz-l-ttetrahydro-ZH-pm—4-ylz- 1H—pmole—4-carboylate Ethyl romo—2-chlorophenyl)—3-oxopropionate (1.2 g) was dissolved in DMF— DMA (4.7 mL), and stirred at room temperature for 1 hour. The reaction mixture was concentrated under reduced pressure. Ethanol (23 mL) and (tetrahydro—ZH—pyran—4— yl)hydrazine hydrochloride (CAS No.1945431; ChemReach Inc.) (759 mg) were added to the obtained e, and stirred at room temperature for 15 hours. Thereafter, the resultant was heated to reﬂux for 2 hours. The reaction mixture was cooled to room ature, and thereafter concentrated under reduced pressure. Ethyl acetate and a ted sodium hydrogencarbonate aqueous solution were added to the ed residue, and partitioned. The resultant organic layer was washed with a saturated sodium hydrogencarbonate aqueous solution, and dried with anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The resultant residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 10% to 30% to 50%) to thereby obtain the title nd (1.5 g). 1H—NMR (400 MHz, CDCl3) 6 (ppm): 1.15 (t, J = 7.2Hz, 3H), 1.63-1.73 (m, 1H), 1.83-1.91 (m, 1H), 2.22-2.45 (m, 2H), 329-3 .41 (m, 2H), 3.83-3.93 (m, 1H), .10 (m, 2H), 4.09- 4.15 (m, 2H), 7.16 (d, J = 8.2 Hz,1H), 7.54 (dd, J = 8.2 Hz, 2.0 Hz, 1H), 7.73 (d, J= 2.0 Hz, 1H), 8.05 (s, 1H).

ESI—MS m/z 415 [M+I—1]+ (3) Smthesis of 5-1 4—bromo-2—chlorophenyl )—N—(2,4—dimethoxybeml 2 ttetrahydro—2H—pm-4—yl)—1H—mle—4-carboxamide Ethyl 5-(4—bromo-2—chlorophenyl)—l-(tetrahydro-2H—pyran—4-yl)—1H—pyrazole—4- carboxylate (1.5 g) was added to ethanol (28 mL), and heated to 60°C to be dissolved. A 5N sodium hydroxide aqueous solution (2.1 mL) was added to the resultant solution, and stirred at 50°C for 2 and a half hours. The reaction mixture was cooled to room temperature, and thereafter, CHCl3 (100 1111.), a 5N hydrochloric acid (12 mL) and a saturated saline solution were added, and partitioned. The resultant organic layer was dried FP1100 with anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The obtained residue was suspended in DCM (31 mL); and CDI (825 mg) was added, and stirred at room temperature. After 30 min, methoxybenzylamine (1.0 mL) was added to the ant solution, and stirred at room temperature for 1 hour. A saturated sodium hydrogencarbonate aqueous solution was added to the reaction mixture, and partitioned. The resultant water layer was ted with ethyl acetate. The extract was combined with the resultant organic layer, and washed with a saturated sodium hydrogencarbonate aqueous solution. The resultant c layer was dried with anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under d pressure. The obtained residue was d by silica gel colurrrn chromatography (ethyl acetate/n—heptane, 50% to 80%) to y obtain the title compound (1.6 g). 1H—NMR (400 MHZ, CDC13) 5 (ppm): 1.57-1.64 (m, 1H), 1.83-1.90 (m, 1H), 2.18-2.29 (m, 1H), 2.33—2.44 (m, 1H), 3.27-3.39 (m, 2H), 3.75 (s, 3H), 3.80 (s, 3H), 3.97-4.09 (m, 2H), 4.33-4.26 (m, 2H), 5.72—5.81 (m, 1H), 6.37-6.44 (m, 3H), 7.08 (d, J = 8.2 Hz, 1H), 7.17 (d, J = 8.4 Hz, 1H), 7.49 (dd, J = 8.2 Hz, 2.0 Hz, 1H), 7.70 (d, J = 2.0 Hz, 1H), 7.92 (s, 1H).

EST-MS m/z 536 [M + H] (4) Smthesis of 7-bromo—5-t2,4-dimethoggbengl)—1-ttetrahydro—2H—pm—4—yl)— 1H—dihydropmlot 4,3-c lguinolin-4t 5ﬂ [one 5-(4—Bromochlorophenyl)-N—(2,4—dimethoxybenzyl)(tetrahydro—2H—pyran—4— yl)-1H-pyrazole—4-carboxamide (1.6 g) was dissolved in THF (29 mL). The solution was cooled to 0°C, and KTB (434 g) was added. The mixture was d at room temperature for 26 hours. A saturated ammonium chloride aqueous solution and methanol were added to the reaction mixture, which was extracted with CHC13. The ant organic layer was dried with anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced re. DMF and water were added to the obtained residue. The precipitated solid was ﬁlter-collected to thereby obtain the title compound (1.1 g). 1H—NMR (400 MHZ, CDC13) 5 (ppm): 2.10-2.20 (m, 2H), 2.42-2.55 (m, 2H), 3.67 (t, J = 11.0 Hz, 2H), 3.68 (s, 3H), 4.02 (s, 3H), 4.19—4.25 (m, 2H), 4.90-5.00 (m, 1H), 5.50 (s, 2H), 6.36 (dd, J = 8.2 Hz, 4.2 Hz, 1H), 6.52 (d, J = 4.2 Hz, 1H), 7.00 (d, J = 8.2 Hz, 1H), 7.39 (d, J = 8.4 Hz, 1H), 7.81 (d, J = 8.4 Hz, 1H), 7.82 (s, 1H), 8.32 (s, 1H).

ESI—MS m/z 500 [M + H] + FP1100 (5) S thesis of 5- 2 tho 1 -l- tetrah dro—2H- l —7- 4 4 5 5- tetramethyl—l ,3,2—dioxaborolan—2—yl [— 1H—dihydropmolol 4,3-c lguinolin-4g 5H [one 7—Bromo(2,4-dimethoxybenzyl)—1-(tetrahydro—2H—pyran—4—y1)—1H— dihydropyrazolo[4,3—c]quinolin—4(51-I)-one (200 mg) was dissolved in 1,4-diozane (10 mL).

Bis(pinacolato)diboron (132 mg), t)C12 DCM x (15 mg) and potassium e (118 mg) were added to the resultant solution, and allowed to react at 130°C for 2 hours using a microwave reaction apparatus. The reaction mixture was returned to room temperature, and thereafter concentrated under d pressure. The obtained residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 30% to 100%) to thereby obtain the title compound (175 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.24 (5, 61-1), 1.34 (s, 6H), 2.13-2.22 (m, 2H), 2.42- 2.55 (m, 2H), 3.63-3.77 (m, 2H), 3.74 (s, 3H), 4.02 (s, 3H), 4.19-4.25 (m, 2H), 4.97-5.07 (m, 1H), 5.62 (s, 2H), 6.32 (dd, J = 8.2 Hz, 4.2 Hz, 1H), 6.50 (d, J = 4.2 Hz, 1H), 7.03 (d, J = 8.2 Hz, 1H), 7.68 (d, J = 10.0 Hz, 1H), 7.95 (d, J = 10.0 Hz, 1H), 8.02 (s, 1H), 8.34 (s, 1H).

ESI—MS m/z 546 [M + H] + (6) Syllthesis of |5-(2,4—dimethogbepyl)4—0xo—1jtetrahydro—2H—pm—4—yl)- 4,5—dihydro—1H—pyjraiolo| 4,3-c lguinolinyl |boronic acid Synthesized 5-(2,4—dimethoxybenzy1)— l -(tetrahydro-2H-pyran—4—y1)—7-(4,4,5,5- tetramethyl—1,3,2-dioxaborolan—2—y1)—1H—dihydropyrazolo[4,3-c]quinolin—4(5H)—one (150 mg) was dissolved in 1,4-dioxane (10 mL). 2 N HCl (1 mL) was added to the solution, and the mixture was stirred at room temperature. Aﬁer 30 minutes, the precipitated solid was collected by ﬁltration. The resulting solid was dried under reduced pressure to give the title compound (104 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): .25 (m, 2H), 2.42—2.60 (m, 2H), 3.71 (s, 3H), 3.72 (s, 3H), 3.81 (5, 21-1), 4.17—4.29 (m, 2H), 4.98-5.09 (m, 1H), 5.62 (s, 2H), 6.32 (dd, J=8.2 Hz, 4.2 Hz, 1H), 6.46 (d, J=4.2 Hz, 1H), 6.94 (d, J=8.2 Hz, 1H), 7.36 (d, J=10.0 Hz, 1H), 7.73 (s, 1H), 8.03 (d, J=10.0 Hz, 1H), 8.36 (s, 1H).

ESI—MS m/z 464 [M+H]+ ation Example 2 Smthesis of 7—chlorog 2,4-dimethoggbizyl1-1—gtetrahydro-2H-M-4—ylHH- pmolol4,3-c lguinolin—4t 5ﬂ [-one FP11—0553-00 Cl Cl - < > C' CI Cl The title compound was obtained by performing the reactions (1) to (4) in ance with Preparation Example 1 using chlorobenzoic acid and (tetrahydro-2H— pyran—4—yl)hydrazine hydrochloride as raw materials. 1H—NMR (400 MHZ, DMSO'dé) 5 (ppm): 2.00-2.09 (m, 2H), 2.10-2.24 (m, 2H), 3.62-3.76 (m, 2H), 3.69 (s, 3H), 3.94 (s, 3H), 3.95—4.04 (m, 2H), 5.18-5.27 (m, 1H), 5.36 (brs, 2H), 7(11), 1H), 6.63-6.65 (m, 2H), 7.37-7.42 (m, 2H), 8.27-8.29 (m, 2H).

ESI—MS m/z 454 [M+H]+ Preparation e 3 S thesis of eth l 5- o 44 5 5-tetrameth 1-13 -dioxaborolan—2— 1 hen 1 tetrah dro—ZH- —4- 1-1H- lecarbo late 0H (1) —> 0 ———> Br05°F Br Br F (1) S thesis ofeth l3— 4-bromoﬂuoro hen loxo r0 anoate CDI (8.88 g) was added to a suspension of 4-bromoﬂuorobenzoic acid (CAS No. 112704—79-7) (10 g) in DCM (97 mL), and the mixture was stirred at room temperature for 3.5 hours. This solution is called ion 1." In another ﬂask, TEA (15.9 mL) and magnesium chloride (10.9 g) were sequentially added to a suspension of potassium ethylmalonate (15.5 g) in acetonitrile (303 mL), and the mixture was stirred at room temperature for three hours and 10 minutes. The "solution 1" prepared above was added dropwise to the reaction mixture over 25 minutes, and then the reaction mixture was stirred at room ature overnight. The reaction mixture was concentrated to half volume under reduced pressure. The resulting residue was diluted with ethyl acetate (500 mL), and 5 N hydrochloric acid (250 mL) was added under ice-cooling, followed by stirring at room temperature for one hour. The organic layer FP1100 was separated. The organic layer was washed with brine, dried over anhydrous magnesium sulfate, ﬁltered and trated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 5% to 20%) to give the title compound (12.8 g).

EST-MS m/z 291 [M + Hf” (2) Smthesis of ethyl 5bromo—2—ﬂuorophenyl)—1-(tetrahydro—2H—pm—4—yl)- lH-pyraiole—4-carboxylate A solution ofethyl 3-(4-bromo—2-ﬂuorophenyl)—3-oxopropanoate (25.6 g) in DMF— DMA (129 mL) was stirred at room temperature for four hours. The reaction mixture was concentrated under reduced pressure. Toluene (250 mL) was added to the residue. The solution was concentrated under reduced pressure. Ethanol (550 mL) was added to the residue. The solution was cooled in an ice bath. (Tetrahydro-ZH—pyran—4—yl)hydrazine hydrochloride (15.4 g) was added to the solution. The mixture was warmed to room temperature over one hour and then heated under reﬂux for two hours. The reaction mixture was stirred at room temperature overnight and then concentrated under reduced pressure. The residue was partitioned by adding ethyl acetate (400 mL) and brine (200 mL). The organic layer was washed with brine (200 mL), dried over anhydrous magnesium sulfate and ﬁltered, and the e was concentrated under reduced pressure.

The residue was puriﬁed by silica gel column chromatography (ethyl e/n—heptane, 10% to 25%). The resulting crude puriﬁed t was suspended in a mixed on ofMTBE (30 mL) and n—heptane (50 mL), followed by stirring at room temperature overnight. The precipitated solid was collected by ﬁltration. The resulting solid was suspended in a mixed solution ofMTBE (30 mL) and n—heptane (50 mL), followed by stirring at room temperature ght. The precipitated solid was collected by ion. After drying, the title compound (22.8 g) was obtained. 1H—NMR (400 MHZ, CDC13) 5 (ppm): 1.13-1.23 (m, 3H), 1.63-1.73 (m, 1H), .87 (m, 1H), .44 (m, 2H), 3.29-3.44 (m, 2H), 3.91—4.11 (m, 3H), 4.11-4.20 (m, 2H), 7.16-7.24 (m, 1H), .49 (m, 2H), 8.05 (d, J=0.59 Hz, 1H).

EST-MS m/z 419 [M+Na]+

[0164] (3) S thesis of eth l 5- 2-ﬂuoro-4— 44 5 5—tetrarneth 1-13 —dioxaborolan-2— yl[phenyl)—1-(tetrahydro—2H—pm-4—yl)—1H—pmle—4~carboylate A mixture of ethyl 5-(4—bromoﬂuorophenyl)—1-(tetiahydro—2H-pyranyl)-1H— pyrazole-4—carboxylate (2 g), bis(pinacolato)diboron (1.53 g), Pd(dppf)C12-DCM complex FP11—0553-00 (0.18 g) and potassium acetate (1.48 g) was dried under reduced pressure using a vacuum pump for one hour. DMF (20 mL) was added to the dried e, and the mixture was stirred at 85°C for six hours. The reaction mixture was returned to room temperature and then ﬁltered through CeliteTM. The ﬁltrate was concentrated under reduced pressure. The residue was partitioned by adding ethyl acetate (100 mL) and water (100 mL). The aqueous layer was extracted with ethyl acetate (20 mL x 2). The combined organic layers were dried over anhydrous magnesium sulfate and ﬁltered, and the ﬁltrate was trated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 10% to 20%) to give the title compound (2.18 g). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.12-1.17 (m, 3H), 1.37 (s, 12H), .72 (m, 1H), 1.81-1.85 (m, 1H), 2.30-2.39 (m, 2H), 3.28-3.36 (m, 2H), .08 (m, 3H), 4.13 (q, J=7.0 Hz, 2H), 7.29-7.32 (m, 1H), 7.61-7.64 (m, 1H), 7.68-7.70 (m, 1H), 8.05 (s, 1H).

Preparation Example 4 tetrameth 1—1 3 2—dioxaborolan 1 -1H- 10 4 3-c uinolin—4 5 -one ( OH Cl 0 o 0 W N, Br 0 O C c: , I \,N N N CO O‘B Br 0’ 0 The title compound was obtained by performing the ons (1) to (5) in accordance with Preparation Example 1 using ethyl 3-(4-bromo-2—chlorophenyl)—3- oxopropanoate obtained in Preparation e 1 and (i)-(tetrahydro—2H—pyran—3- y1)hydrazine hydrochloride obtained in Preparation Example 17 as raw materials.

ESI-MS m/z 546 [M + H]+ Preparation Example5 S thesis of 1,3,2—dioxaborolan—2—yl)—1H—pmlo| 4,3-c lguinolin—4t 5E {-one FP1100 Br b °VB Q Br 6 O O (1) S thesis of —eth 1_ 5- ochloro hen 1 tetrah an l- 1H— le—4—carbo late Ethyl 3-(4-bromochlorophenyl)oxopropanoate obtained in Preparation Example 1(1) (2.00 g) was dissolved in DMF—DMA (6.96 mL), and the reaction mixture was stirred at room temperature for 1.5 hours. The on mixture was concentrated under reduced re, and the residue was dissolved in ethanol (40 mL). (i)-(I‘etrahydroﬁ11an— 3-yl)hydrazine hydrochloride (998 mg) was added to the solution, and the mixture was heated under reﬂux for two hours. The reaction mixture was cooled to room temperature and then trated under reduced pressure. The residue was extracted with ethyl acetate, and the organic layer was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 10% to 30%) to give the title compound (1.05 g).

ESI-MS m/z 401 [M + H]+ (2) S thesis of 4-bromo—2-chloro hen l—l— tetrah droﬁnan l-lH— pyraicle—4-carboxylic acid A mixture of (i)-ethyl 5-(4-bromo-2—chlorophenyl)—1-(tetrahydroﬁnany1)-1H- pyrazole—4—carboxylate (1.05 g) and a 5 M aqueous sodium hydroxide solution (1.58 mL) was stirred in a mixed solvent of ethanol (20 mL) and water (5 mL) at 60°C for three hours.

The reaction mixture was cooled to room temperature and then concentrated under reduced pressure. 5 M hydrochloric acid was added to the residue, followed by extraction with ethyl e. The organic layer was dried over anhydrous magnesium sulfate, and the desiccant was d off. The ﬁltrate was concentrated under reduced pressure to give the title FP1100 compound (1 g).

ESI-MS m/z 371 [M + H]+ (3) S thesis of 4-bromo—2-chloro hen l ' -l- (tetrahydroﬁiranylHH—mle—4—carboxamide (i)(4-bromochlorophenyl)—1-(tetrahydroﬁ1ran—3-yl)-1H—pyrazole—4— carboxylic acid (1 g) was dissolved in DCM (20 mL), and CD1 (611 mg) was added, followed by stirring at room temperature for one hour. 2,4—dimethoxybenzylamine (0.809 mL) was added to the reaction e, and the e was d at room temperature for two hours. A saturated aqueous sodium bicarbonate on was added to the reaction mixture, ed by extraction with DCM. The organic layer was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 10% to 40%) to give the title compound (1.26 g).

ESI—MS m/z 522 [M + 111]”r (4) S thesis of i bromo 2 4-dimetho be 1 -l- tetrah drofuran l - 1H—pmlol43-clgtﬁnolin—415a )—one (i)(4-bromo~2-chlorophenyl)-N-(2,4-dirnethoxybenzyl)—1-(tetrahydroﬁiran yl)-lH—pyrazole—4—carboxamide (1.26 g) was dissolved in TIE (25 mL), and KTB (597 mg) was added at 0°C. The mixture was d for 12 hours while gradually g to room temperature. The reaction mixture was cooled to 0°C, and water was added, followed by ﬁltration The ﬁltration residue was separately stored. The ﬁltrate was extracted with ethyl acetate, and the c layer was concentrated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 10% to 70%).

The resulting fraction and the ﬁltration residue obtained above were combined and concentrated to give the title compound (488 mg). 1H—NMR (400 MHZ, CDC13) 8 (ppm): 2.50-2.62 (m, 1H), 2.72—2.82 (m, 1H), 3.76 (s, 3H), 4.02 (s, 13H), 4.07-4.15 (m, 1H), 4.19-4.32 (m, 2H), 4.35-4.42 (n1, 1H), 5.46-5.57 (m, 3H), 6.34 (dd, J=8.6 Hz, 2.2 Hz, 1H), 6.52 (d, J=2.2 Hz, 1H), 6.99 (d, J=8.6 Hz, 1H), 7.38 (dd, J=8.6 Hz, 1.8 Hz, 11-1), 7.82 (d, J=l.8 Hz, 1H), 7.89 (d, J=8.6 Hz, 1H), 8.32 (s, 1H).

ESI—MS m/z 506 [M + Na]+

[0172] (5) S thesis of i- 2 4-dimetho l tetrah drofuran—37- 4 4 5 5- tetramethy'1—1,3g—dioxaborolanyl2—1H-pmlol4ﬁ-clguinolin-4g51j )—one A mixture of (i)bromo(2,4—dimethoxybenzyl)(tetrahydroﬁ1ran—3-yl)—1H- pyrazolo[4,3-c]quino]in—4(5H)—one (300 mg), bis(pinacolato)diboron (204 mg), Pd(dppf)C12- FP1100 DCM x (13.6 mg) and potassium acetate (182 mg) was d in a mixed solvent of 1,4-dioxane (15 mL) and DMSO (1 mL) using a microwave r at 130°C for three hours.

The reaction mixture was cooled to room temperature and then concentrated under reduced pressure. The residue was extracted with ethyl acetate, and the organic layer was concentrated under reduced pressure. The residue was subjected to a silica gel pad and eluted with ethyl acetate to give the title compound (428 mg) as a crude puriﬁed product.

ESI-MS m/z 532 [M + H]+ Preparation Example 6 S thesis of eth 1 5- (l) S thesis of eth 1 5- 4-bromo—2—ﬂuoro hen l S -tetrah drofuran—3- l— lH—pmolM-carboylate A on of ethyl 3-(4—bromo—2—ﬂuorophenyl)—3-oxopropanoa1'e obtained in Preparation Example 3(1) (45 g) in DMF—DMA (165 mL) was stirred at 50°C for two hours and 15 minutes. The on mixture was concentrated under reduced pressure. Toluene (200 mL) was added to the residue, and the mixture was concentrated again under d pressure. Ethanol (950 mL) was added to the residue, and the mixture was warmed to 50°C. A solution of (S)-(tetrahydroﬁrran—3-y1)hydrazine hydrochloride (21.6 g) in water (60 mL) was added dropwise to the solution over 35 minutes. The resulting reaction mixture was stirred at 50°C for two hours and 10 s. The reaction mixture was cooled to room temperature and then concentrated to half volume under reduced pressure.

Water (200 mL) was added to the residue, and ethanol was distilled off under reduced pressure. Ethyl acetate (500 mL) was added to the resulting residue, and the organic layer was separated. The aqueous layer was ted with ethyl acetate (100 mL). The combined organic layers were washed with brine, dried over anhydrous magnesium sulfate, ﬁltered and concentrated under reduced pressure. The e was puriﬁed by silica gel column tography (ethyl acetate/n—heptane, 10% to 15%) and then puriﬁed by short path NH silica gel column chromatography (ethyl acetate/n—heptane, 33%) to give the title FP1100 compound (43.1 g). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.19 (t, J=7.2 Hz, 3H), 2.19-2.49 (m, 2H), 3.87-4.07 (m, 3H), .25 (m, 3H), 4.58—4.65 (m, 1H), 7.17-7.26 (m, 1H), 7.39-7.47 (m, 2H), 8.06 (s, 1H).

ESI-MS m/z 407 [M+Na]+ (2) Smthesis of ethyl 5-|2—ﬂuorog4,4,5,5-te11amethyl—l,3,2-dioxaborolan—2— l hen l S -tetrah an 1 —1H- le—4—carbo late A mixture of ethyl 5-(4-bromo—2-ﬂuorophenyl)—l-[(S)-tetrahydroﬁ1ran—3-yl]-1H- pyrazole—4—carboxylate (43.1 g), bis(pinacolato)diboron (34.3 g), t)C12-DCM complex (4.59 g) and potassium acetate (33.1 g) was dried under reduced pressure using a vacuum pump for one hour. A solution of dried residue in DMF (430 mL) was stirred at 80°C for three hours and 10 minutes. The reaction e was returned to room temperature and then ﬁltered through CeliteTM. The ﬁltrate was concentrated under reduced pressure. Ethyl acetate (430 mL) and brine (200 mL) were added to the residue, followed by stirring for ﬁve minutes. The insoluble matter was ﬁltered off through CeliteTM. The organic layer was separated from the ﬁltrate. The aqueous layer was re-extracted with ethyl acetate (50 mL). The ed organic layers were dried over anhydrous magnesium sulfate and ﬁltered, and the ﬁltrate was concentrated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl e/n—heptane, 10% to 15%) to 2O give the tiﬂe compound (51.9 g). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.16 (t, J=7.2Hz, 3H), 1.37 (s, 12H), .49 (m, 2H), 3.85-4.06 (m, 3H), 4.14 (q, J=7.2 Hz, 2H), 4.20 (dd, J=15.6, 8.4 Hz, 1H), 4.57—4.66 (m, 1H), 7.30 (t, J=7.2 Hz, 0.5H), 7.35 (t, J=7.2 Hz, 0.5H), 7.63 (dd, J=5.6, 2.0 Hz, 1H), 7.70 (dd, J=7.2, 2.0 Hz, 1H), 8.06 (s, 1H).

[0176] Preparation Example 7 S thesis of eth l 5- tetrahydrofuran—3-yl |-lH—mleA—carboxylate FP1100 N02 OH (1) O \ (2) OzN I N O ——-———-> N/ Br Br LE3 (1) S thesis of eth 1 5- 4-bromo carboglate onitmbenzoic acid (10 g) was dissolved in acetonitrile (50 mL).

Thionyl chloride (3.2 mL) was added to the solution, and the mixture was stirred for three hours with heating under reﬂux. The reaction mixture was cooled with ice water, and triethylamine (11.3 mL) was added dropwise. Ethyl 3-dimethylarnineacrylate (6.4 mL) was further added dropwise. After stirring at room temperature for three hours, (S)- (tetrahydroﬁ1rany1)hydrazine hydrochloride (6.2 g) was dissolved in water (10 mL), and the aqueous solution was added dropwise to the reaction mixture. Thereafter, the mixture was d at room temperature for 60 hours. The reaction mixture was partitioned by adding water (50 mL) and ethyl acetate (200 mL). The organic layer was washed with a 2 N aqueous sodium hydroxide on (100 mL) and brine (50 mL) and dried over anhydrous magnesium sulfate. The ant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. Ethyl acetate (5 mL) was added to the resulting residue which was ved with heating under reﬂux. The solution was cooled with ice water. After one hour, the itated solid was collected by ﬁltration to give the crude puriﬁed product (7.5 g). Further, the ﬁltrate was concentrated under reduced pressure.

MIBE (10 mL) was added to the resulting residue, and the precipitated solid was collected by ﬁltration to give the title compound (1.5 g). 1H—NMR (400 MHz, CDC13) 6 (ppm): 1.13 (td, J=7.2 Hz, 1.6 Hz, 3H), 2.15-2.34 (m, 1H), 2.39-2.55 (m, 1H), 3.85—4.14 (m, 5H), 4.21 (q, J=7.7 Hz, 1H), 4.47-4.62 (m, 1H), 7.21 (d, J=8.2 Hz, 0.5H), 7.26 (d, J=8.2 Hz, 0.5H), 7.88 (t, J=2.2 Hz, 0.5H), 7.88 (t, J=2.2 Hz, 0.5H), 8.02 (s, 1H), 8.35 (d, J=2.2 Hz, 0.5H) 8.37 (d, J=2.2 Hz, 0.5H).

ESl-MS m/z 410 [M+H]+ (2) Synthesis of ethyl 5-|2-nitrot4,4,5,5-tetramethy1-1,3,2-dioxaborolan—2— l hen 1 S -tetrah an—3— 1-1H— 1e-4—carbo late FP1100 A mixture of ethyl 5-(4-bromonitrophenyl)—1—[(S)-tetrahydroﬁ1ran—3-yl]—1H— pyrazole—4—carboxylate (650 mg), bis(pinacolato)diboron (483 mg), Pd(dppt)C12-DCM complex (64.7 mg) and potassium acetate (467 mg) was dried under reduced pressure using a vacuum pump for one hour. DMF (6.5 mL) was added to the dried residue, and the mixture was stirred at 80°C for four hours. The reaction mixture was returned to room temperature and then ﬁltered through Celitem. The ﬁltrate was concentrated under reduced re. Water was added to the residue, followed by extraction with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate, ﬁltered and concentrated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 50% to 100%) to give the title compound (417 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.07-1.11 (m, 31-1), 1.38 (s, 12H), 2.14-2.31 (m, 1H), 2.41-2.53 (m, 1H), .11 (m, 5H), 4.12-4.24 (m, 1H), 4.49-4.57 (m, 1H), 7.29-7.40 (m, 1H), .03 (m, 1H), 8.13-8.16 (m, 1H), 8.58-8.60 (n1, 11-1).

Preparation Example 8 S thesi of i -eth l 5- 4-bromonitro hen 1—1— ox an—4— 1-1H— le-4— carboglate NH N02 No2 OH HN’ 2 HCI N O + _, The title compound (369 mg) was obtained by the same method as in ation Example 7 from 4—bromo-2—nitrobenzoic acid (2.5 g) and (i)-oxepan—4—ylhyd1azine hydrochloride obtained in Preparation Example 15 (1.69 g). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.13 (t, J=7.2 Hz, 3H), .65 (m, 1H), 1.76-1.91 (m, 1H), 1.95—2.21 (m, 2H), 2.27-2.51 (m, 2H), 3.54-3.73 (m, 2H), .88 (m, 21-1), 4.02— 4.13 (m, 3H), 7.20 (d, J=8.0 Hz, 0.5H), 7.21 (d, J=8.0 Hz, 0.5H), 7.87 (dd, J=8.0, 2.0 Hz, 0.5H), 7, 88 (dd, J=8.0, 2.0 Hz, 0.5H), 8.00 (s, 0.5H), 8.01 (s, 0.5H), 8.35 (d, J=2.0Hz, 0.5H), 8.36 (d, J=2.0 Hz, 0.5H).

ESI-MS m/z 462 [M+Na]+ Preparation Example 9 S thesis of eth l 1- 1 4-dioxe FPll00 dioxaborolan—2— l hen l-1H— lecarbo late Bﬁ/Uimg(1) N02 EMA N’ / HN——NH2 ',3 O\_/o o 0 HO] (1) S thesis of -eth l2— 4-bromo—2—nitrobenzc l dimeth lamino late A solution of4-bromo—2-nitrobenzoic acid (2.5 g) in thionyl chloride (2.93 mL) was stirred at 80°C for 3 hours. The reaction mixture was concentrated under reduced pressure.

Toluene (3 mL) was added to the residue and the mixture was concentrated again under reduced pressure. A solution ofthe resulting acid chloride in acetonitrile (8 mL) was added dropwise to a solution of ethyl 3—dimethylaminoacrylate (1.46 g) and TEA (2.83 mL) in acetonitrile (30 mL) at room temperature over 6 minutes. The resulting reaction e was d at room temperature ght. The reaction mixture was partitioned by adding ethyl acetate and water. The aqueous layer was extracted again with ethyl acetate. The combined organic layers were washed with brine, dried over anhydrous magnesium sulfate, ﬁltered and trated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/heptane, 33 to 66%) to give the title compound (2.55 1H—NMR (400 MHz, CDC13) 8 (ppm): 0.91 (t, J=7.2 Hz, 3H), 3.11 (s, 3H), 3.39 (s, 3H), 3.89 (q, J=7.2 Hz, 2H), 7.25 (d, J=8.0 Hz, 1H), 7.74 (d, J=8.0, 1.6 Hz, 1H), 8.00 (s, 1H), 8.19 (d, J=1.6 Hz, 1H).

