NZ553497A - Plant artificial chromosomes, uses thereof and methods of preparing plant artificial chromosomes - Google Patents

Abstract

Disclosed are methods for preparing plant cell lines that contain artificial chromosomes and methods for the preparation of such chromosomes. In particular, methods are provided for preparing cells with sausage chromosomes, chromosomes with amplified heterochromatin, and other artificial chromosomes derived from an acrocentric chromosome. The methods comprise: a) introducing a nucleic acid into an acrocentric plant chromosome, b) culturing the cell, and c) selecting a cell containing the desired chromosome.

Description

10053317343 lirteiiectuai pJ?Renv Office of N.Z. 2 7 FEB 2007 RECEIVE PATENTS FORM NO. 5 Fee No. 4: $250.00 PATENTS ACT 1953 COMPLETE SPECIFICATION Divisional Application From NZ 542162 James & Wells Ref: 43513DIV/ 29 Plant Artificial Chromosomes, Uses Thereof and Methods of Preparing Plant Artificial Chromosomes WE, Chromos Molecular Systems Inc, a Canadian corporation of 8081 Lougheed Highway, Burnaby, BC V5A 1W9, Canada; and Agrisoma Inc, a Canadian corporation of 8081 Lougheed Highway, Burnaby, BC V5A 1W9, Canada; hereby declare the invention for which We pray that a patent may be granted to us, and the method by which it is to be performed to be particularly described in and by the following statement: 1 (followed by 1a) ^ f -IMPLANT ARTIFICIAL CHROMOSOMES, USES THEREOF AND METHODS OF PREPARING PLANT ARTIFICIAL CHROMOSOMES RELATED APPLICATIONS Benefit of priority is claimed to U.S. Provisional Application No. 60/294,687, filed May 30, 2001, by CARL PEREZ AND STEVEN FABIJANSKI entitled PLANT ARTIFICIAL CHROMOSOMES, USES THEREOF AND METHODS FOR PREPARING PLANT ARTIFICIAL CHROMOSOMES and 5to U.S. Provisional Application No. 60/296,329, filed June 4, 2001, by CARL PEREZ AND STEVEN FABIJANSKI entitled PLANT ARTIFICIAL CHROMOSOMES, USES THEREOF AND METHODS FOR PREPARING PLANT ARTIFICIAL CHROMOSOMES. This application is related to U.S. Provisional Application No. 60/294,758, filed May 30, 2001, by EDWARD PERKINS et 10a/.. entitled CHROMOSOME-BASED PLATFORMS and to U.S. Provisional Application No. 60/366,891, filed March 21, 2002, by EDWARD PERKINS et ah. entitled CHROMOSOME-BASED PLATFORMS. This application is also related to U.S. Provisional Application Serial No. 10/161,403, filed May 30, 2002, by EDWARD PERKINS et a/., entitled CHROMOSOME-BASED 15PLATFORMS and to PCT International Patent Application Serial No.

PCT/US02/17452, filed May 30, 2002, by EDWARD PERKINS et al.. entitled CHROMOSOME-BASED PLATFORMS. This application is related to U.S. application Serial No. 08/695,191, filed August 7, 1996 by GYULA HADLACZKY and ALADAR SZALAY, entitled ARTIFICIAL CHROMOSOMES, 20USES THEREOF AND METHODS FOR PREPARING ARTIFICIAL CHROMOSOMES, now U.S. Patent No. 6,025,155. This application is also related to U.S. application Serial No. 08/682,080, filed July 15, 1996 by GYULA HADLACZKY and ALADAR SZALAY, entitled ARTIFICIAL CHROMOSOMES, USES THEREOF AND METHODS FOR PREPARING INARTIFICIAL CHROMOSOMES, now U.S. Patent No. 6,077,697. This application is also related to U.S. application Serial No. 08/629,822, filed April 10, 1996 by GYULA HADLACZKY and ALADAR SZALAY, entitled ARTIFICIAL CHROMOSOMES, USES THEREOF AND METHODS FOR PREPARING ARTIFICIAL CHROMOSOMES (now abandoned), and is also related to copending U.S. application Serial No. 09/096,648, filed June 12, 1998, by GYULA HADLACZKY and ALADAR SZALAY, entitled ARTIFICIAL CHROMOSOMES, USES THEREOF AND METHODS FOR PREPARING 5ARTIFICIAL CHROMOSOMES and to U.S. application Serial No. 09/835,682, April 10, 1997 by GYULA HADLACZKY and ALADAR SZALAY, entitled ARTIFICIAL CHROMOSOMES, USES THEREOF AND METHODS FOR PREPARING ARTIFICIAL CHROMOSOMES (now abandoned). This application is also related to copending U.S. application Serial No. 1009/724,726, filed November 28, 2000, U.S. application Serial No. 09/724,872, filed November 28, 2000, U.S. application Serial No. 09/724,693, filed November 28, 2000, U.S. application Serial No. 09/799,462, filed March 5, 2001, U.S. application Serial No. 09/836,911, filed April 17, 2001, and U.S. application Serial No. 10/125,767, filed April 1517, 2002, each of which is by GYULA HADLACZKY and ALADAR SZALAY, and is entitled ARTIFICIAL CHROMOSOMES, USES THEREOF AND METHODS FOR PREPARING ARTIFICIAL CHROMOSOMES. This application is also related to International PCT application No. WO 97/40183. Where permitted the subject matter of each of these applications is incorporated by 20reference in its entirety.

\ FIELD OF THE INVENTION Artificial chromosomes and methods of producing artificial chromosomes, particularly for use in delivery of nucleic acids and expression thereof in plants are provided. Also provided are methods of use of artificial chromosomes in the delivery of nucleic acids to host cells, including plant 5cells, and the expression of the nucleic acids therein. The resulting plant cells, tissues, organs and whole plants containing the artificial chromosomes, plant cell-based methods for production of heterologous proteins and methods of producing transgenic organisms, particularly plants, using the artificial chromosomes are provided. 10BACKGROUND OF THE INVENTION The stable transfer of nucleic acids into plant cells and the expression of the nucleic acids therein poses many challenges. Many efforts at the stable introduction of nucleic acids into plant cells have utilized Agrobacterium-mediated transformation. Agrobacterium is a free-living 15Gram-negative soil bacterium. Virulent strains of this bacterium are able to infect plant tissue and induce the production of a neoplastic growth commonly referred to as a crowngall. Virulent strains of Agrobacterium contain a large plasmid DNA known as a Ti-plasmid that contains genes required for DNA transfer (vir genes) and replication as well as a region of 20DNA that is transferred to plant cells called T-DNA. The T-DNA region is bordered by T-DNA border sequences that are crucial to the DNA transfer process. These T-DNA border sequences are recognized by the vir genes encoded on the Ti-plasmid and the vir genes are responsible for the DNA transfer process.

Most wild-type Agrobacterium have a relatively broad dicot plant host range and are capable of transferring T-DNA regions up to 25 kilobases of DNA (e.g., nopaline strains) or more (e.g., octopine strains). Accordingly, numerous methods of using Agrobacterium to transfer DNA into plant cells have been developed based on the engineering of the Ti-plasmid to no longer contain the genes responsible for altered morphology and replacing these genes with a recombinant gene encoding a trait of interest. There are two primary types of Agrobacterium-based plant transformation systems, binary 5[see, e.g., U.S. Patent No. 4,940,838] and co-integrate [see, e.g., Fraley et al. (1985) Biotechnology 3\629-635] methods. The T-DNA border repeats are maintained in both systems and the natural DNA transfer process is used to transfer the portion of DNA located between the T-DNA borders into the plant cell.

Another plant cell transformation system, termed biolistics, involves the bombardment of plant cells with microscopic particles coated with DNA encoding a new trait. The particles are rapidly accelerated, typically by gas or electrical discharge, through the cell wall and membranes, whereby the DNA is released into the cell and is incorporated into the genome of the cell. 15 This method is used for transformation of many crops, including corn, wheat, barley, rice, woody tree species and others.

A significant number of crop species of commercial interest have been transformed using either Agrobacterium-med\ated or biolistic systems. However, these methods have many limitations that limit their utility. For 20example, there are limits to the size of the heterologous DNA that can be transferred using these methods; typically, only one to two genes may be transferred. Thus, although these methods may have utility in producing crop products modified to contain a single new trait, such as insect or herbicide tolerance, they may not be sufficient to transfer DNA that will 25provide for multiple traits, or very large DNA segments encoding a multiplicity of traits.

In addition, the genetically modified plant cells produced by these methods tend to contain the transferred DNA in euchromatic regions of the genomic DNA. Typically, a large number of independent transgenic insertion events must be screened before a suitable event (such as insertion of a gene into the host genomic DNA such that it provides a sufficient level of gene expression within temporal and spatial expectations and without evidence of 5gene rearrangement) is identified.

Another limitation of these methods is the effort required to utilize them in the genetic modification of many commercially important crops. For example, transformation efficiency can vary with the crop and can be low, notably in cereal crops such as corn and wheat. Often the inserted genes 10are rearranged and unstable over generations.

Furthermore Agrobacterium tumefaciens relies on host-parasite interaction in order to be successful. This has the effect that Agrobacterium has a preference for some dicots, while other dicots, monocots and conifers are resistant to transformation via Agrobacterium. Self-replicating vectors 15have also been used in the transfer of nucleic acids into plant cells. Such episomal vectors contain DNA sequences that are required for DNA replication and sustainability of the vector in a living cell. In higher plants, very few episomal vectors have been developed. These episomal vectors have the drawback of having a very limited capacity for carrying genetic 20information and are unstable. One example of an episomal plant vector is the Cauliflower Mosaic Virus [Brisson et a!. (1984) Nature 3/0:5113.

Limitations of these gene delivery technologies necessitate the development of alternative vector systems suitable for transferring large (up to Mb size or larger) genes, gene complexes, and multiple genes together with regulatory elements for safe, controlled, and persistent expression of 5the desired genetic material in higher organisms, particularly plants, without rearrangement caused by insertion or mutagenesis. Therefore, it is an object herein to provide artificial chromosomes for the introduction of large nucleic acids into eukaryotic cells and methods using the artificial chromosomes, particularly for the introduction and expression of nucleic acids in plants. 10SUMMARY OF THE INVENTION Provided herein are plant artificial chromosomes and methods for producing plant artificial chromosomes. The artificial chromosomes are fully functional stable chromosomes. Plant artificial chromosomes provided herein have a particular composition that makes them ideal vectors for I5stable, controlled, high-level expression of heterologous nucleic acids in plant cells. The artificial chromosomes are capable of independent, extra-genomic maintenance, replication and segregation within cells and can carry multiple, large heterologous genes.

Artificial plant chromosomes provided herein are non-natural 20chromosomes that exhibit an ordered segmentation that distinguishes them from naturally occurring chromosomes. The segmented appearance can be visualized using a variety of chromosome analysis techniques and correlates with the unique structure of these artificial chromosomes, which, in particular methods of producing these chromosomes, can arise through 25amplification of chromosomal segments (i.e., amplification-based artificial chromosomes). The artificial chromosomes, throughout the region or regions of segmentation, are predominantly made up of one or more nucleic acid units that is (are) repeated in the region (referred to as the repeat region) and that have a similar gross structure. Repeats of a nucleic acid unit tend to be of similar size and share some common nucleic acid sequences, for example, a replication site involved in amplification of chromosome segments and/or some heterologous nucleic acid. Although 5the size of a repeating nucleic acid unit can vary, typically they tend to be greater than about 100 kb, greater than about 500 kb, greater than about 1 Mb, greater than about 5 Mb or greater than about 10 Mb. Typically, repeats of a nucleic acid unit are substantially similar in nucleic acid composition and can be nearly identical. The common nucleic acid 10sequences can contain sequences that represent euchromatic and heterochromatic nucleic acid. The composition of the amplification-based artificial chromosomes can be such that substantially the entire chromosome exhibits a segmented appearance or such that only one or more portions that make-up less than the entire chromosome appear segmented. 15 The composition of the plant artificial chromosomes provided herein can vary. For example, in some of the artificial chromosomes provided herein, the repeat region or regions can be made up predominantly of heterochromatic DNA (i.e., the repeat region or regions contain more heterochromatic DNA than other types of DNA, e.g., euchromatic DNA). In 20other artificial chromosomes provided herein, the repeat region or regions can be made up predominantly of euchromatic DNA (i.e., the repeat region or regions contain more euchromatic DNA than other types of DNA, e.g., heterochromatic DNA) or can be made up of substantially equivalent amounts of heterochromatic and euchromatic DNA, e.g., about 40% to 25about 50% of one type of nucleic acid and about 50% to about 60% of the other type of nucleic acid. The repeat region or regions thus can be entirely heterochromatic (while still containing one or more heterologous genes), or can contain increasing amounts of euchromatic DNA, such that, for example, the region contains about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than 90% euchromatic DNA. Common nucleic acid sequences within repeated nucleic acid units in a repeat region can contain DNA that represents euchromatic nucleic acid and DNA that 5represents heterochromatic nucleic acid. Because the entire artificial chromosome can be made up predominantly of a repeat region or regions (e.g., the composition of the chromosome is such that the repeat region or regions make up greater than about 50% or greater than about 60% of the chromosome), it is thus possible for the artificial chromosome to be made up 10predominantly of heterochromatin or euchromatin, or to be made up of substantially equivalent amounts of heterochromatin and euchromatin, e.g., about 40% to about 50% of one type of nucleic acid and about 50% to about 60% of the other type of nucleic acid. Plant artificial chromosomes provided herein can be isolated or contained within cells or vesicles. 15 Also provided herein are cells containing plant artificial chromosomes as described herein, including plant cells and animal cells. Included among the cells containing the plant artificial chromosomes are any cells that include one or more plant chromosomes. Included, for example, are plant cells, including plant protoplasts, in culture and within plant tissues, organs, 20seeds, pollen or whole plants. Plant cells containing the plant artificial chromosomes can be from any type of plant, including monocots and dicots. For example, the plant cells can be from Arabidopsis, Nicotiana, Solanum, Lycopersicon, Daucus, Hordeum, Zea mays, Brassica, Triticum, Helianthus, Oryza, Glycine (soybean), gossypium (cotton). Also contemplated are 25mammalian and other animal cells that contain plant ACs Plant cells containing artificial chromosomes of any species are also provided herein. Thus, for example, such plant cells can contain an artificial chromosome containing an animal, e.g., mammalian, centromere or an insect or avian centromere. Included among the artificial chromosomes contained within plant cells as provided herein are predominantly heterochromatic [formerly referred to as satellite artificial chromosomes (SATACs); see, e.g., U.S. Patent Nos. 6,077,697 and 6,025,155 and 5published International PCT application No. WO 97/40183], minichromosomes which contain a de novo centromere, artificial chromosomes containing one or more regions of repeating nucleic acid units wherein the repeat region(s) contain substantially equivalent amounts of euchromatic and heterochromatic nucleic acid and in vitro assembled 10artificial chromosomes, each from any species. An exemplary artificial chromosome is a mammalian satellite artificial chromosome containing a mouse centromere. Included among the plant cells containing artificial chromosomes of any species are plant cells, including plant protoplasts, in culture and within plant tissues, organs, seeds, pollen or whole plants. Plant 15cells containing the artificial chromosomes can be from any type of plant, including monocots and dicots. For example, the plant cells can be from Arabidopsis, Nicotiana, So/anum, Lycopersicon, Daucus, Hordeum, Zea mays, Brassica, Triticum, Helianthus and Oryza.

Further provided herein are methods of producing plant artificial 20chromosomes. One embodiment of these methods includes the steps of introducing nucleic acid into a cell containing plant chromosomes and selecting a cell containing an artificial chromosome that contains one or more repeat regions in which one or more nucleic acid units is (are) repeated. The repeats of a nucleic acid unit in a repeat region can contain 25common nucleic acid sequences and can be substantially identical. In some embodiments of this method, the repeat region(s) of the artificial chromosome contain substantially equivalent amounts of euchromatic and heterochromatic nucleic acid. The artificial chromosome can be predominantly made up of one or more repeat regions. In further embodiments of this method, the artificial chromosome is made up of substantially equivalent amounts of euchromatic and heterochromatic nucleic acid. In further embodiments of this method, the repeats of a 5nucleic acid unit have common nucleic acid sequences which contain sequences that represent euchromatic and heterochromatic nucleic acid.

Any cell containing plant chromosomes can be used in these embodiments of methods of producing plant artificial chromosomes described herein. For example, the cell can be any cell that contains lOchromosomes from Arabidopsis, tobacco, Solanum, Lycopersicon, Daucus, Hordeum, Zea mays, Brassica, Triticum, Oryza, Capsicum, lentil and/or Helianthus, including cells or protoplasts of Arabidopsis, tobacco and/or Helianthus.

The nucleic acid that is introduced into a cell containing plant 15chromosomes in methods of producing a plant artificial chromosome as provided herein can be any nucleic acid, including, but not limited to, satellite DNA, rDNA and lambda phage DNA. Satellite DNA and rDNA includes such DNA from plants, such as, for example, Arabidopsis, Nicotiana, Solanum, Lycopersicon, Daucus, Hordeum, Zea mays, Brassica, 20Triticum and Oryza, and from animals, such as mammals. The rDNA can contain sequences of an intergenic spacer region, such as can be obtained, for example, from DNA of Arabidopsis, Solanum, Lycopersicon, Hordeum, Zea, Oryza, rye, wheat, radish and mung bean. In some embodiments of the method, the nucleic acid contains a nucleic acid sequence that facilitates 25amplification of a region of a plant chromosome or targets it to an amplifiable region of a plant chromosome.

In further embodiments of methods of producing plant artificial chromosomes provided herein, the nucleic acid that is introduced into a cell containing one or more plant chromosomes includes nucleic acid for identification of cells containing the nucleic acid. Such nucleic acids include nucleic acid encoding a fluorescent protein, such as a green, blue or red fluorescent protein, and nucleic acid encoding a selectable marker, such as, 5for example, proteins that confer resistance to phosphinothricin, ammonium glufosinate, glyphosate, kanamycin, hygromycin, dihydrofolate or sulfonylurea.

In embodiments of methods of producing plant artificial chromosomes in which nucleic acid is introduced into a cell containing one or more plant lOchromosomes, the cell can be cultured through two or more cell doublings, and typically from about 5 to about 60, or about 5 to about 55, or about 10 to about 55, or about 25 to about 55, or about 35 to about 55 cell doublings following introduction of nucleic acid into a cell. The step of selecting a cell containing a plant artificial chromosome can include sorting 15of cells into which nucleic acid was introduced. For example, cells can be sorted on the basis of the presence of a selectable marker, such as a reporter protein, or by growing (culturing) the cells under selective conditions. The selection step can include fluorescent in situ hybridization (FISH) analysis of cells into which nucleic acid is introduced.

Also provided are methods of producing a transgenic plant using artificial chromosomes that function in plants and transgenic plants containing artificial chromosomes. Artificial chromosomes used in the methods of producing transgenic plants can be of any species. For example, the artificial chromosomes can contain a centromere from species such as 25animals, e.g., mammals, birds, plants, or insects, that functions to segregate nucleic acids to daughter cells through cell division. In some embodiments of the methods for producing a transgenic plant, the artificial chromosomes contain repeat regions predominantly made up of repeats of one or more nucleic acid units. Repeats of a nucleic acid unit can share some common nucleic acid sequences, for example, a replication site involved in amplification of chromosome segments and/or some heterologous nucleic acid. Repeats of a nucleic acid unit can be substantially identical. Common 5nucleic acid sequences of repeats of a nucleic acid unit can contain sequences that represent euchromatic and heterochromatic nucleic acid.

Repeat regions of artificial chromosomes that can be used in the methods of producing a transgenic plant can be made up of substantially equivalent amounts of heterochromatic and euchromatic DNA or can be 10made up predominantly of heterochromatic DNA or can be made up predominantly of euchromatic DNA. The artificial chromosome can be made up predominantly of heterochromatic or euchromatic DNA or can be made up of substantially equivalent amounts of heterochromatin and euchromatin. Such artificial chromosomes that contain plant centromeres can contain a 15plant centromere from any species of plant, including monocots and dicots. For example, the centromere can be from Arabidopsis, tobacco, Helianthus, Solanum, Lycopersicon, Daucus, Hordeum, Zea, Brassica, Triticum, rye, wheat, radish, mung bean or Oryza. The artificial chromosomes can be made using methods described herein.

In a method of producing a transgenic plant provided herein, an artificial chromosome, such as those described above and elsewhere herein, is introduced into a plant cell. The artificial chromosome can contain heterologous nucleic acid encoding a gene product such as, for example, an 5enzyme, antisense RNA, tRNA, rDNA, a structural protein, a marker or reporter protein, a ligand, a receptor, a ribozyme, a therapeutic protein, a biopharmaceutical protein, a vaccine, a blood factor, an antigen, a hormone, a cytokine, a growth factor or an antibody. The product can be one that provides for resistance to diseases, insects, herbicides or stress in the plant. 10 The product can be one that provides for an agronomically important trait in the plant and/or that alters the nutrient utilization and/or improves the nutrient quality of the plant. Heterologous nucleic acid of an artificial chromosome can be contained within a bacterial artificial chromosome (BAC) or a yeast artificial chromosome (YAC).

The plant cell into which such artificial chromosomes can be introduced in methods of producing a transgenic plant provided herein can be any species of plant cell, including, but not limited to, Arabidopsis, tobacco, Helianthus, Solanum, Lycopersicon, Daucus, Hordeum, Zea, Brassica, Triticum, rye, wheat, radish, mung bean, Capsicum, lentil and 20Oryza. Any cell that can develop into a plant can be used, including plant cells and protoplasts of plant embryos, calli, tissues, meristem, organs, seeds, seedlings, pollen, pollen tubes or whole plants.

Artificial chromosomes can be introduced into plant cells in the methods of producing a transgenic plant using any process for transfer of 25nucleic acids into plant cells, including, but not limited to chemical, physical and electrical processes and combinations thereof. For example, the artificial chromosomes can be transferred into plant cells via direct contact in the absence or presence of a fusogen, e.g., polyethylene glycol (PEG), calcium phosphate and/or lipid or they can be encapsulated in a lipid structure (e.g., a liposome) or contained within a protoplast or microcell which is then allowed to fuse (in the presence or absence of a fusogen such as PEG) with a plant cell for introduction of the artificial chromosome into 5the cell in a method of producing a transgenic plant. Artificial chromosomes can be transferred to plant cells that are subjected to electrical pulses (e.g., electroporation) and/or ultrasound (e.g., sonoporation) before, during and/or after exposure of the cells to the artificial chromosomes. Use of electrical pulses and/or ultrasound can be in combination with any other agents, e.g., 10PEG and/or lipids, used in transferring nucleic acids into plant cells. Artificial chromosomes can also be physically injected into plant cells through a micropipette or needle or introduced into plant cells through bombardment of the cells with microprojectiles coated with the chromosomes. To facilitate transfer of nucleic acids into plant cells, the recipient cells or tissue can be I5subjected to mechanical wounding.