ESI-MS m/z 393 [M+Na]+ (2) S thesis of eth l 5— 4-bromonitro hen l-l- 14—diox an—6— carboxylate To a solution of (Z)-ethyl 2—(4—bromonitrobenzoyl)—3-(dimethylamino)acry1ate (642 mg) in itrile (8 mL) was added a solution of (1,4-dioxepan-6—y1)hydrazine hydrochloride (341 mg) obtained in Preparation e 16 in water (2 mL) at room temperature. The reaction e was stirred at room temperature overnight and further stirred at 50°C for 9.5 hours. The reaction mixture was returned to room temperature and partitioned by adding ethyl e and water. The aqueous layer was extracted again with ethyl acetate. The FP11—0553-00 combined organic layers were sequentially washed with the saturated aqueous sodium bicarbonate solution and brine, and dried over anhydrous magnesium sulfate, d and concentrated under reduced pressure. The resulting e was puriﬁed by silica gel column chromatography (ethyl acetate/heptane, 20 to 33%) to give the title compound (408 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.12 (t, J=7.2 Hz\ 3H), .83 (m, 2H), 3.87-4.11 (m, 6H), 4.20-4.39 (m, 3H), 7.17 (d, J=8.0 Hz, 1H), 7.88 (dd, J=8.0, 2.0 Hz, 1H), 8.05 (s, 1H), 8.35 (d, J=2.0 Hz, 1H).

ESI—MS m/z 464 [M+Na]+

[0183] (3) S thesis of dioxaborolan—2—yl [phenyl ]-1H—pmle—4—carboglate.

A mixture of ethyl 5-(4—bromo-2—nitrophenyl)—1-(1,4-dioxepan—6—yl)—1H-pyrazole—4— carboxyrate (200 mg), bis(pinacolato)diboron (138 mg), Pd(dppt)C12-DCM complex (19 mg) and potassium acetate (134 mg) was dried under d pressure using a vacuum pump for 50 minutes. A solution of the resulting residue in DMF (3 mL) was stirred at 80°C for 2 hours and 20 minutes. After Pd(dppf)C12-DCM complex (19 mg) was added to the reaction mixture, the reaction mixture was stirred at 80°C for 3 hours. The on mixture was concentrated under reduced pressure. Brine and ethyl acetate were added to the resulting residue, and the mixture was stirred at room temperature for 5 minutes. The organic layer was separated. The aqueous layer was extracted again with ethyl acetate.

The combined c layers were dried over anhydrous ium sulfate, d and concentrated under d pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/heptane, 33 to 50%) to give the title compound (183 mg). 1H—NMR (400 MHZ, CDC13) 8 (ppm): 1.08 (t, J=6.8 Hz, 3H), 1.38 (s, 12H), 3.69-3.81 (m, 2H), 3.85-4.10 (m, 6H), 4.22—4.38 (m, 3H), 7.28 (d, J=7.6 Hz, 1H), 8.05 (s, 1H), 8.13 (dd, J=7.6, 1.2 Hz, 1H), 8.57 (d, J=1.2 Hz, 1H).

Preparation Example 10 3O S thesis of eth l 5- 4-bromo—2 5-diﬂuoro hen 1 tetrah dro-2H- mleA-carboglate FP1100 F OH (1) __, F0 (1)S thesis ofeth 13- 4—bromo-2 5-diﬂuoro hen loxo r0 anoate 4-bromo—2,5-diﬂuorobenzoic acid (395 mg) was suspended in DCM (3.6 mL).

CDI (378 mg) was added to the solution, and the mixture was stirred at room temperature for about three hours. This solution is called "solution 1." In another ﬂask, potassium ethylmalonate (567 mg) was suspended in acetonitrile (11 mL) in a nitrogen atmosphere, TEA (0.58 mL) and magnesium chloride (397 mg) were sequentially added, and the mixture was then stirred at room temperature for about three hours. The "solution 1" prepared above was added dropwise to the reaction mixture. After completion of the dropwise addition, the mixture was stirred at room ature for about 20 hours. Ethyl acetate (50 mL) was added to the reaction mixture which was cooled to 0°C. 5 N hloric acid (25 mL) was added and the mixture was stirred at room ature for one hour. The organic layer was separated The organic layer was washed with brine and dried over anhydrous ium sulfate. The desiccant was removed by ion, and the ﬁltrate was concentrated under reduced pressure. The resulting residue was subjected to silica gel column chromatography (ethyl acetate/n—heptane, 0% to 7%) to give the title nd (420 mg).

ESI-MS m/z 329, 331 [M + Na]+ (2) Smthesis of ethyl 5-14—bromo—2,5-diﬂuorophenyl)ttetrahydro-2H—pm-4— yl)-lH—pmle—4—carboglate Ethyl 3-(4-bromo-2,5-diﬂuorophenyl)oxopropanoate (420 mg) was dissolved in DIVE-DMA (2 mL). The reaction mixture was stirred at room temperature for about 1.5 hours and ﬁlrther stirred at 45°C for 30 minutes. The reaction mixture was concentrated under reduced pressure. l (6 mL) and (tetrahydro—ZH—pyran—4—yl)hydrazine hydrochloride (250 mg) were added to the resulting residue, and the mixture was stirred at 90°C for 40 s. The reaction mixture was concentrated under reduced pressure.

The resulting residue was partitioned by adding ethyl acetate and brine. The organic layer was washed with brine and dried over anhydrous magnesium e. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The residue FP1100 was subjected to silica gel column chromatography (ethyl acetate/n—heptane, 14% to 35% to 52%) to give the title nd (400 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.21 (t, J=7.1 Hz, 3H), 1.63—1.73 (m, 1H), 1.78-1.87 (m, 1H), 2.27-2.44 (m, 2H), 3.33—3.43 (m, 2H), 3.92-4.22 (m, 5H), 7.09-7.14 (m, 1H), 7.44— 7.50 (m, 1H), 8.05 (s, 11-1). ation Example 11-1 S thesis of eth l mlM-carboglate O ————>

[0188] Ethyl 3—(4—bromo—2,5—diﬂuoropheny1)oxopropanoate obtained in Preparation Example 10(1) (4 g) was dissolved in DMF-DMA (18 mL), and the reaction mixture was stirred at room temperature overnight. The reaction mixture was concentrated under reduced pressure, and ethanol (80 mL) was added to the resulting residue (5.9 g), followed by warming to 60°C. A soluti0n of (S)-(tetrahydroﬁ.1ran—3—y1)hydrazine hydrochloride (2.17 g) in water (4.5 mL) was added to the solution over two minutes, and the e was d at 60°C for two hours. The reaction e was cooled to room temperature and then concentrated under reduced pressure. The resulting residue was partitioned by adding ethyl acetate and brine. The organic layer was washed with brine and dried over anhydrous magnesium sulfate. The ant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The residue was subjected to NH silica gel column chromatography (ﬁrst time: ethyl acetate/n—heptane, 10% to 30%, second time: ethyl acetate/n—heptane, 40%) to give the title compound (4.31 g).

ESI-MS m/z 423 [M +Na]+ Preparation Example 11-2 .

Smthesi of ethyl 5-(4-bromo—2,5—diﬂuorophenyl)—l-(CB)—tetrahydroﬁ1ran¥3-yl)-1H- mle—4—carboylate .

FP1100 L Lo O \ F0 —-——-> I /N Br 2 i0 The title nd was synthesized in accordance with Preparation Example 11-1 ﬁ'om (R)-(tetrahydroﬁiran-3—yl)hydrazine hydrochloride.

EST-MS m/z 423 [M + Na]+ Preparation Example 12 S thesis of i - tetrah droﬁiran l h drazine h oride ethodA (1) Smthesis ofbenyl 2-ldihydroﬁ1ran-3123 2-ylidene |hydrazinecarboxylate 3-oxotetrahydroﬁiran (5.70 g) was dissolved in methanol (150 mL), and benzyl carbazate (10 g) was added to the solution. The mixture was stirred at room temperature for 12 hours. The reaction mixture was concentrated 14.8 g of a residue was obtained as a crude puriﬁed product. This was used for the next reaction without ﬂirther puriﬁcation. (2) Smthesis ofti2-m12-gtetrahydroﬁ1ranyllhydrazinecarbogglate Benzyl 2-[dihydrofuran—3(2H)-ylidene]hydrazinecarboxylate (14.8 g) was suspended in water (96 mL). Acetic acid (42.1 mL) was added to the suspension at room temperature. The mixture was stirred at room temperature for one hour. The suspension turned into a solution. Sodium cyanoborohydride (4.0 g) was added to the solution in small portions. The mixed solution was stirred at room temperature for two hours. The reaction e was cooled to 0°C. The reaction mixture was lized by adding a 5 N s sodium hydroxide solution. The mixture was extracted with chloroform. The c layer was dried over anhydrous ium sulfate and then ﬁltered The ﬁltrate was concentrated under reduced pressure. The residue was puriﬁed by silica gel column tography (methanol/ethyl acetate, 5%). The title compound (13.9 g) was obtained. 1H-NMR (400 MHz, CDC13) 5 (ppm): 1.73-1.80 (m, 1H), 1.92-2.06 (m, 1H), 3.66-3.82 (m, FP1100 3H), 3.82—4.03 (m, 2H), 5.14 (s, 2H), 7.31-7.40 (m, 5H).

It was found that the title compound can be optically resolved using chiral I-IPLC under the following condition. Optical resolution condition [CHIRALPAC (R) OD- Hmanufactured by Daicel Corporation, 10% ethanol/n-hexane, Retention Tune = 12.39 min, 13.5 min] (3) Smthesis ttetiahydroﬁ1ranyl [hydrazine hloride Benzyl 2-(tetrahydroﬁ1ran—3-yl)hydrazinecarboxylate (32.3 mg) was dissolved in methanol (3 mL). 10% palladium carbon (50% wet) (17 mg) was added to the solution, and the mixture was stirred at room temperature for two hours in a hydrogen atmosphere.

The reaction mixture was ﬁltered. The ﬁltrate was trated under reduced re.

The residue was dissolved in methanol (1 mL). A 4 N hydrogen chloride-1,4-dioxane solution (3 mL) was added to the solution. The mixture was stirred at room temperature for three hours. The reaction mixture was concentrated under reduced pressure to give the title compound (4.9 mg). 1H—NMR (400 MHz, CD30D) 8 (ppm): 1.90-2.10 (m, 1H), 2.19-2.32 (m, 1H), 3.53-4.35 (m, SH).

Preparation Example 13 Synthesis ofti t-ttetrahydroﬁiranyl [hydrazine hloride t Method B) X, HCI (1) X40 (2) Aéj Q» H2N~NH _’ HN’N _’ HN—NH2 HN'NH b. 5°

[0195] (1) Synthesis oft-bﬂl 2-| dihydrofuran—3t2ﬂ )-ylidene [hydrazinecarboxylate 3-oxotetrahydroﬁ1ran (10.38 g) was dissolved in methanol (200 mL), and t-butyl carbazate (17.53 g) was added to the solution. The e was stirred at room ature for 12 hours. The reaction mixture was concentrated to give the title compound (27.3 g). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.52 (s, 9H), 2.46 (t, J=6.9 Hz, 2H), 4.10 (t, J=6.9 Hz, 2H), 4.33 (s, 2H). (2) Smthesis of ti t-t-butyl 2-ttetrahydroﬁ1rany1 [hydrazinecarboylate t-butyl 2-[dihydroﬁ1ran—3(2H)-ylidene]hydrazinecarboxylate (17.26 g) was suspended in water (130 mL). Acetic acid (57.2 mL) was added to the suspension at room FP1100 temperature. The mixture was stirred at room temperature for one hour. Sodium cyanoborohydride (5.36 g) was added to the solution in small portions. The mixed solution was stirred at room temperature for two hours. The reaction mixture was cooled to 0°C.

The reaction mixture was neutralized by adding a 5 N aqueous sodium hydroxide solution.

The mixture was extracted with chloroform. The organic layer was dried over anhydrous ium sulfate and then ﬁltered. The ﬁltrate was concentrated under reduced pressure.

The residue was puriﬁed by silica gel column chromatography (5% meﬂ1anol/ethyl acetate).

The title compound (15.3 g) was ed. (3) Smthesis ofgiz-ttetrahydroﬁiranyl zine hydrochloride (i)-t—butyl rahydroﬁ1ran—3-yl)hydrazinecarboxylate (5 g) was dissolved in ol (40 mL). A 4 N hydrogen chloride-1,4—dioxane solution (40 mL) was added to the solution. The mixture was stirred at room ature overnight. The reaction mixture was concentrated under reduced pressure. The residue was tritmated with ethyl acetate, water and methanol. The precipitated solid was collected by ﬁltration to give the title compound (2.09 g). 1H—NMR (400 MHz, CD30D) 8 (ppm): 1.92-2.02 (m, 1H), 2.19-2.30 (m, 1H), 3.70-3.84 (m, 31-1).

Preparation Example 14 S thesis of S - tetrah droﬁJran lh drazineh drochloride o 0 N’N _> HN"N ’ i HN—NH2 ’3 o 0 o/ (3) HN——NH O 2 _.> N‘NHZ €34 HCI (1)S thesis oft—bu l 13-dioxoisoindolin—2— lcarbamate A suspension of ic anhydride (30.0 g) and t—butyl carbazate (CAS No. 870— 46-2) (26.8 g) in toluene (600 mL) was azeotropically reﬂuxed using a Dean-Stark trap for 3.25 hours. The insoluble matter was removed by hot ﬁltration. The ﬁltrate was concentrated to about one-third volume under reduced pressure and then ice-cooled. The precipitated solid was collected by ﬁltration The resulting solid was dissolved in ethyl e (750 mL) and puriﬁed by short path NH silica gel column chromatography (100% 553-00 ethyl e). The target n was concentrated, and the residue was then triturated with ethyl acetate (20 mL). The resulting solid was collected by ﬁltration and dried under reduced pressure to give the title compound (16.4 g). 1H-NMR (400 MHz, CDC13) 5 (ppm): 1.52 (s, 9H), 6.55 (brs, 1H), 7.79 (dd, J=5.6, 3.2 Hz, 2H), 7.91 (dd, J=5.6, 3.2 Hz, 2H). (2) Synthesis of 1S z-t-bugl t 1,3—dioxoisoindolinyl )( ydrofuran—3— yl)carbamate DEAD (11.5 mL) was added dropwise to a solution of (R)-(—) hydroxytetrahydrofuran (CAS No. 86087—24—3) (4.84 g), t-butyl (1,3-dioxoisoindolin-2— yl)carbamate (12 g) and triphenylphosphine (18.0 g) in THF (160 mL) under ice-cooling over ﬁve minutes. The reaction mixture was stirred at 0°C for three minutes and then at room temperature for seven hours and 40 minutes. The reaction mixture was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 20%) to give the title compound (12.4 g). 1H—NMR (400 MHz, CDC13) 6 (ppm): 1.29 (s, 6H), 1.53 (s, 3H), 2.12-2.33 (m, 2H), 3.63- 3.97 (m, 4H), 4.84—4.94 (111, 0331-1), .14 (m, , 7.75-7.84 (m, 2H), .94 (m, 2H).

ESI-MS m/z 355 [M+Na]+ Optical purity analysis >98% ee [IC, 10% ethanol/n-heXane, Retention Time = 9.7 min] 2O [0201] (3) Smthesis of 1 S z-t-bugl 1-(tet1ahydroﬁrran—3-yl)hydrazinecarb0ﬂlate Methylhydrazine (3.94 mL) was added dropwise to a solution of (S)-t-butyl (1,3- dioxoisoindolin—2—yl)(tetrahydroﬁ1ran—3-yl)carbamate (12.3 g) in THF (125 mL) under ice- cooling over two minutes. The reaction e was stirred at 0°C for 30 minutes, at room temperature for three days and then at 50°C for four hours. The on mixture was ice- cooled, and the insoluble matter was then removed ﬁom the reaction mixture by ﬁltration.

The ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 10% to 14%) to give the title compound (7.04 g). 1H—NMR (400 MHz, CDC13) 6 (ppm): 1.48 (s, 9H), 2.00-2.11 (m, 2H), 3.67-3.82 (m, 4H), 3.87 (dd, J=8.8, 7.2 Hz, 1H), 3.97 (dd, J=15.2, 7.2 Hz, 11-1), 4.67-4.80 (m, 1H).

ESI—MS m/z 225 [M+Na]+ (4) S thesis of S - tetrah drofuran—3- l h drazine h drochloride butyl (tetrahydrofuran—3-yl)hydrazinecarboxylate (7.04 g) was dissolved in a FP1100 4 N hydrogen chloride-1,4-dioxane solution (60 mL). The resulting reaction mixture was d at room temperature for 25 minutes and then at 50°C for two hours. The reactiOn mixture was concentrated under reduced pressure. The residue was ated with MTBE and ethanol. The suspension was concentrated under d pressure to give the title compound (4.85 g). 1H—NMR (400 MHz, CD30D) 5 (ppm): 1.90-2.04 (m, 1H), 2.19-2.32 (m, 1H), 3.70-3.84 (m, 3H), 3.86—4.02 (m, 21-1).

Preparation Example 15 S thesis of i -oxe an—4- lh drazine h drochloride 0 HN’N O NH2 o HN’ 65 C5 O O (51? KO 6"”O (l) S thesis ofoxe anone Boron triﬂuoride-diethyl ether complex (13.8 mL) was added to a solution of tetrahydro—4H—pyran—4—one (CAS No. 29943-42—8) (10.0 g) in DCM (400 mL) at room temperature. The reaction mixture was cooled to -25°C. Trimethylsilyl diazomethane (2 M solution in n—hexane, 55 mL) was added dropwise to the reaction mixture over 40 minutes, and the mixture was then stirred at the same temperature for 2.5 hours. Water (40 mL) was added to the reaction e, followed by stirring at room temperature. The organic layer was separated. The organic layer was washed with a saturated aqueous um chloride solution: 28% aqueous a = 10 : 1 (55 mL), dried over anhydrous magnesium sulfate, ﬁltered and concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, % to 14%) to give the title compound (3.80 g). 1H—NMR (400 MHz, CDC13) 6 (ppm): 1.82—1.89 (m, 2H), 2.65-2.72 (m, 4H), 3.85-3.94 (m, 4H).

[0205] (2) S thesis of i -t-b 12— ox an—4— l h drazinecarbo late The title compound (4.60 g) was obtained by the same method as in Preparation Examples 13-(1) and 13-(2) from oxepan—4-one (3.80 g) and t-butyl carbazate (3.61 g).

EST-MS m/z 253 [M + Na]+ (3) is ofti)-oxepan—4—ylhydrazine hydrochloride The title compound (3.72 g) was obtained by the same method as in Preparation Example 13-(3) ﬁom butyl 2—(0xepan—4—y1)hydrazinecarboxylate (4.60 g).

FP1100 1H-NMR (400 MHz, DMSO'dé) 8 (ppm): .82 (m, 4H), 2.02-2.34 (m, 2H), 3.08-3.18 (m, 1H), .57 (m, 2H), 3.61-3.74 (m, 2H).

Preparation Example 16 S thesis of 1 4-dioxe an—6— l h drazine h drochloride 0 0 M —~ aQTXMmX-..9:.

HO\/\OH H0\\/0 0dHCl (l) S thesis of2— oxiran— - lmetho ethanol Epichlorohydrin (31 g) was added dropwise to a mixture of ethylene glycol (20.8 g) and boron ride—diethyl ether complex (0.255 mL) under ice-cooling over one hour.

The reaction mixture was stirred at room temperature for one hour and 10 minutes and then at 80°C for one hour. The reaction mixture was returned to room temperature. The reaction mixture was added dropvvise to a solution of ice-cooled potassium hydroxide powder (20.7 g) in 1,4-dioxane (110 mL) over 45 minutes. The ing reaction mixture was stirred at room temperature for 30 minutes. The insoluble matter in the reaction mixture was removed by ﬁltration The ﬁltrate was concentrated under reduced pressure.

The residue was puriﬁed by distillation to give a fraction having a g point of58 to 62°C at 0.3 mmHg. The product was puriﬁed by silica gel column tography (ethyl acetate/n-heptane, 50% to 75%) to give the title compound (3.11 g). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.10 (t, J=6.4 Hz, 1H), 2.65 (dd, J=4.8, 2.8 Hz, 1H), 2.82 (t, J=4.8 Hz, 1H), 3.16-3, 21 (m, 1H), 3.46 (dd, J=12.0, 6.0 Hz, 1H), .78 (m, 3H), 3.81-3.89 (m, 2H). (2) Synthesis of 1,4-dioxepan—6—ol A on of2-(oxiran-2—ylmethoxy)ethanol (3.11 g) in 1,4-dioxane (200 mL) was added dropvvise over four hours and 20 minutes to a solution of lithium tetraﬂuoroborate (415 mg) and lithium hydroxide (69 mg) in 1,4-dioxane (200 mL) warmed at 55°C. The reaction mixture was stirred at 50°C for 50 minutes and then at room temperature for 10 minutes. The insoluble matter in the reaction e was removed by ﬁltration. The ﬁltrate was concentrated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 40% to 50%). It was then puriﬁed again by silica gel column chromatography yl ether/n—hexane 50% to 100%) to give the title compound (56 mg). 553-00 Further, the fraction containing impurities was puriﬁed again by silica gel column chromatography (diethyl ether, 100%) to give the title compound (212 mg). 1H—NMR (400 MHZ, CDC13) 8 (ppm): 2.57 (brd, J=8.8 Hz, 1H), 3.70-3.77 (m, 2H), 3.82- 3.91 (m, 6H), 3.96 (brs, 1H). (3) Smthesis oft—bgyl 1,4—dioxgpan—6-ylt 1,3-dioxoisoindolin—2—yl )carbamate DEAD (2.2 M in toluen, 1.55 mL) was added dropwise to a solution of 1,4—dioxepan—6—ol (265 mg), l ioxoisoindolin—2—yl)carbamate (560 mg) obtained in preparation example 14-(1) and triphenylphosphine (840 mg) in THF (10 mL) under oling over 3 minutes. The reaction mixture was stirred at 0°C for 6 minutes, and further stirred at room temperature overnight The reaction mixture was concentrated under d pressure.

Aﬁer toluene (2.5 mL) was added to the resulting residue, the precipitated solid was removed by ﬁltration The ﬁltrate was puriﬁed by silica gel column chromatography (ethyl acetate/n- heptane, 20%) to give the title compound (713 mg). 1H—NMR (400 MHz, CDC13) 6 (ppm): 1.28 (s, 5.4H), 1.50 (s, 3.6H), 3.60-3.72 (m, 4H), 4.02-4.11 (m, 21-1), 4.13-4.21 (m, 2H), 4.64-4.71 (m, 0.4H), 4.83-4.92 (m, 0.6H), 7.77-7.83 (m, 2H), 7.89-7.96 (m, 2H).

ESI-MS m/z 385 [M + Na]+ (4) sis oft-butyl 1-1 1,4-dioxgpan—6—y11hydrazinecarboxylate Methylhydrazine (0.21 mL) was added se to a solution of t-butyl 1,4—dioxepan—6— y1(1,3-dioxoisoindolinyl)carbamate (710 mg) in THF (7 mL) over 1 minute. The reaction mixture was stirred at room temperature for 3 days and further d at 50°C for 11 hours. After the on mixture was retumed to room temperature, the insoluble matter was removed from the reaction mixture by ﬁltration. The ﬁltrate was concentrated under reduced pressure. Aﬁer toluene was added to the residue, precipitated solid was removed by ﬁltration. The ﬁltrate was puriﬁed by silica gel column chromatography (ethyl acetate/n- heptane, 15% to 25%) to give the title compound (393 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.47 (s, 9H), 3.67-3.88 (m, 6H), 3.94 (d, J=6.8 Hz, 4H), 4.40460 (m, 1H).

ESI-MS m/z 255 [M + Na]+

[0212] (5)S thesis of 14—diox an 1h drazineh drochloride A 4 M hydrogen chloride-1,4-dioxane solution (3 mL) was added to a solution oft—butyl 1- (1,4-dioxepan—6-yl)hydrazinecarboxylate (392 mg) in dioxane (3 mL). The reaction mixture was stirred at room temperature overnight and further stirred at 50°C for 1 hour.

FPll00 The reaction mixture was concentrated under reduced pressure to give the title compound (341 mg). 1H—NMR (400 MHz, DMSO'dé) 8 (ppm): 3.38 (quint, J=4.4 Hz, 1H), 3.62-3.74 (m, 4H), 3.80 (dd, J=12.8, 4.4 Hz, 2H), 3.86 (dd, J=12.8, 4.4 Hz, 21-1).

Preparation Example 17 Smthesis etrahydro—2H—pm—3-yl [hydrazine hydrochloride 0 ,NH2 (1) HN/NTOK 6. (2) Ho: The title compound was obtained by ming the reactions (1) to (2) in accordance with Preparation Example 13 using dihydro-pyran—3-one as a raw material. 1H—NMR (400 MHz, CD30D) 8 (ppm): 1.53-1.64 (m, 1H), 1.72-1.87 (m, 2H), 1.98-2.09 (m, 1H), 3.06-3.15 (m, 1H), 3.59-3.72 (m, 3H), 3.81-3.90 (m, 1H).

Preparation Example 18 S thesis of 3S 4RS —4—h drazin ltetrah drofuran—3-olh drochloride O oc SNHNHz (1) HO (2) HO ~‘ _,‘L/> _, HCI o O 0 racemic racemlc

[0216] (1) s thesis of t-b 1 2- 3RS 4SR 4—11 dro trah droﬁnan—3- yllhydrazinecarboglate 3,4-epoxytet1ahydroﬁnan (3.33 mL) and t—butyl carbazate (6.14 g) were dissolved in 2-propanol (15 mL), and the solution was heated to 90°C. After three days, l carbazate (6.3 g) was further added. After heating with stining for further two days, the reaction mixture was cooled to room temperature and concentrated under d pressure.

Xylene was added to the residue, and the mixture was concentrated again under reduced re. The residue was partitioned by adding chloroform and brine. The organic layer was dried over anhydrous magnesium e. The desiccant was removed by ﬁltration, and the e was concentrated under reduced pressure. The residue was puriﬁed by NH silica gel column chromatography (ethyl acetate/n—heptane, 50% to 100%) to give the title compound (5.78 g).

ESl-MS m/z 241 [M + Na]+ (2) S thesis of 3S 4RS -4—h drazin ltetrah drofuran—3-olh drochloride FP1100 A4 M hydrogen chloride-1,4—dioxane solution (50 mL) was added to a solution of t-butyl 2—((3RS,4SR)—4—hydroxytetrahydroﬁ1ran—3-y1)hydrazinecarboxylate (5.78 g) in methanol (30 mL) under ice-cooling, and the e was then warmed to room temperature and stirred overnight. The reaction mixture was concentrated to give the title compound (5 1H—NMR (400 MHz, CD3OD) 6 (ppm): 3.49-3.54 (m, 1H), 3.57-3.63 (m, 1H), 3.65 (dd, J=9.67, 2.64 Hz, 1H), 3.70-3.76 (m, 1H), 3.96—4.08 (m, 2H), 4.28-4.32 (m, 1H).

Preparation e 19 S thesis of 2 4 eth l 'din l boronic acid \ B‘OH N 3-bromo-2,4,6-trimethy1pyridine (CAS No. 23079-73—4; Prasenjit Mal etc, Journal of Organic Chemistry, 68(9), pp.3446—3453) (1 g) was added to THF (20 mL). The solution was cooled to -78°C, and n—butyllithium (1.63 M solution in ne, 3.37 mL) was added, followed by stirring at the same ature for 30 minutes. Trimethyl borate (0.78 mL) was added to the reaction mixture, and the mixture was stirred at -78°C for 10 minutes and at room temperature for 50 minutes. A saturated aqueous ammonium chloride on was added to the reaction mixture, and the reaction mixture was concentrated under reduced pressure. The resulting residue was partitioned between oil and water by adding water and DCM. The aqueous layer was concentrated under reduced pressure. DCM and 2O ethanol were added to the resulting residue. The insoluble matter was ﬁltered, and the ﬁltrate was concentrated under reduced pressure to give the title compound (242 mg). 1H—NMR (400 MHz, DMSO'dé) 8 (ppm): 2.50 (s, 3H), 2.63 (s, 3H), 2.67 (s, 3H), 7.52 (s, 1H).

Preparation Example 20 S thesis of2-bromo metho eth 1 -1 th lbenzene 2-bromomesitylene (5.00g ) was dissolved in carbon tetrachloride (50 mL). NBS (4.45 g) and l peroxide (182 mg) were added to the solution, and the mixture was d at 80°C for three hours. The reaction mixture was returned to room temperature and FP1100 ﬁltered. The solid collected by ﬁltration was washed with n-heptane. The ﬁltrate was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (n-heptane). The ing ﬁaction was concentrated under reduced pressure. The residue was dissolved in THF (120 mL). Sodium methoxide (28% solution in methanol, 9.35 mL) was added to the solution, and the mixture was stirred at 80°C for four hours. The reaction mixture was returned to room temperature and concentrated under reduced pressure. Water was added to the residue, followed by extraction with DCM.

The organic layer was concentrated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 5%). The resulting fraction was concentrated under d pressure, and the residue was d again by NH silica gel column chromatography (n-heptane) to give the title compound (880 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.41 (s, 6H), 3.38 (s, 3H), 4.35 (s, 2H), 7.05 (s, 2H). ation Example 21 S thesis of3-bromo—6—chloro-2 th l 'dine CI N 5-bromo-4,6-dimethylpyridin-2—arnine (CAS No. 898560; Aldrich) (4.00 g) was added to a mixed solution of concentrated hydrochloric acid (24 mL) and water (24 mL). The on was cooled to 0°C, and sodium nitrite (3.57 g) was added, followed by stirring at the same temperature for 10 minutes. Copper(I) chloride (5.91 g) was added to the solution, and the e was stirred at 0°C for ﬁve minutes and at room temperature for four hours and 15 minutes. The reaction mixture was cooled to 0°C, and a 5 N aqueous sodium hydroxide solution was added to make the on mixture basic. Ethyl acetate was added to the reaction mixture, followed by ﬁltration. The organic layer in the ﬁltrate was separated, and the aqueous layer was ted with ethyl acetate. The combined c layers were concentrated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 5%) to give the title compound (1.79 g). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.39 (s, 3H), 2.65 (s, 3H), 7.06 (s, 11-1).