Plant cells into which artificial chromosomes have been introduced for purposes of producing a transgenic plant are cultured under conditions that permit generation of a whole plant therefrom. The transformed cells can be analyzed prior to use in the generation of whole plants to determine 20suitability. For example, the cells can be analyzed for the presence of artificial chromosomes and/or regenerative capacity. Plant regeneration techniques, many of which are known to those of skill in the art, can be used to generate whole plants from, for example, cells, embryos and calli containing artificial chromosomes. For example, plants can be regenerated 25from cells containing artificial chromosomes by the planting of transformed roots, plantlets, seed, seedlings, and any structure capable of growing into a whole plant.

Further provided herein are methods for producing an acrocentric plant chromosome and methods for producing plant chromosomes containing adjacent regions of rDNA and heterochromatin, in particular, pericentric and/or satellite heterochromatin. Also provided herein are methods for generating acrocentric plant chromosomes containing adjacent 5regions of heterochromatin, such as pericentric heterochromatin and/or satellite DNA, and rDNA on the short arm of the chromosome.

One embodiment of these methods includes steps of introducing nucleic acid containing two site-specific recombination sites into a cell containing one or more plant chromosomes, recombining nucleic acids of the lOtwo site-specific recombination sites, and selecting a cell containing an acrocentric plant chromosome and/or a plant chromosome containing adjacent regions of rDNA and heterochromatin. The two site-specific recombination sites can be contained on separate nucleic acid fragments which are introduced into the cell simultaneously or sequentially. 15 Other embodiments of the methods of producing an acrocentric plant chromosome and/or a plant chromosome that contains adjacent regions of rDNA and heterochromatin include steps of introducing a first nucleic acid containing a site-specific recombination site into a first plant chromosome, introducing a second nucleic acid containing a site-specific recombination 20site into a second plant chromosome, recombining nucleic acids of the first and second chromosomes and selecting a plant chromosome that is acrocentric or that contains adjacent regions of rDNA and heterochromatin. For example, to produce an acrocentric plant chromosome, the first nucleic acid can be introduced into or adjacent to the pericentric heterochromatin of 25the first chromosome and/or the second nucleic acid can be introduced into the distal end of the arm of the second chromosome. To produce an acrocentric plant chromosome containing adjacent regions of rDNA and heterochromatin, for example, the first nucleic acid can be introduced into or adjacent to the pericentric heterochromatin on the short arm of an acrocentric plant chromosome and the second nucleic acid can be introduced into or adjacent to rDNA. To produce a plant chromosome containing adjacent regions of rDNA and heterochromatin, for example, the 5first nucleic acid can be introduced into or adjacent to heterochromatin, such as pericentric heterochromatin or satellite DNA, and the second nucleic acid can be introduced into or adjacent to rDNA. When the chromosomes are located within a cell, the method can include selecting a cell containing a plant chromosome that is acrocentric and/or that contains adjacent regions 10of rDNA and heterochromatin.

Another embodiment of the methods of producing an acrocentric plant chromosome includes steps of introducing a first nucleic acid containing a site-specific recombination site into the pericentric heterochromatin of a plant chromosome, introducing a second nucleic acid 15containing a site-specific recombination site into the distal end of the chromosome in which the first and second recombination sites are located on the same arm of the chromosome, recombining nucleic acids of the first and second recombination sites in the chromosome and selecting a plant chromosome that is acrocentric.

Another method of producing an acrocentric plant chromosome or a plant chromosome containing adjacent regions of rDNA and heterochromatin includes steps of introducing nucleic acid containing a recombination site adjacent to or sufficiently near nucleic acid encoding a selectable marker into a first plant cell for recombination and introduction of the marker into 25the chromosome, generating a first transgenic plant from the first plant cell, introducing nucleic acid containing a promoter functional in a plant cell and a recombination site in operative linkage into a second plant cell, generating a second transgenic plant from the second plant cell, crossing the first and second plants, obtaining plants resistant to an agent that selects for cells containing the nucleic acid encoding the selectable marker, and selecting a resistant plant that contains cells containing an acrocentric plant chromosome or a plant chromosome containing adjacent regions of rDNA 5and heterochromatin. Methods of this embodiment can optionally include steps of selecting first and second transgenic plants such that one of the plants contains a chromosome containing a recombination site in a region within or adjacent to the pericentric heterochromatin and the other plant contains a chromosome containing a recombination site located within or 10adjacent to rDNA of the chromosome. These methods can further include the steps of selecting first and second transgenic plants where one of the plants contains a chromosome containing a recombination site located on a short arm of the chromosome in a region adjacent to the pericentric heterochromatin; and 15the other plant contains a chromosome containing a recombination site located in rDNA of the chromosome. In one embodiment, the recombination sites on the two chromosomes are in the same orientation.

In methods of producing an acrocentric plant chromosome, one or both of these recombination sites is located on a short arm of the 20chromosome. For example, one of the plants contains a chromosome containing a recombination site in a region within or adjacent to the pericentric heterochromatin located on the short arm of the chromosome. The selecting steps can further include selecting first and second transgenic plants such that the recombination sites on the two chromosomes are in the 25same orientation.

In any of these methods of producing an acrocentric plant chromosome or a plant chromosome containing adjacent regions of rDNA and heterochromatin (in particular, pericentric heterochromatin and/or satellite DNA), recombination between the first and second site-specific recombination sites can be provided for in a number of ways. For example, a recombinase activity can be introduced into a cell containing one or more chromosomes containing the sites which catalyzes the recombination 5reaction. The recombinase activity can be encoded by nucleic acid that is introduced into the cell simultaneously with nucleic acid containing a site-specific recombination site or that is introduced into the cell at a different time. Recombinase activity occurs within the cell upon expression of the nucleic acid encoding a recombinase activity, which can be operatively 10linked to a promoter functional in the cell. The recombinase activity can be constitutively expressed or can be induced, for example, by linking the nucleic acid encoding the recombinase to an inducible promoter. It is also possible that a cell into which nucleic acid containing site-specific recombination sites is introduced contains a recombinase enzyme which can 15be constitutively or inducibly expressed. Alternatively, a transgenic plant can be generated from cells containing the recombination sites and crossed with a transgenic plant containing nucleic acid encoding a recombinase.

Any site-specific recombinase system known to those of skill in the art is contemplated for use herein. It is contemplated that one or a plurality 20of sites that direct the recombination by the recombinase are introduced into the ACes (or other ACs) and then heterologous genes linked to the cognate site are introduced into an ACes to produce platform ACes. The resulting ACes are introduced into cells with nucleic acid encoding the cognate recombinase, typically on a vector, and nucleic acid encoding heterologous 25nucleic acid of interest linked to the appropriate recombination site for insertion into the ACes chromosome. The recombinase encoding nucleic acid may be introduced into the AC, including ACes, or on the same or a different vector from the heterologous nucleic acid.

For the methods herein any recombinase enzyme that catalyzes site-specific recombination can be used to facilitate recombination between the first and second site-specific recombination sites. A variety of recombinases and attachment/recombination sites therefor are available and/or known to 5those of skill in the art. These include, but not limited to: the Cre//ox recombination system using CRE recombinase from the Escherichia coli phage P1 , the FLP/FRT system of yeast using the FLP recombinase from the 2i episome of Saccharomyces cerevisiae, the resolvases, including Gin recombinase of phage, Mu, Cin, Hin, aa Tn3; the Pin recombinase of E. coli, 10the R/RS system of the pSR1 plasmid of Zygosaccharomyces rouxii, site specific recombinases from Kluyveromyces drosophilarium and Kluyveromyces waltii and other systems. Also contemplated is the E. coli phage lambda integrase system, which includes the phage lambda integrase and the cognate att sites (see, also U.S. application Serial No. 10/161,403). 15 In any of these methods of producing acrocentric plant chromosomes, nucleic acid containing a site-specific recombination site can also contain nucleic acid encoding a selectable marker. The nucleic acids used in the methods can be designed such that expression of the selectable marker occurs only upon the desired recombination event.

Acrocentric plant chromosomes produced by the methods provided herein can be of any composition. For example, the DNA of the short arm of the acrocentric chromosome can contain less than 5% or less than 1 % euchromatic DNA or can contain no euchromatic DNA. Acrocentric plant 25artificial chromosomes in which the short arm of the acrocentric chromosome does not contain euchromatic DNA are provided.

In another embodiment, a method of producing a plant artificial chromosome, that includes the steps of introducing nucleic acid into a plant cell acrocentric chromosome in which the short arm does not contain euchromatic DNA; culturing the cell through at least one cell division; and selecting a cell containing an artificial chromosome, such as one that is predominantly heterochromatic, is provided. The acrocentric chromosome is 5produced by the method of any of the methods described herein or other suitable methods.

In another embodiment, a method for producing an artificial chromosome, that includes the steps of introducing nucleic acid into a plant cell; and 10selecting a plant cell that includes an artificial chromosome that contains one or more repeat regions is provided. In this AC, one or more nucleic acid units is (are) repeated in a repeat region; repeats of a nucleic acid unit have common nucleic acid sequences; and the common sequences of nucleotides include sequences that represent euchromatic and 15heterochromatic nucleic acid. The nucleic acid can include plant rDNA from a dicot plant species or plant rDNA from a monocot plant species. The intergenic spacer region can be from DNA from a Nicotiana plant or other suitable source of such DNA. The rDNA can be plant rDNA, and the plant can be a dicot or a monocot.

Also provided are isolated plant artificial chromosomes that contain one or more repeat regions. In these ACs one or more nucleic acid units is (are) repeated in a repeat region; repeats of a nucleic acid unit have common nucleic acid sequences; and the common sequences of nucleotides include sequences that represent euchromatic and heterochromatic nucleic acid. 25The artificial chromosome can be produced by a method that includes the steps of: introducing nucleic acid into a plant cell; and selecting a plant cell containing an artificial chromosome that contains one or more repeat regions. The repeats of a nucleic acid unit have common nucleic acid sequences; and the common nucleic acid sequences contain sequences that represent euchromatic and heterochromatic nucleic acid.

In another embodiment, another method for producing an acrocentric plant chromosome is provided. The method includes the steps of: 5introducing nucleic acid containing two site-specific recombination sites into a cell containing one or more plant chromosomes; introducing into the cell a recombinase activity that catalyzes recombination between the two recombination sites to produce a plant acrocentric chromosome. In the embodiment, the two site-specific recombination sites can be on separate 10nucleic acid fragments, which optionally can be introduced into the cell simultaneously or sequentially. The resulting artificial chromosome can be one that is predominantly heterochromatic.

In another embodiment, a method of producing a plant artificial chromosome is provided. The method includes the steps of: introducing 15nucleic acid into a plant chromosome, such as but not limited to, an acrocentric chromosome, in a cell that contains adjacent regions of rDNA and heterochromatic DNA; culturing the cell through at least one cell division; and selecting a cell containing an artificial chromosome. The resulting artificial chromosome can be predominantly heterochromatic. The 20acrocentric chromosome can be one where the short arm of the chromosome contains adjacent regions of rDNA and heterochromatic DNA, such as, but not limited to, pericentric heterochromatin.

Also provided are a variety of vectors. Among these are vectors containing nucleic acid encoding a selectable marker that is not operably 25associated with any promoter, wherein the selectable marker permits growth of animal cells in the presence of an agent normally toxic to the animal cells; and wherein the agent is not toxic to plant cells; a recognition site for recombination; and a sequence of nucleotides that facilitates amplification of a region of a plant chromosome or targets the vector to an amplifiable region of a plant chromosome. Exemplary of such vectors is pAglla and pAgllb.

Another vector provided herein contains nucleic acid encoding a selectable marker that is not operably associated with any promoter, 5wherein the selectable marker permits growth of animal cells in the presence of an agent normally toxic to the animal cells; and wherein the agent is not toxic to plant cells; a recognition site for recombination; and nucleic acid encoding a protein operably linked to a plant promoter. Exemplary of these vectors is pAg1 and pAg2.

Another vector that is provided contains: nucleic acid encoding a selectable marker that is not operably associated with any promoter, where the selectable marker permits growth of plant cells in the presence of an agent normally toxic to the plant cells but not toxic to animal cells; a recognition site for recombination; and nucleic acid encoding a protein 15operably linked to a plant promoter.

Another vector is a plant transformation vector that contains nucleic acid encoding a recognition site for recombination; a sequence of nucleotides that facilitates or causes amplification of a region of a plant chromosome; one or more selectable markers that are expressed in plant 20cells to permit the selection of cells containing the vector, and Agrobacterium nucleic acid. The vector is for Agrobacterium-med'tated transformation of plants.

Another vector that is provided contains a recognition site for recombination; and a sequence of nucleotides that facilitates amplification of 25a region of a plant chromosome or targets the vector to an amplifiable region of a plant chromosome, wherein the plant is selected from the group consisting of Arabidopsis, Nicotiana, Solanum, Lycopersicon, Daucus, Hordeum, Zea mays, Brassica, Triticum, Helianthus, soybean, cotton and Oryza.

In these vectors, the amplifiable region can contain heterochromatic nucleic acid; the amplifiable region can contain rDNA. Exemplary sequences of nucleotides that facilitate amplification of a region of a plant 5chromosome or targets the vector to an amplifiable region of a plant chromosome are any that contain a sufficient portion of an intergenic spacer region of rDNA to facilitate amplification or effect the targeting. Such sufficient portion can be at least 14, 20, 30, 50, 100, 150, 300, 500, 1 kB, 2 kB, 3 kB, 5 kB, 10 kB or more contiguous nucleotides from an intergenic 10spacer region and/or other rDNA region. An exemplary selectable marker encodes a product confers resistance to zeomycin. The protein in the vectors include a protein that is a selectable marker that permits growth of plant cells in the presence of an agent normally toxic to the plant cells, such as, for example, resistance to hygromycin or to phosphinothricin. Other 15such protein markers include, but are not limited to, fluorescent proteins, such as, for example, green, blue and red fluorescent proteins. An exemplary recognition site contains an att site. Exemplary promoters for inclusion in the vectors, include, but are not limited to, nopaline synthase (NOS) or CaMV35S.

Cells, containing any of the vectors or mixtures thereof are provided. The cells include any cells that have at least one plant chromosome, such as a plant cell. The cells can be protoplasts.

Methods using these vectors are provided. The methods include a step of introducing one of the vectors into a cell, such as a cell that contains 25at least one plant chromosome. Such vector is for example, a vector that contains nucleic acid encoding a selectable marker that is not operably associated with any promoter, where the selectable marker permits growth of animal cells in the presence of an agent normally toxic to the animal cells but is not toxic to plant cells; a recognition site for recombination; and nucleic acid encoding a protein operably linked to a plant promoter. In this method, the cell contains an animal, such as a mammal, platform ACes that contains a recognition site, such as, for example, an att site, that 5recombines with the recognition site in the vector in the presence of the recombinase, thereby incorporating the selectable marker that is not operably associated with any promoter and the nucleic acid encoding a protein operably linked to a plant promoter into the platform ACes to produce a resulting platform ACes. The platform ACes can contain a 10promoter that, upon recombination, is operably linked to the selectable marker that in the vector is not operably associated with a promoter. The method can further include transferring the resulting platform ACes into a plant cell to produce a plant cell that contains the platform Aces. The method optionally further includes culturing the plant cell that contains the 15platform Aces under conditions whereby the protein encoded by the nucleic acid that is operably linked to a plant promoter is expressed.

The resulting platform ACes optionally is isolated prior to transfer. The Aces can be introduced into a plant cell by any suitable method, such as one selected from among protoplast transfection, lipid-mediated delivery, 20liposomes, electroporation, sonoporation, microinjection, particle bombardment, silicon carbide whisker-mediated transformation, polyethylene glycol (PEG)-mediated DNA uptake, lipofection and lipid-mediated carrier systems. The resulting platform ACes can be transferred by fusion of the cells, which, for example, are plant protoplasts. In another embodiment, 25the cell can be an animal cell, such as a mammalian, including human, cell.

In another method, a vector is introduced into plant cells. Such vector, for example, can be a vector that includes nucleic acid encoding a selectable marker that is not operably associated with any promoter, where the selectable marker permits growth of animal cells in the presence of an agent normally toxic to the animal cells but is not toxic to plant cells; a recognition site for recombination; and a sequence of nucleotides that 5facilitates amplification of a region of a plant chromosome or targets the vector to an amplifiable region of a plant chromosome. The plant cells are cultured and a plant cell(s) containing an artificial chromosome that contains one or more repeat regions is selected. In this method, a sufficient portion of the vector can integrate into a chromosome in the plant cell to result in 10amplification of chromosomal DNA. The resulting selected artificial chromosome can be one in which one or more nucleic acid units is (are) repeated in a repeat region; repeats of a nucleic acid unit have common nucleic acid sequences; and the repeat region(s) contain substantially equivalent amounts of euchromatic and heterochromatic nucleic acid. The 15resulting artificial chromosome produced in the method optionally can be isolated.

Another method is also provided. This method includes the steps of introducing a vector into a cell, and culturing the resulting cell under conditions, whereby the protein encoded by nucleic acid operably linked to 20an animal promoter is expressed. In the method the vector can contain; nucleic acid encoding a selectable marker that is not operably associated with any promoter, where the selectable marker permits growth of animal cells in the presence of an agent normally toxic to the animal cells but is not toxic to plant cells; a recognition site for recombination; and nucleic acid 25encoding a protein operably linked to an animal promoter. The cell can contain a platform plant artificial chromosome (PAC) that contains a recombination site and an animal promoter that upon recombination is operably linked to the selectable marker that in the vector is not operably associated with a promoter. Introduction can be effected under conditions whereby the vector recombines with the PAC to produce a plant platform PAC that contains the selectable marker operably linked to the promoter. In this method, the artificial chromosome can be an ACes. In addition, the 5plant platform PAC can be an ACes.

The vectors, such as those that contain nucleic acid encoding a selectable marker that is not operably associated with any promoter, where the selectable marker permits growth of animal cells in the presence of an agent normally toxic to the animal cells but is not toxic to plant cells; a 10recognition site for recombination; and a sequence of nucleotides that facilitates amplification of a region of a plant chromosome or targets the vector to an amplifiable region of a plant chromosome, and the plant transformation vectors that contain nucleic acid for Agrobacterium-med'iated transformation of plants, can be used to produce artificial chromosomes. In 15one exemplary method, such vector is introduced into a cell containing one or more plant chromosomes; and a cell containing an artificial chromosome that contains one or more repeat regions is selected. The artificial chromosome contains one or more nucleic acid units that is (are) repeated in a repeat region; the repeats of a 20nucleic acid unit have common nucleic acid sequences; and the common nucleic acid sequences contain sequences that represent euchromatic and heterochromatic nucleic acid. In another method, a cell containing an artificial chromosome that contains one or more repeat regions is selected. The artificial chromosome contains one or more nucleic units that is (are) 25repeated in a repeat region; repeats of a nucleic acid unit have common nucleic acid sequences; and the repeat region(s) contain substantially equivalent amounts of euchromatic and heterochromatic nucleic acid.

DESCRIPTION OF THE DRAWINGS Figure 1 provides a map of plasmid pAgl.

Figure 2 provides a schematic representation of the construction of plasmid pAgl.

Figure 3 provides a map of plasmid pAg2.

Figure 4 provides a schematic representation of the construction of plasmid pAg2.

Figure 5 provides a schematic representation of the construction of plasmids pAglla and pAgllb.

Figure 6A-6B provide restriction maps of the DNA inserted into pAgl to form plasmids pAglla and pAgllb.

Figure 7 provides a map of plasmid pSV40193attPsensePUR.

Figure 8 depicts a method for formation of a chromosome platform with multiple recombination integration sites, such as attP sites.

Figure 9 diagrammatically summarizes the platform technology; marker 1 permits selection of the artificial chromosomes containing the integration site; marker 2, which is promoterless in the donor vector permits selection of recombinants. Upon recombination with the platform marker 2 is expressed under the control of a promoter resident on the platform. 20DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs. All patents, patent applications, 25published applications and other publications and published nucleotide and amino acid sequences (e.g., sequences available in GenBank or other databases) referred to herein are incorporated by reference in their entirety. Where reference is made to a URL or other such identifier or address, it is understood that such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet. Reference thereto evidences the availability and public dissemination of such information.

As used herein, a chromosome is a defined composition of nucleic acid that is capable of replication and segregation within a cell upon cell division. Typically, a chromosome may contain a centromeric region, telomeric regions and a region of nucleic acid between the centromeric and telomeric regions.

As used herein, a centromere is a molecular composition that includes a nucleic acid sequence that confers an ability to segregate to daughter cells through cell division. A centromere may confer stable segregation of a nucleic acid sequence, including an artificial chromosome containing the centromere, through mitotic and/or meiotic divisions. A plant centromere is 15not necessarily derived from plants, but has the ability to promote DNA segregation in plant cells.

As used herein, euchromatin and heterochromatin have their recognized meanings. Euchromatin refers to chromatin that stains diffusely and that typically contains genes, and heterochromatin refers to chromatin that remains unusually condensed and that has been thought to be 5transcriptionally inactive or has low transcriptional activity relative to euchromatin. Highly repetitive DNA sequences (satellite DNA) are usually located in regions of the heterochromatin surrounding the centromere (pericentric or pericentromeric heterochromatin). Constitutive heterochromatin refers to heterochromatin that contains the highly repetitive 10DNA which is constitutively condensed and genetically inactive.

As used herein, an acrocentric chromosome refers to a chromosome with arms of unequal length.

As used herein, endogenous chromosomes refer to genomic chromosomes as found in the cell prior to generation or introduction of an artificial l5chromosome.

As used herein, artificial chromosomes are nucleic acid molecules, typically DNA, that stably replicate and segregate alongside endogenous chromosomes in cells and have the capacity to accommodate and express heterologous genes contained therein. A mammalian artificial chromosome 20(MAC) refers to a chromosome that has an active mammalian centromere(s). Plant artificial chromosomes (PAC), insect artificial chromosomes and avian artificial chromosomes refer to chromosomes that include centromeres that function in plant, insect and avian cells, respe ctively. Human artificial chromosomes (HAC) refers to chromosomes that include centromeres that 25function in human cells. For exemplary artificial chromosomes, see, e.g., U.S. Patent Nos. 6,025,155; 6,077,697; 5,288,625; 5,712,134; 5,695,967; 5,869,294; 5,891,691 and 5,721,118 and published International PCT application Nos, WO 97/40183 and WO 98/08964.

As used herein, amplification, with reference to DNA, is a process in which segments of DNA are duplicated to yield two or multiple copies of substantially similar or identical or nearly identical DNA segments that are typically joined as substantially tandem or successive repeats or inverted 5repeats.

As used herein, amplification-based artificial chromosomes are artificial chromosomes derived from natural or endogenous chromosomes by virtue of an amplification event, such as one that may be initiated by introduction of heterologous nucleic acid into heterochromatin, for example, 10pericentric heterochromatin, in a chromosome. As a result of such an event, chromosomes and/or fragments thereof exhibiting segmented or repeating patterns arise. Artificial chromosomes can be formed from these chromosomes and fragments. Hence, amplification-based artificial chromosomes refer to non-natural or isolated chromosomes that exhibit an 15ordered segmentation that is not typically observed in naturally occurring chromosomes and that can be a basis for distinguishing them from naturally occurring chromosomes. Amplification-based artificial chromosomes can also be distinguished from naturally occurring chromosomes by virtue of their typically smaller size and often segmented appearance when visualized. 20 The segmented appearance, which can be visualized using a variety of chromosome analysis techniques as described herein and known to those of skill in the art, correlates with the unique structure of these artificial chromosomes. In addition to containing one or more centromeres, the amplification-based artificial chromosomes, throughout the region or regions 25of segmentation, are predominantly made up of one or more nucleic acid units, also referred to as "amplicons", that is (are) repeated in the region and that have a similar gross structure. Thus, a region of segmentation may be referred to as a repeat region. Repeats of an amplicon tend to be of similar size and share some common nucleic acid sequences. For example, each repeat of an amplicon may contain a replication site involved in amplification of chromosome segments and/or some heterologous nucleic acid that was utilized in the initial production of the artificial chromosome. Typically, the 5repeating units are substantially similar in nucleic acid composition and may be nearly identical. The common nucleic acid sequences may contain sequences that represent euchromatic and heterochromatic nucleic acid. Amplicon sizes vary but typically tend to be greater than about 100 kb, greater than about 500 kb, greater than about 1 Mb, greater than about 5 i 10Mb or greater than about 10 Mb. The composition of the amplification-based artificial chromosomes may be such that substantially the entire chromosome exhibits a segmented appearance or such that only one or more portions that make-up less than the entire chromosome appear segmented. The amplification-based artificial chromosomes can also differ 15depending on the chromosomal region that has undergone amplification in the process of artificial chromosome formation. The structures of the resulting chromosomes can vary depending upon the initiating event and/or the conditions under which the heterologous nucleic acid is introduced, including modification to the endogenous chromosomes. For example, in 20some of the artificial chromosomes provided herein, the region or regions of segmentation may be made up predominantly of heterochromatic DNA. In other artificial chromosomes provided herein, the region or regions of segmentation may be made up predominantly of euchromatic DNA or may be made up of similar amounts of heterochromatic and euchromatic DNA. 25The region or regions of segmentation thus may be entirely heterochromatic (while still containing one or more heterologous nucleic acid sequences), or may contain increasing amounts of euchromatic DNA, such that, for example, the region contains about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than 90% euchromatic DNA. Because the entire artificial chromosome can be made up predominantly of a region or regions of segmentation, it is thus possible for the artificial chromosome to be made up predominantly of heterochromatin or euchromatin, or to be 5made up of substantially equivalent amounts of heterochromatin and euchromatin, e.g., about 40% to about 50% of one type of nucleic acid and about 50% to about 60% of the other type of nucleic acid.

As used herein the term "predominantly" with respect to a composition generally refers to a state of the composition in which it can be 1 ©characterized as being or having more of the predominant feature than other features which are not predominant. The predominant feature may represent more than about 50%, more than about 60%, more than about 70%, more than about 80%, more than about 90%, more than about 95% or essentially 100% of the composition. Thus, for example, a repeat region 15that is predominantly made up of heterochromatic DNA contains more heterochromatic DNA than other types, e.g., euchromatic, of DNA. The repeat region may be more than about 50%, more than about 60%, more than about 70%, more than about 80%, more than about 90% or more than about 95% heterochromatic DNA or may be essentially 100% 20heterochromatic DNA. An artificial chromosome predominantly made up of heterochromatin contains more heterochromatic DNA than other types, e.g., euchromatic, of DNA and may be more than about 50%, more than about 60%, more than about 70%, more than about 80%, more than about 90% or more than about 95% heterochromatic DNA or may be essentially 100% 25heterochromatic DNA.

As used herein an amplicon is a repeated nucleic acid unit. In some of the artificial chromosomes described herein, an amplicon may contain a set of inverted repeats of a megareplicon. A megareplicon represents a higher order replication unit. For example, with reference to some of the predominantly heterochromatic artificial chromosomes, particularly eukaryotic chromosomes, described herein, the megareplicon may contain a set of tandem DNA blocks (e.g., —7.5 Mb DNA blocks) each containing 5satellite DNA flanked by non-satellite DNA or may substantially be made up of rDNA. Contained within the megareplicon is a primary replication site, referred to as the megareplicator, which may be involved in organizing and facilitating replication of segments of chromosomes, including, for example, heterochromatin, pericentric heterochromatin, rDNA and/or possibly the 10centromeres. Within the megareplicon there may be smaller (e.g., 50-300 kb) secondary replicons. As used herein, amplifiable, when used in reference to a chromosome, particularly the method of generating artificial chromosomes provided herein, refers to a region of a chromosome that is prone to amplification. Amplification typically occurs during replication and 15other cellular events involving recombination (e.g., DNA repair). Included among such regions are regions of the chromosome that contain tandem repeats, such as satellite DNA, rDNA, and other such sequences.

Among the artificial chromosome systems provided herein are those that are predominantly heterochromatic [formerly referred to as satellite 20artificial chromosomes (SATACs); see, e.g., U.S. Patent Nos. 6,077,697 and 6,025,155 and published International PCT application No. WO 97/40183], minichromosomes which contain a de novo centromere, artificial chromosomes containing one or more regions of repeating nucleic acid units wherein the repeat region(s) contain substantially equivalent 25amounts of euchromatic and heterochromatic nucleic acid and in vitro assembled artificial chromosomes. Of particular interest herein are artificial chromosomes that introduce and express heterologous nucleic acids in plants. These include artificial chromosomes that have a centromere derived from a plant, and, also, artificial chromosomes that have centromeres that may be derived from other organisms but that function in plants. Methods for the construction, isolation, and delivery to target cells of each type of artificial chromosome are provided herein.

As used herein, to target nucleic acid to a locus on a chromosome means that the nucleic acid integrates at or near the targeted locus. Any method or means for effecting such integration, including, but not limited to, homologous recombination, is contemplated.

As used herein, a dicentric chromosome is a chromosome that contains two centromeres. A multicentric chromosome contains more than two centromeres.

As used herein, a formerly dicentric chromosome is a chromosome that is produced when a dicentric chromosome fragments and acquires new telomeres so that two chromosomes, each having one of the centromeres, are produced. Each of the fragments are replicable chromosomes. If one of 5the chromosomes undergoes amplification of primarily euchromatic DNA to produce a fully functional chromosome that is predominantly (more than about 50%, more than about 70% or more than about 90% euchromatin) euchromatin, it is a minichromosome. The remaining chromosome is a formerly dicentric chromosome. If one of the chromosomes undergoes 10amplification, whereby heterochromatin (such as, for example, satellite DNA) is amplified and a euchromatic portion (such as, for example, an arm) remains, it is referred to as a sausage chromosome. A chromosome that is substantially all heterochromatin, except for portions of heterologous DNA, is called a predominantly heterochromatic artificial chromosome. 15Predominantly heterochromatic artificial chromosomes can be produced from other partially heterochromatic artificial chromosomes by culturing the cell containing such chromosomes under conditions that destabilize the chromosome and/or under selective conditions so that a predominantly heterochromatic artificial chromosome is produced. For purposes herein, it 20is understood that the artificial chromosomes may not necessarily be produced in multiple steps, but may appear after the initial introduction of the heterologous DNA. Typically, artificial chromosomes appear after about 5 to about 60, or about 5 to about 55, or about 10 to about 55 or about 25 to about 55 or about 35 to about 55 cell divisions following introduction of 25nucleic acid into a cell. Artificial chromosomes may, however, appear after only about 5 to about 15 or about 10 to about 15 cell divisions.

As used herein, the term "satellite DNA-based artificial chromosome (SATAC)" is interchangeable with the term "artificial chromosome expression system (ACes)". These artificial chromosomes (ACes) include those that are substantially all neutral non-coding sequences (heterochromatin) except for foreign heterologous, typically gene or protein-encoding, nucleic acid, that may be interspersed within the heterochromatin 5for the expression therein (see U.S. Patent Nos. 6,025,155 and 6,077,697 and International PCT application No. WO 97/40183), or that is in a single locus as provided herein. The delineating structural feature is the presence of repeating units, which are generally predominantly heterochromatin. The precise structure of the ACes will depend upon the structure of the 10chromosome in which the initial amplification event occurs; all share the common feature of including a defined pattern of repeating units. Generally ACes have more heterochromatin than euchromatin. Foreign nucleic acid molecules (heterologous genes) contained in these artificial chromosome expression systems can include any nucleic acid whose expression is of 15interest in a particular host cell.

As used herein, an artificial chromosome that is predominantly heterochromatic (i.e., containing more heterochromatin than euchromatin, typically more than about 50%, more than about 60%, more than about 70%, more than about 80% or more than about 90% heterochromatin) may 20be produced by introducing nucleic acid molecules into cells, particularly plant cells, and selecting cells that contain a predominantly heterochromatic artificial chromosome. Any nucleic acid may be introduced into cells in the methods of producing the artificial chromosomes. For example, the nucleic acid may contain a selectable marker and/or a sequence that targets nucleic 25acid to a heterochromatic region of a chromosome, particularly a plant chromosome, such as in the pericentric heterochromatin, in the short arm of acrocentric chromosomes, rDNA or nucleolar organizing regions. Targeting sequences include, but are not limited to, lambda phage DNA and rDNA (e.g., a sequence of an intergenic spacer of rDNA), particularly plant rDNA, for production of predominantly heterochromatic artificial chromosomes in plant cells.

After introducing the nucleic acid into cells, a cell containing a 5predominantly heterochromatic artificial chromosome is selected. Such cells may be identified using a variety of procedures. For example, repeating units of heterochromatic DNA of these chromosomes may be discerned by G- and/or C-banding and/or fluorescence in situ hybridization (FISH) techniques. Prior to such analyses, the cells to be analyzed may be enriched 10with artificial chromosome-containing cells by sorting the cells on the basis of the presence of a selectable marker, such as a reporter protein, or by growing (culturing) the cells under selective conditions. Selection of cells containing amplified nucleic acids may also be facilitated by use of techniques such as PCR and Southern blotting to identify cell lines with 15amplified regions. It is also possible, after introduction of nucleic acids into cells, to select cells that have a multicentric, typically dicentric, chromosome, a formerly multicentric (typically dicentric) chromosome and/or various heterochromatic structures and to treat them such that desired artificial chromosomes are produced. Conditions for generation of a desired 20structure include, but are not limited to, further growth under selective conditions, introduction of additional nucleic acid molecules and/or growth under selective conditions and treatment with destabilizing agents, and other such methods (see International PCT application No. WO 97/40183 and U.S. Patent Nos. 6,025,155 and 6,077,697).

As used herein, heterologous and foreign are used interchangeably with respect to nucleic acid and refer to any nucleic acid, including DNA and RNA, that does not occur naturally as part of the genome in which it is present or which is found in a location or locations in the genome that differ from that in which it occurs in nature. Thus, heterologous or foreign nucleic acid that is not normally found in the host genome in an identical context. It is nucleic acid that is not endogenous to the cell and has been exogenously introduced into the cell. Examples of heterologous DNA include, but are not 5limited to, DNA that encodes a gene product or gene product(s) of interest, introduced for purposes of modification of the endogenous genes or for production of an encoded protein. For example, a heterologous or foreign gene may be isolated from a different species than that of the host genome, or alternatively, may be isolated from the host genome but operably linked 10to one or more regulatory regions which differ from those found in the unaltered, native gene. Other examples of heterologous DNA include, but are not limited to, DNA that encodes traceable marker proteins, and DNA that encodes a protein that confers an input trait including, but not limited to, herbicide, insect, or disease resistance or an output trait, including, but 15not limited to, oil quality or carbohydrate composition. Antibodies that are encoded by heterologous DNA may be secreted, sequestered, stored in an organ or tissue, accumulate in the cytoplasm or cellular organelles or expressed on the surface of the cell in which the heterologous DNA has been introduced.

As used herein, a "selectable marker" is a composition that can be used to distinguish one cell from another cell. For example, a selectable marker may be a nucleic acid encoding a readily detected protein that has been introduced into some cells but not others. Detection of the expressed protein in cells facilitates identification of cells containing the marker nucleic 25acid by distinguishing them from cells that do not contain the nucleic acid. Thus, for example, a selectable marker may be a fluorescent protein, such as green fluorescent protein (GFP), or a-galactosidase (or a nucleic acid encoding either of these proteins). Selectable markers such as these, which are not required for cell survival and/or proliferation in the presence of a selection agent, may also be referred to as reporter molecules. Other selectable markers, e.g., the neomycin phosphotransferase gene, provide for isolation and identification of cells containing them by conferring properties 5on the cells that make them resistant to an agent, e.g., a drug such as an antibiotic, that inhibits proliferation of cells that do not contain the marker.

As used herein, growth under selective conditions means growth of a cell under conditions that require expression of a selectable marker for survival.

As used herein, an agent that destabilizes a chromosome is any agent known by those of skill in the art to enhance amplification events, and/or mutations. Such agents, which include BrdU, are well known to those of skill in the art.

In order to generate an artificial chromosome containing a particular 15heterologous nucleic acid of interest, it is possible to include the nucleic acid of interest in the nucleic acid that is being introduced into cells to initiate production of the artificial chromosome. Thus, for example, a nucleic acid of interest could be introduced into a cell along with nucleic acid encoding a selectable marker and/or a nucleic acid that targets to a heterochromatic 20region of a chromosome. For example, the nucleic acid of interest can be linked to targeting nucleic acid{s). Alternatively, heterologous nucleic acid of interest can be introduced into an artificial chromosome at a later time after the initial generation of the artificial chromosome.

As used herein, the minichromosome refers to a chromosome derived 25from a multicentric, typically dicentric, chromosome that contains more euchromatic than heterochromatic DNA. For purposes herein, the minichromosome contains a de novo centromere, preferably a centromere that replicates in plants, more preferably a plant centromere.

As used herein, de novo with reference to a centromere, refers to generation of an excess centromere in a chromosome as a result of incorporation of a heterologous nucleic acid fragment using the methods herein.

As used herein, in vitro assembled artificial chromosomes or synthetic chromosomes are artificial chromosomes produced by joining essential components of a chromosome in vitro. These components include at least a centromere, a telomere and an origin of replication. An in vitro assembled artificial chromosome may include one or more megareplicators. 10ln particular embodiments, the megareplicator contains sequences of rDNA, particularly plant rDNA.

As used herein, in vitro assembled plant artificial chromosomes are produced by joining components (e.g., the centromere, telomere(s) megareplicator and an origin of replication) that function in plants, and 15preferably, one or more of which is derived from a plant, in vitro assembled artificial chromosomes may contain any amount of heterochromatic and/or euchromatic nucleic acid. For example, an in vitro assembled artificial chromosome may be substantially all heterochromatin, or may contain increasing amounts of euchromatic DNA, such that, for example, it contains 20about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than about 90% euchromatic DNA. In vitro assembled artificial chromosomes may contain one or more regions of segmentation as described with reference to amplification-based artificial chromosomes.

As used herein, an artificial chromosome platform refers to an 25artificial chromosome that has been engineered to include one or more sites for site specific recombination-directed integration. Included within the artificial chromosome platforms are ACes, particularly plant ACes, that are so-engineered. Any sites, including but not limited to any described herein, that are suitable for such integration are contemplated. Among the ACes contemplated herein are those that are predominantly heterochromatic (formerly referred to as satellite artificial chromosomes (SATACs); see, e.g., U.S. Patent Nos. 6,077,697 and 6,025,155 and published International PCT 5application No. WO 97/40183), artificial chromosomes predominantly made up of repeating nucleic acid units and that contain substantially equivalent amounts of euchromatic and heterochromatic DNA or wherein the repeat regions of the chromosomes contain substantially equivalent amounts of euchromatic and heterochromatic nucleic acid. Included among the ACes 10for use in generating platforms are artificial chromosomes that introduce and express heterologous nucleic acids in plants as described herein. These include artificial chromosomes that have a centromere derived from a plant, and, also, artificial chromosomes that have centromeres that may be derived from other organisms but that function in plants.

As used herein, recognition sequences are particular sequences of nucleotides that a protein, DNA, or RNA molecule, or combinations thereof, (such as, but not limited to, a restriction endonuclease, a modification methylase and a recombinase) recognizes and binds. For example, a recognition sequence for Cre recombinase (see, e.g., SEQ ID No. 30) is a 2034 base pair sequence containing two 13 base pair inverted repeats (serving as the recombinase binding sites) flanking an 8 base pair core and designated loxP (see, e.g., Sauer (1994) Current Opinion in Biotechnology 5:521-527). Other examples of recognition sequences, include, but are not limited to, attB and attP, atfR and attL and others (see, e.g., SEQ ID Nos. 2532-48), that are recognized by the recombinase enzyme Integrase (see, SEQ ID Nos. 49 and 50) for the nucleotide and encoded amino acid sequences of an exemplary lambda phage integrase).

The recombination site designated attB is an approximately 33 base pair sequence containing two 9 base pair core-type lnt binding sites and a 7 base pair overlap region; att? (SEQ ID No. 48) is an approximately 240 base pair sequence containing core-type lnt binding sites and arm-type lnt binding sites as well as sites for auxiliary proteins IHF, FIS, and Xis (see, e.g., Landy 5(1993) Current Opinion in Biotechnology 3:699-707, see, e.g., SEQ ID Nos. 32 and 48).

As used herein, a recombinase is an enzyme that catalyzes the exchange of DNA segments at specific recombination sites. An integrase herein refers to a recombinase that is a member of the lambda (e) integrase 10family.

As used herein, recombination proteins include excisive proteins, integrative proteins, enzymes, co-factors and associated proteins that are involved in recombination reactions using one or more recombination sites (see, Landy (1993) Current Opinion in Biotechnology 3\699-707). 15 As used herein the expression "lox site" means a sequence of nucleotides at which the gene product of the ere gene, referred to herein as Cre, can catalyze a site-specific recombination event. A LoxP site is a 34 base pair nucleotide sequence from bacteriophage P1 (see, e.g., Hoess et al. (1982) Proc. Natl. Acad. Sci. U.S.A. 75:3398-3402). The LoxP 20site contains two 13 base pair inverted repeats separated by an 8 base pair spacer region as follows: (SEQ ID NO. 51): AT A ACTTCGT AT A ATGTATGC T AT ACG AAGTT AT £. co//'DH5&lac and yeast strain BSY23 transformed with plasmid pBS44 carrying two loxP sites connected with a LEU2 gene are available from the 25American Type Culture Collection (ATCC) under accession numbers ATCC 53254 and ATCC 20773, respectively. The lox sites can be isolated from plasmid pBS44 with restriction enzymes fcoRl and Sal\, or Xho\ and BamH\. In addition, a preselected DNA segment can be inserted into pBS44 at either the Sal\ or BamH\ restriction enzyme sites. Other lox sites include, but are not limited to, LoxB, LoxL, LoxC2 and LoxR sites, which are nucleotide sequences isolated from E. coli (see, e.g., Hoess et al. (1982) Proc. Natl. Acad. Sci. U.S.A. 79:3398). Lox sites can also be produced by a 5variety of synthetic techniques (see, e.g., Ito et al. (1982) Nuc. Acid Res. 70:1755 and Ogilvie et al. (1981) Science 270:210).

As used herein, the expression "ere gene" means a sequence of nucleotides that encodes a gene product that effects site-specific recombination of DNA in eukaryotic cells at lox sites. One ere gene can be 10isolated from bacteriophage P1 (see, e.g., Abremski et al. (1983) Cell 32:1301-1311). E. coli DH1 and yeast strain BSY90 transformed with plasmid pBS39 carrying a ere gene isolated from bacteriophage P1 and a GAL1 regulatory nucleotide sequence are available from the American Type Culture Collection (ATCC) under accession numbers ATCC 53255 and ATCC 1520772, respectively. The ere gene can be isolated from plasmid pBS39 with restriction enzymes Xho\ and Sa/l.

As used herein, site-specific recombination refers to site-specific recombination that is effected between two specific sites on a single nucleic acid molecule or between two different molecules that requires the presence 20of an exogenous protein, such as an integrase or recombinase.

For example, Cre-lox site-specific recombination can include the following three events: a. deletion of a pre-selected DNA segment flanked by lox sites; b. inversion of the nucleotide sequence of a pre-selected DNA segment flanked by lox sites; and c. reciprocal exchange of DNA segments proximate to lox sites located on different DNA molecules.

This reciprocal exchange of DNA segments can result in an integration event if one or both of the DNA molecules are circular. DNA segment refers to a linear fragment of single- or double-stranded deoxyribonucleic acid (DNA), which can be derived from any source. Since 5the lox site is an asymmetrical nucleotide sequence, two lox sites on the same DNA molecule can have the same or opposite orientations with respect to each other. Recombination between lox sites in the same orientation results in a deletion of the DNA segment located between the two lox sites and a connection between the resulting ends of the original 10DNA molecule. The deleted DNA segment forms a circular molecule of DNA. The original DNA molecule and the resulting circular molecule each contain a single lox site. Recombination between lox sites in opposite orientations on the same DNA molecule result in an inversion of the nucleotide sequence of the DNA segment located between the two lox sites. 15 In addition, reciprocal exchange of DNA segments proximate to lox sites located on two different DNA molecules can occur. All of these recombination events are catalyzed by the gene product of the ere gene. Thus, the Cre-lox system can be used to specifically delete, invert, or insert DNA. The precise event is controlled by the orientation of lox DNA 20sequences, in cis the lox sequences direct the Cre recombinase to either delete (lox sequences in direct orientation) or invert (lox sequences in inverted orientation) DNA flanked by the sequences, while in trans the lox sequences can direct a homologous recombination event resulting in the insertion of a recombinant DNA.