Preparation Example 22 Smthesis of3-bromomethoxy—2,4—dimethylpmdine FP1100 \o N/ 3-bromochloro-2,4-dimethylpy1idine obtained in Preparation Example 21 (200 mg) was added to DMF (1 mL). Sodium methoxide (28% solution in ol, 0.741 mL) was added to the solution, and the mixture was stirred at 60°C for 15 hours. Water was added to the reaction mixture, followed by tion with diethyl ether. The organic layer was concentrated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 10%) to give the title compound (172 mg). 1H-NMR (400 MHz, CDC13) 6 (ppm): 2.34 (s, 3H), 2.57 (s, 3H), 3.88 (s, 3H), 6.46 (s, 1H).

Preparation Example 23 thesis of3-bromo—-metho -2 4-dimeth l (1) S thesis of5—bromo—4 6-dimeth 1 din—2-ol 2—amino—5-bromo-4,6-dimethylpyridine (15 g) was dissolvedin a mixed solution of sulfuric acid (14.2 mL) and water (212 mL). A solution of sodium nitrite (6.18 g) in water (31 mL) was added to the on at 0°C. The reaction mixture was stirred at room temperature for one hour, followed by extraction with chloroform The organic layer was dried over anhydrous magnesium sulfate, and the desiccant was ﬁltered off. The ﬁltrate was concentrated under reduced pressure. MTBE was added to the residue to precipitate the solid, followed by ﬁltration. The ﬁltration residue was washed with MTBE to give the title compound (13.7 g).

ESI-MS m/z 204 [M + HT (2) Smthesis of3-bromomethoxy—2,4-dimethylpmdine Amixture of 5-bromo—4,6—dimethylpyridin—2—ol (7 g), methyl iodide (21.6 mL) and silver ate (19.1 g) was d in a chloroform t (140 mL) at room temperature for 36 hours. The reaction e was subjected to silica gel pad and eluted with a mixed solvent of(ethyl acetate : n-heptane = 2 : 8). The resulting solution was concentrated under reduced re to give the title compound (6.98 g). 1H-NMR (400 MHz, CDC13) 6 (ppm): 2.32-2.35 (m, 3H), 2.56-2.58 (m, 3H), 3.88 (s, 3H), 6.43-6.48 (m, 1H).

FP1100 EST-MS m/z 216 WHH]+ Preparation Example 24 S thesis of 6-metho -2 4-dimeth l 'din—3- l boronic acid 3-bromo-6—meﬂ10xy—2,4—dimethylpyridine (150 mg) was added to THE (3 mL).

The solution was cooled to -78°C, and n—butyllitlﬁum (1.63 M solution in ne, 0.468 mL) was added, followed by ng at the same temperature for 30 minutes. Trimethyl borate (0.108 mL) was added to the reaction mixture, and the mixture was stirred at -78°C for 10 minutes and at room temperature for 50 minutes. A saturated aqueous ammonium chloride solution was added to the reaction mixture, and the reaction e was concentrated under reduced pressure. THF was led off. The resulting residue was ﬁltered The solid collected by ﬁltration was washed with water and ane to give the title compound (41 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.31 (s, 3H), 2.48 (s, 3H), 3.89 (s, 3H), 4.77 (brs, 2H), 6.35 (s, 11-1).

Preparation Example 25 S thesis of3-chloro-2—metho -4 6-dimeth 1 ﬁxit~91 (1) S thesis of3-bromochlorometho -2 4-dirneth l 'dine 3~bromo—6—methoxy—2,4—dimethylpy1idine obtained in Preparation Example 22 (800 mg) was added to DMF (4 mL). NCS (494 mg) was added to the solution, and the mixture was stirred at 80°C for 14 hours. The reaction mixture was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column tography (ethyl acetate/n—heptane, 5% to 30%). The title compound (930 mg) was obtained. 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.51 (s, 3H), 2.56 (s, 3H), 3.98 (s, 3H). (2) Smthesis of3-chloro—2—methoxy—4,6-dimethylpmdine 3-bromochloromethoxy—2,4-dimethylpyridine (930 mg) was added to THE (10 mL). The solution was cooled to —78°C, and n-butyllithium (2.6 M solution in n- FP1100 hexane, 1.428 mL) was added, ed by ng at the same temperature for one hour. A saturated aqueous ammonium chloride solution was added to the reaction mixture, followed by extraction with DCM. The organic layer was washed with brine and dried over sodium sulfate. The ant was removed by ﬁltration, and the ﬁltrate was concentrated under d pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 5% to 30%) to give the title compound (300 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.31 (s, 3H), 2.38 (s, 3H), 3.99 (s, 3H), 6.62 (s, 11-1).

Preparation Example 26 S thesis of3-bromo-2—metho -4 6—dimeth l N? (1) S thesis of3-bromochloro-4 6-dimeth l 'dine 2-chloro-4,6-dimethylpyridin—3-amine (2.85 g) was dissolved in hydrobromic acid (15 mL, 48% aqueous solution), and the on was cooled to 0°C. A solution of sodium nitrite (1.51 g) in water (2 mL) was slowly added dropwise to the solution, and the mixture was stirred at 0°C for 15 minutes. A suspension of copper(I) bromide (4.18 g) in hydrobromic acid (5 mL, 48% aqueous solution) was added se to the solution, and the mixture was stirred at 0°C for 10 minutes and then at 60°C for one hour. The reaction mixture was cooled to room temperature, followed by extraction with ethyl acetate. The organic layer was directly subjected to an NH-silica gel pad and eluted with ethyl acetate. 2O The resulting solution was concentrated under d pressure, and the e was puriﬁed by NH silica gel column chromatography (ethyl acetate/n—heptane, 0% to 30%) to give the title compound (2.97 g).

ESI-MS m/z 220 [M + HT“ (2) Smthesis of3-bromomethog—4,6—dimethylpmdine A mixture of 3-bromochloro—4,6—dimethylpyridine (2.97 g) and sodium methoxide (11.0 mL, 28% solution in methanol) was stirred in a DMF solvent (30 mL) at 80°C for 36 hours. Water was added to the reaction mixture, followed by extraction with diethyl ether. The organic layer was trated under d pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 10%) to give the title compound (2.33 g).

FPll00 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.33-2.34 (m, 3H), 2.36-2.38 (m, 3H), 3.98 (s, 3H), 6.61-6.64 (m, 1H).

ESI-MS m/z 216 [M+H]+ Preparation Example 27 S thesis of 2—metho —4 6-dimeth l 'din-3— lboronic acid The title compound was synthesized in accordance with Preparation Example 24 using 3—bromo—2-methoxy-4,6—dimethylpyridine. 1H-NMR (400 MHz, CDC13) 8 (ppm): 2.37-2.42 (s, 3H), .52 (s, 3H), 3.99 (s, 3H), 5.91 (s, 2H), 6.60-6.67 (s, 1H).

Preparation Example 28 S thesis of4bromo-2—metho -3 S—dimeth l I <1) <2) (3) \ N / NI / NI / (1) S thesis of3 5-dibromo-2—metho amine Amixture of2—methoxy—pyridin—4—ylamine (15 g) and NBS (47.3 g) was stirred in an acetic acid t (150 mL) at room temperature for three hours. The reaction mixture was concentrated under reduced pressure, and a 5 M aqueous sodium hydroxide solution (200 mL) was added to the residue at 0°C, ed by extraction with diethyl ether. The organic layer was directly puriﬁed by a silica gel pad (ethyl acetate/n—heptane, 10%) to give the title compound (32.4 g).

EST-MS m/z 283 [M + Hf" (2) Synthesis of2-methog—3,5-dimeﬂ1ylpm'din—4—amine A mixture of bromo—2—methoxypyridine—4—amine (16 g), trimethylboroxin (19.8 mL), Pd(dppt)C12-DCM complex (4.15 g) and potassium carbonate (23.5 g) was heated under reﬂux in a mixed t of 1,4—dioxane (320 mL) and water (32 mL) for 12 hours. The reaction mixture was cooled to room temperature and then concentrated under reduced pressure. Water and ethyl acetate were added to the e, followed by ﬁltration through CeliteTM. The ﬁltrate was extracted with ethyl acetate, and the organic layer was FP1100 subjected to a silica gel pad (NH-silica gel) and eluted with ethyl e. NH-silica gel (30 g) was added to the resulting solution, and the e was concentrated under reduced pressure. The residue was puriﬁed by NH silica gel column chromatography (ethyl e/n—heptane, 0% to 30%) to give the title nd (4.43 g).

ESI—MS m/z 153 [M+I—1]+ (3) Smthesis of4—bromo-2—methog5-3,5-dimethylpyg'dine Amixture ofcopper(1) bromide (12.1 g) and t—butyl nitrite (7.07 mL) was stirred in an acetonitrile solvent (80 mL) at 70°C for 10 minutes. A solution of oxy—3,5- dimethylpyridin—4—amine (3.9 g) in acetonitrile (40 mL) was added dropwise to the reaction mixture at the same temperature, and the mixture was stirred at 70°C for one hour. The reaction mixture was cooled to room temperature and then concentrated under reduced pressure. Ethyl acetate and a ted aqueous sodium bicarbonate solution were added to the residue, and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was ﬁltered through CeliteTM, and the ﬁltrate was extracted with ethyl acetate. The organic layer was concentrated under reduced pressure, and the residue was puriﬁed by NH silica gel column chromatography (n-heptane, 100%, then NH—silica gel pad, n-heptane, 100%) to give the title compound (4.3 g). 1H—NMR (400 MHz, CDC13) 5 (ppm): .29 (m, 3H), 2.29—2.31 (m, 3H), 3.93 (s, 3H), 7.77-7.84 (m, 1H).

ESI-MS m/z 216 [M+H]+ [$0243] Preparation Example 29 hhhhe hFthesis of ho -3 5—dimeth l din—4- lboronic acid (1) Synthesis of2-ﬂuoroi0do—5—methylp3g'dine Diisopropylamine (92 mL) was added to THF (1.2 L), and the mixture was cooled to -18°C in a nitrogen atmosphere. A 2.69 M solution of n—butyllithium in hexane (224 mL) was added dropwise to the solution. After completion of the dropwise addition, the mixture was warmed to -5°C with stirring over 20 minutes. The reaction mixture was cooled to - 3°C. A solution of 2-ﬂuoromethylpyridine (61 g) in THF (240 mL) was added dropwise to the reaction mixture. The reaction e was stirred at -75°C for 3.5 FP1100 hours. A solution of iodine (139 g) in THF (24 mL) was added dropwise to the reaction mixture. The reaction mixture was stirred at -75°C for one hour and 55 minutes. After completion of the reaction, water (220 mL) was added to the reaction mixture at the same temperature. The mixture was stirred at the same ature for ﬁve minutes. The reaction mixture was returned to room temperature, and water (1.2 L) was then added. A solution of sodium thiosulfate pentahydrate (136 g) in water (300 mL), and water (300 mL) were added to the mixture, followed by stirring for 10 s. The mixture was extracted with MTBE (1.2 L). The organic layer was washed with brine (500 mL). The combined aqueous layers were extracted with MTBE (1 L). The combined organic layers were dried over anhydrous magnesium sulfate. The desiccant was removed by ion, and the ﬁltrate was concentrated under reduced pressure. n—heptane was added to the residue, followed by cooling. The precipitated solid was collected by ﬁltration. The residue was washed with n—heptane. The ﬁltrate was cooled, and the precipitated solid was collected by ﬁltration This operation was repeated ﬁve times to give the title nd (109.69 g). 1H-NMR (400 MHz, CDC13) 8 (ppm): 2.29—2.31 (m, 3H), 7.93-8.14 (m, 2H).

ESI-MS m/z 238 W+H]+ (2) Smthesis of2—ﬂuoro-4—iodo-3,5-dimethylpmdine Diisopropylamine (88 mL) was added to THF (1.2 L), and the mixture was cooled to -18°C in a nitrogen atmosphere. A 2.69 M solution of n—butyllithium in hexane (215 mL) was added dropwise to the solution After completion of the dropwise addition, the mixture was warmed to -5°C with stirring over 30 minutes. The reaction mixture was cooled to -72°C. A solution of 2—ﬂuoroiodomethylpyridine (109.69 g) in THF (240 mL) was added dropwise to the reaction mixture. The reaction mixture was stirred at —74°C for 1.5 hours. A solution yl iodide (36 mL) in THF (160 mL) was added dropwise to the reaction e. The reaction e was stirred at -70°C to - 4°C for two hours.

After completion of the on, water (200 mL) was added to the reaction mixture at the same temperature. The e was stirred at the same temperature for two minutes. The reaction e was returned to room temperature, and water (1.2 L) was then added. The mixed solution was stirred for three s. Water (300 mL) was ﬁirther added. The 3O mixture was extracted with MTBE (1.2 L). The organic layer was washed with brine (500 mL). The combined aqueous layers were extracted with MTBE (1 L). The combined organic layers were dried over anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. n—heptane (100 mL) FP11—0553-00 was added to the residue, followed by cooling. The precipitated solid was collected by ﬁltration. The residue was washed with n-heptane. The ﬁltrate was cooled, and the precipitated solid was collected by ﬁltration. This operation was repeated twice to give the title compound (86.9 g). 1H—NMR (400 MHz, CDC13) 6 (ppm): 2.39-2.40 (m, 6H), 780-782 (m, 1H).

ESI-MS m/z 252 [M+H]+ (3) is of4-iodo-2—methoxy—3,5-dimethylpylidjne A 28% solution of sodium methoxide in methanol (185 mL) was added to 2- ﬂuoroiodo—3,5-dimethylpyridine (97.4 g) in THF (954 mL) at 20°C. The mixture was stirred at 55°C to 65°C for two hours. The reaction mixture was cooled and then partitioned by adding MTBE (1 L) and water (1 L). The organic layer was washed with brine. The combined aqueous layers were extracted with MTBE (500 mL x 2). The combined organic layers were dried over anhydrous magnesium sulfate. The ant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. n-heptane (50 mL) was added to the e, and the mixture was stirred at 0°C for one hour. The precipitated solid was collected by ion. The solid was washed with cooled n-heptane (10 mL). The title compound (42.6 g) was obtained. The ﬁltrate was concentrated under reduced re. n—heptane (5 mL) was added to the residue, and the mixture was stirred at 0°C for minutes. The precipitated solid was collected by ﬁltration The solid was washed with cooled ane (2 mL). The title compound (20.2 g) was obtained. The ﬁltrate was trated under reduced pressure. n—heptane (5 mL) was added to the residue, and the e was stirred at 0°C for 30 s. The precipitated solid was collected by ﬁltration.

The solid was washed with cooled n-heptane (2 mL). The title compound (10.7 g) was obtained The combined title compound (73.5 g) was obtained 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.33-2.34 (m, 3H), 2.36-2.38 (m, 3H), 3.92 (s, 3H), 7.76 (s, 1H).

EST-MS m/z 264 [M+H]+ (4) Smthesis oft2—methoxy—3,5-dimethylpmdin-4—yl )boronic acid methoxy—3,5-dimethylpyridine (2.0 g) in THF (40 mL) was cooled to - 78°C. A2.69 M solution of n—butyllithium in hexane (6.5 mL) was added dropwise to the solution over 10 minutes. The mixture was stirred at -78°C for 20 minutes. Triisopropyl borate (5.26 mL) was added dropwise to the mixture over ﬁve minutes. The mixture was d With warming to 20°C over 1.5 hours. Water was added to the reaction mixture, FPll—0553-00 followed by extraction with ethyl acetate. The aqueous layer was neutralized with citric acid. The aqueous layer was ted with ethyl acetate. The combined organic layers were dried over anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was then concentrated under d pressure. The residue was triturated by adding MTBE. The precipitated solid was collected by ﬁltration. This solid is called ﬁrst crop. The ﬁltrate was trated under reduced pressure. The residue was ted by adding MTBE. The precipitated title compound (551 mg) was collected by ﬁltration. The ﬁrst crop were suspended in ethyl acetate. Trituration was performed by adding a small amount ofMTBE. The precipitated title compound (553.3 mg) was collected by ﬁltration.

The ﬁltrate was concentrated under reduced pressure. The residue was tritmated by adding MTBE. The precipitated title compound (121.1 mg) was collected by ﬁltration The combined title compound (1.23 g) was obtained. 1H-NMR (400 MHz, CDC13) 5 (ppm): 2.19—2.20 (m, 3H), 2.23-2.24 (m, 3H), 3.91 (s, 3H), 4.94 (brs, 2H), 7.74 (s, 1H).

ESI-MS m/z 182 [M+H]+ [$0248] Preparation Example 30 thesis of3-bromo—6— diﬂuorometh 1 -2 th l (1)S thesis of3—bromo—6- romometh 1 -2 th l A e of 3-bromo—2,4,6—trimetlrylpy1idine (15.6 g), NBS (13.9 g) and beny peroxide (567 mg) was heated under reﬂux in a carbon tetrachloride solvent (300 mL) for two hours. The reaction mixture was cooled to room ature and then ﬁltered, and the ion residue was washed with carbon tetrachloride. The resulting ﬁltrate was trated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 10%) to give the title compound (8.00 g). 1H-NMR (400 MHz, CDC13) 5 (ppm): 2.39-2.42 (m, 3H), 2.66-2.69 (m, 3H), 4.44 (s, 2H), 7.15 (s, 1H). (2) Synthesis of5-bromo-4,6-dimethylpicolinaldehyde Sodium methoxide (1.16 g) was added to a solution of2-nitropropane (1.96 mL) in methanol (40 mL) at room temperature, and the mixture was stirred at the same temperature for 20 minutes. 3-bromo(bromomethyl)—2,4-dimethylpyridine (2.00 g) was added to the FP1100 reaction mixture, and the mixture was stirred at 50°C for ﬁve hours. The reaction mixture was trated under reduced pressure, and water was added to the residue, followed by extraction with ethyl acetate. The organic layer was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 50%) to give the title compound (565 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.42-2.55 (m, 3H), .85 (m, 3H), 7.60-7.70 (m, 1H), 10.00 (s, 11-1). (3) S thesis of3-bromo—6 diﬂuorometh l —2 4-dimeth l 'dine BAST (1.07 mL) was added to a solution of 5—bromo-4,6- dimethylpicolinealdehyde (565 mg) in DCM (10 mL) at 0°C, and the mixture was d while gradually warming to room temperature for 12 hours. A saturated aqueous sodium bicarbonate solution was added to the reaction mixture, followed by extraction with DCM.

The organic layer was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 50%) to give the title compound (415 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.47 (s, 31-1), 2.71 (s, 3H), 6.39-6.70 (m, 1H), 7.33 (s, 1H).

Preparation e 31 thesis of3-bromo- 6—ﬂuorometh l—2—metho h 1 dine réc:‘—*’ h: (1) S thesis of3-bromo- 6-ﬂuorometh lmetho -4—meth 1 'dine A mixture of 3-bromo-2—methoxy—4,6—dimethy1pyridine obtained in Preparation Example 26(2) (300 mg), NBS (247 mg) and l peroxide (10.1 mg) was heated under reﬂux in a carbon tetrachloride solvent (6 mL) for two hours. The reaction mixture was cooled to room temperature and then ﬁltered. The resulting e was concentrated under reduced pressure. The residue was dissolved in TBAF (5.55 mL, 1 M solution in THF), and the mixture was stirred at room temperature for two hours. The reaction mixture was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 5%) and subsequently by NH silica gel column chromatography (ethyl e/n-heptane, 0% to 5%) to give the title compound (136 553-00 mg).

ESI-MS m/z 234 [M + HT Preparation Example 32 S thesis of3-bromo ﬂuorometh 1 -2 4-dimeth 1 'dine Br ( 1 ) Br \ \ I I Br N/ F / (1) S thesis of3-bromo-6— ﬂuorometh l -2 4-dimeth l 'dine A mixture of 3-bromo(bromomethyl)—2,4-dimethylpyridine obtained in Preparation Example 30(1) (2.00 g) and TBAF (35.8 mL, 1 M solution in THF) was stirred at room temperature for two hours. The reaction e was concentrated under reduced pressure, and the residue was d by silica gel column tography (ethyl acetate/n- heptane, 0% to 50%) to give the title compound (572 mg). 1H—NMR (400 Nﬂiz, CDC13) 8 (ppm): 2.44 (s, 3H), 2.67 (s, 3H), 5.28—5.47 (m, 2H), 7.14- 7.19 (m, 1H).

Preparation Example 33 [S0256] thesis of3-bromo ﬂuorometh 1 -4 6-dimeth 1 (1) S thesis of3-bromo—2— romometh 1 -4 6-dimeth 1 'dine A mixture of 3-bromo-2,4,6-trimethylpyridine (15.6 g), NBS (13.9 g) and benzoyl peroxide (567 mg) was heated under reﬂux in a carbon hloride solvent (300 mL) for two hours. The reaction mixture was cooled to room temperature and then ﬁltered, and the ﬁltration residue was washed with carbon tetrachloride. The resulting ﬁltrate was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl e/n-heptane, 0% to 10%) to give the title compound (3.51 g). 1H—NMR (400 MHz, CDC13) 8 (ppm): .41 (m, 3H), 2.47 (s, 3H), 4.72 (s, 2H), 6.97 (s, 1H). (2) S thesis of3-bromo ﬂuorometh 1 —4 6-dimeth l 'dine A mixture of 3-bromo(bromomethyl)—4,6-dimethylpyridine (1.00 g) and TBAF (17.9 mL, 1 M solution in THF) was stirred at room temperature for two hours. The FP1100 reaction mixture was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 30%) to give the title compound (651 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.40 (s, 3H), 2.51 (s, 3H), .67 (m, 2H), 7.05 (s, 1H).

Preparation Example 34 thesis of3-bromo-2— diﬂuorometh l -4 6—dimeth l (l) S thesis of3-bromo—4 6-dimeth 1 icolinaldeh de Sodium methoxide (581 mg) was added to a solution of2—nitropropane (0.982 mL) in methanol (20 mL) at room temperature, and the e was stirred at the same temperature for 20 minutes. o(bromomethyl)-4,6—dimethylpyridine ed in Preparation Example 33(1) (1.00 g) was added to the reaction mixture, and the e was stirred at 50°C for ﬁve hours. The reaction e was concentrated under reduced pressure, and water was added to the residue, followed by extraction with ethyl acetate.

The organic layer was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 0% to 50%) to give the title compound (467 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.45-2.48 (m, 3H), 2.58 (s, 3H), 7.23-7.25 (m, 1H), 10.32 (s, 1H). (2) S thesis of3-bromo-2 diﬂuorometh l-4 6-dimeth l 'dine BAST (0.884 mL) was added to a solution of 3-bromo-4,6— dimethylpicolinealdehyde (467 mg) in DCM (10 mL) at 0°C, and the mixture was stirred while gradually warming to room temperature for 12 hours. A saturated aqueous sodium bicarbonate solution was added to the reaction mixture, followed by tion with DCM.

The organic layer was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl e/n—heptane, 0% to 50%) to give the title compound (362 mg). 1H—NMR (400 MHZ, CDC13) 5 (ppm): 2.43 (s, 3H), 2.54 (s, 3H), 6.81-7.10 (m, 1H), 7.16 (s, 1H).

FP1100 [$0262] ation Example 35 thesis of3-bromo ﬂuorometh l metho —4-meth l (l) S thesis of3-bromo-2 romometh l —6-metho meth l 'dine A mixture of 3-bromomethoxy—2,4—dimethylpyridine obtained in Preparation Example 22 (200 mg), NBS (165 mg) and benzoyl peroxide (6.73 mg) was heated under reﬂux in a carbon tetrachloride solvent (4 mL) for two hours. The reaction e was cooled to room temperature and then ﬁltered. The resulting ﬁltrate was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 5%) to give the title compound (126 mg).

EST—MS m/z 296 [M + H]+ (2) Smthesis omo—2jﬂuoromethyl)—6—methoxy—4—methylpmdine A mixture of 3—bromo(bromomethyl)methoxy—4-methylpyridine (126 mg) and TBAF (1.71 mL, 1 M solution in T'HF) was stirred at room temperature for two hours.

The on mixture was concentrated under reduced pressure, and the resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 10%) to give the title compound (37 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.35-2.42 (m, 3H), 3.89-3.97 (m, 3H), 5.42-5.59 (m, 2H), 6.65 (s, 1H).ESI-MS m/z 234 [M+H]+ [$0265] Preparation Example 36 thesis of3-bromo—4— eth l —6-metho meth 1 HO 0 HO HO (1) (2) (3) (4) \ \ I | Cl N/ Cl N/ \ol (l)S thesis of 2—chloro-6—meth l din-4— l methanol Borane—THF complex (16.5 mL, 1.06 M solution1n THF) was added to a solution of 2-chloromethylpyridine—4—carboxylic acid (2 g) in THF (10 mL), and the mixture was heated under reﬂux for 12 hours. 5 M hydrochloric acid was added to the on mixture, and the e was stirred at room temperature for 30 minutes. The reaction mixture was neutralized by adding a saturated aqueous sodium onate solution, followed by FP1100 extraction with ethyl acetate. The organic layer was trated under d pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, % to 50%) to give the title compound (1.75 g).

ESI-MS m/z 158 [M + HTr (2) is oftZ—metl’rom—6—methylpyg’din—4—yl lmethanol Sodium methoxide (11.3 mL, 28% solution in methanol) was added to a solution of (2-chloro-6—methylpyridin—4-yl)methanol (1.75 g) in DMF (18 mL), and the mixture was stirred at 80°C for 12 hours. uently, the reaction mixture was stirred at 120°C for seven hours. The on mixture was trated under reduced pressure, and a saturated aqueous ammonium chloride solution was added to the residue, followed by extraction with ethyl acetate. The organic layer was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, % to 70%) to give the title compound (1.1 g). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.76 (t, J=6.1 Hz, 1H), 2.45 (s, 31-1), 3.92 (s, 3H), 4.64 (d, J=6.1 Hz, 2H), 6.50-6.56 (rn, 1H), 6.68—6.73 (m, 11-1). (3) S thesis of 3-bromo-6—metho -2—meth 1 'din—4- l methanol Amixture of(2-methoxy—6-methylpyridin—4—yl)methanol (1.1 g) andNBS (1.34 g) was stirred in an acetic acid solvent (22 mL) at room temperature for 12 hours. A 5 M aqueous sodium ide solution was added to the reaction mixture, followed by 2O extraction with ethyl acetate. The organic layer was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column tography (ethyl acetate/n-heptane, % to 50%) to give the title compound (1.32 g).

ESI—MS m/z 234 [M + H]+ (4) S thesis omo-4 ﬂuorometh l -6—metho —2-meth l 'dine BAST (0.89 mL) was added to a solution of (3-bromomethoxy—2— methylpyridin—4—yl)methanol (800 mg) in DCM (16 mL) at -60°C, and the mixture was stirred while gradually warming to room temperature for two hours and stirred at room temperature for further one hour. A saturated aqueous sodium bicarbonate solution was added to the reaction mixture, followed by extraction with DCM. The organic layer was concentrated under reduced pressure, and the e was puriﬁed by silica gel column chromatography (ethyl e/n-heptane, 0% to 10%, then NH—silica gel, ethyl acetate/n- heptane, 0% to 5%) to give the title compound (632 mg). 1H-NMR (400 MHz, CDC13) 5 (ppm): 2.57 (5, 31-1), 3.91 (s, 3H), 5.29-5.47 (m, 2H), 6.70 (s, FP1100 1H).

ESI-MS m/z 234 [M + H]+ Preparation Example 37 S thesis of3-bromoch10ro-2—metho meth l N/C 61:; (in: 4141: (1) S thesis omo—2-chlorometh 1 'dine 3-amino-2—chloro-4—methylpyridine (2 g) was added to a mixed solvent of a 48% aqueous hydrogen bromide solution (17 mL) and water (12 mL). Sodium nitrite (2.5 g) was added to the solution at 0°C. Further, e (2.2 mL) was added. The reaction mixture was warmed to room temperature and stirred for 12 hours. The reaction mixture was partitioned by adding a 5 N aqueous sodium hydroxide on and ethyl e. The organic layer was washed with brine and then dried over anhydrous magnesium sulfate.

The desiccant was d by ﬁltration. The ﬁltrate was concentrated under reduced pressure to give the title compound (1.7 g). 1H—NMR (400 MHz, CDC13) 6 (ppm): 2.51 (s, 3H), 7.01-7.24 (m, 1H), 8.06—8.35 (m, 1H). (2) Smthesis of3-bromo—2-methoxy—4—methylp}1idine 3-bromo—2—chloromethylpyridine (1 g) was added to DMF (5.6 mL). Sodium methoxide (28% solution in ol, 4.6 mL) was added to the solution, and the mixture was stirred at 100°C for 12 hours. The reaction mixture was partitioned by adding ethyl acetate and water. The organic layer was dried over anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 5% to 30%) to give the title compound (1.1 g). 1H—NMR (400 MHZ, CDC13) 6 (ppm): 2.40 (s, 3H), 4.00 (s, 3H), 6.77 (d, J=5.1 Hz, 1H), 7.94 (d, J=5.1 Hz, 1H). (3) is of3-bromo—5chlom—Z—meﬂioy—4-methylpmdine 3-bromomethoxy—4-methylpyridine (100 mg) was added to DMF (575 uL).

NCS (72.5 mg) was added to the solution, and the mixture was stiired at 80°C for three hours. The reaction mixture was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 5% to FP1100 %) to give the title compound (100 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.51 (s, 3H), 3.98 (s, 3H), 8.02 (s, 11-1).