As used herein, a plant refers to an organism that is taxonomically classified as being in the kingdom Plantae. Such organisms include eukaryotic organisms that contain chloroplasts capable of carrying out photosynthesis. A plant can be unicellular or multicellular and can contain multiple tissues and/or organs. Plants can reproduce sexually and/or asexually and include species that are perennial or annual in growth habit. A plant can be found to exist in a variety of habitats, including terrestrial and aquatic environments. The term "plant" includes a whole plant, plant cell, 5plant protoplast, plant calli, plant seed, plant organ, plant tissue, and other parts of a whole plant.

As used herein, reproductive mode with reference to a plant refers to any and all methods by which a plant produces progeny. Reproductive modes include, but are not limited to, sexual and asexual reproduction. 10Plants may produce progeny by one or multiple reproductive modes. Sexual reproduction can include union of cells derived from haploid gametophytes (e.g., eggs produced from ovules and sperm produced from pollen in seed plants) to form diploid zygotes. Zygotes may be formed from gametophytes from different plants or from gametophytes of the same plant (e.g., through 15self-fertilization). Asexual reproduction can occur when offspring are produced through modifications of the sexual life cycle that do not include meiosis and syngamy. For example, when vascular plants reproduce asexually, they may do so by vegetative reproduction, such as budding, branching, and tillering, or by producing spores or seed genetically identical 20to the sporophytes that produced them.

As used herein, stable maintenance of chromosomes occurs when at least about 85%, preferably 90%, more preferably 95%, of the cells retain the chromosome. Stability is measured in the presence of a selective agent. Preferably these chromosomes are also maintained in the absence of a 25selective agent. Stable chromosomes also retain their structure during cell culturing, suffering no unintended intrachromosomal nor interchromosomal rearrangements.

As used herein, Brdli refers to 5-bromodeoxyuridine, which during replication is inserted in place of thymidine. BrdU is used as a mutagen; it also inhibits condensation of metaphase chromosomes during cell division.

As used herein, ribosomal RNA (rRNA) is the specialized RNA that forms part of the structure of a ribosome and participates in the synthesis of 5proteins. Ribosomal RNA is produced by transcription of genes which, in eukaryotic cells, are present in multiple copies. In human cells, the approximately 250 copies of rRNA genes (i.e., genes which encode rRNA) per haploid genome are spread out in clusters on at least five different chromosomes (chromosomes 13, 14, 15, 21 and 22). In mouse cells, the lOpresence of ribosomal DNA (rDNA, which is DNA containing sequences that encode rRNA) has been verified on at least 11 pairs out of 20 mouse chromosomes (chromosomes 5, 6, 7, 9, 11, 12, 15, 16, 17, 18, and 19) [see e.g., Rowe et at. (1996) Mamm. Genome 7:886-889 and Johnson et al. (1993) Mamm. Genome 4:49-52]. In Arabidopsis thaiiana the presence of 15rDNA has been verified on chromosomes 2 and 4 (18S, 5.8S, and 25S rDNA) and on chromosomes 3,4, and 5 (5S rDNA)[see The Arabidopsis Genome Initiative (2000) Nature 408'.796-815]. In eukaryotic cells, the multiple copies of the highly conserved rRNA genes are located in a tandemly arranged series of rDNA units, which are generally about 40-45 kb 20in length and contain a transcribed region and a nontranscribed region known as spacer (i.e., intergenic spacer) DNA which can vary in length and sequence. In the human and mouse, these tandem arrays of rDNA units are located adjacent to the pericentric satellite DNA sequences (heterochromatin). The regions of these chromosomes in which the rDNA is 25located are referred to as nucleolar organizing regions (NOR) which loop into the nucleolus, the site of ribosome production within the cell nucleus. In higher plants, the rDNA is arranged in long tandem repeating units, similar to those of other higher eukaroytes. The 18S, 5.8S and 25S rRNA genes are clustered and are transcribed as one unit, while the 5S genes are located elsewhere in the genome. Between the 3' end of the 25S gene and the 5' end of the 18S gene is located a DNA spacer that ranges from 1 kb to greater than 12 kb in length for different species. Therefore, the rDNA 5repeat ranges from about 4 kb to about 15 kb for different plant species [see, e.g., Rogers and Bendich (1987) Plant MoL Biol. 5:509-520].

As used herein, a megachromosome refers to a chromosome that, except for introduced heterologous DNA, is substantially composed of heterochromatin. Megachromosomes are made up of an array of repeated lOamplicons that contain two inverted megareplicons bordered by introduced heterologous DNA [see, e.g., Figure 3 of U.S. Patent No. 6,077,697 for a schematic drawing of a megachromosome]. For purposes herein, a megachromosome is about 50 to 400 Mb, generally about 250-400 Mb. Shorter variants are also referred to as truncated megachromosomes [about 1590 to 120 or 150 Mb], dwarf megachromosomes [ — 150-200 Mb] and cell lines, and a micro-megachromosome [-50-90 Mb, typically 50-60 Mb]. For purposes herein, the term megachromosome refers to the overall repeated structure based on an array of repeated chromosomal segments (amplicons) that contain two inverted megareplicons bordered by any inserted 20heterologous DNA.

As used herein, transformation and transfection are used interchangeably to refer to the process of introducing nucleic acid into cells. The terms transfection and transformation refer to the taking up of exogenous nucleic acid, e.g., an expression vector, by a host cell whether or 25not any coding sequences are in fact expressed. Numerous methods of introducing nucleic acids into cells are known to the ordinarily skilled artisan, for example, by Agrobacterium-mediated transformation, protoplast transfection (including polyethylene glycol (PEG)-mediated transfection, electroporation, protoplast fusion, and microcell fusion), lipid-mediated delivery, liposomes, eleotroporation, microinjection, particle bombardment and silicon carbide whisker-mediated transformation (see, e.g., Paszkowski et al. (1984) EMBO J. 3:2717-2722; Potrykus et al. (1985) Mol. Gen.

SGenet. 759:169-177; Reich et al. (1986) Biotechnology 4:1001 -1004; Klein et al. (1987) Nature 327:70-73; U.S. Patent No. 6,143,949; Paszkowski et al. (1989) in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J and Vasil, L.K. Academic Publishers, San Diego, California, p. 52-68; and Frame et al. (1994) Plant J. 6:941-948), direct uptake using calcium phosphate [CaP04; see,e.g., Wigler et al. (1979) Proc. Natl. Acad. Sci. U.S.A. 76:1373-1376], polyethylene glycol [PEG]-mediated DNA uptake, lipofection [see, e.g., Strauss (1996) Meth. Mol. Biol. 54:307-327], microcell fusion [see Lambert (1991) Proc. Natl. Acad. Sci. U.S.A. 53:5907-5911; U.S. Patent No. 155,396,767, Sawford et al. (1987) Somatic Cell Mol. Genet. 73:279-284; Dhar et al. (1984) Somatic Cell Mol. Genet. 70:547-559; and McNeill-Killary et al. (1995) Meth. Enzymol. 254:133-152], lipid-mediated carrier systems [see, e.g., Teifel et al. (1995) Biotechniques 19:79-80; Albrecht et al. (1996) Ann. Hematol. 72:73-79; Holmen et al. (1995) In Vitro Cell Dev. 20Biol. Anim. 37:347-351; Remy et al. (1994) Bioconjug. Chem. 5:647-654; Le Bolch et al. (1995) Tetrahedron Lett. 36:6681-6684; Loeffler et al. (1993) Meth. Enzymol. 27 7:599-618] or other suitable method. Successful transfection is generally recognized by detection of the presence of the heterologous nucleic acid within the transfected cell, such as, for example, 25any visualization of the heterologous nucleic acid or any indication of the operation of a vector within the host cell.

As used herein, injected refers to the microinjection (use of a small syringe, needle, or pipette) of nucleic acid into a cell.

As used herein, gene therapy involves the transfer or insertion of nucleic acid molecules into certain cells, which are also referred to as target 5cells, to produce products that are involved in preventing, curing, correcting, controlling or modulating diseases, disorders and/or deleterious conditions. The nucleic acid is introduced into the selected target cells in a manner such that the nucleic acid is expressed and a product encoded thereby is produced. Alternatively, the nucleic acid may in some manner mediate 10expression of DNA that encodes a therapeutic product. This product may be a therapeutic compound, which is produced in therapeutically effective amounts or at a therapeutically useful time. It may also encode a product, such as a peptide or RNA, that in some manner mediates, directly or indirectly, expression of a therapeutic product. Expression of the nucleic 15acid by the target cells within an organism afflicted with a disease or disorder thereby enables modulation of the disease or disorder. The nucleic acid encoding the therapeutic product may be modified prior to introduction into the cells of the afflicted host in order to enhance or otherwise alter the product or expression thereof.

For use in gene therapy, cells can be transfected in vitro, followed by introduction of the transfected cells into an organism. This is often referred to as ex vivo gene therapy. Alternatively, the cells can be transfected directly in vivo within an organism.

As used herein, a therapeutically effective product is a product that 25effectively ameliorates or eliminates the symptoms or manifestations of an inherited or acquired disease or disorder or that cures said disease or disorder in an organism. For example, therapeutically effective products include a product that is encoded by heterologous DNA expressed in a diseased organism and a product produced from heterologous DNA in a host cell and to which a diseased organism is exposed.

As used herein, a transgenic plant refers to a plant (e.g., a plant cell, tissue, organ or whole plant) containing heterologous or foreign nucleic acid 5or in which the expression of a gene naturally present in the plant has been altered. Heterologous nucleic acid within a transgenic plant may be transiently or stably maintained within the plant. Stable maintenance of heterologous nucleic acid may be maintenance of the nucleic acid through one or more, or two or more, or five or more, or ten or more, or 25 or more, 10or 50 or more or 60 or more cell divisions. A transgenic plant may contain heterologous nucleic acid in one cell, multiple cells or all cells. A transgenic plant may produce progeny that contain or do not contain the heterologous nucleic acid.

As used herein, a promoter, with respect to a region of DNA, refers to 15a sequence of DNA that contains a sequence of bases that signals RNA polymerase to associate with the DNA and initiate transcription of messenger RNA (mRNA) from a template strand of the DNA. A promoter thus generally regulates transcription of DNA into mRNA.

As used herein, operative linkage of heterologous DNA to regulatory 20and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences refers to the relationship between such DNA and such sequences of nucleotides. For example, operative linkage of heterologous DNA to a promoter refers to the physical relationship between the DNA and the promoter such that the 25transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA in reading frame.

As used herein, isolated, substantially pure nucleic acid, such as, for example, DNA, refers to nucleic acid fragments purified according to standard techniques employed by those skilled in the art, such as that found in Maniatis et al. [(1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY].

As used herein, expression refers to the transcription and/or translation of nucleic acid. For example, expression can be the transcription of a gene into an RNA molecule, such as a messenger RNA (mRNA) molecule. Expression may further include translation of an RNA molecule into peptides, polypeptides, or proteins. If the nucleic acid is derived from 10genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA. With respect to an antisense construct, expression may refer to the transcription of the antisense DNA.

As used herein, vector or plasmid refers to discrete elements that are 15used to introduce heterologous nucleic acids into cells for either expression of the heterologous nucleic acid or for replication of the heterologous nucleic acid. Selection and use of such vectors and plasmids are well within the level of skill of the art.

As used herein, substantially homologous DNA refers to DNA that 20includes a sequence of nucleotides that is sufficiently similar to another such sequence to form stable hybrids under specified conditions.

It is well known to those of skill in this art that nucleic acid fragments with different sequences may, under the same conditions, hybridize detectably to the same "target" nucleic acid. Two nucleic acid fragments 25hybridize detectably, under stringent conditions over a sufficiently long hybridization period, because one fragment contains a segment of at least about 14 nucleotides in a sequence which is complementary (or nearly complementary) to the sequence of at least one segment in the other nucleic acid fragment. If the time during which hybridization is allowed to occur is held constant, at a value during which, under preselected stringency conditions, two nucleic acid fragments with exactly complementary base-pairing segments hybridize detectably to each other, departures from exact 5complementarity can be introduced into the base-pairing segments, and base-pairing will nonetheless occur to an extent sufficient to make hybridization detectable. As the departure from complementarity between the base-pairing segments of two nucleic acids becomes larger, and as conditions of the hybridization become more stringent, the probability 10decreases that the two segments will hybridize detectably to each other.

Two single-stranded nucleic acid segments have "substantially the same sequence," within the meaning of the present specification, if (a) both form a base-paired duplex with the same segment, and (b) the melting temperatures of said two duplexes in a solution of 0.5 X SSPE differ by less 15than 10°C. If the segments being compared have the same number of bases, then to have "substantially the same sequence", they will typically differ in their sequences at fewer than 1 base in 10. Methods for determining melting temperatures of nucleic acid duplexes are well known [see, e.g., Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284 and 20references cited therein].

As used herein, a nucleic acid probe is a DNA or RNA fragment that includes a sufficient number of nucleotides to specifically hybridize to DNA or RNA that includes identical or closely related sequences of nucleotides. A probe may contain any number of nucleotides, from as few as about 10 and 25as many as hundreds of thousands of nucleotides. The conditions and protocols for such hybridization reactions are well known to those of skill in the art as are the effects of probe size, temperature, degree of mismatch, salt concentration and other parameters on the hybridization reaction. For example, the lower the temperature and higher the salt concentration at which the hybridization reaction is carried out, the greater the degree of mismatch that may be present in the hybrid molecules.

To be used as a hybridization probe, the nucleic acid is generally 5rendered detectable by labelling it with a detectable moiety or label, such as 32P, 3H and 14C, or by other means, including chemical labelling, such as by nick-translation in the presence of deoxyuridylate biotinylated at the 5'-position of the uracil moiety. The resulting probe includes the biotinylated uridylate in place of thymidylate residues and can be detected {via the biotin 10moieties) by any of a number of commercially available detection systems based on binding of streptavidin to the biotin. Such commercially available detection systems can be obtained, for example, from Enzo Biochemicals, Inc. (New York, NY). Any other label known to those of skill in the art, including non-radioactive labels, may be used as long as it renders the 15probes sufficiently detectable, which is a function of the sensitivity of the assay, the time available (for culturing cells, extracting DNA, and hybridization assays), the quantity of DNA or RNA available as a source of the probe, the particular label and the means used to detect the label.

Once sequences with a sufficiently high degree of homology to the 20probe are identified, they can readily be isolated by standard techniques, which are described, for example, by Maniatis et al. [(1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY].

As used herein, conditions under which DNA molecules form stable 25hybrids and are considered substantially homologous are such that DNA molecules with at least about 60% complementarity form stable hybrids. Such DNA fragments are herein considered to be "substantially homologous". For example, DNA that encodes a particular protein is substantially homologous to another DNA fragment if the DNA forms stable hybrids such that the sequences of the fragments are at least about 60% complementary and if a protein encoded by the DNA retains its activity.

For purposes herein, the following stringency conditions are defined: 1) high stringency: 0.1 x SSPE, 0.1% SDS, 65°C 2) medium stringency: 0.2 x SSPE, 0.1% SDS, 50°C 3) low stringency: 1.0 x SSPE, 0.1 % SDS, 50°C or any combination of salt and temperature and other reagents that result in selection of the same degree of mismatch or matching.

As used herein, all assays and procedures, such as hybridization reactions and antibody-antigen reactions, unless otherwise specified, are conducted under conditions recognized by those of skill in the art as standard conditions.

A. Amplification of Chromosomal Segments and Use Thereof in the 15Generation of Artificial Chromosomes The methods, cells and artificial chromosomes provided herein are produced by virtue of the discovery of the existence of a higher-order replication unit (megareplicon) of the centromeric region, including the pericentric DNA, of a chromosome. This megareplicon is delimited by a 20primary replication initiation site (megareplicator), and appears to facilitate replication of the centromeric heterochromatin, and, most likely, centromeres, integration of heterologous nucleic acid into the megareplicator region, or in close proximity thereto, initiates a large-scale amplification of megabase-size chromosomal segments. Products of such 25amplification may be used as artificial chromosomes or in the generation of artificial chromosomes as described herein.

Included among the DNA sequences that may provide a megareplicator are the rDNA units that give rise to ribosomal RNA (rRNA).

In plants and animals, particularly mammals such as mice and humans, these rDNA units can contain specialized elements, such as the origin of replication (or origin of bidirectional replication, i.e., OBR, in mouse) and amplification promoting sequences (APS) and amplification control elements 5(ACE) [see, e.g., with respect to plant rDNA, U.S. Patent Nos. 6,096,546 (to Raskin) and 6,100,092 (to Borysyuk et a/.); PCT International Application Publication No. W099/66058; Genbank Accession no. Y08422 (containing the central AT-rich region of a tobacco rDNA intergenic spacer); Borysyuk et al. (1997) Plant Mol. Biol. 35:655-660); Borysyuk et al.. (2000) Nature 10Biotechnology 78:1 303-1306; Hernandez et al. (1993) EMBO J. 72:1475-1485; Van't Hof and Lamm (1992) Plant Mol. Biol. 20:377-382; Hernandez et al. (1988) Plant Mot. Biol. 70:413-322; and with respect to mammalian rDNA, Gogel et at. (1996) Chromosoma 704:511-518; Coffman et al. (1993) Exp. Cell. Res. 209:123-132; Little et al. (1993) Mol. Cell. Biol. 15 73:6600-6613; Yoon et al. (1995) Mol. Cell. Biol. 75:2482-2489; Gonzalez and Sylvester (1995) Genomics 27:320-328; Miesfeld and Arnheim (1982) Nuc. Acids Res. 70:3933-3949; Maden et al. (1987) Biochem. J. 246:519-527].

As described herein, without being bound by any theory, specialized 20elements such as these may facilitate replication and/or amplification of megabase-size chromosomal segments in the de novo formation of chromosomes, such as the artificial chromosomes described herein, in cells. These specialized elements are typically located in the nontranscribed intergenic spacer region upstream of the transcribed region of rDNA. The 25intergenic spacer region may itself contain internally repeated sequences which can be classified as tandemly repeated blocks and nontandem blocks (see e.g., Gonzalez and Sylvester (1995) Genomics 27:320-328). In mouse rDNA, an origin of bidirectional replication may be found within a 3-kb initiation zone centered approximately 1.6 kb upstream of the transcription start site (see, e.g., Gogel et at. (1996) Chromosoma 704:511-518). The sequences of these specialized elements tend to have an altered chromatin structure, which may be detected, for example, by nuclease hypersensitivity 5or the presence of AT-rich regions that can give rise to bent DNA structures.

Sequences of intergenic spacer regions of plant rDNA include, but are not limited to, sequences contained in GenBank Accession numbers S70723 (from the 5S rDNA of barley {Hordeum vulgare)), AF013103 and X03989 10(from maize (Zea mays)), X65489 (from potato (Solarium tuberosum)), X52265 (from tomato (Lycopersicon esculentum)), AF177418 (from Arabidopsis negiecta), AF177421 and AF17422 (from Arabidopsis halleri), A71562, X15550, and X52631 (from Arabidopsis thaliana; see Gruendler et al. (1991) J. Moi. Biol. 221:1209-1222 and Gruendler et al. (1989) Nucleic IBAcids Res. 7 7:6395-6396), X54194 (from rice (Oryza sativa)) and Y08422 and D76443 (from tobacco (Nicotiana tabacum). Sequences of intergenic spacer regions of plant rDNA further include sequences from rye (see Appels et al. (1986) Can. J. Genet. Cytol. 28:673-685), wheat (see Barker et al. (1988) J. Mol. Biol. 207:1-17 and Sardana and Flavell (1996) Genome 2039:288-292), radish (see Delcasso-Tremousaygue et al. (1988) Eur. J. Biochem. 172:767-776), Vicia faba and Pisum sativum (see Kato et al. (1990) Plant Mol. Biol. 74:983-993), mung bean (see Gerstner et al. (1988) Genome 30:723-733; and Schiebel et al. (1989) Mol. Gen. Genet. 278:302-307), tomato (see Schmidt-Puchta et al. (1989) Plant Mol. Biol. 73:251-25253), Hordeum bulbosum (see Procunier et al. (1990) Plant Mol. Biol. 75:661-663) and Lens culinaris Medik., and other legume species (see Fernandez et at. (2000) Genome 43:597-603). Nucleic acids containing intergenic spacer sequences from plants can be obtained by nucleic acid amplification of DNA from plant cells using oligonucleotide primers corresponding to the 3' end of the conserved 25S mature rRNA encoding region and the 5' end of the conserved 18S mature rRNA encoding region (see e.g., PCT Application Publication No. W098/13505). 5 An exemplary sequence encompassing a mammalian origin of replication is provided in GENBANK accession no. X82564 at about positions 2430-5435. Exemplary sequences encompassing mammalian amplification-promoting sequences include nucleotides 690-1060 and 1105-1530 of GENBANK accession no. X82564 and are also provided in PCT Application 10Publication No. WO 97/40183. Exemplary sequences encompassing plant amplification-promoting sequences (APS) include those provided in U.S.

Patent No. 6,100,092.

In human rDNA, a primary replication initiation site may be found a few kilobase pairs upstream of the transcribed region and secondary 15initiation sites may be found throughout the nontranscribed intergenic spacer region (see, e.g., Yoon et al. (1995) Mol. Cell. Biol. 15:2482-2489). A complete human rDNA repeat unit is presented in GENBANK as accession no. U13369. Another exemplary sequence encompassing a replication initiation site may be found within the sequence of nucleotides 35355-2042486 in GENBANK accession no. U13369 particularly within the sequence of nucleotides 37912-42486 and more particularly within the sequence of nucleotides 37912-39288 of GENBANK accession no. U13369 (see Coffman et al. (1993) Exp. Cell. Res. 209:123-132).

B. Preparation of Plant Artificial Chromosomes 25 Cell lines containing artificial chromosomes can be prepared by transforming cells, preferably a stable cell line, with heterologous nucleic acid and identifying cells that contain an artificial chromosome as described herein. The artificial chromosome is a chromosomal structure that is distinct from any chromosome that existed in the cell prior to introduction of the heterologous nucleic acid. A cell containing an artificial chromosome may be identified using a variety of procedures, alone or in combination, as described in detail herein. In particular embodiments of the methods Bdescribed herein, the heterologous nucleic acid contains a sequence that targets the nucleic acid to an amplifiable region of a chromosome in the cell, such as, for example, the pericentric heterochromatin and/or rDNA. A variety of targeting sequences are provided herein.

Prior to analyzing transformed cells for the presence of an artificial lOchromosome, the cells to be analyzed may be enriched with artificial chromosome-containing cells using a variety of techniques depending on the heterologous nucleic acid that was introduced into the host cell to initiate generation of the artificial chromosomes. For example, if nucleic acid encoding a selectable marker was included in the heterologous nucleic acid, 15cells containing the marker may be selected for analysis, if the selectable marker is one that confers resistance to a cytotoxic agent, e.g., bialaphos, hygromycin or kanamycin, the transformed cells may be cultured under selective conditions which include the agent. Cells surviving growth under selective conditions are then analyzed for the presence of artificial 20chromosomes. If the selectable marker is a readily detectable reporter molecule, such as, for example, a fluorescent protein, the transformed cells may be selected on the basis of fluorescent properties. For example, cells containing the fluorescent protein may be isolated from nontransformed cells using a fluorescence-activated cell sorter (FACS).

In analyzing transformed cells for the presence of artificial chromosomes, it is also possible to identify cells that have a multicentric, typically dicentric, chromosome, formerly multicentric (typically dicentric) chromosome, minichromosome and/or heterochromatic structures, such as a 5megachromosome and a sausage chromosome. If cells containing multicentric chromosomes or formerly multicentric (typically formerly dicentric) chromosomes are initially selected, these cells can then be manipulated, if need be, as described herein to produce the minichromosomes and other artificial chromosomes, particularly the lOheterochromatic artificial chromosomes and other segmented, repeat region-containing artificial chromosomes, as described herein. 1. Cells used in the generation of plant artificial chromosomes Any cells harboring plant centromere-containing chromosomes may be 15used in the generation of plant artificial chromosomes (PACs). Such cells include, but are not limited to, plant cells, protoplasts, and cells that are hybrid cells of one or more plant species. Preferred cells are those that harbor plant centromere-containing chromosomes and are readily susceptible to the introduction of heterologous nucleic acids therein.

Cells for use in the generation of plant artificial chromosomes include cells that harbor acrocentric plant chromosomes. Examples of acrocentric plant chromosomes include chromosomes 2 and 4 of the plant Arabidopsis thaliana (see, e.g., Mayer et al. (1999) Nature 402:769-777-, Murata et al. (1997) The Plant Journal 12:31-37; The Arabidopsis Genome Initiative 25(2000) Nature 408:796-815), four acrocentric chromosome pairs in Helianthus annuus (sunflower; see Sehrader et al. (1997) Chromosome Res. 5:451-456), two pairs of acrocentric chromosomes in domesticated pepper plant (Capsicum annuum) and a nearly acrocentric chromosome in lentil plant. In particular embodiments of the methods described herein, cells harboring acrocentric plant chromosomes containing rDNA are used in generating plant artificial chromosomes.

Plant species from which cells may be obtained include, but are not limited to, vegetable crops, fruit and vine crops, field plants, bedding plants, 5trees, shrubs, and other nursery stock. Examples of vegetable crops include artichokes, kohlrabi, arugula, leeks, asparagus, lettuce, bok choy, malanga, broccoli, melons (e.g., muskmelon, watermelon, crenshaw, honeydew, cantaloupe), brussel sprouts, cabbage, cardoni, carrots, napa, cauliflower, okra, onions, celery, parsley, chick peas, parsnips, chicory, Chinese cabbage, 10peppers, collards, potatoes, cucumber plants, pumpkins, cucurbits, radishes, dry bulb onions, rutabaga, eggplant, salsify, escarole, shallots, endive, garlic, spinach, green onions, squash, greens, beet, sweet potatoes, swiss chard, horseradish, tomatoes, kale, turnips and spices. Fruit and vine crops include apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, quince, 15almonds, chestnuts, filberts, pecans, pistachios, walnuts, citrus, blueberries, boysenberries, cranberries, currants, loganberries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwi, persimmons, pomegranate, pineapple, tropical fruits, pomes, melon, mango, papaya and lychee.

Field crop plants include evening primrose, meadow foam, corn, maize, hops, jojoba, peanuts, rice, safflower, small grains (barley, oats, rye, wheat, and others), sorghum, tobacco, kapok, leguminous plants (beans, lentils, peas, soybeans), oil plants (canola, rape, mustard, poppy, olives, 5sunflowers, coconut, castor oil plants, cocoa beans, groundnuts), fiber plants (cotton, flax, hemp, jute), lauraceae (cinnamon, camphor) and plants such as coffee, sugarcane, tea and natural rubber plants. Other examples of plants include bedding plants such as flowers, cactus, succulents and ornamental plants, as well as trees such as forest (broad-leaved trees and 10evergreens, such as conifers), fruit, ornamental and nut-bearing trees, shrubs, algae, moss, and duckweed. 2. Heterologous nucleic acids for use in generating plant artificial chromosomes a. Selectable markers The heterologous nucleic acid that is introduced into a cell in the generation of artificial chromosomes as described herein may include nucleic acid encoding a selectable marker. Any nucleic acid that includes a selectable marker sequence may be introduced into cells harboring plant centromere-containing chromosomes for the generation of plant artificial 20chromosomes. Examples of selectable markers include, but are not limited to, DNA encoding a product that confers resistance to a cytotoxic or cytostatic agent and DNA encoding a readily detectable product, such as a reporter protein. (1) Nucleic acids encoding products that confer 25resistance to a selection agent Examples of selectable markers include the dihydrofolate reductase (dhfr) gene, hygromycin phosphotransferase genes, the phosphinothricin acetyl transferase gene (bar gene) and neomycin phosphotransferase genes.

Selectable markers that can be used in animal, e.g., mammalian cells include, but are not limited to the thymidine kinase gene and the cellular adenine-phosphoribosyltransferase gene.

Of particular interest for purposes herein are nucleic acid selectable markers that, upon expression in the host cell, confer antibiotic or herbicide 5resistance to the cell, sufficient to provide for the maintenance of heterologous nucleic acids in the cell, and which facilitate the transfer of artificial chromosomes containing the marker DNA into new host cells. Examples of such markers include DNA encoding products that confer cellular resistance to hygromycin, kanamycin, G418, bialaphos, Basta, 10methotrexate, glyphosate, and puromycin. For example, neo (or nptll) provides kanamycin resistance and can be selected for using kanamycin, G418, paromomycin and other agents [see, e.g., Messing and Vierra (1982) Gene 19:259-268; and Bevan et al. (1983) Nature 304:184-187]; bar from Steptomyces hygroscopicus, which encodes the enzyme phosphinothricin 15acetyl transferase (PAT) confers bialaphos, glufosinate, Basta or phosphinothricin resistance [see e.g., White et al. (1990) Nuc. Acids Res. 78:1062; Spencer et al. (1990) Theor. Appi. Genet. 79:625-631; Vickers et al. (1996) Plant Mol. Biol. Reporter 74:363-368; and Thompson et al. (1987) EMBO J. 6:2519-2523]; the hph gene which confers resistance to the 20antibiotic hygromycin (see, e.g., Blochinger and Diggelmann, Mol. Cell. Biol. 4:2929-2931); a mutant EPSP synthase protein [see Hinchee et al. (1988) Bio/technol 6:915-922] confers glyphosate resistance (see also U.S. Patent Nos. 4,940,935 and 5,188,642); and a nitrilase such as bxn from Klebsiella ozaenae confers resistance to bromoxynil [see Stalker et al. (1988) Science 25242:419-42]. DNA encoding cystathionine gamma-synthase (CGS) can be used as a marker that confers resistance to ethionine (see PCT Application Publication No. WO 00/55303). Examples of markers that can be used in animal, e.g., mammalian cells, include but are not limited to DNA encoding products that confer cellular resistance to streptomycin, zeocin, chloramphenicol and tetracycline. (2) Reporter Molecules Nucleic acids encoding reporter molecules may also be included in the 5nucleic acid that is introduced into a recipient cell in the generation of artificial chromosomes. Reporter genes provide a means for identifying cells and chromosomes into which heterologous nucleic acids have been transferred and further provide a means for assessing whether or not, and to what extent, transferred DNA is expressed.

Nucleic acids encoding reporter molecules that may be used in monitoring transfer and expression of heterologous nucleic acids into cells, particularly plant cells include, but are not limited to, nucleic acid encoding a-glucuronidase (GUS) or the uidk gene product, which is an enzyme for which various chromogenic substrates are known [see Novel and Novel 15(1973) Mol. Gen. Genet. 120:319-335; Jefferson et al. (1986) Proc. Natl. Acad. Sci. USA 83:8447-8451; US Patent No. 5,268,463; commercially available from Clontech Laboratories, Palo Alto, CA], DNA from an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues [see, e.g., Dellaporta et al. (1988) In 20 "Chromosome Structure and Function: Impact of New Concepts, 18th Stadler Genetics Symposium" 17:263-282], nucleic acid encoding a-lactamase [Sutcliffe (1978) Proc. Natl. Acad. Sci. U.S.A. 75:3737-3741], which is an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin), DNA from a xy/E gene [see, 25e.g., Zukowsky et al. (1983) Proc. Natl. Acad. Sci. U.S.A. 80:1101-1105], which encodes a catechol dioxygenase that can convert chromogenic catechols; nucleic acid encoding a-amylase [see, e.g., Ikuta et al. (1990) Bio/technol. 8:241-242], nucleic acid encoding tyrosinase [see, e.g., Katz et al. (1983) J. Gen. Microbiol. 729:2703-2714], an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone which in turn condenses to form the readily detectable compound melanin, nucleic acid encoding a-galactosidase, an enzyme for which there are chromogenic substrates, nucleic 5acid encoding luciferase (lux) gene [see, e.g., Ow et al. (1986) Science 234:856-859] which allows for bioluminescence detection, nucleic acid encoding aequorin [see, e.g., Prasher et a I. (1985) Biochem. Biophy. Res. Commun. 726:1259-1268], which may be employed in calcium-sensitive bioluminescence detection, nucleic acid encoding a green fluorescent protein (GFP) [see, e.g., 10Sheen et al. (1995) Plant J. 8:777-784; Haselhoff et al. (1997) Proc. Natl. Acad. Sci. U.S.A. 94:2122-2127; Hasseloff and Amos (1995) Trends Genet 7 7:328-329; Reichel et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93:5888-5893; Tian et al. (1997) Plant Cell Rep. 76:267-271; Prasher et al. (1992) Gene 7 7 7:229-233; Chalfie et al. (1994) Science 263:802; PCT Application 15Publication Nos. W097/41228 and WO 95/07463; and commercially available from Clontech Laboratories, Palo Alto, CA), nucleic acid encoding a red or blue fluorescent protein (RFP or BFP, respectively), or nucleic acid encoding chloramphenicol acetyltransferase (CAT).

Enhanced GFP (EGFP) is a mutant of GFP with a 35-fold increase in 20fluorescence. This variant has mutations of Ser to Thr at amino acid 65 and Phe to Leu at position 64 and is encoded by a gene with optimized human codons (see, e.g., U.S. Patent No. 6,054,312). EGFP is a red-shifted variant of wild-type GFP (Yang et al. (1996) Nucl. Acids Res. 24:4592-4593; Haas et al. (1996) Curr. Biol. 6:315-324; Jackson et ai. (1990) Trends Biochem. 25 75:477-483) that has been optimized for brighter fluorescence and higher expression in mammalian cells (excitation maximum = 488 nm; emission maximum = 507 nm). EGFP encodes the GFPmutl variant (Jackson (1990) Trends Biochem. 75:477-483) which contains the double-amino-acid substitution of Phe-64 to Leu and Ser-65 to Thr. Sequences flanking EGFP have been converted to a Kozak consensus translation initiation site (Huang et at. (1990) Nucleic Acids Res. 18: 937-947) to further increase the translation efficiency in eukaryotic cells.

Nucleic acid from the maize R gene complex can also be used as nucleic acid encoding a reporter molecule. The R gene complex in maize encodes a protein that acts to regulate the production of anthocyanin pigments in most seed and plant tissue. Maize strains can have one, or as 5many as four, R alleles which combine to regulate pigmentation in a developmental and tissue-specific manner. Thus, an R gene introduced into such cells will cause the expression of a red pigment and, if stably incorporated, can be visually scored as a red sector. If a maize line carries dominant alleles for genes encoding for the enzymatic intermediates in the lOanthocyanin biosynthetic pathway (C2, A1, A2, Bz1 and Bz2), but carries a recessive allele at the R locus, the transformation of any cell from that line with R will result in red pigment formation. Exemplary lines include Wisconsin 22 which contains the rg-Stadler allele and TR112, a K55 derivative which is r-g, b, PI. Alternatively, any genotype of maize can be 15utilized if the C1 and R alleles are introduced together. b. Promoters and other sequences that influence gene expression Expression of nucleic acid encoding a selectable marker (or any heterologous nucleic acid) in a recipient cell can be regulated by a variety of promoters. Promoters for use in regulating transcription of DNA in cells, particularly plant cells, include, but are not limited to, the nopaline synthase 5(NOS) and octopine synthase (OCS) promoters, cauliflower mosaic virus (CaMV) 19S and 35S promoters, the light-inducible promoter from the small subunit of ribulose bis-phosphate carboxylase (ssRUBISCO, an abundant plant polypeptide), the mannopine synthase (MAS) promoter [see, e.g., Velten et al. (1984) EMBO J. 3:2723-2730; and Velten and Schell (1985) 10Nuc. Acids Res. 73:6981-6998], the rice actin promoter, the ubiquitin promoter, for example, from Z. mays (see e.g., PCT Application Publication No. WOOO/6OO6I), Arabidopsis tha/iana UBI 3 promoter [see e.g., Norris et al. (1993) Plant Mol. Biol. 22:895-906] and the chemically inducible PR-1 promoter from tobacco ox Arabidopsis (see e.g., U.S. Patent No. 155,689,044).

Selection of a suitable promoter may include several considerations, for example, recipient cell type (such as, for example, leaf epidermal cells, mesophyll cells, root cortex cells), tissue- or organ-specific (e.g., roots, leaves or flowers) expression of genes linked to the promoter, and timing 20and level of expression (as may be influenced by constitutive vs. regulatable promoters and promoter strength).

Additional sequences that may also be included in the nucleic acid containing a selectable marker include, but are not restricted to, transcription terminators and extraneous sequences to enhance expression 25such as introns. A variety of transcription terminators may be used which are responsible for termination of transcription beyond a coding region and correct polyadenylation. Appropriate transcription terminators include those that are known to function in plants such as, for example, the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator and the pea rbcS E9 terminator, all of which may be used in both monocotyledonous and dicotyledonous plants.

Numerous sequences have been found to enhance gene expression 5from within the transcriptional unit and these sequences can be used in conjunction with selectable marker and other genes to increase expression of the genes in plant cells. For example, various intron sequences such as introns of the maize Adh/ gene have been shown to enhance expression, particularly in monocotyledonous cells. In addition, a number of non-10translated leader sequences derived from viruses are also known to enhance expression, and these are particularly effective in dicotyledonous cells, c. Nucleic acids containing targeting sequences Development of a multicentric, particularly dicentric, chromosome typically is effected through integration of heterologous nucleic acid into 15heterochromatin, such as the pericentric heterochromatin, near or within the centromeric regions of chromosomes and/or into rDNA sequences. Thus, the development of artificial chromosomes may be facilitated by targeting the heterologous nucleic acid for integration into these regions, such as by introducing DNA, including, but not limited to, rDNA {e.g., rDNA intergenic 20spacer sequence), satellite DNA, pericentric DNA and lambda phage DNA, into the recipient host cell. The targeting sequence may be introduced alone or with other nucleic acids, including but not limited to selectable markers. For example, a targeting sequence can be linked to a selectable marker.

Examples of plant pericentric DNA and satellite DNA include, but are 25not limited to, pericentromeric sequences on tomato chromosome 6 [see, e.g., Weide et al. (1998) Mol. Gen. Genet. 259:190-197], satellite DNA of soybean [see, e.g., Morgante et al. (1997) Chromosome Res. 5:363-373; and Vahedian et al. (1995) Plant Mol. Biol. 29:857-862], pericentromeric DNA of Arabidopsis thaliana [see, e.g., Tutois et al. (1999) Chromosome Res. 7:143-156], satellite DNA of arabidopsis thaliana (GenBank accession nos. AB033593 and X58104), pericentric DNA of the chickpea [Cicer arietinum L.; see e.g., Staginnus et al. (1999) Plant Mol. Biol. 39:1037-51050], satellite DNA on the rye B chromosome [see, e.g., Langdon et al. (2000) Genetics 154:869-884], subtelomeric satellite DNA from Silene latifolia [see, e.g., Garrido-Ramos et ai. (1999) Genome 42:442-446] and satellite DNA in the Saccharum complex [see, e.g., Alix et al. (1998) Genome 47:854-864].

Examples of rDNA targeting sequences include nucleic acids from plant and animal rDNA. Plant rDNA sequences include, but are not limited to, sequences contained in GENBANK Accession numbers D16103 [from rDNA of carrot (Daucus carota)), M23642 and M11585 [from rDNA encoding 24S rRNA of rice (Oryza sativa)], M26461 [from rDNA encoding 1518S rRNA of rice (Oryza sativa)], M16845 [from rDNA encoding 17S, 5.8S and 25S rRNA of rice (Oryza sativa)], X82780 and X82781 [from rDNA encoding 5S rRNA of potato (Solanum tuberosum)], AJ131161, A J13116 2, AJ131163, AJ131164, AJ131165, AJ131166 and AJ131167 [from rDNA encoding 5S rRNA of tobacco (Nicotiana tabacum], L36494 and U31016 20through U31030 [from rDNA encoding 5S rRNA of barley (Hordeum spontaneum)], U31004 through U31015 and U31031 [from rDNA encoding 5S rRNA of barley (Hordeum bulbosum)], Z11759 [from rDNA encoding 5.8S rRNA of barley (Hordeum vulgare)], X16077 (from rDNA encoding 18S rRNA oi Arabidopsis thaliana), M65137 (rDNA encoding 5S rRNA of Arabidopsis 2hthaliana), AJ232900 (from rDNA encoding 5.8S rRNA of Arabidopsis thaliana) and X52320 (from Arabidopsis thaliana genes for 5.8S and 25S rRNA with an 18S rRNA fragment).

Intergenic spacer regions of plant rDNA include, but are not limited to sequences contained in GENBANK Accession numbers S70723 (from the 5S rDNA of barley (Hordeum vu/gare)), AF013103 and X03989 (from maize (Zea mays)), X65489 (from potato (Solanum tuberosum)), X52265 (from tomato (Lycopersicon esculentum)), AF177418 (from Arabidopsis neglecta), 5 AF177421 and AF17422 (from Arabidopsis halleri), A71562, X15550, X52631, U43224, X52320, X52636 and X52637 (from Arabidopsis thaliana; see Gruendler et al. (1991) J. Mol. Biol. 221: 1209-1222 and Gruendler et al. (1989) Nucleic Acids Res. 7 7:6395-6396), X54194 [from rice (Oryza sativa)] Y08422 and D76443 [from tobacco (Nicotiana \0tabacum)\, AJ243073 [from wheat (Triticum boeoticum)] and X07841 [from wheat (Triticum aestivum)]. Sequences of intergenic spacer regions of plant rDNA further include sequences from rye [see Appels et al. (1986) Can. J. Genet. Cytol. 28:673-685], wheat [see Barker et al. (1988) J. Mol. Biol. 201'.\-\1 and Sardana and Flavell (1996) Genome 39:288-292], radish [see 15Delcasso-Tremousaygue et al. (1988) Eur. J. Biochem. 772:767-776], Vicia faba and Pisum sativum [see Kato ef al. (1990) Plant Mol. Biol. 74:983-993], mung bean [see Gerstner et al. (1988) Genome 30:723-733; and Schiebel et al. (1989) Mol. Gen. Genet. 218:302-307], tomato [see Schmidt-Puchta et al. (1989) Plant Mol. Biol. 13:251-253], Hordeum 20bulbosum [see Procunier et al. (1990) Plant Mol. Biol. 75:661-663], Lens culinaris Medik., and other legume species [see Fernandez et al. (2000) Genome 43:597-603] and tobacco [see U.S. Patent Nos. 6,100,092 and 6,096,546 and PCT Application Publication No. W099/66058; Borysyuk et al. (1997) Plant Mol. Biol. 35:655-660); Borysyuk et al. (2000) Nature 25Biotechnology 78:1303-1306].

Mammalian rDNA sequences include, but are not limited to, DNA of GENBANK accession no. X82564 and portions thereof, the DNA of GENBANK accession no. U13369 and portions thereof and DNA sequences provided in PCT Application Publication No. W097/40183 (particularly SEQ. ID. NOS. 18-24 of W097/40183). A particular vector for use in directing integration of heterologous nucleic acid into chromosomal rDNA is pTERPUD (see PCT Application Publication No. W097/40183). Satellite DNA 5sequences can also be used to direct the heterologous DNA to integrate into the pericentric heterochromatin. For example, vectors pTEMPUD and pHASPUD, which contain mouse and human satellite DNA, respectively (see PCT Application Publication No. W097/40183), are examples of vectors that may be used for introduction of heterologous nucleic acid into cells for de '\Onovo chromosome formation leading to artificial chromosomes. 3. Methods for introduction of heterologous nucleic acids into host cells Any methods known in the art for introducing heterologous nucleic acids into host cells may be used in the methods of preparing artificial 15chromosomes. The particular method used may depend on the type of cell into which the heterologous nucleic acid is being transferred. For example, methods for the physical introduction of nucleic acids into plant cells, for example, protoplasts and plant cells in culture, include, but are not limited to polyethylene glycol (PEG)-mediated DNA uptake, electroporation, lipid-20mediated delivery, including liposomes, calcium phosphate-mediated DNA uptake, microinjection, particle bombardment, silicon carbide whisker-mediated transformation and combinations of these methods, for example methods utilizing combinations of calcium phosphate and PEG for DNA uptake or methods utilizing a combination of electroporation, PEG and heat 25shock (see, e.g., U.S. Patent Nos. 5,231,019 and 5,453,367). Physical methods such as these are known in the art and are effective in introducing DNA into a variety of dicotyledonous and monocotyledonous plants [see, e.g., Paszkowski et at. (1984) EMBO J. 3:2717-2722; Potrykus et al. (1985) Mol. Gen. Genet. 199A 69-177; Reich et al. (1986) Biotechnology 4:1001- 1004; Klein et al. (1987) Nature 327:70-73; U.S. Patent No. 6,143,949; Paszkowski et al. (1989) in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J and Vasil, L.K. Academic Publishers, San Diego, California, p. 52-68; and Frame et al. 5(1994) Plant J. 6:941-948].