Preparation Example 38 thesis of3-bromo--ﬂuoro-2 th 1 .frﬁrm 2—amino-5—bromo—4,6—dimethylpyridine (2 g) was suspended in ﬂuoroboric acid (48% aqueous on, 7.5 mL). Sodium nitrite (890 mg) dissolved in water (3 mL) was added to the solution at 0°C. The reaction mixture was stirred at 0°C for 10 minutes. The precipitated solid was collected by ﬁltration and suspended in n—heptane (100 mL). The on was stirred with heating under reﬂux for two hours. After cooling to room temperature, the precipitated solid was collected by ﬁltration. The resulting solid was dried under reduced pressure to give the title compound (500 mg). 1H—NMR (400 MHZ, CDCl3) 8 (ppm): 2.43 (s, 3H), 2.62 (s, 3H), 6.67 (s, 11-1).

Preparation Example 39 S thesis omochloro-2 6—dimeth l nwiwr (1) Smthesis of4-chloro—2,6dimethylpyrjdin 2,6-dimethyl—4-hydroxypyridine (l g) was added to phosphoryl chloride (5 mL).

The solution was stirred at 100°C for six hours. The reaction mixture was partitioned by adding water, a 5 N s sodium hydroxide solution and ethyl acetate. The organic layer was washed with brine and then dried over anhydrous magnesium sulfate. The desiccant was removed by ion The ﬁltrate was concentrated under reduced pressure to give the title compound (1.15 g). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.51 (s, 6H), 6.99 (s, 21-1).

[0278] (2) Smthesis of3—bromochloro-2,6-dimethylpm'dine ro-2,6-dimethylpyridine (1.5 g) was added to a mixed solvent of triﬂuoroacetic acid (3 mL) and concentrated ic acid (6 mL). NBS (2.2 g) was added to the solution, and the mixture was stirred at room temperature for 12 hours. A 5 N aqueous sodium hydroxide solution was added to the reaction mixture, followed by FP11—0553—00 separation with ethyl acetate. The c layer was washed with brine and then dried over anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 5% to 30%) to give the title compound (500 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.46 (s, 3H), 2.49 (s, 3H), 7.11 (s, 1H).

ESI-MS m/z 222 [M+I—1]+ Preparation Example 40 S thesis of3—bromochloro—2-metho -4 6—dimeth 1 f11596531 (1) S thesis of2—metho -4 th l 'dine 2—chloro-4,6-dimethylpyridine (CAS number: 30838—93—8) (400 mg) was added to DMF (3.3 mL). Sodium methoxide (28% solution in methanol, 2.6 mL) was added to the solution, and the mixture was stirred at 100°C for 12 hours. The reaction mixture was partitioned by adding ethyl acetate and water. The organic layer was dried over anhydrous magnesium sulfate. The desiccant was removed by ﬁltration. The ﬁltrate was concentrated under reduced pressure to give the title compound (380 mg) as a 50% solution in DMF. 1H-NMR (400 MHz, CDC13) 5 (ppm): 2.24 (s, 3H), 2.40 (s, 3H), 3.89 (s, 3H), 6.35 (s, 1H), 6.56 (s, 1H). (2) Smthesis of3-bromo-5chloro-Z-methoxy—4,6—dimethylp}g'dine 2—methoxy—4,6—dimethylpyridine (380 mg) was added to DMF (3 mL). NCS (407 mg) was added to the solution, and the mixture was stirred at 80°C for one hour.

Thereatter, NBS (542 mg) was added to the solution, followed by stirring for one hour. The on mixture was concentrated under reduced pressure. The resulting residue was d by silica gel column tography (ethyl e/n-heptane, 5% to 30%) to give the title compound (600 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.50 (s, 3H), 2.51 (s, 3H), 3.97 (s, 3H).

ESI—MS m/z 252 [M+H]’r

[0282] ation Example 41 553-00 S thesis of3-bromo—5-ﬂuoro—2—metho methl 'dine F Br F (1) F Br (2) F Br (3) \ \ \ | I I / / {j / N/ o N NH2 N NH2 N CI | (1) S thesis of3-bromo-5—ﬂuoro-4—meth 1 'd 1- -amine -ﬂuoromethylpyridy1—2—amine (2 g) was added to acetonitrile (14 mL). NBS (3.1 g) was added to the solution. The reaction mixture was d at room temperature for ﬁve hours. The reaction mixture was trated under reduced pressure, and the resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, % to 30%) to give the title compound (2.4 g). 1H—NMR (400 MHZ, CDC13) 5 (ppm): 2.33 (s, 3H), 4.82 (hrs, 2H), 7.84 (s, 1H).

ESI—MS m/z 207 [M+H]+ (2) Smthesis of3-bromo-2—chloro—5-ﬂuoromethylpm'dine 3-bromoﬂuoromethy1pyridy1— —amine (2.4 g) was added to a mixed solvent of concentrated hydrochloric acid (11 mL) and water (11 mL). Sodium nitrite (2.1 g) and coppera) chloride (3.5 g) were added to the solution, and the mixture was stirred at room temperature for 12 hours. A5 N aqueous sodium hydroxide solution and ethyl acetate were added to the reaction mixture, and the insoluble matter was removed by ﬁltration through a glass ﬁlter. The e was separated. The organic layer was washed with brine and dried over anhydrous magnesium sulfate. The desiccant was d by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column tography (ethyl acetate/n-heptane, 5% to 30%) to give the title compound (340 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.44 (s, 3H), 8.16 (s, 1H).

ESI—MS m/z 226 mm]+ (3) Smthesis of3-bromoﬂuoromethoxy—4—methylpmdine o-2—chloro—5-ﬂuoromethylpyridine (340 mg) was added to DMF (1.8 mL). Sodium methoxide (28% solution in methanol, 5.4 mL) was added to the solution, and the mixture was stirred at 80°C for two hours. Water was added to the reaction mixture. The precipitated solid was collected by ﬁltration to give the title compound (240 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.38 (s, 3H), 3.92 (s, 3H), 7.86 (s, 1H).

FP1100 ESI-MS m/z 222 [M+I—1]+ Preparation Example 42 S thesis of5-bromo—4 6-dimeth l icolinonitrile / / (1) S thesis of5-amino—4 omo icolinonitrile -amino-2—cyanopyridine (2 g) was added to a 48% aqueous hydrogen bromide on (14 mL). Bromine (2.2 mL) was added to the solution at 0°C. The reaction mixture was warmed to room temperature and stirred for six hours. The precipitated solid was collected by ﬁltration to give the title compound (4.5 g). 1H—NMR (400 MHz, CDC13) 8 (ppm): 5.09 (brs, 2H), 7.69 (s, 1H).

EST-MS m/z 278 [M + I—I]+ (2) is of 5-amino—4,6-dimethylpicolinonitrile 4,6-dibromoamino—2—cyanopyridine (1 g) was dissolved in a mixed solvent of 1,4-dioxane (10 mL) and water (1 mL). Trimethylboroxin (1.3 g), Pd(dppt)C12—DCM complex (264 mg) and potassium carbonate (1.5 mg) were added to the solution, and the mixture was reacted using a microwave reactor at 140°C for four hours. The reaction mixture was returned to room temperature and then ioned by adding ethyl acetate and water. The organic layer was washed with brine and dried over anhydrous magnesium e. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 0% to 100%) to give the title compound (390 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.18 (s, 3H), 2.44 (s, 3H), 4.05 (brs, 2H), 7.28 (s, 11-1). (3) Synthesis omo-4,6-dimethylpicolinonitrile —amino-4,6-dimethylpicolinonitrile (390 mg) was added to aqueous hydrogen bromide (2.9 mL). Bromine (164 pl) and sodium nitrite (467 mg) were added to the on at 0°C. The on was warmed to room ature and stirred for four hours.

A 5 N aqueous sodium ide solution was added to the reaction mixture, followed by separation with ethyl acetate. The organic layer was washed with brine and then dried using magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 0% to 30%) to give the title compound FP1100 (300 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.47 (s, 3H), 2.72 (s, 3H), 7.40 (s, 1H).

ESI—MS m/z 213 [M+H]+ Preparation Example 43 S thesis of3—bromo—6— diﬂuorometho -2 4-dimeth l 'dine he" 1311 HO N/ FAQ N/ (1) S thesis of3—bromo diﬂuorometho —2 th l 'dine A mixture of o—4,6-dimethylpyridin—2—ol obtained in Preparation Example 23(1) (500 mg), 2—(ﬂuorosulfony1)diﬂuoroacetic acid (0.307 mL) and sodium sulfate (70.3 mg) was stirred in an acetonitrile solvent (10 mL) at room temperature for 3.5 hours. A saturated aqueous sodium bicarbonate solution was added to the reaction mixture, and the mixture was then concentrated under reduced pressure. The residue was extracted with ethyl e, and the organic layer was concentrated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 0% to 10%) to give the title nd (68.6 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.38-2.41 (m, 3H), 2.57—2.60 (m, 3H), 6.61—6.64 (m, 1H), 7.25—7.63 (m, 1H).

EST-MS m/z 252 [M+H]+ Preparation Example 44 [$0292] 81:51:61erthesis omo-2—etho meth l dine 3-bromochlor0methylpyridine obtained in Preparation Example 37(1) (1 g) was added to a mixed solvent ofethanol (2 mL) and DMF (5.6 mL). Sodium hydride (60% oil dispersion, 58 mg) was added to the solution, and the mixture was stirred at 100°C for ﬁve hours. The reaction mixture was partitioned by adding ethyl acetate and water. The organic layer was dried over anhydrous magnesium e. The ant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The resulting e was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 5% to 30%) to FPll00 give the title compound (40% solution in ane, 250 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.43 (t, J=7.0 Hz, 3H), 2.39 (s, 3H), 4.41 (q, J=7.0 Hz, 2H), 6.57-6.88 (m, 1H), 7.80-8.04 (m, 1H).

Preparation Example 45 thesis of2— diﬂuorometho iodo-3 5-dimeth 1 $1 $1 i; t 1 1 Sﬂthesis of4-iodo-3,5-dimethylpm'din—2—ol -2—methoxy—3,5-methylpyn'dine obtained in Preparation Example 29(3) (3 g) and sodium iodide (4.27 g) were added to acetonitrile (132 mL), and the mixture was stirred at room ature for one hour. Chlorotrimethylsilane (3.61 mL) was added to the mixed solution, and the mixture was stirred at room temperattue for 30 minutes and then at 70°C for ﬁve hours. The reaction mixture was cooled to room temperature, and water and chloroform were then added. The precipitated solid was ted by ﬁltration to give the title compound (2.33 g). 1H-NMR (400 MHz, DMSO—d6) 6 (ppm): 2.10 (s, 3H), 2.20 (s, 3H), 7.15 (s, 1H), 11.59 (brs, 1H).

ESI—MS m/z 250 [M+H]+ 2 S thesis of2— diﬂuorometho iodo-3 th l 'dine 4-iodo-3,5-dimethylpyridin—2-ol (350 mg), 2-(ﬂuoros1ﬂfonyl)diﬂuoroacetic acid (0.17 mL), and sodium sulfate (39.9 mg) were added to acetonitrile (5.7 mL). The mixture was stirred at room temperature for 3.5 hours. A saturated aqueous sodium bicarbonate solution was added to the reaction mixture, followed by extraction with ethyl e. The organic layer was concentrated under reduced pressure to give the title compound (378.6 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm). 2.39 (s, 31-1), 2.43 (s, 3H), 7.42 (t, J=72.0 Hz, 1H), 7.79 (s,1H).

EST-MS m/z 300 ﬂ\/I+I—1]+ Preparation Example 46 Smthesis of2-ethoy—4—iodo—3,S-dimethylpmdine FP1100 |\| (1) \l N/ Nl/ F ()\l A20% solution of sodium de in ethanol (1.23 mL) was added to a solution of2-ﬂuor0-4—iodo—3,5-dimethylpyridine obtained in Preparation Example 29(2) (400 mg) in THF (5 mL), and the mixed solution was stirred at room ature overnight. The reaction mixture was cooled at 0°C, and MTBE (20 mL) and water (20 mL) were then added. The organic layer was separated. The organic layer was washed with brine. The combined aqueous layers were extracted with MTBE. The combined organic layers were dried over anhydrous magnesium sulfate and ﬁltered. The ﬁltrate was concentrated under reduced pressure to give the title nd (423.8 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.38 (t, J=7.0 Hz 3H), 2.32 (s, 3H), 2.37 (s, 3H), 4.33 (q, J=7.0 Hz, 2H), 7.74 (s, 1H).

ESI—MS m/z 278 [M+H]+ Preparation e 47 S thesis of4—iodo-2—iso ro lo -3 5—dimeth l 'dine |\I (1) \l N/ NI/ 07/ Sodium hydride (60% oil dispersion, 191 mg) was added to a solution ofIPA (0.77 mL) in THF (5 mL). After g was stopped, a solution of 2-ﬂuoroiodo-3,5- dimethylpyridine obtained in Preparation Example 29 (500 mg) in THF (5 mL) was added to the solution, and the mixture was stirred at room temperature for two hours. The mixture was stirred at 50°C for two hours, and the reaction mixture was then cooled to room temperature. The reaction mixture was cooled at 0°C, and MTBE (20 mL) and water (20 mL) were then added. The organic layer was separated. The organic layer was washed with brine. The ed aqueous layers were extracted with MTBE. The combined organic layers were dried over anhydrous magnesium e and ﬁltered. The ﬁltrate was concentrated under reduced pressure to give the title compound (490 mg). 553—00 1H—NMR (400 MHZ, CDC13) 8 (ppm): 1.33 (d, J=6.3 HZ, 6H), 2.31-2.32 (m, 3H), 2.34-2.35 (m, 3H), 5.21-5.27 (m, 1H), 7.73-7.75 (m, 1H).

ESI-MS m/z 292 [M+H]Jr Preparation Example 48 S thesis of3-bromo6—iso roIﬁrﬁlmlo —2 4-dimeth l KTB (222 mg) was added to a suspension of 5-bromo—4,6—dimethylpyridin—2—ol obtained in Preparation Example 23(1) (400 mg) in DME (2 mL), and the mixture was d at room ature for 30 minutes. Potassium carbonate (192 mg) and 2- iodopropane (572 mg) were added to the on mixture. The mixture was heated under reﬂux overnight. The reaction mixture was cooled to room temperature, and the insoluble matter was removed by ﬁltration and washed with DME. The ﬁltrate was concentrated under reduced pressure. Chloroform was added to the residue. The solution was washed with a 0.1 N aqueous hydrochloric acid on The organic layer was dried over anhydrous magnesium sulfate and ﬁltered. The ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 10% to 50%) to give the title compound (133.9 mg). 1H—NMR (400 MHZ, CDC13) 8 (ppm): 1.31 (d, J=6.25 HZ, 6H), 2.32 (s, 3H), 2.25 (s, 3H), .17-5.27 (m, 1H), 6.37-6.46 (m, 1H).

ESI-MS m/Z 244 [M+H]+ Preparation Example 49 S thesis of3-eth l—4—iodo-2—metho meth l 'dine 1 S thesis of3-eth 1ﬂuoro—4-iodometh l 'dirre The title compound was synthesized in accordance with ation Examples 29(2) and 29(3) using 2—ﬂuoro—3-iodomethylpyridine and ethyl iodide as raw materials.

However, the temperature was gradually raised to -17°C after adding ethyl . 1H-NMR (400 MHZ, CDC13) 8 (ppm): 1.11-1.22 (m, 3H), 2.35-2.45 (m, 3H), 2.80-2.91 (m, FPll00 2H), 7.81 (s, 1H) 2 S thesis of3-eth 1—4—iodo-2—metho —5-meth l 'dine The title compound was synthesized in accordance with Preparation Example 29(3) using 3-ethylﬂuoro—4—iodo—5-methylpyridine. 1H—NMR (400 MHZ, CDC13) 8 (ppm): 1.04-1.13 (m, 3H), 2.29-2.37 (m, 3H), 2.83 (q, J=7.42 Hz, 2H), 389—3 .93 (m, 3H), 7.76 (s, 1H) Preparation Example 50 S thesis of4- o-3 5—dimeth l hen l —3 6-dih dro-2H-

[0306] (1) S thesis of4-bromo—3 5—dimeth l hen ltriﬂuoromethanesulfonate romethanesulfonic anhydride (2.0 mL) was added dropwise to a solution of 4—bromo-3,5-dimethylphenol (CAS No. 74636) (2.0 g) and TEA (1.94 mL) in DCM (20 mL) under oling over three minutes. The reaction mixture was stirred at room temperature for 30 minutes. Ice and ethyl acetate were added to the reaction mixture, and the organic layer was separated. The organic layer was sequentially washed with 1 N hloric acid, water, a saturated aqueous sodium onate solution and brine, dried over anhydrous magnesium sulfate, ﬁltered and concentrated under d pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, %) to give the title compound (3 .20 g). 1H—NMR (400 MHZ, CDC13) 5 (ppm): 2.45 (s, 6H), 7.01 (s, 21-1). (2) is of4-t 4-bromo-3,5-dimethylphenyl )—3,6—dihydro-2H—pyrin Potassium carbonate (1.99 g) and Pd(dppt)C12-DCM complex (196 mg) were added to a solution of 4-bromo-3,5-dimethylphenyl triﬂuoromethanesulfonate (1.6 g) and 3,6-dihydro—2H—pyran—4-boronic acid pinacol ester (CAS No. 2879445) (1.11 g) in DMF (16 mL). The reaction mixture was stirred at 85°C for four hours. The reaction mixture was returned to room temperature, and the reaction mixture was then concentrated under reduced pressure. MTBE, water and brine were added to the residue, and the organic layer was separated. The organic layer was washed with brine, dried over ous magnesium sulfate, ﬁltered and concentrated under d pressure. The resulting residue was FPll00 puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 2%) to give the title compound (747 mg). 1H-NMR (400 MHZ, CDC13) 8 (ppm): 2.42 (s, 6H), 2.45-2.51 (m, 2H), 3.92 (t, J=5.6 Hz, 2H), 4.30 (dd, J=6.0, 2.8 Hz, 2H), 6.08-6.12 (m, 1H), 7.09 (s, 2H).

ESI-MS m/z 267, 269 [M+H]+ Preparation Example 51 S thesis of3-bromo—6-etho -2 4—dimeth 1 'dine Br Br \ \ i —> ! HO N/ /\o N/ A mixture of 5-bromo-4,6—dimethylpyridin—2—ol obtained in ation Example 23(1) (50 mg), ethyl iodide (2.0 mL) and silver carbonate (1.4 g) was stirred in a chloroform solvent (10 mL) at room temperature for 36 hours. The on mixture was subjected to silica gel pad and eluted with a mixed solvent of (ethyl acetate/n—heptane, 10%). The resulting on was concentrated under reduced pressure to give the title compound (550 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.36 (t, J=7.0 Hz, 3H), 2.33 (s, 3H), 2.56 (s, 3H), 4.27 (q, J=7.0 Hz, 21-1), 6.44 (s, 1H) ESI-MS m/z 232 [NIH—1]+ Preparation Example 52 Synthesis of H-benyl 2—(tetrahydroﬁ1ran—3-yl)hydrazinecarboxylate and 1+?le 2- 2O tteﬂ‘ahydroﬁiranyl)hydrazinecarboglate HN-—NH HN’NL/‘I HN—NH C. ”C. b.

A saturated aqueous sodium bicarbonate solution (30 mL) was added to a solution of(i)-benzyl 2—(tetrahydroﬁ11an—3—y1)hydrazinecarboxylate obtained in Preparation Example 12—(2) (11.5 g) in MTBE (110 mL). The mixture was stirred for 10 minutes at room temperature, and the c layer was then separated. The resulting c layer was sequentially washed with saturated sodium bicarbonate and brine and dried over anhydrous magnesium e, and the desiccant was removed by ﬁltration. The ﬁltrate was concentrated under reduced re. The resulting residue was puriﬁed by silica gel FP1100 column chromatography (ethyl e/hexane, 25 to 50%), and the target ﬁaction was concentrated. Diethyl ether (30 mL) and hexane (15 mL) were added to the residue. The precipitated solid was collected by ﬁltration and dried under reduced pressure to give pure (i)—benzyl 2—(tetrahydroﬁrran—3-yl)hydrazinecarboxylate (6.17 g).

This product was dissolved in l and ﬁltered through a millipore ﬁlter. The resulting ﬁltrate was optically resolved under two conditions. Condition 1: OD-H (20 mm (PX 250 mm L), 20% IPA-hexane, 25 mL/min. Condition 2: AD-H (20 mm(I> x 250 mm L), 20% IPA-hexane, 24 mL/min. The target fraction was concentrated to give the title compound with a short retention time and a (—) optical rotation (2.60 g, >99% ee [OD-H, 20% IPA/hexane, retention time=11.2 min]), and the title compound with along retention time and a (+) optical rotation (2.59 g, 97.2% ee [OD-H, 20% IPA/hexane, retention time = 12.4 min]).

Preparation Example 53 Smthesis ofg S )—ttetrahydroﬁ1ran—3-yl )hydrazine hloride HN—NH HN'NHZ i ——> H01 /’ 5/ (-)-Benzyl rahydroﬁnan—3-yl)hydrazinecarboxylate (50 g) was dissolved in methanol (500 mL), and di-t—butyl dicarbonate (92.4 g) and palladium carbon (50% wet) (5 g) were added. The mixture was stirred at 25°C and 15 psi for 48 hours in a hydrogen atmosphere. The reaction e was d, and the ﬁltrate was concentrated under d pressure. The resulting residue was dissolved in diisopropyl ether (300 mL).

After cooling at 0°C, hydrochloric iisopropyl ether (500 mL) was added to the solution.

The mixture was stirred at 10°C for 14 hours. The itated solid was collected by ﬁltration The same operation from (—)-benzyl 2—(tetrahydroﬁrran—3- yl)hydrazinecarboxy1ate (70 g) was performed nine times, and the same operation from (-)- benzyl rahydroﬁiranyl)hydrazinecarboxylate (50 g) was performed once. The resulting solid was triturated with DCM/ethanol (10/1) (1 L) for two hours. The precipitated solid was collected by ﬁltration The resulting solid was dried under reduced pressure to give the title compound (235 g). 1H—NMR (400 MHZ, DMSO—dg) 6 (ppm): 1.87-2.09 (m, 2H), 3.55-3.71 (m, 2H), 3.71-3.84 (In, 3H)- FP11-0553—00 Both ofthe optical rotation ofthe Z-derivative ofthe title compound and the l rotation ofthe Z-derivative of (S)-(tetrahydroﬁ1ran—3-yl)hydrazine hydrochloride obtained in Preparation Example 14 are negative. The retention times of both compounds were identical according to chiral HPLC analysis.

The absolute conﬁguration ofthe resulting title nd was conﬁrmed to be an (S)—form according to X—ray crystallography. The result is shown in Figure 1 as its ORTEP representalion (ﬂack parameter = -0.05). [03 13] Preparation e 54 Smthesis of( 3)—ttetrahydroﬁ1ran—3—yl )hydrazine hydrochloride HN——NH HN'NHz e —~ m» The title nd was obtained by the same method as in ation Example 53 ﬁom (+)-benzyl 2-(tetrahydroﬁiranyl)hydrazinecarboxylate. 1H—NMR (400 MHZ, DMSO'dé) 5 (ppm): 1.85-2.07 (m, 2H), 3.55-3.71 (m, 2H), 3.71-3.80 (In, 3H)-

[0315] Example 1 S thesi of 7- 26-dimeth l hen l -l- tetrah dro-2H— l-lH— lo 43— clguinolin—415ﬂ2-one 7-chloro(2,4-dimethoxybenzyl)-1—(tetrahydro—2H—pyran—4—yl)—lH—pyrazolo[4,3- c]quinolin—4(5H)-one obtained in ation Example 2 (100 mg) was dissolved in DMF (3.3 mL). 2,6-dimethylphenylboronic acid (33 mg), Pd(PPh3)4 (13 mg), potassium carbonate (91 mg) and water (0.7 mL) were added to the solution, and the mixture was d using a microwave reactor at 150°C for two hours. The reaction mixture was returned to room temperature and then concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 30% to 50% to 80%) to give 5-(2,4—dimethoxybenzyl)(2,6-dimethy1phenyl)—1-(tetrahydro—2H— FPll-0553—00 pyran—4-yl)-1H-pyrazolo[4,3-c]quinolin—4(5H)—one (80 mg). The 5-(2,4- dimethoxybenzyl)—7—(2,6—djmethy1phenyl)(tetrahydro—2H—pyran—4—yl)—lH—pyrazolo[4,3- c]quinolin—4(5H)—one (75 mg) was dissolved in TFA (1 mL), and the mixture was stirred at 65°C for two hours. The reaction mixture was cooled to room temperature and then concentrated under reduced pressure. The resulting residue was neutralized by adding a saturated aqueous sodium bicarbonate solution. The aqueous solution was extracted with DCM. The organic layer was dried over anhydrous magnesium sulfate. The desiccant was removed by ﬁltration. The ﬁltrate was concentrated under reduced pressure. The ing residue was puriﬁed by silica gel column chromatography (ethyl e/n—heptane, 50% to 70% to 80%) to give the title compound (10 mg). 1H—NMR (400 MHZ, CDC13) 8 (ppm): 2.06 (s, 6H), 2.18-2.22 (m, 2H), .60 (m, 2H), 3.69-3.78 (m, 2H), .26 (m, 2H), 5.00-5.10 (m, 1H), 7.09-7.26 (m, 5H), 8.03 (d, J=8.4 Hz, 1H), 8.31 (s, 1H), 8.83 (5, 11-1).

ESI—MS m/z 374 [M+H]+

[0317] e 2 The title compound was obtained by the same method as in Example 1 from 7- chloro-S-(2,4—dimethoxybenzyl)—l-(tetrahydro—2H—pyran—4—yl)—1H-pyrazolo[4,3-c]quinolin— 4(5H)-one obtained in Preparation Example 2 and (2,4,6-trimethy1pyridinyl)boronic acid obtained in Preparation Example 19. 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.05 (s, 3H), 2.17-2.21 (m, 2H), 2.29 (s, 3H), 2.48— 2.60 (m, 2H), 2.57 (s, 3H), 367-3 .76 (m, 2H), 4.20—4.28 (m, 2H), 5.01-5.11 (m, 1H), 6.99 (s, 1H), 7.13 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.27 (d, J=1.6 Hz, 1H), 8.05 (d, J=8.2 Hz, 1H), 8.31 (s, 1H), 10.60 (s, 1H).

ESI—MS m/z 389 [M+H]+ Example 3 S thesis FP1100 9mm]4,3-c lguinolin—4t5ﬂ )-one 7—bromo-5—(2,4-dimethoxybenzyl)—1-(tetrahydro-2H—pyran—4—y1)-1H—pyrazolo[4,3- c]quinolin—4(51-I)-one ed in Preparation Example 1(4) (41 mg) was dissolved in DMF (2 mL). (6-methoxy—2,4—dimethylpyridin—3—yl)boronic acid obtained in Preparation Example 24 (15 mg), Pd(PPh3)4 (4.8 mg), cesium carbonate (54 mg) and water (0.5 mL) were added to the solution, and the mixture was d using a microwave reactor at 150°C for two hours. The reaction mixture was returned to room temperature and then trated under reduced pressure. The resulting residue was ved in TFA (1 mL), and the mixture was stirred at 65°C for two hours. The reaction mixture was cooled to room temperature and then trated under reduced pressure. The resulting residue was lized by adding a 5 N aqueous sodium hydroxide solution. The aqueous solution was extracted with DCM. The organic layer was dried over anhydrous magnesium e.

The desiccant was removed by ﬁltration The ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column cinematography (ethyl acetate/n—heptane, 50% to 100%) to give the title compound (3.7 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.03 (s, 3H), 2.17—2.21 (m, 2H), 2.22 (s, 3H), 2.48— 2.60 (m, 2H), 3.67-3.76 (m, 2H), 3.97 (5, 31-1), 4.20-4.28 (m, 2H), 5.01-5.11 (m, 1H), 6.55 (s, 1H), 7.13 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.19 (d, J=1.6 Hz, 1H), 8.03 (d, J=8.2 Hz, 1H), 8.32 (s, 1H), 10.60 (s, 1H).

ESI-MS m/z 405 [M+H]+ Example 4 -(2,4-dimethoxybenzyl)— 1 -(tetrahydro-2H-pyran—4—yl)—7-(4,4,5,5-tettamethyl- FP11—0553-00 1,3,2—dioxaborolan—2—yl)—1H-pyrazolo[4,3-c]quinolin—4(5H)—one (100 mg) obtained in Preparation Example 1(5) was dissolved in 1,4-dioxane (4 mL). 3-chloro-2—methoxy—4,6— dimethylpyridine obtained in Preparation Example 25 (47.2 mg), [(t—Bu)2P(OI-I)]2PdC12 (4.6 mg), cesium carbonate (119 mg) and water (1 mL) were added to the solution, and the mixture was reacted using a microwave reactor at 130°C for four hours. The reaction mixture was extracted with DCM. The organic layer was washed with brine and dried over sodium sulfate. The desiccant was removed by ion, and the ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl e/n—heptane, 50% to 100%) to give a 1:1 mixture of 5—(2,4- 1 0 dimethoxybenzyl)—7—(2-methoxy—4,6-dimethylpyridin—3—yl)(tet1ahydro—2H—pyran—4—yl)— 1H—pyrazolo[4,3-c]quinolin—4(5H)—one and 5-(2,4—dimethoxybenzyl)—1-(tet1ahydro-2H— pyran—4-yl)-1H—pyrazolo[4,3—c]quinolin—4(51-I)—one (76 mg). The mixture (76 mg) was dissolved in TFA (1.5 mL), and the mixture was stirred at 65°C for three hours. The on mixture was concentrated under reduced pressure. DCM and a saturated aqueous sodium onate solution were added to the resulting residue, followed by tion with DCM. The organic layer was washed with brine and dried over sodium sulfate. The desiccant was removed by ﬁltration, and the e was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 50% to 100%) to give the title compound (22 mg). 1H—NMR (400 MHZ, CDCl3) 5 (ppm): 2.10 (s, 3H), .23 (m, 2H), 2.47-2.59 (m, 2H), 2.48 (s, 3H), 3.65-3.73 (m, 2H), 3.86 (s, 3H), 4.20-4.26 (m, 2H), 5.01—5.10(m, 1H), 6.74 (s, 1H), 7.20 (dd, J=8.4 Hz, 1.6 Hz, 1H), 7.27 (d, J=1.6 Hz, 1H), 8.01 (d, J=8.4 Hz, 1H), 8.30 (s, 1H), 10.01 (s, 1H).