In addition to these methods for the introduction of nucleic acids into plant cells based on physically, mechanically or chemically mediated processes, it is possible to introduce nucleic acids into plant cells by biological methods, such as those utilizing Agrobacterium. In this method, 10nucleic acid sequences located adjacent to T-DNA border repeats can be inserted into the genome of a plant cell, typically dicotyledonous plant cells, by utilizing the encoded function for DNA transfer found in the genus Agrobacterium. This method has also been shown to work for some monocotyledonous plant cells, such as rice cells.

Any method for introducing nucleic acids into plant cells can be used in the generation of artificial chromosomes, provided the method is capable of introducing the nucleic acid into an amplifiable region of a chromosome, for example, heterochromatin, and particularly in close proximity to a megareplicator region of a plant chromosome. a. Agrobacterium-mediaXed introduction of nucleic acids into plant cells Agrobacterium-medlated transformation is particularly well-suited for transformation of dicotyledons because of its high efficiency of transformation and its broad utility with many different species, including 25tobacco, tomato (see, e.g., European Patent Application no. 0 249 432), sunflower, cotton (see, e.g., European Patent Application no. 0 317 511), oilseed rape, potato, soybean, alfalfa and poplar (see, e.g., U.S. Patent No. 4,795,855) (see also PCT Application Publication no. W087/07299 with respect to transformation of Brassica). Agrobacterium-med'\ated transformation has also been used to transfer nucleic acids into monocotyledonous plants. Agrobacterium-mediated transformation of Chlorophytum capense and Narcissus cv "Paperwhite" [see, e.g., Hooykaas-5Van Slogteren et al. (1984) Nature 317:763-764], corn and wheat [see, e.g., U.S. Patent Nos. 5,164,310, 5,187,073 and 5,177,010 and Mooney et al. (1991) Plant Cell, Tissue, Organ Culture 25:209-218], rice [see, e.g., Raineri et a/, (1990) Bio/Technology 8:33-38 and Chan et al. (1993) Plant Mol. Biol. 22:491-506] and barley [see, e.g., Tingay et al. (1997) The Plant 10J. 17:1369-1376 and Qureshi et al. (1998) Proc. 42nd Conference of Australian Society for Biochemistry and Molecular Biology, September 28-October 1, 1998, Adelaide Australia] has been reported.

Agrobacterium-medlated delivery of nucleic acids is based on the capacity of certain Agrobacterium strains to introduce a part of their Ti 15(tumor-inducing) plasmid, i.e., the transforming DNA or T-DNA, into plant cells and to integrate this T-DNA into the genome of the cells. The part of the Ti plasmid that is transferred and integrated is delineated by specific DNA sequences, the left and right T-DNA border sequences. The natural T-DNA sequences between these border sequences can be replaced by foreign 20DNA [see, e.g., European Patent Publication 116 718 and Deblaere et al. (1987) Meth. Enzymol. 753:277-293].

When Agrobacterium is used for transformation, the heterologous nucleic acid being transferred typically is cloned into a plasmid that contains T-DNA border regions and is replicated independently of the Ti plasmid 25(referred to as the binary vector system) or the heterologous nucleic acid is inserted between the T-DNA borders of the Ti plasmid (referred to as the co-integrate method). In co-integrate methods, these vectors are integrated into the Ti or Ri plasmid by homologous recombination owing to sequences that are homologous to sequences within the T-DNA region of the Ti or Ri plasmid. The Ti or Ri plasmid also contains the vir region necessary for transfer of the T-DNA.

Intermediate vectors cannot replicate in Agrobacteria. The 5intermediate vector can be transferred into Agrobacterium by means of a helper plasmid (conjugation, see Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803). This method, typically referred to as triparental mating, introduces the heterologous nucleic acid sequence into the bacterium and allows for selection of a homologous recombination event that produces the 10desired Agrobacterium genotype. The triparental mating procedure typically employs Escherichia coli carrying the recombinant intermediate vector and a helper E. coli strain which carries a plasmid that is able to mobilize the recombinant intermediate vector to the target Agrobacterium strain. A modified Ti or Ri plasmid is obtained from the transfer and selection process, 15which contains a heterologous nucleic acid sequence located within the T-DNA region. The resultant Agrobacterium strain is capable of transferring the heterologous nucleic acid to plant cells.

Binary vectors can replicate both in E. coli and Agrobacterium. They typically contain a selection marker gene and a linker or polylinker which are 20flanked by the right and left T-DNA border regions and can be transformed directly into Agrobacterium [see, e.g., Hofgen and Wilmitzer (1988) Nuc. Acids. Res. 16:9877 and Holsters et al. (1978) Mol. Gen. Genet. 163:181-187] or introduced through triparental mating. The Agrobacterium host cell contains a plasmid carrying a vir region needed for transfer of the T-DNA 25into a plant cell [see, e.g., White in Plant Biotechnology, eds. Kung, S. and Arntzen, C.J., Butterworth Publishers, Boston, Mass., (1989) p. 3-34 and Fraley in Plant Biotechnology, eds. Kung, S. and Arntzen, C.J., Butterworth Publishers, Boston, Mass., (1989) p. 395-407].

Agrobacterium-med\ated transformation typically involves the transfer of a binary vector carrying the heterologous nucleic acid of interest to an appropriate Agrobacterium strain, which may depend on the complement of vir genes carried by the host Agrobacterium strain either on a co-resident Ti 5plasmid or chromosomally (see, e.g., Uknes et al. (1993) Plant Cell 5:159-169). The transfer of a recombinant binary vector to Agrobacterium is accomplished by a triparental mating procedure using Escherichia coli carrying the recombinant binary vector, and a helper E. coli strain which carries a plasmid which is able to mobilize the recombinant binary vector to 10the target Agrobacterium strain. Alternatively, the recombinant binary vector can be transferred to Agrobacterium by DNA transformation (see, e.g., Hofgen & Willmitzer (1988) Nuc. Acids. Res. 76:9877).

Many vectors are available for transfer of nucleic acids into Agrobacterium tumefaciens [see, e.g., Rogers et al. (1987) Methods in 1 BEnzymol. 753:253-277]. These typically carry at least one T-DNA border sequence and include vectors such as pBIN19 [see, e.g., Bevan (1984) Nuc. Acids. Res. 72:8711-8721]. Typical vectors suitable for Agrobacterium transformation include the binary vectors pCIB200 and pCIB2001, as well as the binary vector pCIBIO and hygromycin selection derivatives thereof (see, 20e.g., U.S. Patent No. 5,639,949). Other vectors that can be employed are the pCambia vectors (see www.cambia.org), including, for example, pCambia 3300 and pCambia 1302 (GenBank Accession No. AF234298).

A particularly useful Ti plasmid cassette vector for the transformation of dicotyledonous plants contains the enhanced CaMV35S promoter 25(EN35S) and the 3' end, including polyadenylation signals, of a soybean gene encoding the a subunit of a-conglycinin. Between these two elements is a multilinker containing multiple restriction sites for the insertion of genes of interest (see, e.g., U.S. Patent No. 6,023,013). The vector can contain a segment of pBR322 which provides an origin of replication in E. coli and a region for homologous recombination with the disarmed T-DNA in Agrobacterium strain ACO; the oriV region from the broad host range plasmid RK1; the streptomycin/spectinomycin resistance gene from Tn7; and 5a chimeric NPTIl gene, containing the CaMV35S promoter and the nopaline synthase (NOS) 3' end, which provides kanamycin resistance in transformed plant cells. Optionally, the enhanced CaMV35S promoter may be replaced with the 1.5 kb mannopine synthase (MAS) promoter (see, e.g., Velton et al. (1984) EMBO J. 3:2723-2730). After incorporation of a DNA construct 10into the vector, it is introduced into A. tumefaciens strain ACO which contains a disarmed Ti plasmid. Cointegrate Ti plasmid vectors are selected and subsequently may be used to transform a dicotyledonous plant.

Transformation of the target plant species by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with 15explants from the plant and follows published protocols. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. The plant tissue can be either protoplast, callus or organ tissue, depending on the plant species. A widely used approach is the leaf disc procedure which can be performed with any tissue 20explant that provides a good source for initiation of whole plant differentiation (see, e.g., Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9 and U.S. Patent No. 6,136,320). The addition of nurse tissue may be desirable under certain conditions. There are multiple choices of Agrobacterium strains (including, 25but not limited to, A. tumefaciens and A. rhizogenes) and plasmid construction strategies that can be used to optimize genetic transformation of plants. Transformed tissue carrying an antibiotic or herbicide resistance marker present between the binary plasmid and T-DNA borders can be regenerated on selectable medium.

A. tumefaciens ACO is a disarmed strain similar to pTiB6SE (see Fraley et al. (1985) Bio/Technology 3:629-635). For construction of ACO, the starting Agrobacterium strain was A208 which contains a nopaline-type 5Ti plasmid. The Ti plasmid was disarmed in a manner similar to that described by Fraley et al. (1985) Bio/Technology 3:629-635) so that essentially all of the native T-DNA was removed except for the left border and a few hundred base pairs of T-DNA inside the left border. The remainder of the T-DNA extending to a point just beyond the right border 10was replaced with a piece of DNA including (from left to right) a segment of pBR322, the oriV region from plasmid RK2, and the kanamycin resistance gene from Tn601. The pBR322 and oriV segments are similar to these segments and provide a region of homology for cointegrate formation (see U.S. Patent No. 6,023,013). Another useful strain of Agrobacterium is A. 15tumefaciens strain GV3101/pMP90 [see, e.g., Koncz and Schell (1986) Mol. Gen. Genet. 204:383-396].

Advances in Agrobacterium-mediated transfer allow introduction of larger segments of nucleic acids [see, e.g., Hamilton (1997) Gene 4:200(1-2):107-116; Hamilton et al. (1996) Proc. Natl. Acad. Sci. U.S.A. 93:9975-209979; Liu et al. (1999) Proc. Natl. Acad. Sci. U.S.A. 96:6535-6540]. The vectors used in these methods are designed to have the characteristics of both bacterial artificial chromosomes (BACs) and binary vectors for Agrobacterium-mediated transformation. Therefore, somewhat larger DNA fragments cloned in the T-DNA region can be transferred into a plant 25genome by Agrobacterium. Binary bacterial artificial chromosome (BIBAC) vector BIBAC2 (see U.S. Patent No. 5,733,744; available from the Plant Science Center, Cornell University) and the transformation-competent bacterial artificial chromosome (TAC) vector pYLTAC7 (available from the Plant Cell Bank of the RIKEN Gene Bank, Tsukuba, Japan) are examples of the types of vectors that may be used in transferring larger segments of nucleic acids, particularly heterologous nucleic acids containing targeting and/or selectable marker sequences as described herein, into plants via BAgrobacterium-medlated DNA transfer processes.

Introduction of heterologous nucleic acids into plant cells without the use of Agrobacterium circumvents the requirements for T-DNA sequences in the transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors containing T-DNA sequences. 5Techniques for nucleic acid transfer that do not rely on Agrobacterium include transformation via particle bombardment, direct DNA uptake (e.g., PEG, lipids, electroporation) and mechanical methods such as microinjection or silicon "whiskers". The choice of vector that may be used in introduction of heterologous nucleic acids into plant cells can involve largely on the 10preferred selection for the species being transformed. Typical vectors suitable for transformation without Agrobacterium include pCIB3064, pS0G19 and pSOG35 (see, e.g., U.S. Patent No. 5,639,949), or common plasmid, phage or cosmid vectors. b. Direct DNA Uptake 15 Introduction of heterologous nucleic acids into plant cells may be achieved using a variety of methods that facilitate direct DNA uptake, including calcium phosphate precipitation, polyethylene glycol (PEG) treatment, electroporation, and combinations thereof [see, e.g., Potrykus et al. (1985) Mol. Gen. Genet. 799:183; Lorz et al. (1985) Mol. Gen. Genet. 20799:178; Fromm et al. (1985) Proc. Natl. Acad. Sci. U.S.A. 82:5824-5828; Uchimiya et al. (1986) Mol. Gen. Genet. 204:204; Callis et al. (1987) Genes Dev. 7:1183-2000; Callis et al. (1987) Nuc. Acids Res. 75:5823-5831; Marcotte et al. (1988) Nature 355:454, Toriyama et al. (1988) Bio/Technology 6:1072-1074; Haim et al. (1985) Mol. Gen. Genet. 25 799:161-168; Deshayes et al. (1985) EMBO J. 4:2731-2737; Krens et al. (1982) Nature 296:72-74; Crossway et al. (1986) Mol. Gen. Genet. :179].

Typically, plant protoplasts are used for direct DNA uptake, or in some instances plant tissue that has been treated to remove a portion or the majority of the cell wall (see, e.g., PCT Publication No. W093/21335 and U.S. Patent No. 5,472,869). Removal of the cell wall is believed to facilitate entry of DNA into plant cells, although in some instances 5electroporation may be used to introduce DNA into specialized plant cells, e.g., electroporation of pollen, without first removing the cell wall.

Techniques for the preparation of callus and protoplasts from maize, transformation of protoplasts using PEG or electroporation, and the regeneration of maize plants from transformed protoplasts are found, for example, in European Patent Application nos. 0 292 435 and 0 392 225 and 5PCT Application Publication no. W093/07278. Transformation of rice can also be undertaken by direct gene transfer techniques utilizing protoplasts [see, e.g., Zhang et al. (1988) Plant Cell Rep. 7:379-384; Shimamoto et al. (1989) Nature 338:274-277; Datta et al. (1990) Biotechnology 8:736-740]. The regeneration of fertile transgenic barley by direct DNA transfer to 10protoplasts is described, for example, by Funatsuki et al. [(1995) Theor. Appl. Genet. 97:707-712]. Other plant species, including tobacco and Arabidopsis, may also serve as sources of protoplasts for use in introduction of heterologous nucleic acids into plant cells. c. Particle bombardment-mediated introduction of nucleic 15acids into plant cells Microprojectile bombardment of plant cells can be an effective method for the introduction of nucleic acids into plant cells. In these methods, nucleic acids are carried through the cell wall and into the cytoplasm on the surface of small, typically metal, particles [see, e.g., Klein Bet al. (1987) Nature 327:70; Klein et al. (1988) Proc. Natl. Acad. Sci. U.S.A. 85:8502-8505, Klein et al. in Progress in Plant Cellular and Molecular Biology, eds. Nijkamp, Van der Plas, J.H.W., and Van Aartrijk, J., Kluwer Academic Publishers, Dordrecht, (1988), p. 56-66; Seki et al. (1999) Mol. Biotechnol. 17:251-255; and McCabe et al. (1988) Bio/Technology 106:923-926]. Particles may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those containing tungsten, gold or platinum, as well as magnesium sulfate crystals. The metal particles can penetrate through several layers of cells and thus allow the transformation of cells within tissue explants.

In an illustrative embodiment [see, e.g., U.S. Patent No. 6,023,013] of a method for delivering nucleic acids into plant cells, e.g., maize cells, by acceleration, a Biolistics Particle Delivery System may be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with plant (e.g., corn) 20cells cultured in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. The intervening screen between the projectile apparatus and the cells to be bombarded may reduce the size of projectile aggregates and may contribute to a higher frequency of transformation by reducing damage inflicted on the recipient 25cells by projectiles that are too large.

For the bombardment, cells in suspension may be concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells may be arranged on solid culture medium. The cells to be bombarded are typically positioned at an appropriate distance below the macroprojectile stopping plate. If desired, one or more screens may also be positioned between the acceleration device and the cells to be bombarded.

The prebombardment culturing conditions and bombardment 5parameters may be optimized to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment can be important in this technology. Physical factors include those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles. lOBiological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming nucleic acid, such as linearized DNA or intact supercoiled plasmids.

Physical parameters that may be adjusted include gap distance, flight distance, tissue distance and helium pressure. In addition, transformation may be optimized by adjusting the osmotic state, tissue hydration and subculture stage or cell cycle of the recipient cells.

Techniques for transformation of the A188-derived maize line using 20particle bombardment are described in Gordon-Kamm et al. [(1990) Plant Cell 2:603-618] and Fromm et al. [(1990) Biotechnology 8:833-839]. Transformation of rice may also be accomplished via particle bombardment [see, e.g., Christou et al. (1991) Biotechnology 9:957-962]. Particle bombardment may also be used to transform wheat [see, e.g., Vasil et al. 25(1992) Biotechnology 70:667-674 for transformation of cells of type C long-term regenerable callus; and Weeks et al. (1993) Plant Physiol. 702:1077-1084 for transformation of wheat using particle bombardment of immature embryos and immature embryo-derived callus]. The production of transgenic barley using bombardment methods is described, for example, by Koprek et al. [(1996) Plant Sci. 119:79-91]. d. Electroporation-mediated introduction of nucleic acids into plant cells The application of brief, high-voltage electric pulses to a variety of animal and plant cells leads to the formation of nanometer-sized pores in the plasma membrane. Nucleic acids are taken directly into the cell cytoplasm either through these pores or as a consequence of the redistribution of membrane components that accompanies closure of the pores. 10Electroporation can be extremely efficient and can be used both for transient expression of cloned genes and for the establishment of cell lines that carry integrated copies of the gene of interest.

Certain cell wall-degrading enzymes, such as pectin-degrading enzymes, may be employed to render the target recipient cells more 15susceptible to transformation by electroporation than untreated cells. Alternatively, recipient cells may be more susceptible to transformation by mechanical wounding. To effect transformation by electroporation, friable tissues such as a suspension culture of cells or embryonic callus may be used or immature embryos or other organized tissues may be directly 20transformed [see, e.g., Fromm et al. (1986) Nature 3/9:791-793; and Neuman et al. (1982) EMBO J. 1:841-845]. e. Microinjection-mediated introduction of nucleic acids into plant cells In microinjection techniques, nucleic acids are mechanically injected 25directly into cells using very small micropipettes. For example, microinjection of protoplast cells with foreign DNA for transformation of plant cells has been reported for barley and tobacco [see, e.g., Holm et al. (2000) Transgenic Res. 9:21-32 and Schnorf et al. Transgenic Res. 7:23-30], f. Lipid-mediated introduction of nucleic acids into plant cells In lipid-mediated transfer, nucleic acids are contacted with lipids and/or encapsulated in lipid-containing structures, including but not limited 5to liposomes, and the liposome-containing nucleic acids are fused with plant protoplasts. The fusion can occur in the presence or absence of a fusogen, such as PEG. Lipid-mediated transformation of plant protoplasts has been reported [see e.g., Fraley and Papahadjopoulos (1982) Curr. Top. Microbiol. Immunol. 96:171-191; Deshayes et al. (1985) EMBO J. 4:2731-2737 and 10Spoerlein and Koop (1991) Theor. Appl. Genetics 83:1-5]. g. Other methods of introduction of nucleic acids into plant cells Other methods to physically introduce nucleic acid into plant cells may be used, including silicon carbide fibers ("whiskers") that are used to 15pierce plant cell walls thereby facilitating nucleic acid uptake, the use of sound waves to introduce holes in plant cell membranes to facilitate nucleic acid uptake (e.g., sonoporation) and the use of laser beams to open holes in cell membranes facilitating the entry of nucleic acids (e.g., laser poration).

Nucleic acids may also be imbibed by hydrating plant tissue, providing 20another method for nucleic acid uptake into plant cells [see, e.g., Simon (1974) New Phytologist 37:377-420]. For example, nucleic acids may be taken into cereal and legume seed embryos by imbibition [see, e.g., Toepfer et at. (1989) The Plant Cell 1:133-139]. 4. Treatment of cells into which heterologous nucleic acids have 25been introduced Cells into which heterologous nucleic acids have been introduced may be analyzed for de novo formation of artificial chromosomes described herein such as may result from amplification of chromosomal segments occurring in connection with integration of heterologous nucleic acids into chromosomes.

Typically, amplification occurs over multiple generations of cell division leading to the formation of detectable changes in chromosome structure. Therefore, transfected cells are typically cultured through multiple cell divisions, from about 5 to about 60, or about 5 to about 55, or about 10 to 5about 55, or about 25 to about 55, or about 35 to about 55 cell divisions following introduction of nucleic acid into a cell. Artificial chromosomes may, however, appear after only about 5 to about 15 or about 10 to about 15 cell divisions. Cells into which heterologous nucleic have been introduced may be treated in a variety of ways prior to or during analysis 10thereof for the presence of artificial chromosomes.

For example, cells into which nucleic acid encoding a selectable marker required for growth in the presence of a selection agent has been transferred can be treated as the exemplified cells herein to facilitate generation of multicentric chromosomes, and fragmentation thereof, and/or 15the generation of artificial chromosomes. The cells may be grown in the presence of an appropriate concentration of selection agent, which may be determined empirically by growing untransfected cells in varying concentrations of the agent and identifying concentrations sufficient to prevent cell growth and/or facilitate amplification of chromosomal segments. 20 Transfected cells may be grown in selective media for numerous generations and cell lines can be established that contain the introduced nucleic acid. The concentration of selection agent may also be increased over several generations to promote amplification of a region of a chromosome into which heterologous nucleic acid integrated. Transfected 25cells may also be treated to destabilize the chromosomes to facilitate generation and fragmentation of a multicentric, typically dicentric, chromosome.

Additional heterologous nucleic acid, e.g., nucleic acid encoding a selectable marker, may also be introduced into the transfected cells to facilitate amplification of chromosomal segments, such as the pericentric heterochromatin, contained in, for example, a fragment released from a multicentric chromosome (e.g., a formerly dicentric chromosome), and 5generation of a heterochromatic artificial chromosome. The resulting transformed cells can then be grown in the presence of a selection agent, which may be a second agent (if the heterologous nucleic acid introduced into the transfected cells encodes a selectable marker different from any selectable marker encoded by heterologous nucleic acid initially transferred 10into the original host cells), with or without the first selection agent.