ESI—MS m/z 405 [M+I—1]+

[0322] Example 5 (1) S thesis of eth 15- 2—ﬂuoro—4- 2—metho —4 th 1 'din l hen l— FP1100 1- tetrah dro-2H- —4— l-lH— ole—4-carbo late Water (5 mL), 3-bromo-2—methoxy-4,6—dimethylpyridine obtained in Preparation Example 26 (784 mg), Pd(PPh3)4 (380 mg) and cesium carbonate (2.36 g) were added to a solution of ethyl 5-[2-ﬂuoro(4,4,5,5-tetramethyl-1,3,2-dioxaborolan—2—yl)phenyl]—1- (tetrahydro—2H—pyran—4-yl)—lH—pyrazole—4—carboxylate obtained in Preparation Example 3 (2.04 g) in 1,4—dioxane (20 mL), and the reaction mixture was d at 110°C for two hours in a nitrogen atmosphere. The reaction mixture was returned to room temperature and then ﬁltered h CeliteTM. The ﬁltrate was concentrated under reduced pressure. Ethyl acetate (100 mL) and water (100 mL) were added to the residue. The aqueous layer was extracted with ethyl acetate (50 mL x 2). The combined organic layers were dried over anhydrous magnesium sulfate and ﬁltered, and the ﬁltrate was concentrated under reduced pressure. The residue was puriﬁed by NH silica gel column chromatography (ethyl acetate/n—heptane, 10% to 23%). The title compound obtained by the same method (578 mg) was combined, and the combined product was puriﬁed again by silica gel column chromatography (ethyl acetate/n—heptane, 50% to 70%) to give the title compound (2.07 g). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.11—1.18 (m, 3H), 1.72-1.80 (m, 1H), .92 (m, 1H), 2.14 (s, 3H), .48 (m, 5H), 3.35-3.46 (m, 2H), 3.88 (s, 3H), 4.03-4.18 (m, 5H), 6.71-6.73 (m, 1H), 7.08—7.15 (m, 2H), 7.30-7.35 (m, 1H), 8.09-8.10 (m, 1H).

EST-MS m/z 454 [M+H]+

[0324] (2) S thesis of 5- 2—ﬂuoro-4— 2—metho —4 6—dimeth l 'din—3— l hen l -l- ttetrahydro—ZH—pym-4—ylHH—pmle—Lcarboxamide Ethyl 5-[2-ﬂuoro(2-methoxy—4,6—dimetl:1ylpyridin—3—yl)phenyl](tetrahydro- 2H—pyran—4—yl]—1H—pyrazelecarboxylate (2.06 g) was added to ethanol (30 mL). After ng the suspension at 60°C for three minutes, a 5 N aqueous sodium hydroxide solution (3.6 mL) was added, and the e was stirred at 60°C to 70°C for one hour. The reaction mixture was cooled to room temperature and then concentrated under reduced pressure. Chloroform (20 mL) and 5 N hydrochloric acid (6 mL) were added to the residue. The precipitated solid was collected by ﬁltration. Toluene was added to the ing solid, and the mixture was concentrated under d pressure. The resulting 3O e was dissolved in DMF (15 mL). CD1 (935 mg) was added to the on, and the mixture was stirred at room ature for one hour in a nitrogen atmosphere. 28% aqueous a (1.4 mL) was added to the reaction mixture, and the mixture was stirred at room temperature for ﬁve hours. The reaction mixture was concentrated under reduced FP1100 pressure. The e was partitioned by adding chloroform (100 mL) and water (50 mL).

The aqueous layer was extracted with chloroform (50 mL). The combined organic layers were washed with a saturated aqueous sodium bicarbonate solution (50 mL). The washings were extracted with form (5 mL). The ed organic layers were dried over anhydrous ium sulfate and ﬁltered The ﬁltrate was concentrated under reduced pressure. The residue was tiiturated by adding MTBE (5 mL). The precipitated solid was ted by ﬁltration to give the title compound (1.5 g). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.68-1.78 (m, 1H), 1.86—1.95 (m, 1H), 2.13 (s, 3H), 2.29-2.45 (m, 2H), 2.47 (s, 3H), 3.32-3.47 (m, 2H), 3.69 (s, 3H), 4.00—4.15 (m, 3H), 5.29 (brs, 2H), 6.72 (s, 1H), 7.14-7.26 (m, 2H), 7.37—7.43 (m, 1H), 8.07 (s, 1H).

ESI-MS m/z 447 [M+Na]+ 4-ylHH—mlol4,3—c lguinolin—4t 5ﬂ )-one KTB (655 mg) was added to a solution of 5-[2—ﬂu0ro—4-(2—methoxy—4,6— dimethylpyridin—3-yl)phenyl]-l—(tetrahydro—2H—pyran—4—yl)-lH—pyrazole—4—carboxamide (1.52 g) in NMP (15 mL), and the mixture was stirred at 90°C for 30 minutes. KTB (40 mg) was added to the reaction mixture, and the mixture was d at 90°C for 30 minutes.

Further, KTB (40 mg) was added to the reaction mixture, and the mixture was stirred at 90°C for 30 minutes. The reaction e was cooled to room temperature. Water (3 mL) was added to the reaction mixture. The solid was precipitated After stirring for one hour ly, the precipitated solid was collected by ﬁltration. The residue was washed with water (1 mL). The resulting solid was suspended in l-propanol/water (9/1) (2 mL) and dissolved by heating under reﬂux. The solution was cooled to room temperature over one hour. The precipitated solid was collected by ﬁltration. The resulting solid was dried under reduced pressure at 50°C to give the title compound (872 mg). The instrumental data were identical to those ofthe title compound synthesized in e 4.

Example 6 S thesis of 7- 2—metho —4-meth l 'din 1 tetrah dro—2H- 1 mlol4,3-c lguinolin—4t 5ﬂ )-one FP1100 -(2,4—dimethoxybenzyl)—1-(tetrahydro-2H—pyran—4-yl)—7—(4,4,5,5—tetrarnethyl— 1,3,2-dioxaborolan—2—yl)-1H—pyrazolo[4,3-c]quinolin-4(5H)—one (100 mg) obtained in ation Example 1(5) was dissolved in 1,4—dioxane (4 mL). 3-bromomethoxy—4— methylpyridine obtained in Preparation Example 37 (2) (55.6 mg), 3)4 (10.6 mg), cesium carbonate (179 mg) and water (1 mL) were added to the solution, and the mixture was reacted using a microwave reactor at 130°C for three hours. The reaction mixture was ed to room temperature and then partitioned by adding ethyl acetate. The organic layer was washed with brine and then dried over magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was trated under reduced pressure. The ing residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, % to 50% to 80%) to give 5-(2,4-dimethoxybenzyl)(2-methoxy—4-methylpyridin—3—yl)- 1-(tetrahydro-2H—pyran—4—y1)—lH-pyrazolo[4,3-c]quinolin-4(51-I)-one (78 mg). The 5-(2,4- dimethoxybenzyl)—7—(2-methoxy—4—methylpyridin—3-yl)(tetrahydro—2H—pyrm1—4—yl)—1H— pyrazclo[4,3—c]quinolin—4(5H)—one (78 mg) was dissolved in T'FA (1 mL), and the mixture was d at 65°C for two hours. The reaction mixture was cooled to room temperature and then concentrated under reduced pressure. The resulting residue was neutralized by adding a saturated aqueous sodium bicarbonate solution. The aqueous solution was extracted with DCM. The organic layer was dried over anhydrous magnesium sulfate.

The desiccant was removed by ﬁltration. The ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl e/n—heptane, 50% to 70% to 80% to 100%) to give the title compound (30 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.15 (s, 3H), 2.15-2.24 (m, 2H), 2.45—2.59 (m, 2H), 3.70 (t, J=12.0 Hz, 2H), 3.87 (s, 3H), 4.20-4.27 (m, 2H), 5.02-5.11 (m, 1H), 6.89 (d, J=5.1 Hz, 1H), 7.21 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.34 (d, J=1.6 Hz, 1H), 8.03 (d, J=8.6 Hz, 1H), 8.11 (d, J=5.1 Hz, 1H), 8.31 (s, 1H), 10.57 (brs, 1H).

ESI—MS m/z 391 [M+I—1]+ The compounds ples 7 to 22 were synthesized as in Example 6.

FP1100 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.06 (s, 6H), 2.18- 2.24 (m, 2H), 2.49—2.60 (m, 2H), 3.47 (s, 3H), 3.70-3.82 (m, 2H), 4.22430 (m, 2H), 4.46 (s, 2H), 4.97-5.13 (m, 1H), 7.13 (dd, J=8.4 Hz, 1.6 Hz, 1H), 7.14 (s, 2H), 7.19 (d, J=1.6 Hz, 1H), 8.03 (d, J=8.4 Hz, 1H), 8.31 (s, 1H), 9.01 (s, 1H).

ESI-MS m/z 418 [M+H]+ 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.12 (s, 3H), 2.15- 2.24 (m, 2H), 2.26 (s, 3H), 2.47-2.61 (m, 2H), 3.64-3.77 (m, 2H), 4.21430 (m, 2H), .13 (m, 1H), 6.76 (s, 1H), 7.12 (dd, J=8.0 Hz, 1.2 Hz, 1H), 7.35 (d, J=1.2 Hz, 1H), 8.07 (d, J=8.0 Hz, 1H), 8.32 (s, 1H), 11.34 (hrs, 1H).

ESI—MS m/z 393 [M+H]+ lH—NMR (400 MHz, CDC13) 5 (ppm): 2.16-2.24 (m, 2H), 2.36 (s, 3H), 2.47-2.60 (m, 2H), 2.60 (s, 3H), 3.65-3.77 (m, 2H), 4.21-4.28 (m, 2H), 5.01-5.12 (m, 1H), 7.18 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.21 (s, 1H), 7.36 (d, J=1.6 Hz, 1H), 8.07 (d, J=8.6 Hz, 1H), 8.32 (s, 1H), 10.86 (hrs, 1H).

ESI-MS m/z 409 [M+H]+ 1H-NMR (400 MHz, CDC13) 5 (ppm): 2.15-2.24 (m, 2H), 2.18 (s, 3H), 2.46-2.59 (m, 2H), 3.74-3.76 (m, 2H), 3.85 (s, 3H), 4,204.27 (m, 2H), 5.01—5.11 (m, 1H), 7.17 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.26 (d, J=1.6 Hz, 1H), 8.04 (d, J=8.6 Hz, 1H), 8.18 (s, 1H), 8.31 (s, 1H), 10.22 (hrs, 1H).

ESI-MS m/z 425 [1v1+H]+ 11 1H—NMR (400 MHz, CD013) 5 (ppm): 2.15-2.23 (m, 2H), / 2.17 (s, 3H), 2.48-2.59 (m, 2H), 2.61 (s, 3H), .75 (m, \ / 2H), 3.84 (s, 3H), 4.20427 (m, 2H), 5.01—5.11 (m, 1H), N 0 7.14-7.20 (m, 1H), 7.27 (s, 1H), 8.02 (d, J=8.2 Hz, 1H), 8.30 (s, 1H), 9.44 (hrs, 1H).

ESI-MS m/z 439 [M+H]+ FP11—0553-00 12 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.11 (s, 3H), 2.15— / 2.24 (m, 2H), .59 (m, 2H), 3.64-3.76 (m, 2H), 3.85 \ / (s, 3H), 4,204.29 (m, 2H), 5.00-5.12 (m, 1H), 7.19 (d, N 0 J=9.0 Hz, 1H), 7.31 (s, 1H), 8.02 (s, 1H), 8.05 (d, J=9.0 Hz, 1H), 8.31 (s, 1H), 10.35 (s, 1H).

ESI—MS m/z 409 [M+H]+ 1H-NMR (400 MHz, CDC13) 8 (ppm): 2.15 (s, 3H), 2.15— 2.25 (m, 2H), 2.36 (s, 3H), 2.48-2.62 (m, 2H), 3.65-3.77 (m,, 2H), 4.20427 (m, 2H), 5.01—5.11 (m, 1H), 7.11 (dd, J=8.4 Hz, 1.5 Hz, 1H), 7.24 (d, J=1.5 Hz, 1H), 7.54 (s, 1H), 8.11 (d, J=8.4 Hz, 1H), 8.32 (s, 1H), 10.45 (s, 1H).

ESI-MS m/z 400 [M+H]+ 1H-NMR (400 MHz, CDC13) 8 (ppm): 2.15—2.24 (m, 2H), 2.28 (s, 3H), 2.47—2.59 (m, 2H), 3.64-3.76 (m, 2H), 3.93 (s, 3H), 4.06 (s, 3H), 4.20-4.28 (m, 2H), 5.02—5.11 (m, 1H), 7.20 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.32 (d, J=1.6 Hz, 1H), 8.02 (d, J=8.6 Hz, 1H), 8.31 (s, 1H), 10.36 (s, 1H).

ESI-MS m/z 422 [M+H]+ lH—NMR (400 MHz, CDC13) 8 (ppm): 1.94 (s, 3H), 1.96 (s, 3H), 2.15-2.26 (m, 2H), 2.47-2.61 (m, 2H), 3.66-3.76 (m, 2H), 4.01 (s, 3H), 4.20429 (m, 2H), 5.01—5.11 (m, 1H), 7.09 (dd, J=8.3 Hz, 1.4 Hz, 1H), 7.19 (d, J=1.4 Hz, 1H), 7.95 (s, 1H), 8.05 (d, J=8.3 Hz, 1H), 8.32 (s, 1H), .26 (hrs, 1H).

ESI—MS m/z 405 [M+H]+ 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.16 (s, 3H), 2.17— 2.26 (m, 2H), 2.35 (s, 3H), 2.47-2.61 (m, 2H), 3.66-3.76 (m, 2H), 9 (m, 2H), 5.01-5.11 (m, 1H), 6.50-6.80 (m, 1H), 7.13 (dd, J=8.4 Hz, 1.6 Hz, 1H), 7.24 (d, J=1.6 Hz, 1H), 7.46 (s, 1H), 8.09 (d, J=8.4 Hz, 1H), 8.32 (s, 1H), .28 (hrs, 1H).

ESI—MS m/z 425 [M+H]+ 1H-NMR (400 MHz, CDC13) 8 (ppm): 2.13—2.24 (m, 5H), 2.46-2.60 (m, 2H), .75 (m, 2H), 3.85 (s, 3H), 4.18- 4.28 (m, 2H),4.99-5.11 (m, 1H), 5.32—5.50 (m, 2H), 7.03 (s, 1H), 7.16 (d, J=1.5 Hz, 1H), 7.19 (dd, J=8.3 Hz, 1.5 Hz, 1H), 8.03 (d, J=8.3 Hz, 1H), 8.30 (s, 1H), 8.91 (s, 1H).

ESI-MS m/z 423 [M+H]+ 1H-NMR (400 MHz, CD013) 8 (ppm): 2.08 (s, 3H), 2.15— 2.26 (m, 5H), 2.47-2.60 (m, 2H), 366-3 .76 (m, 2H), 4.20— 4.29 (m, 2H), 5.00—5.10 (m, 1H), 6.71 (s, 1H), 7.11 (dd, J=8.4 Hz, 1.5 Hz, 1H), 7.16 (d, J=1.5 Hz, 1H), 7.37-7.76 (m, 1H), 8.06 (d, J=8.4 Hz, 1H), 8.31 (s, 1H), 9.71 (brs, 1H).

ESI-MS m/z 441 [M+H]+ FP1100 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.13 (s, 3H), 2.17- 2.26 (m, 2H), 2.31 (s, 3H), 2.47-2.62 (m, 2H), 3.65-3.77 (m, 2H), 4.20—4.30 (m, 2H), 5.01-5.13 (m, 1H), 5.43-5.58 (m, 2H), 7.14 (dd, J=8.4 Hz, 1.6 Hz, 1H), 7.24 (d, J=1.6 Hz, 1H), 7.28 (s, 1H), 8.07 (d, J=8.4 Hz, 1H), 8.32 (s, 1H), .24 (hrs, 1H).

ESI-MS m/z 407 [M+H]+ 1H-NMR (400 MHz, CDC13) 5 (ppm): 2.12 (s, 3H), 2.16- 2.24 (m, 2H), 2.46-2.60 (m, 2H), 2.64 (s, 3H), 3.66-3.76 (m, 2H), 4.20—4.29 (m, 2H), 5.01-5.11 (m, 1H), 5.11-5.26 (m, 2H), 7.16-7.18 (m, 1H), 7.18-7.22 (m, 1H), 7.30 (d, J=1.8 Hz, 1H), 8.05 (d, J=8.4 Hz, 1H), 8.31 (s, 1H), 10.39 (hrs, 1H).

ESI-MS m/z 407 [M+H]+ 1H-NMR (400 MHZ, CDC13) 8 (ppm): 2.12 (s, 3H), 2.16- 2.24 (m, 2H), 2.47-2.60 (m, 2H), 2.65 (s, 3H), 3.66—3.75 (m, 2H), 4.21-4.28 (m, 2H), 5.01-5.10 (m, 1H), 6.29-6.57 (m, 1H), 7.18 (dd, J=8.4 Hz, 1.6 Hz, 1H), 7.22 (d, J=1.6 Hz, 1H), 7.25-7.26 (m, 1H), 8.05 (d, J=8.4 Hz, 1H), 8.31 (s, 1H), 9.58 (s, 1H).

ESI—MS m/z 425 [M+H]+ 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.15—2.24 (m, 2H), 2.26 (s, 3H), 2.47-2.60 (m, 2H), 366-3 .76 (m, 2H), 4.00 (s, , 3H), 4.19-4.30 (m, 2H), 4.98-5.14 (m, 3H), 6.81 (s, 1H), 7.14 (dd, J=8.4 Hz, 1.6 Hz, 1H), 7.21 (d, J=1.6 Hz, 1H), 8.04 (d, J=8.4 Hz, 1H), 8.31 (s, 1H), 9.91 (brs, 1H).

ESI—MS m/z 423 [M+I—1]+ Example 23 ' of [5—(2,4-dimeﬂ10xybenzyl)—4—oxo-l -(te1rahydro-2H—pyran—4—yl)—4,5-dihydro-1H— pyrazolo[4,3-c]quinoljnyl]boronic acid obtained in Preparation e 1 (70 mg) was dissolved in oxane (4 mL). 3-bromo-2—eﬂ10xy—4—methylpyridine obtained in Preparation e 44 (49 mg), Pd(PPh3)4 (8.7 mg), cesium carbonate (148 mg) and water FP1100 (1 mL) were added to the solution, and the mixture was d using a microwave reactor at 130°C for two hours. The reaction e was ed to room temperature and then partitioned by adding ethyl acetate. The organic layer was washed with brine and then dried over magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 30% to 50% to 80%) to give 5—(2,4— dimethoxybenzyl)-7—(2-ethoxy-4—methylpyridin—3-yl)-l-(tetrahydro—2H—pyran—4—y1)—1H— pyrazolo[4,3—c]quinolin—4(5H)—one (55 mg). The 5-(2,4-dimethoxybenzyl)—7—(2—ethoxy—4— methylpyridin—3-yl)—1-(tetrahydro-2H—pyran—4—yl)—1H—pyrazolo[4,3-c]quinolin—4(5H)—one (55 mg) was dissolved in T'FA (1 mL), and the mixture was stirred at 65°C for two hours.

The reaction e was cooled to room temperature and then concentrated under reduced pressure. The resulting residue was neutralized by adding a saturated aqueous sodium bicarbonate solution. The aqueous solution was extracted with DCM. The organic layer was dried over anhydrous magnesium sulfate. The ant was removed by ﬁltration.

The ﬁltrate was concentrated under reduced pressure. The resulting residue was puriﬁed by silica gel column chromatography (ethyl acetate/n-heptane, 50% to 70% to 80% to 100%) to give the title compound (17 mg). 1H—NMR (400 MHZ, CDC13) 5 (ppm): 1.25 (t, J=7.5 Hz, 3H), 2.15 (s, 3H), 2.15-2.25 (m, 2H), 2.46-2.60 (m, 2H), 3.65-3.77 (m, 2H), 4.20-4.29 (m, 2H), 4.35 (q, J=7.5 Hz, 2H), 5.03- 5.12 (m, 1H), 6.86 (d, J=5.5 Hz, 1H), 7.21 (dd, J=1.6 Hz, 8.2 Hz, 1H), 7.35 (s, 1H), 8.01 (d, J=8.2 Hz, 1H), 8.08 (d, J=5.5 Hz, 1H), 8.30 (s, 1H), 10.51 (brs, 1H).

ESI-MS m/z 405 [M+H]+ The nd ofExample 24 was synthesized as in e 23.

[Table 2] 24 1H—N1V1R(4OO MHz, CDC13) 5 (ppm): 2.10 (s, 3H), 2.15— / 2.25 (m, 2H), 2.47-2.60 (m, 2H), 3.66-3.76 (m, 2H), 4.01 \ \ F (s, 3H), 4.19429 (m, 2H), 5.00-5.19 (m, 3H), 6.74 (s, 1H), 0 N 7.16-7.23 (m, 2H), 8.04 (d, J=8.2 Hz, 1H), 8.31 (s, 1H), FP11-0553—00 9.45 (brs, 1H).

ESI-MS m/z 423 [M+H]+ Example 25 S thesis of + 2-metho —3 5-dimeth l - l-l- tetrah drofuran—3— l-lH— tetrah drofuran—31H— 10 4 3—c uinolin—4 5 -one (1) S thesis of i l -lH— lo 4 3-c uinolin-4 5 -one A mixture of (i)-5—(2,4~dimethoxybenzyl)—1-(tetrahydroﬁiranyl)(4,4,5,5- tetramethyl—l,3,2-dioxaborolan—2—yl)-lH-pyrazolo[4,3-c]quinolin—4(5H)-one obtained in Preparation e 5 (219 mg), 4-bromo-2—methoxy—3,5—dimethylpyridine obtained in Preparation Example 28 (134 mg), Pd(PPh3)4 (23.8 mg) and cesium carbonate (403 mg) was reacted in a mixed solvent of 1,4-dioxane (8 mL) and water (2 mL) using a microwave reactor at 130°C for 70 minutes. The on mixture was cooled to room temperature and then direcﬂy puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 10% to 90%). The resulting coupling t was dissolved in TFA (4 mL), and the mixture was stirred at 70°C for two hours. The reaction mixture was cooled to room temperature and then concentrated under reduced pressure. A ted aqueous sodium bicarbonate solution was added to the e, followed by extraction with ethyl acetate. The organic ’ layer was concentrated under reduced pressure, and the residue was puriﬁed by silica gel column chromatography (DCM, 100%, then ethyl acetate/n—heptane, 50% to 100%) to give the title compound (78 mg).

ESI—MS m/z 391 [M + HT“ (2) S thesis of + 1-tteh'ahydroﬁ1ran-3—ylHH—mlol 4,3-c Iguinolin-4g SH )—one (i)(2—Methoxy—3,5-dimethylpyridin—4—yl)—1-(tetrahydroﬁ1ran—3-yl)—1H— pyramlo[4,3-c]quinolin—4(51-I)—one was analyzed by a chiral column [AD-H (0.46 cm d) x 15 FP1100 cm), mobile phrase; 100% ethanol] to identify (+)-form at 7.8 min and rm at 9.7 min and conﬁrm that l resolution is possible. (i)—7-(2-Methoxy—3,5-dimethylpyridin—4— yl)-l-(teu‘ahydroﬁ1ran—3-yl)-1H—pyrazolo[4,3-c]quinolin—4(51-I)—one (78 mg) was dissolved in a mixed solvent of ethanol (12 mL) and methanol (12 mL), and the solution was ﬁltered through a cotton plug. The ﬁltrate was optically resolved by chiral column chromatography [chiral column: AD-H column, n solvent: 100% ethanol, ﬂow rate: 10 , elution time: 80 minutes/elution, injection: 2 nil/injection, short retention time: (+)-fonn, long retention time: (—)-form] to give 26.4 mg of a (+)—form and 25.2 mg of a (-)-form ofthe title compound. 1H-NMR (400 MHZ, CDC13) 8 (ppm): 1.92-1.94 (m, 3H), 1.94-1.96 (m, 3H), 2.55-2.66 (m, 1H), 2.76-2.86 (m, 1H), 4.00 (s, 3H), 4.09-4.16 (m, 1H), 4.24-4.37 (m, 2H), .45 (m, 1H), 5.61-5.68 (m, 1H), 7.04 (d, J=l.5 Hz, 1H), 7.08 (dd, J=1.5 Hz, 8.3 Hz, 1H), 7.94 (s, 1H), 8.13 (d, J=8.3 Hz, 1H), 8.31 (s, 1H), 8.86 (s, 1H).

ESI—MS m/z 391 [M+I—1]+ e 26 ' of (1) S thesis of eth 15- 2-ﬂuoro 2-metho -3 5-dimeth l 'din—4- 1 hen l - H g S )—te1rahydroﬁ.1ran—3-yl |-1H—mle—4—carboglate Water (170 mL), 4-iodomethoxy—3,5-dimethylpyridine obtained in Preparation Example 29(3) (35.6 g), Pd(PPh3)4 (6.52 g) and cesium carbonate (110 g) were added to a solution of ethyl 5-[2—ﬂuoro—4—(4,4,5,5—tetramethyl—1,3,2-dioxaborolan—2—yl)phenyl]-l-[(S)- tetrahydroﬁnan—3—yl]~1H-pyrazolecarboxylate obtained in Preparation Example 6 (51.9 g) FPll00 in 1,4-dioxane (500 mL), and the reaction mixture was d at 110°C for six hours. The reaction mixture was returned to room temperature, and the organic layer was then separated.

The organic layer was concentrated under d pressure. The aqueous layer, ethyl acetate (700 m) and water (100 mL) were added to the resulting residue, and the organic layer was separated. The s layer was re-extracted with ethyl acetate (50 mL). The combined organic layers were sequentially washed with water and brine, dried over ous magnesium sulfate, d and concentrated under reduced pressure. The residue was puriﬁed by NH silica gel column chromatography (ethyl acetate/n—heptane, 5% to 14%). The product was then puriﬁed again by NH silica gel column chromatography (ethyl acetate/n—heptane, 2% to 10%) to give the title compound (43 .5 g). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.16 (t, J=7.2 Hz, 1.5H), 1.17 (t, J=7.2 Hz, 1.5H), 1.97 (s, 1.5H), 1.98 (s, 1.5H), 1.99 (s, 1.5H), 2.00 (s, 1.5H), 2.25—2.55 (m, 2H), 3.92-4.27 (m, 6H), 3.99 (s, 1.5H), 4.00 (s, 1.5H), 4.65—4.75 (m, 1H), 7.01 (d, J=9.2 Hz, 1H), 7.05 (d, J=7.2 Hz, 1H), 7.39 (t, J=7.2 Hz, 0.5H), 7.45 (t, J=7.2 Hz, 0.5H), 7.93 (s, 1H), 8.12 (s, 1H).

ESI-MS m/z 440 [M+H]+ (2) S thesis of 5- 2 | g S g-tetrahydroﬁiranyl l-lH-pmleA—carboylic acid A 5 N aqueous sodium hydroxide solution (79 mL) was added to a solution of ethyl 5-[2-ﬂuoro(2-methoxy—3,5-dimethylpyridin—4—yl)phenyl]-l-[(S)-tetrahydroﬁiran yl]-1H—pyrazole—4-carboxylate (43.2 g) in ethanol (574 mL) at room temperature, and the reaction mixture was stirred at 60°C for two hours and 10 minutes. The reaction mixture was cooled to room temperature and then concentrated to half volume under reduced re. Water (300 mL) was added to the residue, and ethanol was distilled off under reduced pressure. MTBE (130 mL) was added to the ing residue, and the aqueous layer was separated. The organic layer was extracted with water (30 mL). The combined aqueous layers were made acidic with 5 N hydrochloric acid (78 mL) under oling and extracted with ethyl acetate twice. The combined organic layers were dried over anhydrous magnesium sulfate, ﬁltered and concentrated under reduced pressure to give the title compound (39.0 g). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.91 (s, 1.5H), 1.94 (s, 1.5H), 1.98 (s, 1.5H), 2.01 (s, 1.5H), 2.25-2.56 (m, 2H), 3.92-4.17 (m, 3H), 3.96 (s, 1.5H), 4.00 (s, 1.5H), 4.23 (dd, J=16.0, 8.0 Hz, 1H), 4.65-4.77 (m, 1H), 6.99 (brd, J=10.0 Hz, 1H), 7.03 (dr d, J=7.6 Hz, 1H), 7.38 (t, J=7.6 Hz, 0.5H), 7.44 (t, J=7.6 Hz, 0.5H), 7.90 (s, 0.5H), 7.94 (s, 0.5H), 8.14 (s, 1H).

FPll00 ESI—MS m/z 434 [M+Na]+ (3) Smthesis of 5—[2—ﬂuoro—4-t 2—meﬂ10xy—3,5-dimethylpm'din—4—yl [phenyll-l- I t S z-tetrahydrofurany1 |- e—4—carboxamide CDI (21.4 g) was added at one time to a solution of 5-[2—ﬂuoro(2-methoxy-3,5— dimethylpyridin—4—yl)phenyl]—1-[(S)-tetrahydroﬁ1ran—3-yl]-lH—pyrazole-4—carboxylic acid (38.7 g) in DMF (290 mL) at room temperature, and the mixture was stirred at room ature for 95 minutes. 28% aqueous ammonia (95 mL) was added to the reaction mixture, and the e was stirred at room temperature for 35 minutes. 28% aqueous ammonia (95 mL) was added again to the reaction mixture, and the mixture was stirred at room temperature for 90 minutes. The reaction mixture was concentrated under reduced pressure. form (250 mL) and water (80 mL) were added to the resulting residue, and the organic layer was separated. The s layer was re-extracted with chloroform (50 mL). The combined organic layers were sequentially washed with a saturated s ammonium chloride solution (60 mL x 3) and brine, dried over anhydrous magnesium sulfate and ﬁltered. The ﬁltrate was passed through a silica pad (NH-silica gel). The ﬁltrate was trated under reduced pressure to give the title compound (37.2 g). 1H—NMR (400 MHZ, CDC13) 8 (ppm): 1.98 (brs, 6H), 2.24—2.60 (m, 2H), 3.90-4.20 (m, 3H), 3.99 (s, 3H), 4.23 (dd, J=l6.0, 8.0 Hz, 1H), 4.62-4.71 (m, 1H), 5.32 (brs, 2H), 7.05 (brd, J=10.0 Hz, 1H), 7.10 (dd, J=7.6, 1.2 Hz, 1H), 7.42-7.56 (m, 1H), 7.94 (brs, 1H), 8.03 (s, 1H).