Cells into which nucleic acids have been introduced may also be subjected to cell sorting. For example, protoplasts may be prepared from transfected plant cells or calli and subjected to sorting. If the sorting is conducted prior to chromosomal analysis of the cells for the presence of 1 Bartificial chromosomes, it provides a population of transfected cells that may be enriched for artificial chromosomes and thus facilitates the subsequent chromosomal analysis of the cells.

The sorting is based on the presence of a detectable marker in the cells, as provided for by the introduced nucleic acid, which can provide the 20basis for isolating such cells from cells that do not contain the heterologous nucleic acid. For example, the nucleic acid introduced into the plant cells may contain nucleic acid encoding a fluorescent protein, such as a green, red or blue fluorescent protein, which may be used for selection, by flow cytometry and other methods, of recipient cells that have taken up and 25express the nucleic acid at readily detected levels.

In an exemplary protocol, GFP fluorescence of transfected cell cultures may be monitored visually during culture using an inverted microscope equipped with epifluorescence illumination (Axiovert 25; Zeiss, (North York ON) and #41017 Endow GFP filter set (Chroma Technologies, Brattleboro, VT). Enrichment of GFP expressing populations can be carried out as follows. Cell sorting may be carried out, for example, using a FACS Vantage flow cytometer (Becton Dickinson Immunocytometry Systems, San 5Jose, CA) equipped with turbo-sort option and 2 Innova 306 lasers (Coherent, Palo Alto CA). For cell sorting a 70 im nozzle can be used. The buffer can be changed to PBS (maintained at 20 p.s.i.). GFP may be excited with a 488 nm laser beam and excitation detected in FL1 using a 500 EFLP filter. Forward and side scattering can be adjusted to select for viable cells. 10 Gating parameters may be adjusted using untransfected cells as negative control and GFP CHO cells as positive control.

For the first round of sorting, transfected cells may be harvested post-transfection (e.g., about 7-14 days post-transfection), converted to protoplasts, resuspended in about 10 ml of growth medium and sorted for 15GFP-expressing populations using parameters described above. GFP-positive cells may be dispensed into a volume of about 5-10 ml of protoplast medium while non-expressing cells are directed to waste. The expressing cells may be cultured. Plant cells or calli can then be analyzed, for fluorescence in-situ hybridization screening.

. ' Analysis of transformed cells and identification and manipulation of artificial chromosomes Cells into which nucleic acids have been introduced, and which may or may not have been further treated as described herein, may be analyzed for indications of amplification of chromosomal segments, the presence of structures that may arise in connection with amplification and de novo 5artificial chromosome formation and/or the presence of desired artificial chromosomes as described herein. Analysis of the cells typically involves methods of visualizing chromosome structure, including, but not limited to, G- and C-banding, PCR, Southern blotting and FISH analyses, using techniques described herein and/or known to those of skill in the art. Such 10analyses can employ specific labelling of particular nucleic acids, such as satellite DNA sequences, heterochromatin, rDNA sequences and heterologous nucleic acid sequences, that may be subject to amplification. During analysis of transfected cells, a change in chromosome number and/or the appearance of distinctive, for example, by increased segmentation 15arising from amplification of repeat units, chromosomal structures will also assist in identification of cells containing artificial chromosomes. The following description of events and structures that may be observed in analyzing cells for evidence of chromosomal amplification and/or the presence of artificial chromosomes is intended to be illustrative of the 20observations and considerations that may occur in the analysis of cells of any type, including mammalian and plant cells. It should be recognized that numerous types of structures may be formed during amplification of chromosomal segments and treatment of the cells. Additional, yet related, structures and variations of these structures are contemplated herein and 25are recognizable based on the descriptions and teachings of the generation and identification of artificial chromosomes presented herein. Each structure can be further manipulated, for example using procedures described herein, to derive additional chromosomal structures and compositions.

Typically, de novo centromere formation occurs in cells upon integration of heterologous nucleic acids into the cell chromosomes and amplification of chromosomal and heterologous nucleic acids. The integration and amplification that gives rise to de novo centromere formation 5typically occurs at the centromeric region of the short arm of a chromosome, typically an acrocentric chromosome. By employing methods such as chromosome-staining methods, including FISH and G-and C-banding, it may be possible to identify a chromosome at which the process occurs. The amplification can lead to the formation of multicentric, typically lOdicentric, chromosomes. Because of the presence of two or more functionally active centromeres on the same chromosome, regular breakages occur between the centromeres. Such specific chromosome breakages can give rise to the appearance of a chromosome fragment carrying a neo-centromere. The neo-centromere may be found on a minichromosome (neo-15minichromosome), while a formerly dicentric chromosome may carry traces of the heterologous nucleic acid. a. The neo-minichromosome Breakage of a dicentric chromosome between the two functional centromeres can form at least two chromosomes, for example, a so-called 20minichromosome, and a formerly dicentric chromosome. Treatment of cells containing a dicentric chromosome, such as, for example, recloning, treatment with agents that destabilize the chromosomes, e.g., BrdU, and/or culturing under selective conditions, may facilitate breakage of the dicentric chromosome. Selection of transformed cells can yield cell lines containing a 25stable neo-minichromosome. The breakage of a multicentric, typically dicentric, chromosome in transformed cells, which separates the neo-centromere from the remainder of the endogenous chromosome, may occur, for example, in the G-band positive heterologous nucleic acid region as is suggested if traces of the heterologous nucleic acid sequences at the broken end of the formerly dicentric chromosome are observed.

Multiple E-type amplification (amplification of euchromatin) may form a neo-chromosome, which separates from the remainder of the dicentric 5chromosome through a specific breakage between the centromeres of the dicentric chromosome. Inverted duplication of the fragment bearing the neo-centromere can result in the formation of a stable neo-minichromosome. The minichromosome is generally about at least 20-30 Mb in size.

The presence of inverted chromosome segments can be associated 10with the chromosomes formed de novo at the centromeric region of a chromosome. During the formation of the neo-minichromosome, the event leading to the stabilization of the distal segment of the chromosome that bears the duplicated neo-centromere may be the formation of its inverted duplicate.

Although the neo-minichromosome typically carries only one functional centromere, both ends of the minichromosome can be heterochromatic, carrying, for example, satellite DNA sequences as discernable by in situ hybridization. Comparison of the G-band pattern of a chromosome fragment carrying the neo-centromere with that of a stable 20neo-minichromosome, can indicate that the neo-minichromosome is an inverted duplicate of the chromosome fragment that bears the neo-centromere.

Cells containing a de novo-formed minichromosome, which contains multiple repeats of the heterologous nucleic acids, can be used as recipient 25cells in cell transfection. Donor nucleic acids, such as heterologous nucleic acids containing DNA encoding a desired protein and DNA encoding a second selectable marker, can be introduced into the cells and integrated into the de novo-ioxmed minichromosomes. To facilitate integration into the de novo-formed minichromosomes, the heterologous DNA may also contain sequences that are homologous to nucleic acids already present in the minichromosomes, which can, through homologous recombination, provide targeted integration into the minichromosome. Nucleic acids can also be 5integrated into the minichromosome through the use of site-specific recombinases by producing minichromosomes containing site-specific recombination sites as described herein. Integration can be verified by in situ hybridization and Southern blot analyses. Transcription and translation of heterologous DNA can be confirmed by primer extension, immunoblot 10analyses and reporter gene assays, if a reporter gene has been included in the heterologous DNA, using, for example, appropriate nucleic acid probes and/or product-specific antibodies.

The resulting engineered minichromosome that contains the heterologous DNA can also be transferred, for example by cell fusion, into a 15recipient cell line to further verify correct expression of the heterologous DNA. Following production of the cells, metaphase chromosomes can be obtained, such as by addition of colchicine, and the minichromosomes purified using methods as described herein. The resulting minichromosomes can be used for delivery to specific cells of interest using any known method 20or methods for transferring heterologous nucleic acids into cells, particularly plant cells, and/or methods described herein.

Thus, the neo-minichromosome is stably maintained in cells, replicates autonomously, and permits the persistent, long-term expression of genes under non-selective culture conditions, and in a whole, intact, regenerated plant. It also can contain megabases of heterologous known 5DNA that can serve as target sites for homologous recombination and integration of DNA of interest. The neo-minichromosome is, thus, a vector for the delivery and expression of nucleic acids to cells.

Cell lines that contain artificial chromosomes, such as the minichromosome, the neo-chromosome, and the heterochromatic artificial lOchromosomes, are a convenient source of these chromosomes and can be manipulated, such as by cell fusion or production of microcells for fusion with selected cell lines, to deliver the chromosome of interest into a multiplicity of cell lines, including cells from a variety of different plant species. b. Heterochromatin-containing and predominantly heterochromatic artificial chromosomes Manipulation of cells containing a fragment released upon breakage of the dicentric chromosome (e.g., a formerly dicentric chromosome), for example, by introducing additional heterologous nucleic acids, including, for example, DNA encoding a second selectable marker and growth under 5selective conditions, can yield heterochromatic structures. Included among such structures are compositions referred to as sausage chromosomes and megachromosomes. For example, a formerly dicentric chromosome may translocate to the end of another chromosome, such as an acrocentric chromosome. Additional heterologous nucleic acids added to cells 10containing a formerly dicentric chromosome can integrate into the pericentric heterochromatin of the formerly dicentric chromosome and be amplified several times with megabases of pericentric heterochromatic satellite DNA sequences forming a "sausage" chromosome carrying a newly formed heterochromatic chromosome arm. The size of this heterochromatic 15arm can vary, for example, between -150 and -800 Mb in individual metaphases. The chromosome arm can contain four to five satellite segments rich in satellite DNA, and evenly spaced integrated heterologous "foreign" DNA sequences. At the end of the compact heterochromatic arm of the sausage chromosome, a less condensed euchromatic terminal 20segment may be observed. By capturing a euchromatic terminal segment, this new chromosome arm is stabilized in the form of the "sausage" chromosome. In subclones of sausage chromosome-containing cell lines, the heterochromatic arm of the sausage chromosome may become unstable and show continuous intrachromosomal growth, particularly after treatment 25with BrdU and/or drug selection to induce further H-type amplification. In extreme cases, the amplified chromosome arm can exceed 500 Mb or even 1000 Mb in size (gigachromosome). Thus, the gigachromosome is a structure in which a heterochromatic arm has amplified but not broken off from a euchromatic arm.

In situ hybridization with, for example, biotin-labeled subfragments of the added heterologous nucleic acids may show a hybridization signal only in the heterochromatic arm of the sausage chromosome, indicating that the 5heterologous nucleic acid sequences are localized in the pericentric heterochromatin.

Gene expression, however, may be possible in the heterochromatic environment of a sausage chromosome. The level of heterologous gene expression may be determined by Northern hybridization with a subfragment 10of the selectable marker gene. Reporter genes included in heterologous nucleic acids also provide a readily detectable product for use in evaluating gene expression in a sausage or other heterochromatic or predominantly heterochromatic chromosome. Southern hybridization of DNA isolated from subclones of sausage chromosome-containing cells with subfragments of 15reporter (and selectable marker) genes can show a close correlation between the intensity of hybridization and the length of the sausage chromosome.

Cell lines containing sausage chromosomes can be manipulated to yield additional heterochromatic structures and artificial chromosomes, including, for example, an artificial chromosome referred to as a 20megachromosome. Such manipulation includes fusion of the cell line with other cells and growth in the presence of one or more selection agents and/or BrdU.

Cells with a structure, such as the sausage chromosome, can be selected and fused with a second cell line, including other plant and non-25plant species [see, e.g., Dudits et at. (1976) Heriditas 82:121-123 for the fusion of human cells with carrot protoplasts and Wiegand et al. (1987) J. Cell. Sci. (Pt. 2^:145-149 for laser-induced fusion of plant protoplasts with mammalian cells] to eliminate other chromosomes that are not of interest.

Structures such as sausage chromosomes formed during this process may be further manipulated, for example, by treating the cells with agents that destabilize chromosomes, e.g., BrdU, so that the heterochromatic arm forms a chromosome that is substantially heterochromatic (e.g., a 5megachromosome). Structures such as the gigachromosome in which the heterochromatic arm has amplified but not broken off from the euchromatic arm, may also be observed. Further manipulation, such as fusions and growth in selective conditions and/or BrdU treatment or other such treatment, can lead to fragmentation of the megachromosome to form 10smaller chromosomes that have the amplicon as the basic repeating unit.

If a cell with a sausage chromosome is selected, it can be treated with an agent, such as BrdU, that destabilizes the chromosome so that the heterochromatic arm forms a chromosome that is substantially heterochromatic (e.g., a megachromosome). Prior to treating the cell with 15BrdU, it can be fused with another cell line carrying chromosomes of another species, in order to eliminate chromosomes of the original host cell and obtain a cell in which the only chromosome from the host cell is the sausage chromosome. The resulting hybrid cells can be grown in the presence of multiple selection agents to select for those that carry the sausage 20chromosome. In situ hybridization with chromosome painting probes that detect chromosomes of both the host cell species and the species of cell to which the host cell was fused can provide an indication of the chromosomal make up of the hybrid cells.

Cell lines containing a sausage chromosome can be treated with a 25destabilizing agent, such as BrdU, followed by growth in selective medium and retreatment with BrdU. The BrdU treatments appear to destabilize the genome, resulting in a change in the sausage chromosome as well. A cell population in which a further amplification has occurred will arise. In addition to the heterochromatic arm (which may, for example, be -100-150 Mb) of the sausage chromosome, an extra centromere and another (for example, —150-250 Mb) heterochromatic chromosome arm may be formed. By the acquisition of another euchromatic terminal segment, a new 5submetacentric chromosome (e.g., megachromosome) can form.

Megachromosomes may also be produced through regrowth and establishment of sausage chromosome-containing cells in selective medium. Repeated BrdU treatment can produce cell lines that have a dwarf megachromosome (for example, about 150-200 Mb), a truncated 10megachromosome (for example, about 90-120 Mb), or a micro- megachromosome (for example, about 50-90 Mb). Cell lines containing smaller truncated megachromosomes can be used to generate even smaller megachromosomes, e.g., -10-30 Mb in size. This may be accomplished, for example, by breakage and fragmentation of a micro-megachromosome 15through exposing the cells to X-ray irradiation, BrdU or telomere-directed jn vivo chromosome fragmentation.

Apart from the euchromatic terminal segments and the integrated foreign nucleic acid, the whole megachromosome, as well as other related types of predominantly heterochromatic artificial chromosomes, is 20constitutive heterochromatin. This can be demonstrated by C-banding of the megachromosome, which results in positive staining characteristic of constitutive heterochromatin. It can contain tandem arrays of satellite DNA. In a particular example, satellite DNA blocks are organized into a giant palindrome (amplicon) carrying integrated exogenous nucleic acid sequences 25at each end. It is of course understood that the specific organization and size of each component can vary among species, and also the chromosome in which the amplification event initiates.

In general, a clear segmentation may be observed in one or more arms of an amplification-based chromosome. For example, a megachromosome may contain building units that are amplicons of, for example, -30 Mb containing satellite DNA with the integrated "foreign" DNA sequences at both ends. The —30 Mb amplicons may be composed of 5two -15 Mb inverted doublets of -7.5 Mb satellite DNA blocks, which are separated from each other by a narrow band of non-satellite sequences. The wider non-satellite regions at the amplicon borders may contain integrated, exogenous (heterologous) nucleic acid, while any narrow bands of non-satellite DNA sequences within the amplicons may be integral parts 10of the pericentric heterochromatin of the host chromosomes. The sizes of the building units of a megachromosome or other amplification-based chromosome may vary depending on the species of the host chromosome from which the artificial chromosome was generated.

Further BrdU treatment can produce cell and/or calli that include cells 15with a truncated megachromosome. The megachromosome can be further fragmented in vivo using a chromosome fragmentation vector to ultimately produce a chromosome that comprises a smaller stable replicable unit, for example, about 15 Mb-60 Mb, containing one to four megareplicons.

Apart from the euchromatic terminal segments, the whole 20megachromosome is heterochromatic, and has structural homogeneity. Therefore, artificial chromosomes such as the megachromosome offer a unique possibility for obtaining information about the amplification process, and for analyzing some basic characteristics of the pericentric constitutive heterochromatin, as a vector for heterologous DNA, and as a target for 25further fragmentation.

C. Isolation of Artificial Chromosomes The artificial chromosomes provided herein can be isolated by any suitable method known to those of skill in the art. Also, methods are provided herein for effecting substantial purification, particularly of the artificial chromosomes.

Artificial chromosomes may be sorted from endogenous chromosomes using any suitable procedures, and typically involve isolating 5metaphase chromosomes, distinguishing the artificial chromosomes from the endogenous chromosomes, and separating the artificial chromosomes from endogenous chromosomes. Such procedures will generally include the following basic steps for animal cells and protoplasts: (1) culture of a sufficient number of cells (typically about 2 x 107 mitotic cells) to yield, 10preferably on the order of 1 x 106 artificial chromosomes, (2) arrest of the cell cycle of the cells in a stage of mitosis, preferably metaphase, using a mitotic arrest agent such as colchicine, (3) treatment of the cells, particularly by cell wall dissolution for plant cells and/or swelling of the cells in hypotonic buffer, to increase susceptibility of the cells to disruption, (4) 15application of physical force to disrupt the cells in the presence of isolation buffers for stabilization of the released chromosomes, (5) dispersal of chromosomes in the presence of isolation buffers for stabilization of free chromosomes, (6) separation of artificial chromosomes from endogenous chromosomes and (7) storage (and shipping if desired) of the isolated 20artificial chromosomes in appropriate buffers. Modifications and variations of the general procedure for isolation of artificial chromosomes, for example to accommodate different cell types with differing growth characteristics and requirements and to optimize the duration of mitotic block with arresting agents to obtain the desired balance of chromosome yield and level of 25debris, may be empirically determined (see Examples).

Steps 1-5 relate to isolation of metaphase chromosomes. The separation of artificial from endogenous chromosomes (step 6) may be accomplished in a variety of ways. For example, the chromosomes may be stained with DNA-specific dyes such as Hoechst 33258 and chromomycin A3 and sorted into artificial chromosomes and endogenous chromosomes on the basis of dye content by employing fluorescence-activated cell sorting (FACS).

Artificial chromosomes have been isolated by fluorescence-activated cell sorting (FACS). This method takes advantage of the nucleotide base content of the artificial chromosomes. In the case of predominantly heterochromatic artificial chromosomes, by virtue of their high heterochromatic DNA content, they will differ from any other chromosomes 10in a cell. In a particular embodiment, metaphase chromosomes are isolated and stained with base-specific dyes, such as Hoechst 33258 and chromomycin A3. Fluorescence-activated cell sorting will separate artificial chromosomes from the endogenous chromosomes. A dual-laser cell sorter (such as, for example, a FACS Vantage Becton Dickinson Immunocytometry 15Systems) in which two lasers were set to excite the dyes separately, allowed a bivariate analysis of the chromosomes by base-pair composition and size. Cells containing such artificial chromosomes can be similarly sorted.

Preparative amounts of artificial chromosomes (for example, 5 x 104 -5 x 107 chromosomes/ml) at a purity of 95% or higher can be obtained. The resulting artificial chromosomes are used for delivery to cells by methods such as, for example, microinjection, liposome-mediated transfer, and 5electroporation.

Additional methods provided herein for isolation of artificial chromosomes from endogenous chromosomes include procedures that are particularly well suited for large-scale isolation of artificial chromosomes. In these methods, the size and density differences between artificial lOchromosomes and endogenous chromosomes are exploited to effect separation of these two types of chromosomes. To facilitate larger scale isolation of the artificial chromosomes, different separation techniques may be employed such as swinging bucket centrifugation (to effect separation based on chromosome size and density) [see, e.g., Mendelsohn et aJL (1968) 15J. Mol. Biol. 32:101-1081, zonal rotor centrifugation (to effect separation on the basis of chromosome size and density) [see, e.g., Burki et aL (1973) Prep. Biochem. 3:157-182; Stubblefield et aL (1978) Biochem. Biophvs. Res. Commun. 83:1404-1414, and velocity sedimentation (to effect separation on the basis of chromosome size and shape) [see e.g., Collard et 20al. (1984) Cytometry 5:9-19].

Affinity-, particularly immunoaffinity-, based methods for separation of ACs from endogenous chromosomes are also provided herein. For example, artificial chromosomes which are predominantly heterochromatin may be separated from endogenous chromosomes through immunoaffinity 5procedures involving antibodies that specifically recognize heterochromatin, and/or the proteins associated therewith, when the endogenous chromosomes contain relatively little heterochromatin.

Immuno-affinity purification may also be employed in larger scale artificial chromosomes isolation procedures. In this process, large 10populations of artificial chromosome-containing cells (asynchronous or mitotically enriched) are harvested en masse and the mitotic chromosomes (which can be released from the cells using standard procedures such as by incubation of the cells, such as freshly isolated protoplasts, in hypotonic buffer and/or detergent treatment of the cells in conjunction with physical 15disruption of the treated cells) are enriched by binding to antibodies that are bound to solid state matrices (e.g. column resins or magnetic beads). Antibodies suitable for use in this procedure bind to condensed centromeric proteins or condensed and DNA-bound histone proteins. For example, autoantibody LU851 (see Hadlaczky et aL (1989) Chromosoma 97:282-20288), which recognizes mammalian centromeres, may be used for large-scale isolation of chromosomes prior to subsequent separation of artificial chromosomes from endogenous chromosomes using methods such as FACS. The bound chromosomes would be washed and eventually eluted for sorting.

Immunoaffinity purification may also be used directly to separate artificial chromosomes from endogenous chromosomes. For example, in the case of artificial chromosomes that are predominantly heterochromatic, the artificial chromosomes may be generated in or transferred to (e.g., by microinjection or microcell fusion as described herein) a cell line that has chromosomes that contain relatively small amounts of heterochromatin, such as hamster cells (e.g., V79 cells or CHO-K1 cells). The predominantly heterochromatic artificial chromosomes are then separated from the 5endogenous chromosomes by utilizing anti-heterochromatin binding protein (Drosophila HP-1) antibody conjugated to a solid matrix. Such matrix preferentially binds artificial chromosomes relative to hamster chromosomes. Unbound hamster chromosomes are washed away from the matrix and the artificial chromosomes are eluted by standard techniques. Similarly, artificial lOchromosomes of one species, e.g., a plant-derived artificial chromosome, may be separated from a background of endogenous chromosomes of another species, e.g., animal, such as mammalian, chromosomes, based on immunological differences of the two species, provided that antibodies that specifically recognize one species and not the other are available or can be 15generated.