ESI-MS m/z 411 [M+H]Jr (4) S thesis of S yl )-lH—pmlol 4,3-c lin-4g 5ﬂ Q-one Sodium hydroxide powder (9.43 g) was added at one time to a solution of 5-[2- ﬂuoro(2—methoxy—3,5-dimethylpyridin—4-yl)phenyl]—l-[(S)-tetrahydroﬁ11an—3-yl]—1H— pyrazole—4—carboxamide (37.2 g) in DMSO (186 mL) at room temperature. The on mixture was stirred at the same temperature for 50 minutes and then at 70°C for 45 minutes.

Under Water-cooling, water (600 mL) was added dropwise to the reaction mixture, and then acetic acid (13.5 mL) was added dropwise. The precipitated powder was collected by ion The collected subject was washed with water and MTBE and then dried under reduced pressure to give the title compound (34.0 g).

The 1H—NMR and ESI-MS of the title compound were identical to those of Example 25. The title compound showed a (—) optical rotation and had > 99% ee of an optical purity [AD-H, 100% ethanol, retention time: 9.7 min].

FP1100 Example 27

[0339] | t S )—tetrahydroﬁ.1ran—3-yl |-lH—pmle—4—carboxylate Ethyl 5—(4—bromo—2-nitrophenyl)—l-[(S)—tet:rahydroﬁ1ran-3—yl]-lH—pyrazole—4- carboxylate obtained in Preparation Example 7(1) (1.5 g) was dissolved in toluene (50 mL). (2-methoxy—3,5-dimethylpyridin—4-yl)boronic acid (728 mg) obtained in Preparation Example 29, bis(triphenylphosphine)dichloropalladium(ll) (128 mg), sodium carbonate (1.16 g) and water (10 mL) were added to the solution, and the mixture was reacted at 100°C for four hours. After cooling the on e to room temperature, ethyl e (50 mL) and water (50 mL) were added, and the on mixture was ﬁltered through CeliteTM.

The ﬁltrate was ioned by adding ethyl acetate (100 mL). The organic layer was washed with brine and dried over anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the e was concentrated under reduced pressure. Ethanol (2 mL) was added to the resulting residue which was dissolved with heating under reﬂux. The solution was cooled with ice water. Aﬁer one hour, the precipitated solid was collected by ﬁltration to give the title compound (750 mg). The ﬁltrate was concentrated under d pressure. Ethanol (1 mL) was added to the resulting residue which was dissolved with heating under reﬂux. The solution was cooled with ice water. After one hour, the precipitated solid was collected by ﬁltration to give the title compound (450 mg). 1H—NMR (400 MHz, CDCl3) 8 (ppm): 1.07-1.14 (m, 3H), 1.98 (d, J=3.9 Hz, 3H), 2.01 (d, J=3.9 Hz, 3H), 2.21-2.40 (m, 1H), 2.47-2.58 (m, 1H), 3.92—4.00 (m, 1H), 4.00 (s, 3H), 4.02- 4.18 (m, 4H), 4.23 (q, J=7.7 Hz, 1H), 4.56-4.66 (m, 1H), 7.43 (d, J=8.2 Hz, 0.67H), 7.48 (d, J=8.2 Hz, 0.33H), 7.51-7.56 (m, 1H), 7.96-8.02 (m, 2H), 8.08 (s, 1H).

EST—MS m/z 467 [M+H]+ (2) S thesis of S FPll00 1 -1H— 010 4 3-c n—4 5 -one Ethyl 5-[4-(2—methoxy—3,5—dimethylpyridin—4—yl)nitrophenyl][(S)- tetrahydrofuran—3-yl]—1H—pyrazolecarboxy1ate (1.1 g) was suspended in ethanol (13 mL).

Iron powder (280 mg) and a saturated aqueous ammonium chloride solution (3 mL) were added to the solution, and the mixture was stirred at 100°C for 3.5 hours. The reaction mixture was cooled to room temperature and then d through CeliteTM. The ﬁltrate was partitioned by adding ethyl acetate (100 mL) and water (50 mL). The organic layer was washed with brine and dried over anhydrous ium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was trated under reduced pressure. The resulting residue was dissolved in acetic acid (2 mL), followed by stirring at 50°C. After four hours, the reaction mixture was cooled to room temperature, and water (20 mL) was added. The precipitated solid was collected by ﬁltration. anol (10 mL) and water (1.5 mL) were added to the resulting solid which was dissolved with heating under reﬂux.

The solution was cooled with ice water. After one hour, the precipitated solid was collected by ﬁltration and washed with MTBE (5 mL) to give the title compound (780 mg).

The compounds ofExamples 28 to 32 were synthesized as in Example 25.

Mobile phase Optical rotation (+/-) Retention time (min) lH—NMR (400 MHz, CDC13) 5 (ppm): 2.10 (s, 3H), 2.48 (s, 3H), 100% ethanol 2.54-2.65 (m, 1H), 2.75-2.84 (m, 1H), (+): 7.0 3.86 (s, 3H), 4.08-4.16 (m, 1H), 4.22— (-): 6.0 4.28 (m, 1H), 4.28-4.36 (m, 1H), .44 (m, 1H), 5.59-5.69 (m, 1H), 6.73 (s, 1H), 7.18 (dd, J=8.4 Hz, 1.6 Hz, 1H), 7.23 (d, J=1.6 Hz, 1H), 8.08 (d, J=8.4 Hz, 1H), 8.29 (s, 1H), 9.60 (brs, 1H).

ESI-MS m/z 391 [M+H]+ FP11-0553—00 e 29 lH—NMR (400 MHz, CDC13) 5 OD-H (ppm): 2.03 (s, 3H), 2.22 (s, 3H), 100% ethanol 2.55-2.67 (m, 1H), 2.76-2.86 (m, 1H), (+): 8.5 3.97 (s, 3H), 4.094.17 (m, 1H), 4.23— (-): 6.2 4.29 (m, 1H), 4.304.37 (m, 1H), 4.39446 (m, 1H), 5.62-5.69 (m, 1H), 6.54 (s, 1H), 7.12 (dd, J=8.4 Hz, 1.6 Hz, 1H), 7.21 (d, J=1.6 Hz, 1H), 8.10 (d, J=8.4 Hz, 1H), 8.31 (s, 1H), 10.00 (brs,1H).

ESI-MS m/z 391 [M+H]+ Example 30 1H—NMR (400 MHz, CDC13) 5 IA (ppm): 2.10 (s, 3H), 2.56-2.67 (m, 100% ethanol 1H), 2.76-2.86 (m, 1H), 4.01 (s, 3H), (+): 9.0 4.08417 (m, 1H), 4.23437 (m, 2H), (-): 9.7 4.39446 (m, 1H), 5.01—5.20 (m, 2H), .61-5.69 (m, 1H), 6.74 (s, 1H), 7.15— 7.22 (m, 1H), .30 (m, 1H), 8.11 (d, J=8.2 Hz, 1H), 8.31 (s, 1H), 10.11— .25 (m, 1H).

ESI-MS m/z 409 [M+H]+ Example 31 1H-NMR (400 MHz, CDC13) 8 AD-H (ppm): 2.17 (s, 3H), 2.54-2.65 (m, 100% ethanol 1H), 2.76-2.85 (m, 1H), 3.85 (s, 3H), (+): 6.0 4.08—4.16 (m, 1H), 9 (m, 1H), (-): 7.1 4.29436 (m, 1H), 4.38444 (m, 1H), .33—5.49 (m, 2H), 5.61—5.68 (m, 1H), 7.03 (s, 1H), 7.18 (d, J=8.5 Hz, 1H), 7.21 (s, 1H), 8.10 (d, J=8.5 Hz, 1H), 8.30 (s, 1H), 9.41 (brs, 1H).

ESl-MS m/z 409 [M+H]+ I“Example 32 lH—NMR (400 MHz, CDC13) 5 (ppm): 2.15 (s, 3H), 2.54-2.66 (m, 100% ethanol 1H), 2.76—2.85 (m, 1H), 3.85 (s, 3H), (+): 5.8 4.12 (td, J=8.4 Hz, 4.7 Hz, 1H), 4.27 (-): 7.5 (q, J=7.8 Hz, 1H), 4.33 (dd, J=7.8 Hz, 1.6 Hz, 1H), 4.42 (dd, J=8.4 Hz, 3.4 Hz, 1H), 5.61-5.69 (m, 1H), 6.89 (d, J=5.5 Hz, 1H), 7.19 (dd, J=8.4 Hz, 1.4 Hz, 1H), 7.33 (d, J=1.4 Hz, 1H), 8.08— 8.14 (m, 2H), 8.30 (s, 1H), 10.49 (brs, L 1H).

ESI-MS m/z 377 [M+H]+ Example 33 S thesis of FP11-0553—00 O O O \ HN HN | \ \ HN \ o o N l N | N (1) 05%N, (2) OQTN, 0C"N. Ni:~—~ N O o O o O o 3. <50 The title compound was obtained by performing the reactions (1) to (2) by the same method as in Example 25 using (i)—7-bromo-5—(2,4—dimeﬂioxybenzyl) (tetrahydroﬁnan—3-yl)—1H—pyrazolo[4,3-c]quinolin—4(5H)—one obtained in Preparation Example 5(4) and 2,6-dimethylphenylboronic acid as raw materials. The optical resolution of (2) under the ions of chiral column: IB, mobile phase: 100% ethanol, and ﬂow rate: 1.00 mL/min identiﬁed (-)—form at 4.0 min and rm at 4.4 min. Thus, the optical resolution was performed using TB column for optical resolution under the conditions of mobile phase: 100% ethanol, ﬂow rate: 10.0 mL/min, elution time: 60 min/run and injection: 1.5 mL/run and (—)-form of a r retention time and (+)-fonn of a longer retention time were obtained 1H—NMR (400 MHZ, CDC13) 8 (ppm): 2.06 (s, 6H), 2.60-2.64 (m, 1H), 2.79-2.83 (m, 1H), 4.12-4.13 (m, 1H), 4.24-4.37 (m, 2H), 4.40-4.45 (m, 1H), 5.62-5.70 (m, 1H), 7.10-7.19 (m, 4H), 7.21-7.24 (m, 1H), 8.10-8.12 (m, 1H), 8.30 (s, 1H), 9.57 (brs, 1H).

ESI—MS m/z 360 [M+H]+ Example 34 S thesis of + tetrah dro-2H— l-lH- 10 43-0 n-4 5 —one 0 0 O HN HN O l \,N l \’N i \,N (1) N (2) N N l \ ——> —> + 'N ., \ \ \ "'\ N l 0 I 0 I 0 0‘ N/ o N/ o N/ o >§f§ o l I The title compound was obtained by ming the reactions (1) to (2) by the same method as in Example 25 using (i)—5-(2,4—dimethoxybenzyl)—l-(tetrahydro—2H—pyran— 3-yl)(4,4,5,5-tetramethyl—1,3,2—dioxaborolan—2—y1)—1H—pyrazolo[4,3-c]quino]in—4(5H)-one FP1100 obtained in Preparation Example 4 and omethoxy-4,6—dimethylpy1idine obtained in Preparation Example 26 as raw materials. The optical tion of (2) under the conditions of chiral column: OD-H, mobile phase: 100% ethanol, and ﬂow rate: 1.00 mL/min identiﬁed (+)-form at 4.8 min and (-)-forrn at 5.2 min. Thus, the optical resolution was performed using OD—H column for optical resolution and using an elution t of 100% ethanol and (+)-form of a shorter retention time and (—)—form ofa longer retention time were obtained 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.92-2.00 (m, 2H), 2.10 (s, 3H), 2.38-2.54 (m, 5H), .61 (m, 1H), 3.86 (s, 3H), 3.88-3.95 (m, 1H), 4.04-4.10 (m, 1H), 4.28-4.35 (m, 1H), 4.95-5.05 (m, 1H), 6.72-6.75 (m, 1H), 7.18-7.21 (m, 1H), 7.22 (d, J=1.4 Hz, 1H), 8.09 (d, J=8.4 Hz, 1H), 8.28 (s, 1H), 9.63 (s, 1H).

ESI-MS m/z 405 [M+H]+ The compounds ofExamples 35 to 39 were synthesized as in Example 34.

Mobile phase Optical on (+/-) Retention time (min) Example 35 1H-NMR (400 MHz, CDC13) 5 (ppm): 1.93-2.02 (m, 2H), 2.17 (s, 3H), 2.37— 100% ethanol 2.55 (m, 2H), 3.53-3.62 (m, 1H), 3.85 (s, (+): 5.8 3H), 3.88-3.96 (m, 1H), 4.04411 (m, (-): 6.4 1H), 4.27435 (m, 1H), 4.95—5.05 (m, 1H), 5.33-5.48 (m, 2H), 7.03 (s, 1H), 7.17-7.22 (m, 2H), 8.11 (d, J=8.6 Hz, 1H), 8.28 (s, 1H), 9.35 (s, 1H).

ESI—MS m/z 423 [M+H]+ FP1100 _Example 36 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.91-2.04 (m, 8H), 2.39-2.56 (m, 2H), 100% ethanol 3.54-3.62 (m, 1H), 3.89-3.97 (m, 1H), (+): 4.6 4.00 (s, 3H), 4.04414 (m, 1H), 4.28- (-): 5.1 4.36 (m, 1H), 4.96-5.06 (m, 1H), 7.07— 7.12 (m, 1H), 7.14 (d, J=1.4 Hz, 1H), 7.94 (s, 1H), 8.14 (d, J=8.2 Hz, 1H), 8.30 (s, 1H), 9.83 (brs, 1H).

ESI-MS m/z 405 [M+H]+ 22593212123]_________________________ 1H—NMR (400 MHz, CDC13) 5 (ppm): AD-H 1.94-2.00 (m, 2H), 2.02 (d, J=O.6 Hz, 100% ethanol 3H), 2.22 (s, 3H), 2.40—2.53 (m, 2H), (+): 8.0 3.52-3.62 (m, 1H), 3.89-3.95 (m, 1H), (-): 10.7 3.96 (s, 3H), 4.05411 (m, 1H), 4.28— 4.35 (m, 1H), 4.96-5.05 (m, 1H), 6.54 (s, 1H), 7.09 (d, J=1.6 Hz, 1H), 7.13 (dd, J=8.4 Hz, 1.6 Hz, 1H), 8.11 (d, J=8.4 Hz, 1H), 8.29 (s, 1H), 9.01 (brs, 1H).

ESI-MS m/z 405 [M+H]+ Example 38 1H-NMR (400 MHz, CDC13) 5 (ppm): .03 (m, 2H), 2.09 (s, 3H), 2.39— 100% ethanol 2.54 (m, 2H), 3.53-3.62 (m, 1H), 3.89- (+): 5.2 3.97 (m, 1H), 4.01 (s, 3H), 4,054.13 (m, (-): 5.8 1H), 4.26-4.37 (m, 1H), 4.95—5.20 (m, 3H), 6.74 (s, 1H), 7.17-7.23 (m, 2H), 8.12 (d, J=8.4 Hz, 1H), 8.29 (s, 1H), 9.56-9.67 (m, 1H).

ESI-MS m/z 423 [M+H]+ Example 39 1H—NMR (400 MHz, CDC13) 5 (ppm): .01 (m, 2H), 2.14 (s, 3H), 2.38- 100% ethanol 2.53 (m, 2H), 3.53-3.61 (m, 1H), 3.87 (s, (+): 6.0 3H), 3.88-3.95 (m, 1H), 11 (m, (-): 6.6 1H), 4,274.35 (m, 1H), 4.95—5.04 (m, 1H), 6.88 (d, J=5.3 Hz, 1H), 7.17 (d, J=1.5 Hz, 1H), 7.21 (dd, J=8.2 Hz, 1.5 Hz, 1H), 8.08-8.14 (m, 2H), 8.28 (s, 1H), 9.06 (brs, 1H).

ESI-MS m/z 391 [M+H]+ Example 40 S thesis of 7- 4-y1)—1H—mlo|4,3-c lguinoljn-4g 5H z-one FPll00 ﬁg0\ (l) S thesis of 7- o be l tetrah dro-2H— l-lH— lo 43-c uinolin—4 5 -one Water (0.2 mL), 4—(4-bromo—3,5-dimethylphenyl)—3,6—dihydro—2H—pyran (44.1 mg) obtained in ation e 50, Pd(PPh3)4 (12.7 mg) and cesium carbonate (108 mg) were added to a solution of 5—(2,4—dimethoxybenzyl)—l-(tetrahydro-2H—pyran—4—yl)—7- (4,4,5,5—tetramethyl-1,3,2-dioxaborolan—2—yl)—lH—pyrazolo[4,3-c]quinolin—4(51-I)—one obtained in Preparation Example 1(5) (60 mg) in 1,4-dioxane (1.5 mL). The reaction mixture was stirred at 100°C overnight Alter returning the reaction mixture to room temperature, ethyl acetate and water were added to the reaction mixture, and the organic layer was separated. The organic layer was washed with brine, dried over anhydrous magnesium sulfate, ﬁltered and concentrated under reduced pressure. The resulting residue was puriﬁed by NH silica gel column chromatography (ethyl acetate/n—heptane, 20 to 50%) to give the title compound (44 mg).

EST—MS m/z 606 [M + H]+ (2) Smthesis of 7-|2,6-dimethyl—4—gtetrahydro—2H—pm—4—ylxphenyll-l- tetrah dro—2H- —41H— 10 4 3-c uinolin—4 5 -one % palladium carbon (50% wet, 15 mg) was added to a solution of 7-[4-(3,6- dihydro-2H-pyran—4-yl)-2,6-dimethylphenyl](2,4-dimethoxybenzyl)—l-(tetrahydro-Z — pyran—4—yl)—1H—pyrazolo[4,3-c]quinolin—4(51—I)-one (44 mg) in ethanol (2 mL)-THF (2 mL).

The reaction mixture was stirred at room temperature for four hours and 35 s in a hydrogen atmosphere. The st was removed ﬁom the reaction mixture by ﬁltration, and the ﬁltrate was then concentrated under reduced pressure. TFA (1.5 mL) was added to the resulting residue. The reaction e was stirred at 60°C for 14 hours. The reaction mixture was returned to room temperature, and the reaction mixture was then concentrated under d pressure. form and a saturated aqueous sodium bicarbonate solution were added to the residue, and the organic layer was separated. The aqueous layer was re- FPll00 extracted with chloroform. The combined organic layers were dried over ous magnesium sulfate, ﬁltered and concentrated under reduced re. The resulting residue was puriﬁed by silica gel column chromatography (chlorofOIm 100%, then ethyl acetate 100%). The target ﬁaction was collected and trated. Ethyl acetate and MTBE were added to the resulting residue. The precipitated solid was collected by ﬁltration and dried under reduced pressure to give the title compound (14.8 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.79-1.95 (m, 4H), 2.07 (s, 6H), 2.20 (d, J=12.8 Hz, 2H), 2.53 (ddd, J=15.6, 11.6, 4.0 Hz, 2H), 2.72-2.81 (m, 1H), 3.56 (td, , 2.8 Hz, 2H), 3.71 (t, J=10.4 Hz, 2H), 4, 12 (dd, J=10.4, 2.8 Hz, 2H), 4.24 (d, J=10.8 Hz, 2H), 5.03-5.11 (m, 1H), 7.03 (s, 2H), 7.13 (dd, J=8.0, 1.2 Hz, 1H), 7.25 (d, J=1.2 Hz, 1H), 8.01 (d, J=8.0 Hz, 1H), 8.31 (s, 1H), 10.26 (brs, 1H).

ESI-MS m/z 458 [M+I—1]+ Example 41 S thesis of + 0 0 8%°\/ HN \ , + . (v i: o .; . .9 (1) S thesis nitro hen 1 o'x an—4— l-lH- lecarbo late The title compound (80 mg) was obtained by the same method as in Example 27- (1) from (i)-ethyl 5-(4-bromonitrophenyl)—1-(oxepan—4-yl)-1H—pyrazole-4—carboxylate ed in Preparation Example 8 (85 mg) and (2-methoxy—3,5-dimethylpyridin—4— yl)boronic acid obtained in ation Example 29 (42.1 mg).

ESI—MS m/z 495 [M + HTr

[0352] (2) S thesis of 2-metho -3 5—dimeth 1 'din—4— l ox an—4— 1 -1H— mlol4,3-c lguinolin-41 5B )—one The title compound (53 mg) was obtained by the same method as in Example 45- (2) from (i)—ethyl 5-[4—(2—methoxy—3,5-dimethy1pyridin—4—yl)nitrophenyl](oxepan—4- yl)—1H—pyrazole—4—carboxylate (80 mg). 1H-NMR (400 lVH-Iz, CDC13) 8 (ppm): 1.90-2.05 (m, 2H), 1.94, 1.95, 1.96 (s, 3H), 1.97 (s, FP1100 3H), 2.33—2.70 (m, 4H), 3.70-3.80 (m, 1H), 3.92-4.08 (m, 3H), 4.01 (s, 3H), 5.20-5.29 (m, 1H), 7.08 (dd, J=8.4, 1.6 Hz, 1H), 7.19 (d, J=1.6 Hz, 1H), 7.95 (s, 1H), 8.11 (d, J=8.4 Hz, 1H), 8.30 (s, 1H), 10.30 (brs, 1H).

ESI-MS m/z 419 [M+H]+ oxe an—4— 1 -1H— 10 4 3-c uinolin-4 5 -one 7—(2-methoxy-3,5-dimethylpyridin—4—yl)—l-(oxepan—4-yl)-lH—pyrazolo[4,3- c]quinolin—4(5H)—one (53 mg) was dissolved in ethanol (5 mL), and the solution was ﬁltered through a millipore ﬁlter. The e was optically resolved by CIRALCEL(R) OD-H ctured by DAICEL Corporation (20 mm diameter x 250 mm long) under the condition ofethanol 100% and 10 mL/min. The title compound with a retention time of 11 minutes and a (+) optical rotation (15.9 mg, >98% ee [CIRALCEL (R) OD-H (0.46 cm d) x cm), 20% ethanol/hexane, retention time = 7.3 min]) and the title compound with a retention time of 12 s and a (-) optical rotation (16.7 mg, >98% ee [CIRALCEL (R) OD-H (0.46 cm (D x 25 cm), 20% ethanol/hexane, retention time = 7.9 min]) were obtained.

The compound ofExample 42 was synthesized as in Example 41.

Mobile phase Optical rotation (+/—) Retention time (min) Example 42 lH—NMR (400 MHz, CDC13) 5 (ppm): .05 (m, 2H), 2.05 (s, 3H), 2.06 (s, 100%IPA 3H), 2.31-2.68 (m, 4H), .78 (m, (+): 8.3 1H), 3.85 (s, 3H), 3924.07 (m, 3H), (9; 9.4 5.19-5.28 (m, 1H), 6.71 (s, 2H), 7.12 (d, J=8.4 Hz, 1H), 7.15 (s, 1H), 8.07 (d, J=8.4 Hz, 1H), 8.30 (s, 1H), 9.62 (brs, 1H).

ESI-MS m/z 418 [M+H]+ FP11—0553-00 Example 43 S thesis of 4—yl 1—2—nitrophenyl |-lH—mle—4—carboxylate Water (0.2 mL), (2-methoxy—3,5-dimethylpyridin—4—yl)boronic acid (39.5 mg) obtained in ation Example 29, Pd(PPh3)4 (10.5 mg) and cesium carbonate (178 mg) were added to a solution of ethyl 5-(4—bromonitrophenyl)—1—(1,4-dioxepan—6—yl)—1H-pyrazole—4— carboxylate (80 mg) obtained in ation Example 9-(2) in 1,4-dioxane (1.3 mL), and the on mixture was d at 100°C for 6.75 hours. (2—methoxy—3,5-dimeﬂiylpyridin—4— yl)boronic acid (15 mg) was added to the on mixture and the reaction mixture was stirred at 100°C for 2.5 hours. After the reaction mixture was returned to room temperature, ethyl acetate and water were added to the reaction mixture, and the organic layer was separated. The resulting organic layer was washed with brine, dried over anhydrous magnesium sulfate, ﬁltered, and concentrated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (silica gel, ethyl e/n—heptane, 20 to 33 %) to give the title compound (64 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.09 (t, J=7.2 Hz, 1.5H), 1.11 (t, J=7.2 Hz, 1.5H), 1.98 2O (s, 15H), 1.99 (s, 1.5H), 2.01 (3, 151-1), 2.02 (s, 1.5H), 3.73-3.87 (m, 2H), 3.90-4.02 (m, 2H), 4.00 (s, 3H), 4.03—4.17 (m, 4H), 4.30—4.40 (m, 2H), 4.41—4.49 (m, 1H), 7.39 (d, J=7.6 Hz, 1H), 7.52 (dd, J=7.6, 1.6 Hz, 1H), 7.95—8.01 (m, 2H), 8.11 (s, 1H).

ESI-MS m/z 519 [M + Na]+ (2) S thesis of 1— 1 4 1H—pmlol 4,3-c |guinolin—4( SH z—one Iron powder (28.8 mg) was added to a solution of ethyl l-(1,4-dioxepan—6—yl)[4—(2— methoxy—3,5-dimethy1pyridin—4—yl)nitrophenyl]-lH—pyrazolecarboxylate (64 mg) in acetic acid (2 mL)-water (0.1 mL), and the reaction mixture was stirred at 80°C for 2.5 hours in a nitrogen atmosphere. The reaction mixture was returned to room temperature, and FP1100 ethyl acetate (10 mL) was added to the reaction mixture. The insoluble matter was removed by ion through TM. The ﬁltrate was concentrated under reduced pressure. A solution ofthe residue in ethyl acetate was sequentially washed with a saturated aqueous sodium bicarbonate solution and brine, dried over anhydrous magnesium sulfate, ﬁltered. The ﬁltrate was passed through a NH silica gel pad ' The ing solution was concentrated under reduced pressure. Ethyl acetate (0.3 mL) and MTBE (0.3 mL) were added to the residue. The precipitated solid was collected by ﬁltration to give the title compound (29.1 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.93 (s, 3H), 1.96 (s, 3H), 3.90-4.07 (m, 4H), 4.00 (s, 3H), 4.38 (dd, J=12.0, 6.0 Hz, 2H), 4.40 (dd, J=12.0, 6.8 Hz, 2H), 5.50 (tt, J=6.8, 6.0 Hz, 1H), 7.08 (d, J=8.0 Hz, 1H), 7.17 (s, 1H), 7.94 (s, 1H), 8.13 (d, J=8.0 Hz, 1H), 8.36 (s, 1H), .23 (brs, 1H).

EST-MS m/z 421 [M+H]+ The nd ofExample 44 was synthesized as in e 43. lH—NMR (400 MHz, CDC13) 8 (ppm): 2.05 (s, 6H), 3.85 (s, 3H), 3,914.07 (m, 4H), 4.38 (dd, J=12.8, 6.0 Hz, 2H), 4.44 (dd, J=12.8, 6.8 Hz, 2H), 5.51 (tt, J=6.8, 6.0 Hz, 1H), 6.71 (s, 2H), 7.12 (dd, J=8.4, 1.6 Hz, 1H), 7.24 (brs, 1H), 8.08 (d, J=8.4 Hz, 1H), 8.36 (s, 1H), 10.43 (brs, 1H).

ESI-MS m/z 420 [M+H]+ Example 45 lo 4 3-c uinolin—4 5 -one FP1100 (1) S thesis ofeth l 1- 1 e an— 3-yl 2nitrophenyl {-1H—pmle—4—carb0ﬁlate Water (0.3 rnL), 3-bromomethoxy—4,6—dimethylpyridine (32.5 mg) obtained in Preparation Example 26, Pd(PPh3)4 (7.2 mg) and cesium carbonate (122 mg) were added to a solution of ethyl 1-(1,4-dioxepan—6—yl)—5-[2-nitro—4—(4,4,5,5-tetramethy1—1,3,2- dioxaborolan—Z—yl)phenyl]—1H—pyrazole—4—carboxylate (61 mg) in 1,4—dioxane (1.2 mL), and the reaction mixture was stirred at 100°C for 4 hours. Pd(PPh3)4 (7.2 mg) was added to the reaction mixture, and the reaction mixture was stirred at 100°C for 1 hour and 10 minutes.

The reaction mixture was returned to room temperature and partitioned by adding ethyl acetate and water, and the organic layer was separated. The resulting organic layer was sequentially washed with water and brine, dried over anhydrous magnesium sulfate, ﬁltered and concentrated under reduced pressure. The residue was puriﬁed by silica gel column tography (ethyl acetate/n—heptane, 15 to 20%) to give the title compound (15 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.06 (t, J=7.2 Hz, 3H), 2.16 (s, 3H), 2.48 (s, 3H), 3.74-3.88 (m, 2H), 3.88 (s, 3H), 3.91-4.16 (m, 6H), 4.28-4.37 (m, 2H), 4.47-4.55 (m, 1H), 6.74 (s, 1H), 7.29 (d, J=7.6 Hz, 1H), 7.60 (dd, J=7.6, 1.6 Hz, 1H), 8.07 (d, J=1.6 Hz, 1H), 8.10 (s, 1H).

ESI-MS m/z 519[M + Na]+ (2) S thesis of 1- 1 4—diox an-6— ol4,3-c [guinolin—4g 5E z-one Iron powder (17 mg) was added to a solution of ethyl 1-(1,4-dioxepan-6—yl)—5—{4— (2-methoxy—4,6—dimethylpyridin—3-y1)nitropheny1}-1H—pyrazole—4—carboxy1ate (15 mg) in acetic acid (1 mL)—water (0.05 mL), and the mixture was stirred at 80°C for 4.25 hours in a nitrogen atmosphere. The reaction mixture was returned to room temperature, and ethyl acetate (5 mL) was added to the reaction mixture. The insoluble matter was removed by ﬁltration h Celitem. The e was concentrated under reduced pressure. A solution of the residue in ethyl acetate was sequentially washed with a ted aqueous sodium bicarbonate solution and brine, dried over ous magnesium sulfate, ﬁltered and concentrated. The residue was puriﬁed by ative thin-layer tography (silica gel, ethyl acetate/n—heptane, 66%) to give the title nd (1.5 mg). 1H—NMR (400 MHZ, CDC13) 5 (ppm): 2.09 (s, 3H), 2.48 (s, 3H), 3.85 (s, 3H), 391—3 .99 (m, 2H), 4.00—4.08 (m, 2H), 4.36 (dd, J=12.8, 6.4 Hz, 2H), 4.42 (dd, J=12.8, 6.4 Hz, 2H), 5.49 (tt, J=6.8, 6.4 Hz, 1H), 6.72 (s, 1H), 7.15—7.21 (m, 2H), 8.08 (d, J=8.0 Hz, 1H), 8.34 (s, 1H), 9.17 FP1100 (br s, 1H).

ESI—MS m/z 421 [M+H]+ The compounds ofExamples 46 and 47 were sized as in Example 45. lH—NMR (400 MHz, CDC13) 8 (ppm): 2.02 (s, 3H), 2.21 (s, 3H), 3.91-3.99 (m, 2H), 3.96 (s, 3H), 4004.07 (m, 2H), 4.38 (ddd, J=13.2, 6.4, 2.4 Hz, 2H), 4.44 (dd, J=13.2, 6.4 Hz, 2H), .50 (tt, J=6.8, 6.4 Hz, 1H), 6.54 (s, 1H), 7.12 (dd, J=8.0, 1.6 Hz, 1H), 7.17 (d, J=1.6 Hz, 1H), 8.10 (d, J=8.0 Hz, 1H), 8.34 (s, 1H), 9.78 (brs, 1H).

ESI-MS m/z 421 [M+H]+ 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.14 (s, 3H), 3.87 (s, 3H), 391—3 .99 (m, 2H), 4.00407 (m, 2H), 4.37 (dd, J=12.8, 6.4 Hz, 2H), 4.43 (dd, , 6.4 Hz, 2H), 5.50 (tt, 1%.4, 6.0 Hz, 1H), 6.88 (d, J=5.6 Hz, 1H), 7.18-7.22 (m, 2H), 8.08-8.13 (m, 2H), 8.35 (s, 1H), 9.29 (brs, 1H).

ESI-MS m/z 407 [M+HJ+

[0364] (1) S thesis nitro hen 1 S -tetrah droﬁdran l—1H— le—4-carbo late Ethyl 5-(4—bromo—2—nitrophenyl)—1-[(S)-tetrahydroﬁlrany1]-1H-pyrazole-4— carboxylate obtained in Preparation Example 7—(1) (200 mg) was converted to ethyl 5-[ - nitro(4,4,5,5-tet1amethyl—1 ,3,2—dioxaborolan—2—yl)phenyl]- 1-[(S)-te11ahydroﬁnan—3-yl]- FP1100 1H—pyrazole—4—carboxylate by the same method as in Preparation Example 7-(2). A solution of4—iodoisopropyloxy-3,5-dimethylpyridine obtained in Preparation Example 47 (142 mg) in DMF (0.5 mL), and water (0.5 mL) were added to the reaction mixture, and the mixture was stirred at 110°C for two hours. The reaction mixture was cooled to room temperature and then partitioned by adding ethyl acetate and water. The aqueous layer was extracted with ethyl acetate. The combined c layers were dried over anhydrous magnesium e and d. The e was concentrated under reduced pressure.

The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 50% to 100%) to give the title compound (138.1 mg).

ESI-MS m/z 517 [M + Na]+ (2) S thesis of 2—iso r0 lo -3 5-dimeth l 'din—4— l (tetrahydroﬁ1ran—3-yl)—1H—pmlol4,3-cIguinolin—4g5ﬂ )—one The title compound (67.1 mg) was obtained by the same method as in Example 45-(2) ﬁom ethyl 5—[4-(2-isopropyloxy—3,5—dimethylpyridin—4—yl)—2—nitrophenyl][(S)— tetrahydroﬁnan—3-yl]-1H—pyrazole—4-carboxylate (138.1 mg). 1H-NMR (400 MHz, CDC13) 8 (ppm): 1.37—1.41 (m, 6H), 1.91 (s, 3H), 1.95 (s, 3H), 2.59- 2.64 (m, 1H), .83 (m, 1H), 4.12-4.29 (m, 1H), 4.23-4.27 (m, 2H), 4.39—4.46 (m, 1H), .29—5.40 (m, 1H), 5.62—5.69 (m, 1H), 7.07—7.09 (m, 1H), 7.19-7.20 (m, 1H), .92 (m, 1H), 8.13 (d, J=8.40 Hz, 1H), 8.31 (s, 1H), 10.18 (s, 1H).

ESI—MS m/z 419 [M+Hj+ The compounds ofExamples 49 and 50 were synthesized as in Example 48. l \,N [Table 8] lH—NMR (400 MHz, CDC13) 5 (ppm): 2.01 (s, 6H), 2.59-2.64 (m, 1H), 2.70-2.90 (m, 1H), 4.10420 (m, 1H), 4.25435 (m, 2H), 4.40445 (m, 1H), 5.60-5.63 (m, 1H), 6.99—7.10(m, 2H), 7.52 (t, J=72.0 Hz, 1H), 7.96 (s, 1H), 8.14-8.17 (m, 1H), 3.31 (s, 1H), 9.01 (brs,1H).

ESI—MS m/z 449 [M+Na]+ FP1100 lH—NMR (400 MHz, CDC13),8 (ppm): 1, 43 (t, J=7.13 Hz, 3H), 1.94 (s, 3H), 1.95 (s, 3H), .68 (m, 1H), 2.76-2.87 (m, 1H), 4.12420 (m, 1H), 4.23437 (m, 2H), .46 (m, 3H), 5.57—5.72 (m, 1H), 7.07-7.09 (n1, 1H), 7.17-7.18 (m, 1H), 7.92 (s, 1H), 8.12-8.14 (m, 1H), 8.31 (s, 1H), 10.07 (brs, 1H).

ESI-MS m/z 405 [M+H]+

[0368] (1) S thesis nitro hen 1 S h an—3- l-lH— olecarbo late Ethyl 5-[2—nitro-4—(4,4,5,5-tetramethyl-1,3,2—dioxaborolan—2—yl)phenyl][(S)- tetrahydroﬁiran—3-yl]-1H—pyrazole—4—carboxy1ate obtained in Preparation Example 7-(2) (70 mg) was dissolved in a mixed solution of 1,4—dioxane (1 mL) and water (0.2 mL), and 3— bromo—6-isopropyloxy-2,4-dimethy1pyridine (41.1 mg), Pd(PPh3)4 (17.7 mg) and cesium carbonate (150 mg) were added. The reaction mixture was stirred at 110°C overnight.

Aﬁer returning the reaction mixture to room temperature, the reaction mixture was d by silica gel column chromatography (ethyl acetate/n—heptane, 10 to 50% to 100%) to give the title compound (66.5 mg).

ESI—MS m/z 495 [M + I—l]+ (2) S thesis of (tetrahydroﬁiran-3—yl)-1H-pm@lo[4,3-c]guinolin—4(51;I)—one A solution of ethyl 5-[4-(6-isopropyloxy—2,4—dimethylpy1idinyl)nitropheny1]— 1-[(S)-tetrahydroﬁnanyl]-1H-pyrazole—4—carboxylate (65.1 mg) in acetic acid (1.5 mL)- water (0.15 mL) was stirred at 80°C for 15 minutes. Iron powder (45.1 mg) was added to the solution, and the mixture was stirred at the same temperature for two hours in a nitrogen atmosphere. The reaction mixture was returned to room temperature, and ethyl acetate (5 FP1100 mL) was added to the reaction mixture. The insoluble matter was removed by ﬁltration through CeliteTM. The e was concentrated under reduced pressure. A solution ofthe residue in ethyl acetate was washed with a ted aqueous sodium bicarbonate solution, dried over anhydrous ium sulfate and ﬁltered. The ﬁltrate was concentrated under reduced pressure. The residue was suspended and triturated by adding MTBE. The precipitated solid was collected by ﬁltration to give the title compound (35.1 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.38 (d, J=6.25 Hz, 6H), 2.01 (s, 3H), 2.20 (s, 3H), 2.55-2.67 (m, 1H), 2.76—2.87 (m, 1H), 4.12—4.14 (m, 1H), 4.23—4.37 (m, 2H), 4.39—4.45 (m, 1H), 5.30-5.35 (m, 1H), 5.61-5.69 (m, 1H), 6.48 (s, 1H), 7.11-7.13 (m, 1H), 7.16-7.17 (m, 1H), 8.09—8.11 (m, 1H), 8.31 (s, 1H), 9.58 (brs, 1H).

ESI—MS m/z 419 [M+H]+ Example 52 S thesis of 8-ﬂuoro-7— 2—metho —4 6—dimeth l 'din 1 tetrah dro-2H- (1) Smthesis of ethyl 5-|2,5-diﬂuoro—4—t2—methog—4,6-dimethylpyg'din—3- l hen 1 tetrah dro-2H- l-1H— arbo late Pd(PPh3)4 (50 mg), cesium carbonate (282 mg) and water (0.5 mL) were added to a mixed on of ethyl 5-(4-bromo—2,5-diﬂuorophenyl)—1-(tetrahydro—2H—pyran—4—yl)—1H— pyrazcle-4—carboxy1ate obtained in ation Example 10 (180 mg), (2—methoxy—4,6- dimethylpyridin—3—yl)boronic acid obtained in Preparation Example 27 (90 mg) and 1,4- dioxane (2 mL), and the mixture was stirred at 110°C for six hours. Aﬁer cooling the reaction mixture to room temperature, ethyl acetate and brine were added, and the mixture was ﬁltered h a cotton plug. The c layer was separated and dried over anhydrous magnesium sulfate. The desiccant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The residue was subjected to silica gel column chromatography (ethyl acetate/n—heptane, 25% to 46% to 53%) to give the title compound (157 mg).

ESI—MS m/z 494 [M + Na]+

[0372] (2) S thesis of 5— 2 5-diﬂuoro—4- o -4 6-dimeth l FP1100 ttetrahydro—ZH—pmA-yl i-1H—mle—4—carboxamide A 5 N aqueous sodium hydroxide solution (0.3 mL) was added to a solution of ethyl 5-[2,5—diﬂuoro(2—methoxy—4,6—dimethylpyridin—3—yl)phenyl](tetrahydro-2H— pyran—4-yl)—1H-pyrazole-4—carboxylate (157 mg) in ethanol (3 mL), and the mixture was stirred at 55°C for two hours. The reaction mixture was cooled to room ature and then concentrated under reduced pressure. The residue was partitioned by adding chloroform, 5 N hydrochloric acid and a saturated aqueous ammonium chloride on The organic layer was dried over anhydrous magnesium sulfate. The desiccant was removedby ﬁltration, and the ﬁltrate was concentrated under reduced pressure to give 5-[2,5- l 0 diﬂuoro—4—(2—methoxy—4,6—dimetlryl-pyridin¥3-yl)phenyl]— rahydro-2H—pyran—4—yl)—1H- pyrazole—4—carboxylic acid (155 mg) as a crude puriﬁed product. The carboxylic acid (155 mg) was dissolved in DMF (1 mL) and THF (3 mL). CDI (108 mg) was then added, and the mixture was d at room temperature for about 1.5 hours. A28% aqueous ammonia solution (0.35 mL) was added to the reaction mixture, and the mixture was stirred at room temperature overnight. The reaction mixture was trated under reduced pressure, and the residue was partitioned by adding ethyl acetate and brine. The c layer was washed with a saturated aqueous sodium bicarbonate solution and dried over anhydrous magnesium sulfate. The ant was removed by ﬁltration, and the ﬁltrate was concentrated under reduced pressure. The residue was solidiﬁed by adding n- heptane/MTBE (1/9) to give the title compound (82 mg). The title compound was used for the next reaction without r puriﬁcation.

ESI-MS m/z 465 [M + Na]+ (3) S thesis of 8-ﬂuoro—7— 2-metho —4 6—dimeth l 'din—3- l tetrah dro —4— l—lH— olo 43-c uinolin—4 5 -one KTB (41 mg) was added to a solution of -diﬂuoro—4—(2—methoxy—4,6— dimeﬂrylpyridin—3-yl)phenyl)—1—(tetrahydro—2H—pyran—4—yl)—lH—pyrazole-4—carboxamide (81 mg) inNMP (0.4 mL), and the mixture was heated to 90°C. After one hour, KTB (20 mg) was further added, followed by stirring for 30 minutes. The reaction mixture was cooled to room temperature, followed by adding a saturated aqueous um chloride solution (2 mL) and water (1 mL). The generated solid was ﬁltered off, washed with water (2 mL) and dried under reduced re at 60°C to give the title compound (57 mg). 1H—NMR (400 MHz, CDC13) 6 (ppm): 2.11 (s, 3H), 2.14—2.24 (m, 2H), 2.50 (s, 3H), 2.42- 2.63 (m, 2H), 3.65-3.79 (m, 2H), 3.87 (s, 3H), 4.20-4.28 (m, 2H), 4.93-5.03 (m, 1H), 6.76 (s, FP1100 1H), 7.35 (d, J=6.44 Hz, 1H), 7.71 (d, J=10.35 Hz, 1H), 8.30 (s, 1H), 10.93 (hrs, 1H).

EST—MS m/z 423 [M+I—1]+ Example 53 S thesis of S 1H— 10 4 3-c uinolin—4 5 —one (1) S thesis of eth l 5- 2 5—diﬂuoro—4— 2—metho -3 5-dimeth l 'din—4- l hen l S -tetrah drofuran 1 —1H— le—4—carbo late Ethyl 5-(4-bromo-2,5-diﬂuorophenyl)((S)-tetrahydroﬁ1ran—3-y1)-1H-pyrazole-4— carboxylate obtained in Preparation Example 11—1 (4.31 g), bis(pinacolato)diboron (3.27 g), potassium acetate (3.16 g) and Pd(dppf)C12-DCM x (439 mg) were added to DMF (41.6 mL), and the mixture was d at 95°C in a nitrogen atmosphere. After two hours, the reaction mixture was d at 105°C for four hours. The reaction mixture was cooled to room temperature and ﬁltered through CeliteTM. The e was trated under ‘ reduced pressure, brine and ethyl acetate were added to the residue, and the mixture was then stirred at room temperature for ﬁve minutes. The mixture was ﬁltered again through CeliteTM, and the ﬁltrate was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and ﬁltered through CeliteTM. The ﬁltrate was concentrated.

The residue was d by silica gel chromatography (n-heptane/ethyl acetate, 20% to 30% to 80%) to give ethyl 5—(2,5—diﬂuoro—4—(4,4,5,5-tetramethyl—1,3,2-dioxaborolan-2—yl)phenyl)— 1-((S)—tetrahydroﬁ1ran—3—yl)-1H-pyrazole-4—carboxylate (2.95 g). The resulting ethyl 5— (2,5-diﬂuoro(4,4,5,5-tet1amethyl—1,3,2—dioxaborolan—2-yl)phenyl)—1-((S)-tetrahydroﬁ1ran— 3-yl)-1H-pyrazole—4—carboxylate (900 mg), 4-iodo-2—methoxy—3,5-dimethylpyridine obtained in Preparation Example 29(3) (634 mg), Pd(PPh3)4 (116 mg) and cesium carbonate (1.96 g) were added to a mixed solvent of 1,4—di0xane (9.3 mL) and water (3.1 mL), and the mixture was heated under reﬂux for 2.5 hours. The reaction e was cooled to room temperature and partitioned by adding ethyl acetate and brine. The organic layer was dried over anhydrous ium sulfate and ﬁltered. The ﬁltrate was concentrated, and the residue was puriﬁed by NH silica gel column tography (ethyl acetate/n—heptane, ﬁrst time: 15% to 36% to 47%, second time: 10% to 30% to 35%) to give the title compound FPll00 (280 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 1.17-1.23 (m, 3H), 1.99-2.06 (m, 6H), 2.26-2.55 (m, 2H), 3.92-4.29 (m, 9H), 4.65—4.75 (m, 1H), 6.95-7.03 (m, 1H), 7.14-7.25 (m, 1H), 7.96 (s, 1H), 8.12 (s, 1H).

EST-MS m/z 480 [M+Na]+ (2) S thesis of 5— 2 5 It S l—tetrahydroﬁiranyl[-1H—pmole—4—carboxamide N sodium hydroxide (0.5 mL) was added to a solution ofethyl 5-[2,5-diﬂuoro-4— (2-methoxy—3,5-dimethylpyridin—4-yl)phenyl]—1-[(S)—tetrahydroﬁnan—3-yl)-1H—pyrazole—4— carboxylate (280 mg) in ethanol (3.6 mL), and the mixture was stirred at 65°C for three hours. After cooling the reaction mixture to room temperature, chloroform and brine were added, and the mixture was adjusted to pH 6 with 5 N hydrochloric acid and saturated ammonium chloride solution. The c layer was dried over anhydrous ium sulfate, and the desiccant was removed by ion. The ﬁltrate was concentrated under reduced pressure to give -diﬂuoro—4—(2—methoxy—3,5-dimethylpy1idin—4—yl)phenyl)-l- ((S)—tetrahydroﬁ.1ran—3—yl)—1H—pyrazole-4—carboxylic acid (238 mg) as a crude d product. CDI (121 mg) was added to a solution ofthe ylic acid (238 mg) in DMF (3 mL), and the mixture was stirred at room ature for one hour. A 28% aqueous ammonia solution (0.6 mL) was added to the on mixture, followed by stirring overnight. The reaction mixture was concentrated under reduced pressure, and the residue was partitioned by adding chloroform and a saturated aqueous sodium bicarbonate solution The organic layer was washed with brine and then dried over ous magnesium sulfate, and the desiccant was removed by ﬁltration. The ﬁltrate was passed through a silica gel pad (NH silica gel; eluting with ethyl acetate), and the resulting ﬁltrate was concentrated under reduced pressure to give the title compound (186 mg). 1H-NMR (400 MHZ, CDC13) 5 (ppm): 1.95-2.10 (m, 6H), 2.25-2.57 (m, 21-1), 3.91-4.29 (m, 7H), 4.69 (brs, 1H), 5.24—5.57 (m, 2H), 7.01 (dd, J=8.79, 5.66 Hz, 1H), 7.17-7.26 (m, 1H), 7.94-7.99 (m, 2H).

ESI-MS m/z 451 [M+Na]+ 3O [0377] (3) S thesis of hydroﬁiranyl )— 1H-pmlol 4,3-c lguinolin—4g 5ﬂ l-one Sodium hydroxide (powder, 82 mg) was added to a solution of 5-(2,5-diﬂuoro-4— (2-methoxy-3,5-dimethylpyridin—4—yl)phenyl)—l-[(S)-tetrahydroﬁ1ran—3-yl]-1H-pyrazole FP1100 carboxamide (186 mg) in DMSO (1.5 mL), and the mixture was stirred at 75°C for 1.5 hours. The reaction mixture was cooled to room temperature, and water (5.5 mL) was then added with stirring. Acetic acid (0.12 mL) was ﬁirther added, ed by stirring for 30 minutes. The generated solid was ﬁltered, washed with water (5 mL) and then dried under reduced pressure at 60°C for one hour to give the title nd (155 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.98 (s, 3H), 2.00 (s, 3H), 2.55-2.72 (n1, 1H), 2.73-. 2.86 (m, 1H), 4.01 (s, 3H), 4.13 (td, J=8.40, 4.69 Hz 1H), .39 (m, 2H), 4.43 (dt, J=9.57, 3.03 Hz, 1H), 5.52-5.62 (m, 1H), 7.23 (d, J=6.25 Hz, 1H), 7.84 (d, J=9.96 Hz, 1H), 7.98 (s, 1H), 8.32 (s, 1H), 10.82 (brs, 1H).

ESI-MS m/z 409 [M+1]+ Example 54 S thesis of S 1H— 10 43-0 uinolin—4 5 -one L Lo Lo 0 FC’O‘NI L H" ~31an L t° w 3 t0 [a e N N ...,.,. ....,.,\ Z/O a...” IIIIIII \ ....... \ on]9 L), \ L), \ ‘0 l '5: F l F i N/ O F >§<o N/ cf N/ (I) |

[0379] 1 thesis of eth 1 5- 2 5-diﬂuoro-4— 2—metho -4 th l - 1 hen 1—1- S -tetrah drofuran l-lH— olecarbo late Ethyl 5—(4-bromo-2,5-diﬂuorophenyl)—1—[(S)-tetrahydroﬁiran-3—yl]-1H-pyrazole—4— carboxylate (4.31 g), ' bis(pinacolato)diboron (3.27 g), potassium acetate (3.16 g), Pd(dppt)C12-DCM complex (439 mg) were added to DMF (41.6 mL), and the reaction mixture was stirred at 95°C in a nitrogen atmosphere. After stirring the reaction mixture for about 2 hours, the on mixture was stirred at 105°C for about 4 hours. The reaction mixture was cooled to room ature and then ﬁltered through CeliteTM. The ﬁltrate was concentrated under reduced pressure, and after brine and ethyl acetate were added to the residue the solution was d at room temperature for 5 minutes. The reaction mixture was again d through Celitem, and the ﬁltrate was extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and ﬁltrated through CeliteTM.

The ﬁltrate was concentrated, and the residue was puriﬁed by silica gel chromatography (heptane/ethyl acetate, 20% to 30 % to 80 %) to give ethyl 5-(2,5-diﬂuoro—4-(4,4,5,5- tetramethyl—l,3,2-dioxaborolan—2—yl)phenyl)-l-[(S)-tetrahydroﬁ1ran—3-yl]-1H-pyrazole—4— carboxylate (2.95 g). Eethyl 5-(2,5—diﬂuoro(4,4,5,5-tetrameﬂ1yl—1,3,2-dioxaborolan—2— FP1100 yl)phenyl)—1-[(S)-tetrahydroﬁrran—3-yl]—1H—pyrazole—4-carboxylate (812 mg), 3-bromo-2— methoxy—4,6-dimethyl pyridine (490 mg), Pd(PPh3)4 (130 mg) and cesium carbonate (1.77 g) were added to a mixed t of 1,4-dioxane (9.00 mL) and water (3.00 mL), and the reaction mixture was heated under reﬂux for 4 hours. The reaction mixture was cooled to room temperature and partitioned by adding ethyl acetate and brine. The organic layer was dried over anhydrous magnesium e and ﬁltered. The ﬁltrate was concentrated, and the residue was puriﬁed byNH silica gel column chromatography (ethyl acetate/n-heptane, 11% to 30% to 50%) to give the title compound (397 mg). The title compound was used for the next reaction without further puriﬁcation.

ESI-MS m/z 480 + (2) S thesis of 5- 2 5-diﬁuoro—4- | t S )—tetrahydroﬁrran—3-yl |— lH—pmle—4—carboxamide A 5 N aqueous sodium hydroxide solution (0.8 mL) was added to a solution ofethyl 5—(2,5- diﬂuoro—4—(2—methoxy—4,6—dimethylpyridin—3-y1)phenyl)-l-[(S)—tetrahydroﬁrran—3-yl]-1H— pyrazole—4—carboxylate (397 mg) in ethanol (5 mL), and the reaction mixture was d at 70°C for 1 hour. After cooling the reaction mixture to room temperature, chloroform and brine were added, and the mixture was adjusted to pH 6 with 5 N hydrochloric acid and a saturated aqueous ammonium de on. The organic layer was dried over anhydrous ium sulfate, and the desiccant was removed by ﬁltration The ﬁltrates was trated under reduced pressure to give 5-(2,5-diﬂuoro—4—(2—methoxy—4,6- dimeﬂrylpyridin—3-y1)phenyl)[(S)—tetrahydroﬁJranyl]-lH—pyrazole—4—carboxylic acid (457 mg) as a crude. CD1 (211 mg) was added to a solution of the carboxylic acid (457 mg) in DMF (6 mL), and the reaction mixture was stirred at room ature. After 75 minutes, a 28% aqueous ammonia solution (0.88 mL) was added to the reaction mixture and the reaction e was stirred at room temperature overnight. The reaction mixture was concentrated under reduced pressure, and the residue was partitioned by adding ethyl acetate and a saturated aqueous ammonium chloride solution. The c layer was washed with a saturated aqueous sodium bicarbonate solution, dried over anhydrous magnesium sulfate, and the desiccant was removed by ﬁltration. After the ﬁltrate was concentrated under reduced pressure, the precipitated solid was removed by ﬁltration and washed with dichloromethane and ethyl e. The ﬁltrate was concentrated under reduced pressure and the residue was puriﬁed by silica gel chromatography (ethyl acetate/n-heptane, 60% to 80 % to 85 %) to give title compound (199 mg). This title compound was used for the next FP1100 reaction without further puriﬁcation.

ESI-MS m/_z 451 [M+Na]+ (3) ' of ttetrahydroﬁiran-3—yl 2-1H—pmlol 4,3-c [guinolin-4t 5E [one Sodium hydroxide (powder, 74 mg) was added to a solution of 5-(2,5-diﬂuoro—4-(2— y—4,6-dimethylpyridin—3-yl)phenyl)[(S)-tetrahydroﬁ1ran—3-yl]—1H—pyrazole—4— carboxarnide (199 mg) in DMSO (2 mL), and the on mixture was stirred at 75°C for 1.5 hours. After the reaction mixture was cooled to room temperature, water, acetic acid (0.106 mL) and ethyl acetate were added to the reaction mixture with ng. After the precipitated solid was ﬁltered, organic layer was washed with water, a saturated aqueous sodium bicarbonate solution and brine, dried over anhydrous magnesium e, and the desiccant was d by ﬁltration. After the ﬁltrate was concentrated under reduced pressure, the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n- heptane, 55% to 90 % to 96 %), and the resulting crude was solidiﬁed by adding n- heptane/MTBE to give the title compound (33 mg). 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.11 (s, 3H), 2.49 (s, 3H), 2.56—2.67 (m, 1H), 2.71- 2.84 (m, 1H), 3.86 (s, 3H), 4.07—4.40 (m, 4H), 5.49-5.62 (m, 1H), 6.68-6.78 (m, 1H), 7.24- 7.31 (m, 1H), .84 (m, 1H), 8.25-8.32 (m, 1H), 10.16 (br.s., 1H).

ESI-MS m/z 409 [M+1]+

[0382] Example 55 S thesis of S ﬂuoro F0 |\N (1) F0 |\N (2) F0 INK/h(3) | ,N ——* N N ....... mm. ------- \ IIIIIII \ O\B L): \ / L‘o\o >§<é (1) S thesis of eth l 5- 2 5—diﬂuoro-4— 6-metho —2 4—dimeth l 'din l hen 1 -l- S -tetrah drofuran—31H— lecarbo late A mixture of ethyl 5-[2,5-diﬂuoro-4—(4,4,5,5-tetramethyl—1,3,2—dioxaborolan—2- nyl]—1-[(S)—tetrahydroﬁnan—3-yl]-lH—pyrazole—4—carboxylate synthesized in accordance with Example 53 (430 mg), 3-bromomethoxy-2,4—dimethylpyridine obtained in Preparation e 23 (223 mg), potassium hydrogen ﬂuoride (254 mg), Pd(PPh3)4 (90 mg) and tripotassium phosphate n—hydrate (400 mg) in DME (8 mL) and water (2 mL) was FP11—0553-00 heated under reﬂux at 110°C for seven hours. The reaction mixture was cooled to room temperature and partitioned by adding ethyl acetate and brine. The organic layer was dried over anhydrous magnesium sulfate and ﬁltered. The ﬁltrate was concentrated, and the residue was puriﬁed byNH silica gel column chromatography (ethyl acetate/n—heptane: 16% to 37% to 46%) and silica gel column chromatography (ethyl acetate/n—heptane: 28% to 49% to 54%) to give the title compound (144 mg). This compound was used for the next reaction without ﬂirther puriﬁcation.

ESI—MS m/z 458 [M + H]+ The ons of (2) to (3) were performed in accordance with Example 53.

However, in the reaction (3), the title nd obtained as a crude puriﬁed product was subjected to silica gel column tography (ethyl acetate/n—heptane, 60% to 95%) and then puriﬁed by solidiﬁcation from MTBE to give the title compound. 1H—NMR (400 MHz, CDC13) 5 (ppm): 2.02-2.10 (m, 3H), 2.23-2.27 (m, 3H), 2.56-2.69 (m, 1H), .87 (m, 1H), 3.97 (s, 3H), 4.13 (td, J=8.44, 4.59 Hz, 1H), 4.20—4.37 (m, 2H), 4.43 (dd, J=9.86, 3.22 Hz, 1H), 5.51—5.63 (m, 1H), 6.57 (d, J=0.59 Hz, 1H), .25 (m, 1H), 7.82 (d, J=10.15 Hz, 1H), 8.31 (s, 1H), 10.38 (hrs, 1H).

EST-MS m/z 409 [M+H]+ Example 56 S thesis of S o o (1) (1) o FINEL’ FINz/o\N | \IN 3. | \/N g N/N "lull ------- \ O\m/° 0 \ F {)0 \ F l | L\0 "I / N N The title nd was obtained by ming the reactions (1) to (3) in accordance with Example 53 using ethyl 5-(4-bromo-2—ﬂuorophenyl)—l-[(S)— tetrahydroﬁiran-3—yl]-lH—pyrazole-4—carboxylate obtained in Preparation Example 6(1) and 3-ethyl—4-iodo-2—methoxy—5-methylpyridine obtained in Preparation Example 49. 1H-NMR (400 MHz, CDC13) 8 (ppm): 0.94-1.06 (m, 3H), 1.88-1.96 (m, 3H), 2.35 (q, J=7.48 Hz, 2H), 2.55-2.69 (m, 1H), 2.75-2.88 (m, 1H), 3.96-4.05 (m, 3H), 4.08—4.19(m, 1H), 4.22- 4.38 (m 4.38-4.48 (m, 1H), 5.60-5.72 (m, 1H), 7.09 (dd, J=8.30, 1.66 Hz, 1H), 7.20- , 2H), 7.25 (m, 1H), 7.93-7.95 (m, 1H), 8.12 (d, J=8.20 Hz, 1H), 8.30 (s, 1H), 10.38 (brs, 1H).

ESI—MS m/z 405 [M+I—I]+ FPll00 Example 57 S thesis of 1H- 10 4 3-c uinolin—4 5 —one 075’ ° 1\ The title compound was obtained by performing the reactions (1) to (3) in accordance with Example 53 using ethyl 5-(4-bromo-2,5—diﬂuorophenyl)—1-((R)- tetrahydroﬁxran—3-yl)—1H—pyrazolecarboxylate obtained in Preparation Example 11-2 and 4-iodo-2—methoxy—3,5-dimethylpyridine obtained in Preparation Example 29(3). However, in the reaction (3), the title compound obtained as a crude puriﬁed t was puriﬁed by washing with l-propanol. 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.98 (s, 3H), 2.00 (s, 3H), 2.56-2.71 (m, 1H), 2.73— 2.89 (m, 1H), 4.01 (s, 3H), 4.13 (td, , 4.69 Hz, 1H), 4.18-4.38 (m, 2H), 4.40-4.48 (m, 1H), 5.51—5.64 (m, 1H), 7.21-7.30 (m, 1H), 7.84 (d, J=10.15 Hz, 1H), 7.98 (d, J=0.78 Hz, 1H), 8.32 (s, 1H), 11.05 (brs, 1H).

ESI-MS m/z 409 [M+H]+ The compounds ples 58 and 59 were synthesized as in Example 57. lH—NMR (400 MHz CDC13) 5 (ppm): 2.11 (s, 3H), 2.50 (s, 3H), 2.56-2.69 (m, 1H), 2.71-2.87 (m, 1H), 3.87 (s, 3H), 4.12 (1d, J=8.40, 4.69 Hz, 1H), 4.21-4.36 (m, 1H), 4.38-4.47 (m, 1H), .50-5.61 (m, 1H), .78 (m, 1H), 7.36 (d, 1%.44 Hz, 1H), 7.79 (d, 1:10.15 Hz, 1H), 8.30 (s, 1H), 11.05 (d, J=8.01 Hz, 1H).

ESI-MS m/z 409 DVHHT" FP1100 1H-NMR (400 MHz, CDC13) 5 (ppm): 2.06 (s, 3H), 2.25 (s, 3H), 2.57—2.70 (m, 1H), 2.74-2.85 (m, 1H), 3.98 (s, 3H), 4.13 (td, J=8.35, 4.59 Hz, 1H), 4.22437 (m, 2H), 4.43 (dd, , 3.32 Hz, 1H), 5.54-5.62 (m, 1H), 6.57 (s, 1H), 7.30 (d, J=6.64 Hz, 1H), 7.82 (d, J=9.96 Hz, 1H) 8.32 (s, 1H), 10.96 (brs, 1H).

ESI-MS m/z 409 [M+H]+ Example 60 S thesis of 7- 2-metho —4 6-dimeth 1 'din—3- 1 3RS 4SR metho trah drofuran—31H— 10 4 3—c uinolin—4 5 -one (1) S thesis of eth l 5- 4—bromo-2—ﬂuoro hen 1 3RS 48R h dro trah drofuran l-lH— olecarb0 late The title compound was synthesized in accordance with Preparation Example 7 using (3SR,4RS)—4—hydrazinyltet1ahydroﬁ11an—3-ol hydrochloride obtained in Preparation Example 18 in place of(S)—(tetrahydroﬁ11an—3-yl)hydrazine hloride.

ESI—MS m/z 421 [M + Na]+ (2) S thesis of eth 15- 2-ﬂuoro—4— 2-metho -4 6-dimeth l 'din—3- 1 hen l- 1-[(3RS,4SR)-4—hydromtrahydroﬁ1ranyl]-lH-pmQlecarboglate Ethyl 5-(4-bromo—2-ﬂuorophenyl)—l-[(3RS,4SR)-4—hydroxytetrahydroﬁnan—3-yl]- 1H-pyraz01e—4—carboxylate (3.8 g), bis(pinacolato)diboron (2.90 g), potassium acetate (2.80 g) and Pd(dppt)C12—DCM complex (480 mg) were added to DMF (38.3 mL), and the mixture was stirred at 90°C in a nitrogen atmosphere. After stirring the reaction mixture for about two hours, a solution of omethoxy—4,6-dimethylpyridine obtained in Preparation Example 26 (3.09 g) in DMF (15 mL), and water (22 mL) were added, and the mixture was warmed to 120°C and r stirred for about ﬁve hours. The reaction FP1100 mixture was cooled to room temperature and concentrated under reduced pressure, and the residue was passed through a silica gel pad (NH silica gel, eluting with ethyl acetate). The ﬁltrate was concentrated to about 200 mL and then partitioned by adding brine. The organic layer was dried over anhydrous magnesium sulfate and ﬁltered. The ﬁltrate was concentrated, and the residue was puriﬁed by NH silica gel column chromatography (ethyl acetate/n—heptane, 70% to 90%) to give the title compound (2.26 g).

ESI-MS m/z 456 [M + HT" (3) S thesis of eth 15- 2—ﬂuoro o —4 6—dirneth l 'din—3- l hen l- l- 3RS 4SR -4—metho trah droﬁJran—3- l ~1H— le—4-carbo late Sodium hydride (60% oil dispersion, 86 mg) was added to a solution ofethyl 5-(2- ﬂuoro—4-(2—methoxy—4,6-dimethylpyridin—3-yl)phenyl)-l—[(3RS,4SR) hydroxytetrahydroﬁnan—3-yl]—lH—pyrazele-4—carboxylate (612 mg) in THF (5 mL) under ice-cooling, followed by stirring for three minutes. Methyl iodide (0.142 mL) was added to the reaction mixture, and the mixture was stirred at the same temperature for ﬁve minutes, and then warmed to room temperature and stirred for ﬁthher two hours. A saturated aqueous ammonium chloride solution was added to the reaction mixture, followed by extraction with ethyl e. The organic layer was washed with brine, dried over anhydrous magnesium sulfate and d. The ﬁltrate was concentrated, and the residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 27% to 48%) to give the title compound (379 mg).

ESI-MS m/z 492 [M + Na]+ (4) S thesis of 5- 2—ﬂuoro—4- 2-metho —4 6-dimeth l 'din l hen l I t3RS,4SR)—4—methoy§trahydroﬁ1ran—3-yl|-1H-py;a@lecarboxamide The title compound was sized in accordance with Example 53(2).

ESI—MS m/z 463 [M + Na]+ (5) Synthesis of 7-(2-methoxy—4,6-dimethylpmdin—3-yl)—1-|t3RS,4SR) metho trah drofuran l-lH— lo 43-c uinolin-4 5 -one The title compound was obtained in accordance with Example 53. r, the title nd obtained as a crude puriﬁed product was puriﬁed by washing with MTBE. 1H—NMR (400 MHz, CDC13) 8 (ppm): 2.10 (s, 3H), 2.49 (s, 3H), 3.42 (s, 3H), 3.86 (s, 3H), 4.10 (dd, 5, 2.15 Hz, 1H), 4.24-4.37 (m, 2H), 4.47 (dd, J=9.47, 6.35 Hz, 1H), 4.64- 4.70 (m, 11-1), 5.47—5.51 (m, 1H), 6.73-6.74 (m, 1H), .23 (m, 1H), 7.27-7.30 (n1, 1H), 8.16 (d, J=8.40 Hz, 1H), 8.27-8.32 (m, 1H), 10.11 (s, 1H).

FPll00 ESI—MS m/z 421 [M+H]+ Example 61 S thesis of 7- 2-metho -3 5-dimeth 1 'din—4— l-l— 3RS 48R metho nah drofuran—3- l-lH— 10 43-0 uinolin—4 5 -one The title compound was obtained by performing the reactions (1) to (5) in accordance with Example 60 using 4-iodo-2—methoxy—3,5-dimethylpyridine obtained in Preparation e 29(3). 1H—NMR (400 MHz, CDC13) 6 (ppm): 1.89-2.00 (m, 6H), 3.42 (d, J=0.59 Hz, 3H), 4.00 (s, 3H), 4.07—4.16 (m, 1H), .39 (m, 2H), 4.48 (dd, J=9.47, 6.35 Hz, 1H), 4.68 (dd, J=4.69, 1.95 Hz, 1H), 5.50 (ddd, J=6.20, 4.25, 1.86 Hz, 1H), 7.06-7.14 (m, 1H), 7.16-7.21 (m, 1H), 7.95 (s, 1H), 8.22 (d, J=8.40 Hz, 1H), 8.29-8.34 (m, 1H), 10.11 (s, 1H).

ESI—MS m/z 421 [M+I-I]+ Example 62 ' of (1) S thesis of eth 1 5- 4- 6 S -tetrah an 1 -1H— 1ecarbo late FP1100 Ethyl 5-[2-nitro(4,4,5,5-tetramethyl—1,3,2—dioxaborolan—2—yl)phenyl][(S)- tetrahydroﬁ1ranyl]-1H—pyrazolecarboxylate obtained in Preparation Example 7—(2) (200 mg) was dissolved in a mixed solution of 1,4-dioxane (4 mL) and water (1 mL). 3- bromo-6—ethoxy—2,4—dimethylpyridine obtained in Preparation Example 51 (121 mg), Pd(PPh3)4 (25 mg) and cesium ate (428 mg) were added, and the mixture was d using a ave reactor at 130°C for three hours. The reaction mixture was returned to room temperature, followed by extraction with ethyl acetate. The organic layer was washed with brine and dried over anhydrous sodium sulfate. The desiccant was removed by ﬁltration, and the e was trated under reduced pressure. The residue was puriﬁed by silica gel column chromatography (ethyl acetate/n—heptane, 30% to 100%) to give the title compound (97 mg).

EST-MS m/z 481 [M + Hf (2) S thesis of S 351 )—1H—pmlol 4,3-c lguinolin-4t 5ﬂ )—one Ethyl 5-[4-(6-ethoxy—2,4-dimethylpyridin—3-yl)-2—nitrophenyl]—1-[(S)- tetrahydroﬁnan—3-y1]—1H—pyrazole—4-carboxylate (97 mg) was ved in acetic acid (1 mL). Iron powder (56 mg) was added to the solution, and the mixture was stirred at 90°C for four hours. The reaction mixture was returned to room temperature, and water (2 mL) was added to the reaction mixture. The precipitated solid was collected by ﬁltration and washed with water. The resulting solid was dissolved in ethanol (1 mL) at 90°C. The solution was ice-cooled, and the precipitated solid was collected by ﬁltration. The resulting solid was washed with MTBE to give the title compound (16 mg). 1H—NMR (400 MHz, CDC13) 5 (ppm): 1.43 (t, J=7.0 Hz, 3H), 2.03 (s, 3H), 2.21 (s, 3H), 2.55-2.67 (m, 1H), 2.76-2.87 (m, 1H), 4.07-4.17 (m, 2H), 4.23-4.47 (m, 4H), 5.62-5.70 (m, 1H), 6.53 (s, 1H), 7.12 (dd, J=8.2 Hz, 1.6 Hz, 1H), 7.32 (d, J=1.6 Hz, 1H), 8.10 (d, J=8.6 Hz, 1H), 8.31 (s, 1H), 11.02 (brs, 1H).

ESI-MS m/z 405 r Example 63 FP1100 k L o O o HN I \N 0N0 \ <1) (1) \N (2) 2 I HzNo I \N l N’ IN —> , __> NI LE) ....... \ 0 Br Br {/\0 Br Lo NI / (1) S thesis of S bromo-l— tetrah drofuran—31H- 10 43-0 uinolin- 4 5 -one Sodium hydrosulﬁte (265 mg) was added to a solution of ethyl 5-(4-bromo—2— nitrophenyl)—l-[(S)-tetrahydroﬁ1ran—3—y1]-1H—pyrazolecarboxylate obtained in Preparation Example 7(1) (100 mg) in THF(1 mL) and water (0.5 mL) at 0°C. The e was stirred at room temperature for 46 hours. The on mixture was cooled at 0°C, and 5 N hydrochloric acid (0.25 mL) was then added. The mixture was stirred at room temperature for three hours. After cooling at 0°C, a 5 N aqueous sodium hydroxide solution (0.25 mL) was added to the reaction mixture. The mixture was extracted with pyl acetate. The c layer was washed with water and brine and then concentrated under reduced pressure. Ethyl 5-(2-aminobromophenyl)[(S)-tetrahydroﬁ1ran—3-y1]-1H-pyrazclo—4— carboxylate (71 mg) was obtained as a crude d product. This was used for the next step without further puriﬁcation Ethyl 5-(2-arninobromophenyl)—l-[(S)- tetrahydroﬁiranyl]-lH—pyrazolocarboxylate (50 mg) obtained as a crude puriﬁed product was added to acetic acid (1 mL). The mixture was stirred at 60°C for two hours.

After cooling the reaction mixture to room ature, water (1 mL) was added, and the mixture was stirred at room temperature for two hours. The precipitated solid was collected by ﬁltration. The solid was washed with ethanol (1 mL) and then dried under reduced pressure. The title compound (42 mg) was ed 1H-NMR (400 MHZ, DMSO'dG) 6 (ppm): 2.41-2.56 (m, 2H), 3.89-4.03 (m, 2H), 4.10-4.19 (m, 2H), 5.78 (m, 1H), 7.41—7.44 (m, 1H), 7.64-7.65 (m, 1H), 8.16-8.18 (m, 2H), 11.53 (s, 1H).

ESI-MS m/z 336 [M+I—1]+

[0402] (2) S thesis of S yl 1-1H-pmlol4ﬁ-clguinolin-4gSH l-one (S)bromo-l-(tetrahydrofuranyl)-1H-pyrazolo[4,3-c]quinolin—4(SI-I)-one (100 mg), (2-methoxy—3,5-dirnethyl—pyridin—4—yl)boronic acid (65 mg) ed in Preparation Example 29 (4) and cesium carbonate (293 mg) were added to a mixed solution ofDMF (5 mL) and water (1 mL) at room temperature. PdC12(PPh3)2 (10.5 mg) was added to the FP1100 mixture in a nitrogen gas stream. The mixture was stirred at 80°C for one hour and at 100°C for 4.5 hours. After cooling the reaction mixture to room temperature, water (5 mL) was added, and the mixture was ted with isopropyl e. The organic layer was washed with water and brine and then concentrated under reduced re. A crude puriﬁed product (64.7 mg) was obtained as the title compound. The mental data of this compound were identical to those ofthe (-)-form ofExample 25.

[Pharmacological Test Examples] APDE9 inhibitory activity test example 1) Preparation ofa human inant PDE9 protein An hsPDE9A chNA ﬁagment was ampliﬁed by being based on a base sequence (Accession No.: AF048837) of the hsPDE9Al registered on GenBank data base, and by using the following sequences ido System Science Co., Ltd.) as a primer and Human hippocarnpus cDNA library (Clontech Laboratories, Inc.) as a template DNA, and using PquO DNApolymerase (Invitrogen Corp), and by a polymerase chain reaction (PCR) ofthe following ion An hPDE9-1 primer: AGGATGGGATCCGGCTCCTCCA (SEQ No. 1) An hPDE9A-3 primer: CAGGCACAGTCTCCTTCACTG (SEQ No. 2) The ion of PCR: [96°C, 5 min] x 1 cycle, [(96°C, 10 sec), (57°C, 5 sec), (72°C, 2 min)] x 30 cycles

[0404] The obtained hsPDE9A chNA fragment was incorporated in a TOPO-TA cloning vector (Invitrogen Corp), and the base sequence was checked; and fter, the resultant was transfected in a pcDNA 3.1/myc His-tag vector (Invitrogen Corp.) to thereby make a human PDE9 expression vector for mammal cells. The human PDE9 expression vector for mammal cells was transfected with transient expression to an HEK293 cell by using a LH’OFETAMINE 2000 Reagent (Gibco). It was conﬁrmed by Western blot method that the PDE9A expressed in the HEK293 cell, and then, the human PDE9A chNA fragment was ected in a pYNG vector ura Industries Co., Ltd.) to thereby make an expression vector for insect cells. A supernatant of homogenized silk worm in which a large amount ofPDE9 was expressed was puriﬁed by an equilibrated Ni column using a buffer A (20 mmol/L Tris-HCl, pH: 8.0, 1 mmol/L DTT, 10 mmol/L imidazcle). After 1 hour ofmixing ofthe supernatant and the Ni column, cleaning was carried out using a butfer B (20 mmol/L Tris-HCl, pH: 8.0, 1 mmol/L DTT), and elution was carried out using a buffer C (20 mmol/L Tris-HCl, pH: 8.0, 1 mmol/L DTT, 100 mmol/L imidazole). An elution FP11—0553—00 ﬁaction was preparatively collected to thereby obtain a PDE9 enzyme solution. 2) ement ofPDE9 inhibitory action To 100 “L ofa buffer D (40 mmol/L Cl, pH: 7.4, 10 mmol/L MgClz, 1 mM DTT, 2 uM cGMP) solution containing Gl\/IP (0.5 ), 10 pl, of a compound solution for evaluation (a solution in which a compound was dissolved in DMSO and diluted so that the DMSO concentration became 5%) and 90 uL of a solution prepared by diluting the PDE9 enzyme solution prepared in the above with a buffer B (40 mmol/L Tris-HCl, pH: 7.4, 10 mmol/L MgClz, 1 mM DTT, 1 mmol/L EGTA) were added under ice cooling. The resultant mixed solution was incubated at 30°C for 10 min, and thereafter heated for 2 min in boiled water to stop the enzyme reaction ofthe PDE9. Then, the resultant was ed to room temperature; 50 uL of 5'-Nuc1eotidase (Biomol Gran, 10 units/mL) was added thereto; and the resultant was incubated at 30°C for 10 min to thereby convert [3H]-5'-GMP formed in the previous on to [3H]-guanosine. 500 uL of an anion exchange resin (Bio-Rad AGl-X2 resin, mesh size: 200-400, H20 : resin = 2 : 1) was added to the resultant reaction , and allowed to stand for 10 min, and thereafter centrifuged (2,000 rpm, 10 min); and a supernatant in which the [3H]-guanosine was present was transferred to a LumaPlate (PerkinElmer, Inc), and the radioactivity was measured by a TopCount NXT microplate scintillation and luminescence counter (PerkinElmer, Inc.) The inhibition percentage of the tion compound was calculated using the following expression, taking the radioactivity of a control containing no evaluation compound to be (A), the radioactivity of a blank containing no enzyme to be (B), and the radioactivity ofthe evaluation compound to be (C). tion percentage = 100 — {[(C) - (B)] / [(A) — (B)]} x 100 (%) The ICso value for PDE9 of the evaluation nd was determined from inhibition percentage for various concentrations. The ICso value in each evaluation compound is shown in Table 10.

[Table 10] PDE9 1050 PDE9 ICso PDE9 ICso Example (uM) (pM) _OHM).0243 28 (-) 0.00836 Example)41 ()- 0.0121 _————00105 _——-_—00121 FP1100 3 1 ( )— 0.00742 45 0.00333 47 11 48 12 49 13 50 14 51 52 16 53 17 54 18 55 19 56 57 ' 21 58 22 3—8 (-) 5-9 00171 E__ 00111 3) Eﬁ‘ect on rodent cerebrospinal ﬂuid cGMP The test compound was administered to ICR male mice (Charles River Laboratories Japan, Inc), Sprague—Dawley male rats (SD) (Charles River Laboratories Japan, Inc.) or Long-Evans male rats (LE) (Institute for Animal Reproduction), and the cerebrospinal ﬂuid was then collected under pentobarbital anesthesia and stored at -20°C. cGMP in the cerebrospinal ﬂuid was measured in ance with the ation EIA procedure ofcGMP EIA kit (GE Healthcare) or the non-acetylation procedure ofcGMP EIA kit (Cayman). The result was an increase (C) in the amount of cGMP of the test compound-administered group (B) relative to the amount of cGMP of the e- administered group (A), and was calculated using the following formula cGMP increase (C) = [(B) - (A)] / (A) x 100 (%) The s are shown in the following table.

[Table 11] (+/-) % CSF cGMP . or increase from species dis: (mg/kg, $133!; Example (R/S) vehicle control p. ' FP1100 m 10 )—l ———- mm _-p—Ip—d [\J 149 )-d O p—A O 32 )...A 0 AU.) 292 ’5 £11 )—A 1 89 10 £11 ()3 ilB33B'535’:R202 10 _—_- SEE p—l -_-H 4) Eﬁect on rodent hippocampal cGMP The test compound was administered to Sprague—Dawley male rats (Charles River Laboratories Japan, Inc.) or Long-Evans male rats (Institute for Animal Reproduction) and then the animals were sacriﬁced with microwave under arbital anesthesia, and the hippocampus was extracted After ing the wet weight, the hippocampus was ﬁozen with liquid nitrogen and stored at —80°C. In the measurement of cGMP in the ampus, a 0.5 M perchloric acid/1 mM EDTA solution was added at 5% (w/V) based on the wet weight, and the mixture was nized. After the homogenization, the homogenate was centrifuged (10000 rpm, 15 min), and the supernatant was collected. The collected supernatant was neutralized with a 2 M potassium bicarbonate solution and centn'ﬁiged (13000 rpm, 10 min). The cGMP concentration in the supernatant was measured in accordance with the non-acetylation EIA ure of cGMP EIA kit (GE Healthcare). The result was an increase (C) in the amount ofcGMP ofthe test compound- admjnistered group (B) ve to the amount of cGMP of the vehicle-administered group (A), and was calculated using the following formula cGMP increase (C) = [(B) - (A)] / (A) x 100 (%) The results are shown in the following table.

[Table 12] FP110.v5530.0 % hippocampal cGMP increase from vehicle g s AwmW) con1I01 EPCmm

Claims

1. A compound or cologically acceptable salt thereof represented by the formula (I): 5 wherein R1 is a hydrogen atom; R2 is an aromatic ring group selected from the group consisting of a phenyl group, a pyridinyl group, and a pyrimidinyl group, where the two atoms on the aromatic ring which are adjacent to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring each 10 ndently has a substituent selected from Group A1, and the other atoms on the ic ring independently optionally have a substituent selected from Group B1; R3 is a hydrogen atom, or a fluorine atom; R4 is a hydrogen atom; R5 is an oxepanyl group, a dioxepanyl group, a tetrahydropyranyl group, or a 15 tetrahydrofuranyl group optionally having a methoxy group; R6 is a hydrogen atom; Group A1 consists of a halogen atom, a C1-6 alkyl group optionally having 1 to 3 halogen atoms, and a C1-6 alkoxy group; and Group B1 consists of a halogen atom, a cyano group, a C1-6 alkyl group optionally 20 having 1 to 3 n atoms, a C1-6 alkoxy-C1-6 alkyl group, a C1-6 alkoxy group optionally having 1 to 3 halogen atoms, and a tetrahydropyranyl group, with the proviso that when R2 is a 3-pyridinyl group, the substituent at the 4- position is a halogen atom, or a C1-6 alkyl group optionally having 1 to 3 halogen atoms. 25

2. The compound or pharmacologically acceptable salt thereof according to claim 1, n R2 is an aromatic ring group selected from the group ting of a phenyl group, a 3-pyridinyl group, a 4-pyridinyl group, and a 5-pyrimidinyl group, where the two atoms on the aromatic ring which are adjacent to the carbon atom attached to the pyrazolo[4,3- c]quinoline ring each independently has a substituent ed from Group A2, and the other atoms on the aromatic ring independently optionally have a substituent selected from Group R5 is a anyl group, a 1,4-dioxepanyl group, a 3,4,5,6-tetrahydro-2H 5 pyranyl group, a 6-tetrahydro-2Hpyranyl group, or a 3-tetrahydrofuranyl group; Group A2 consists of a chlorine atom, and a methyl group optionally having 1 to 2 fluorine atoms, an ethyl group, a methoxy group, and an ethoxy group; and Group B2 consists of a ne atom, a chlorine atom, a cyano group, a methyl group optionally having 1 to 3 fluorine atoms, an ethyl group, a methoxymethyl group, a 10 y group optionally having 1 to 3 fluorine atoms, an ethoxy group, an isopropyloxy group, and a 3,4,5,6-tetrahydro-2Hpyranyl group.

3. The compound or pharmacologically acceptable salt thereof according to claim 2, wherein R3 is a fluorine atom.

4. The compound or pharmacologically acceptable salt thereof according to claim 1, wherein R3 is a hydrogen atom; and R5 is a tetrahydropyranyl group, or a tetrahydrofuranyl group optionally having a 20 methoxy group.

5. The compound or pharmacologically acceptable salt f according to claim 2, wherein R3 is a hydrogen atom; and 25 R5 is a 3,4,5,6-tetrahydro-2Hpyranyl group, a 3,4,5,6-tetrahydro-2Hpyranyl group, or a 3-tetrahydrofuranyl group.

6. The compound or pharmacologically acceptable salt thereof according to claim 1, wherein 30 R2 is an aromatic ring group selected from the group consisting of a phenyl group, a 3-pyridinyl group, and a 4-pyridinyl group, where the two atoms on the aromatic ring which are adjacent to the carbon atom attached to the pyrazolo[4,3-c]quinoline ring each ndently has a substituent selected from Group A3, and the other atoms on the aromatic ring independently optionally have a substituent selected from Group B3; R3 is a hydrogen atom; R4 is a hydrogen atom; R5 is a 3,4,5,6-tetrahydro-2Hpyranyl group, or a 3-tetrahydrofuranyl group; 5 Group A3 consists of a methyl group, and a methoxy group; and Group B3 consists of a methyl group, a methoxy group, and a methoxymethyl group.

7. A compound or pharmacologically acceptable salt thereof according to 10 claim 1 ed from the following group: 1) 7-(6-methoxy-2,4-dimethylpyridinyl)(tetrahydro-2H-pyranyl)-1H- pyrazolo[4,3-c]quinolin-4(5H)-one, 2) 7-(2-methoxy-4,6-dimethylpyridinyl)(tetrahydro-2H-pyranyl)-1H- pyrazolo[4,3-c]quinolin-4(5H)-one, 15 3) (S)(6-isopropyloxy-2,4-dimethylpyridinyl)(tetrahydrofuranyl)-1H- pyrazolo[4,3-c]quinolin-4(5H)-one, 4) ro(2-methoxy-4,6-dimethylpyridinyl)(tetrahydro-2H-pyranyl)- azolo[4,3-c]quinolin-4(5H)-one, 5) 1-(1,4-dioxepanyl)(2-methoxy-3,5-dimethylpyridinyl)-1H- 20 pyrazolo[4,3-c]quinolin-4(5H)-one, 6) -dioxepanyl)(2-methoxy-4,6-dimethylpyridinyl)-1H- pyrazolo[4,3-c]quinolin-4(5H)-one, 7) (S)fluoro(2-methoxy-3,5-dimethylpyridinyl)(tetrahydrofuranyl)- 1H-pyrazolo[4,3-c]quinolin-4(5H)-one, 25 8) 7-(2-methoxy-3,5-dimethylpyridinyl)(tetrahydro-2H-pyranyl)-1H- pyrazolo[4,3-c]quinolin-4(5H)-one, 9) (-)(2-methoxy-4,6-dimethylpyridinyl)(tetrahydrofuranyl)-1H- pyrazolo[4,3-c]quinolin-4(5H)-one, 10) (-)(6-methoxy-2,4-dimethylpyridinyl)(tetrahydrofuranyl)-1H- 30 pyrazolo[4,3-c]quinolin-4(5H)-one, 11) (S)fluoro(2-methoxy-4,6-dimethylpyridinyl)(tetrahydrofuranyl)- 1H-pyrazolo[4,3-c]quinolin-4(5H)-one 12) (S)(6-ethoxy-2,4-dimethylpyridinyl)(tetrahydrofuranyl)-1H- pyrazolo[4,3-c]quinolin-4(5H)-one 13) (S)fluoro(6-methoxy-2,4-dimethylpyridinyl)(tetrahydrofuranyl)- 1H-pyrazolo[4,3-c]quinolin-4(5H)-one and 14) (S)(2-methoxy-3,5-dimethylpyridinyl)(tetrahydrofuranyl)-1H- 5 lo[4,3-c]quinolin-4(5H)-one.

8. A compound according to claim 1 that is 7-(6-isopropyloxy-2,4- dimethylpyridinyl)(tetrahydrofuranyl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a pharmacologically acceptable salt thereof.

9. A compound according to claim 1 that is (S)(6-isopropyloxy-2,4- dimethylpyridinyl)(tetrahydrofuranyl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a pharmacologically able salt thereof

10. A compound according to claim 1 that is 8-fluoro(2-methoxy-3,5- dimethylpyridinyl)(tetrahydrofuranyl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a pharmacologically acceptable salt thereof. 20

11. A compound according to claim 1 that is (S)fluoro(2-methoxy-3,5- dimethylpyridinyl)(tetrahydrofuranyl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a pharmacologically acceptable salt thereof: 25

12. A compound ing to claim 1 that is 7-(2-methoxy-3,5- dimethylpyridinyl)(tetrahydrofuranyl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a pharmacologically acceptable salt thereof.

13. A compound according to claim 1 that is (S)(2-methoxy-3,5- dimethylpyridinyl)(tetrahydrofuranyl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a 5 pharmacologically acceptable salt thereof:

14. A compound according to claim 1 that is 1-(1,4-dioxepanyl)(2- methoxy-3,5-dimethylpyridinyl)-1H-pyrazolo[4,3-c]quinolin-4(5H)-one or a 10 pharmacologically acceptable salt thereof: N O O .

15. A pharmaceutical composition comprising the compound or cologically acceptable salt f according to claim 1 as an active ingredient.

16. The pharmaceutical composition according to claim 15 which is a PDE9 inhibitor.

17. The pharmaceutical composition according to claim 15 for increasing the 20 intracerebral cGMP concentration.

18. A cognitive impairment improving agent in Alzheimer's disease, comprising the compound or pharmacologically acceptable salt f according to claim 1. 25

19. The compound or pharmacologically acceptable salt f according to claim 1 for use for improving cognitive impairment in Alzheimer's disease.

20. The use of a compound ing to claim 1 in the manufacture of a medicament for improving cognitive impairment in Alzheimer’s disease.

21. The use of a compound according to claim 1 in the manufacture of a medicament for increasing intra cerebral CGMP concentration.

22. The compound according to claim 1, substantially as herein described 10 with reference to any one of the examples and/or figures.

23. The use ing to claim 20 or 21, substantially as herein bed with reference to any one of the examples and/or figures.