D. Generation of Artificial Chromosomes Through Assembly of Component Elements Artificial chromosomes can be constructed in vitro by assembling the structural and functional elements that contribute to a complete 20chromosome capable of stable replication and segregation alongside endogenous chromosomes in cells. The identification of the discrete elements that in combination yield a functional chromosome has made possible the in vitro assembly of artificial chromosomes. The process of in vitro assembly of artificial chromosomes, which can be rigidly controlled, 25provides advantages that may be desired in the generation of chromosomes that, for example, are required in large amounts or that are intended for specific use in transgenic organism systems.

For example, in vitro assembly may be advantageous when efficiency of time and scale are important considerations in the preparation of artificial chromosomes. Because in vitro assembly methods do not involve extensive cell culture procedures, they may be utilized when the time and labor required to transform, feed, cultivate, and harvest cells used in de novo cell-based production systems is unavailable.

Provided herein are in vitro assembly methods that include the joining of essential components, such as a centromere, telomere and an origin of replication, to yield an artificial chromosome, in particular, an artificial chromosome that functions in plants and that may contain components derived from plant chromosomes. Also provided are artificial chromosomes lOproduced by the methods. Particular embodiments of the methods and chromosomes include a megareplicator. The megareplicator may contain rDNA, for example, mammalian or plant rDNA. In vitro assembled artificial chromosomes may contain any amount of heterochromatic and/or euchromatic nucleic acid. For example, an in vitro assembled artificial 15chromosome may be substantially all heterochromatin, while still containing protein-encoding DNA, or may contain increasing amounts of euchromatic DNA, such that, for example, it contains about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than about 90% euchromatic DNA.

In vitro assembly may also be rigorously controlled with respect to the 20exact manner in which the several elements of the desired artificial chromosome are combined and in what sequence and proportions they are assembled to yield a chromosome of precise specifications. This feature is of particular significance in the generation of plant artificial chromosomes containing one or more regions of segmentation as described herein with 25reference to amplification-based artificial chromosomes. For example, certain plant chromosome structures (such as acrocentric chromosomes and/or chromosomes containing adjacent regions of heterochromatin and rDNA) that may be desirable for use in the generation of particular types of plant artificial chromosomes via amplification-based methods as described herein may be limited in number or may not exist. These particular types of plant artificial chromosomes, e.g., certain predominantly heterochromatic plant artificial chromosomes, may also be generated via in vitro assembly of 5artificial chromosomes as described herein.

For example, plant artificial chromosomes containing regions of repeated nucleic acid units that are predominantly heterochromatic may be assembled by joining essential chromosomal components and repeat regions, or may be generated from an in vitro assembled artificial chromosome via 10amplification of heterochromatic DNA contained within an in vitro assembled artificial chromosome. For generation of such chromosomes via amplification of heterochromatic DNA contained within an in vitro assembled artificial chromosome, nucleic acids are introduced into a cell containing an in vitro assembled artificial chromosome and a resulting cell is selected that 15contains an artificial chromosome containing one or more regions of repeated nucleic acid units that are predominantly heterochromatic. The in vitro assembled artificial chromosome either contains a megareplicator to facilitate amplification of chromosomal DNA in connection with integration of nucleic acid into the chromosome or megareplicator-containing DNA is 20included in the nucleic acid that is integrated into the in vitro assembled artificial chromosome.

The following describes the processes involved in the assembly of artificial chromosomes in vitro, utilizing a megachromosome as exemplary starting material. 1. Identification and isolation of the components of the artificial 5chromosome The chromosomes provided herein are elegantly simple chromosomes for use in the identification and isolation of components to be used in the in vitro assembly of expression systems or artificial chromosomes. The ability to purify artificial chromosomes to a very high level of purity, as described 10herein, facilitates their use for these purposes. For example, the megachromosome, particularly truncated forms thereof, serve as starting materials. With respect to the construction of an artificial chromosome containing at least some mammalian cell derived components, possible starting materials can be obtained from, for example, cell lines such as 1B3 I5and mM2C1, which are derived from H1D3 (deposited at the European Collection of Animal Cell Culture (ECACC) under Accession No. 96040929). With respect to the construction of an artificial chromosome containing at least some plant cell derived components, possible starting materials include cells containing PACs, e.g., megachromosomes, generated as described 20herein.

For example, the mM2C1 cell line contains a micro-megachromosome (~50-60 kB), which advantageously contains only one centromere, two regions of integrated heterologous DNA with adjacent rDNA sequences, with the remainder of the chromosomal DNA being mouse major satellite DNA. 250ther truncated megachromosomes can serve as a source of telomeres, or telomeres can be provided. The centromere of the mM2C1 cell line contains mouse minor satellite DNA, which provides a useful tag for isolation of the centromeric DNA.

Additional features of particular ACs provided herein, such as the micro-megachromosome of the mM2C1 cell line, that make them uniquely suited to serve as starting materials in the isolation and identification of chromosomal components include the fact that the centromeres of each megachromosome within a single specific cell line are identical. The ability 5to begin with a homogeneous centromere source (as opposed to a mixture of different chromosomes having differing centromeric sequences) greatly facilitates the cloning of the centromere DNA. By digesting purified megachromosomes, particularly truncated megachromosomes, such as the micro-megachromosome, with appropriate restriction endonucleases and 10cloning the fragments into commercially available and well known YAC vectors (see, e.g.. Burke et aL (1987) Science 236:806-812), BAC vectors (see, e.g., Shizuya et aL (1992) Proc. Natl. Acad. Sci. U.S.A. 89: 8794-8797 bacterial artificial chromosomes which have a capacity of incorporating 0.9 - 1 Mb of DNA) or PAC vectors (the P1 artificial 15chromosome vector which is a P1 plasmid derivative that has a capacity of incorporating 300 kb of DNA and that is delivered to coli host cells by electroporation rather than by bacteriophage packaging; see, e.g.. loannou et aL. (1994) Nature Genetics 6:84-89; Pierce et aL. (1992) Meth. Enzymol. 216:549-574; Pierce etaL (1992) Proc. Natl. Acad. Sci. U.S.A. 89:2056-202060; U.S. Patent No. 5,300,431 and International PCT application No. WO 92/14819), it is possible for as few as 50 clones to represent the entire micro-megachromosome. a. Centromeres 25 An exemplary centromere for use in the construction of an artificial chromosome is that contained within a megachromosome, such as those described herein. One example of a particular megachromosome-containing cell line provided is, for example, H1D3 and derivatives thereof, such as mM2C1 cells. Megachromosomes are isolated from such cell lines utilizing, for example, the procedures described herein, and the centromeric sequence is extracted from the isolated megachromosomes. For example, the megachromosomes may be separated into fragments utilizing selected Brestriction endonucleases that recognize and cut at sites that, for instance, are primarily located in the replication and/or heterologous DNA integration sites and/or in the satellite DNA. Based on the sizes of the resulting fragments, certain undesired elements may be separated from the centromere-containing sequences. The centromere-containing DNA could be 10as large as 1 Mb.

Probes that specifically recognize centromeric sequences, such as mouse minor satellite DNA-based probes [see, e.g., Wong et aL (1988) Nucl. Acids Res. 16:11645-11661], pCT4.2 probe, a 3.5 kb fragment of Arabidopsis 5S rDNA (Campbell et al. (1992) Gene 112:225-228), 1BArabidopsis cosmids E4.11 (30kb) adn E4.6 (33 kb, Bent et al. (1994) Science 265:1856-1860; and 180 bp pAL1 repeat sequence (Maluszynska et al. (1991) Plant J. 7:159-166; and Martinez-Zapater et al. (1986) Mol. Gen. Genet. 204:417-423) may be used to isolate a centromere-containing YAC, BAC or PAC clone derived from the megachromosome. Alternatively, 20or in conjunction with the direct identification of centromere-containing megachromosomal DNA, probes that specifically recognize the non-centromeric elements, such as probes specific for mouse major satellite DNA, plant satellite DNA, the heterologous DNA and/or rDNA, may be used to identify and eliminate the non-centromeric DNA-containing clones. 2B Additionally, centromere cloning methods described herein may be utilized to isolate the centromere-containing sequence of the megachromosome.

Once the centromere fragment has been isolated, it may be sequenced and the sequence information may in turn be used in PCR amplification of centromere sequences from megachromosomes or other sources of centromeres. Isolated centromeres may also be tested for function in vivo by transferring the DNA into a host cell. Functional analysis 5may include, for example, examining the ability of the centromere sequence to bind centromere-binding proteins. The cloned centromere will be transferred to cells with a selectable marker gene and the binding of a centromere-specific protein, such as anti-centromere antibodies (e.g., LU851, see, Hadlaczky et ah (1986) Exp. Cell Res. 167:1-15) can be used 10to assess function of the centromeres. b. Telomeres Telomeres that may be used in assembly of an artificial chromosome include a 1 kB synthetic telomere (see, e.g., PCT Application Publication No. WO 97/40183). A double synthetic telomere construct, which contains a 1 15kB synthetic telomere linked to a dominant selectable marker gene that continues in an inverted orientation may be used for ease of manipulation. Such a double construct contains a series of TTAGGG repeats 3' of the marker gene and a series of repeats of the inverted sequence, i.e., GGGATT, 5' of the marker gene as follows: (GGGATT)n—dominant marker gene—(TTAGGG)n. Using an inverted marker provides an easy means for insertion, such as by blunt end ligation, since only properly oriented fragments will be selected.

Telomere sequences also include sequences described in plants, for example, an Arabidopsis sequence containing head-to-tail arrays of the 25monomer repeat CCCTAAA totaling a few, for example 3-4, kb in length. Telomere sequences vary in length and do not appear to have a strict length requirement. An example of a cloned telomere is found in GenBank accession no. M20158 (Richards and Ausubel (1988) Cell 53:127-136) and in U.S. Patent No. 5,270,201. Yeast telomere sequences include those provided in GenBank accession no. S70807 (Louis et al. (1994) Yeast 70:271-274). Additionally, a method for isolating a higher eukaryotic telomere from A. thaliana has been reported (Richards and Ausubel (1988) 5Ce// 53:127-136; and U.S. Patent No. 5,270,201). c. Megareplicator The megareplicator sequences, such as those containing rDNA, provided herein are preferred for use in artificial chromosomes generated by assembly of component elements in vitro. The rDNA provides an origin of replication and also provides sequences that facilitate amplification of the 5artificial chromosome in vivo to increase the size of the chromosome to, for example, accommodate increasing copies of a heterologous gene of interest as well as continuous high levels of expression of the heterologous genes, d. Filler heterochromatin Filler heterochromatin, particularly satellite DNA, is included to "lOmaintain structural integrity and stability of the artificial chromosome and provide a structural base for carrying genes within the chromosome. The satellite DNA is typically A/T-rich DNA sequence, such as mouse major satellite DNA, or G/C-rich DNA sequence, such as hamster natural satellite DNA. Sources of such DNA include any eukaryotic organisms that carry 15non-coding satellite DNA with sufficient A/T or G/C composition to promote ready separation by sequence, such as by FACS, or by density gradients. Examples of plant satellite DNA include, but are not limited to, satellite DNA of soybean (see, e.g., Morgante et al. (1997) Chromosome Res. 5:363-373; and Vahedian et al. (1995) Plant Mol. Biol. 29:857-862), satellite DNA on 20the rye B chromosome (see, e.g., Langdon et al. (2000) Genetics 154:869-884) and satellite DNA in the Saccharum complex (see, e.g., Alix et al. (1998) Genome 47:854-864). The satellite DNA may also be synthesized by generating sequence containing monotone, tandem repeats of highly A/T- or G/C-rich DNA units.

The most suitable amount of filler heterochromatin for use in construction of the artificial chromosome may be empirically determined by, for example, including segments of various lengths, increasing in size, in the construction process. Fragments that are too small to be suitable for use will not provide for a functional chromosome, which may be evaluated in cell-based expression studies, or will result in a chromosome of limited functional lifetime or mitotic and structural stability. e. Selectable marker 5 Any convenient selectable marker, including specific examples described herein, may be used and at any convenient locus in the expression system. 2. Combination of the isolated chromosomal elements Once the isolated elements are obtained, they may be combined to generate the complete, functional artificial chromosome expression system. This assembly can be accomplished for example, by in vitro ligation either in solution, LMP agarose or on microbeads. The ligation is conducted so that 5one end of the centromere is directly joined to a telomere. The other end of the centromere, which serves as the gene-carrying chromosome arm, is built up from a combination of satellite DNA and megareplicator sequences, e.g., rDNA sequence, and may also contain a selectable marker gene. Another telomere is joined to the end of the gene-carrying chromosome arm. The 10gene-carrying arm is the site at which any heterologous genes of interest, for example, in expression of desired proteins encoded thereby, are incorporated either during in vitro assembly of the chromosome or sometime thereafter. 3. Analysis and testing of the artificial chromosome expression 15systems Artificial chromosomes assembled in vitro may be tested for functionality in cell systems, such as plant and animal cells, using any of the methods described herein for the artificial chromosomes, minichromosomes, or known to those of skill in the art. 4. Introduction of desired heterologous DNA into the in vitro assembled chromosome Heterologous DNA may be introduced into the in vitro synthesized chromosome using routine methods of molecular biology, may be introduced using the methods described herein for the artificial chromosomes, or may 25be incorporated into the in vitro assembled chromosome as part of one of the synthetic elements, such as the heterochromatin. The heterologous DNA may be linked to a selected repeated fragment, and then the resulting construct may be amplified in vitro using the methods for such in vitro amplification provided herein.

In a particular embodiment of these in vitro assembly methods, a site-specific recombination site is included in the assembly DNA or is added into the assembled chromosome, such as a plant in vitro assemble artificial chromosome, after initial assembly. The presence of a recombination site in 5the in vitro assembled artificial chromosome facilitates recombinase-catalyzed introduction of heterologous nucleic acid into the chromosome if the heterologous nucleic acid also contains a complementary recombination site. Such recombination systems include, but are not limited to, Crellox [see, e.g., Dale and Ow (1995) Gene 97:79-85], FLP/FRT [see, e.g., Nigel et 10a/. (1995) The Plant Journal 8:637-652], R//?S [see, e.g., Onouchi et al. (1991) Nuc. Acids Res. 79:6373-6378], GinIgix [see, e.g., Maeser and Kahman (1991) Mol. Gen. Genet. 230:170-176] and intlatt. The introduction of att recombination sites into a chromosome and the use of lambda phage integrase recombinase in conjunction therewith to permit 15engineering of natural and artificial chromosomes is described in copending U.S. provisional application Serial No. 60/294,758, by Perkins et al. entitled "CHROMOSOME-BASED PLATFORMS" filed on May 30, 2001, U.S. provisional application Serial No. 60/366,891, by Perkins et al. entitled "CHROMOSOME-BASED PLATFORMS" filed on March 21, 2002, U.S. 20patent application Serial No. 10/161,403, by Perkins et al. entitled "CHROMOSOME-BASED PLATFORMS" filed on May 30, 2002, and PCT International Application No. PCT/US02/17452, by Perkins et al. entitled "CHROMOSOME-BASED PLATFORMS" filed on May 30, 2002, each of which is incorporated herein in its entirety by reference thereto. Thus, also 25contemplated herein are in vitro assembled artificial chromosomes, in particular such chromosomes containing plant chromosome-derived components, that contain one or more recombination sites, such as an att site.

E. Methods for the Production of Plant Acrocentric Chromosomes and Plant Chromosomes Containing Adjacent Regions of rDNA and Heterochromatin Acrocentric human and mouse chromosomes in which the short arm 5contains only pericentric heterochromatin, an rDNA array, and telomeres can be used in the de novo formation of a satellite DNA based artificial chromosome (SATAC, also referred to as ACes). In some embodiments of the methods of producing a plant artificial chromosome provided herein, it may be desirable to introduce heterologous nucleic acids into a plant 10chromosome with arms of unequal length (e.g., into the short arm of an acrocentric chromosome) and/or containing adjacent regions of rDNA and heterochromatin, such as pericentric heterochromatin or satellite DNA. Of particular interest in such methods are plant acrocentric chromosomes that contain rDNA located adjacent to the pericentric heterochromatin or satellite 15DNA, and, in particular, on the short arm of the chromosome with little to no euchromatic DNA between the rDNA and the pericentric heterochromatin. Utilizing such structures as the initial composition in the generation of plant artificial chromosomes may facilitate generation of plant artificial chromosomes that are predominantly heterochromatic. For example, 20introduction of heterologous nucleic acid into a cell containing such an acrocentric plant chromosome such that the nucleic acid integrates into the pericentric heterochromatin and/or rDNA of the short arm of the chromosome may be associated with amplification (possibly through "megareplicator" DNA sequences such as may reside in plant rDNA arrays, 25also known as the nucleolar organizing regions (NOR)) of heterochromatin that leads to the formation of a predominantly heterochromatic plant artificial chromosome.

Naturally occurring acrocentric plant chromosomes are limited in number, and plant chromosomes with a structure that includes adjacent regions of heterochromatin and rDNA may not exist or may not exist for a variety of plant species. Provided herein are methods for generating acrocentric plant chromosomes and plant chromosomes containing adjacent regions of rDNA and heterochromatin, in particular, pericentric and/or 5satellite heterochromatin. Further provided herein are methods for generating acrocentric plant chromosomes containing adjacent regions of heterochromatin, such as pericentric heterochromatin and/or satellite DNA, and rDNA on the short arm of the chromosome.

Also provided herein are plant acrocentric chromosomes in which the lOnucleic acid of one or both arms of the chromosome contains less than about 50%, or less than about 40%, or less than about 30%, or less than about 20%, or less than about 10%, or less than about 5%, or less than about 2%, or less than about 1 %, or less than about 0.5% or less than about 0.1 % euchromatin. In some embodiments of these chromosomes, the 15nucleic acid of only one arm, either the short arm or the long arm, contains less than these specified amounts of euchromatin. In a particular embodiment of these chromosomes, the nucleic acid of the short arm contains less than these specified amounts of euchromatin.

Further provided herein are plant chromosomes containing adjacent 20regions of heterochromatin, in particular pericentric heterochromatin or satellite DNA, and rDNA with little to no euchromatin between the two regions. With reference to such plant chromosomes, "little to no" means that the amount of euchromatic DNA, if any, located between the rDNA and heterochromatin (such as pericentric heterochromatin and/or satellite DNA), 25generally does not stain diffusely and recognizably as euchromatin and/or does not contain protein-encoding genes. Thus, in these chromosomes, between the heterochromatin (such as pericentric heterochromatin and/or satellite DNA) and the rDNA, there is substantially no chromatin that is less condensed than the heterochromatin (e.g., pericentric heterochromatin). The plant chromosomes containing adjacent regions of rDNA and heterochromatin (such as pericentric heterochromatin) provided herein may be acrocentric chromosomes. In a particular embodiment of these plant 5chromosomes, the adjacent regions of rDNA and heterochromatin, in particular pericentric heterochromatin, are contained on the short arm of the chromosome.

Further provided are methods of utilizing such plant chromosomes in the generation of plant artificial chromosomes, and, in particular, 10predominantly heterochromatic plant artificial chromosomes, such as ACes (also referred to as SATACs). In particular methods of producing plant artificial chromosomes provided herein, nucleic acids are introduced into a cell containing a plant chromosome that is acrocentric and/or contains adjacent regions of rDNA and heterochromatin, such as pericentric 15heterochromatin, the cells are cultured through at least one cell division and a cell comprising an artificial chromosome, such as a predominantly heterochromatic artificial chromosome, is selected. In these methods, the plant chromosome into which nucleic acid is introduced may be an acrocentric chromosome containing adjacent regions of rDNA and 20heterochromatin on the short or long arm, and, in particular, on the short arm.

The plant chromosomes provided herein can be generated using site-specific recombination between plant chromosome regions. The regions may be on the same chromosome or separate chromosomes. Through site-25specific recombination, sections of plant chromosomes may be altered to remove, invert and/or insert sequences such that a desired plant chromosome results. The resulting plant chromosome is acrocentric and/or contains adjacent regions of heterochromatic DNA and rDNA, which may or may not be on the short arm of an acrocentric chromosome. Thus, the starting chromosome in these methods may be a plant chromosome or may be a plant acrocentric chromosome that does not contain adjacent regions of rDNA and heterochromatin, such as pericentric heterochromatin or satellite 5DNA. If the starting chromosome is acrocentric, then it may be used in the generation of a plant acrocentric chromosome that contains adjacent regions of heterochromatic DNA (e.g., pericentric heterochromatin and/or satellite DNA) and rDNA, particularly on the short arm of the chromosome, or to generate a plant acrocentric chromosome in which the nucleic acid of one or lOboth arms contains less than about 50%, or less than about 40%, or less than about 30%, or less than about 20%, or less than about 10%, or less than about 5%, or less than about 2%, or less than about 1 %, or less than about 0.5% or less than about 0.1 % euchromatin.

In one of the methods provided herein for producing a plant 15chromosome that is acrocentric and/or contains adjacent regions of rDNA and heterochromatin, nucleic acid containing a site-specific recombination site and nucleic acid containing a complementary site-specific recombination site are introduced into a cell containing one or more plant chromosomes. The nucleic acids may be introduced into the cell sequentially or 20simultaneously. The nucleic acids may also be targeted to particular chromosomes and/or particular sequences of a chromosome. Such targeting may be accomplished by including in the nucleic acids sequences homologous to particular sequences in the chromosome(s).

The cell is then exposed to a recombinase activity. The recombinase 25activity can be provided by introduction of nucleic acid encoding the activity into the cell for expression of the activity therein, or may be added to the cell from an exogenous source. The recombinase activity is one that catalyzes recombination between sequences at the two recombination sites.

An appropriate recombination event produces a plant chromosome that is acrocentric and/or contains adjacent regions of rDNA and heterochromatin (such as pericentric heterochromatin and/or satellite DNA) which may be readily identified therein based on its particular structure (e.g., arms of 5unequal length if the chromosome is acrocentric) and/or other features, e.g., the presence of particular added sequences, such as recombination sites and DNA encoding a selectable marker, the absence of particular sequences, such as excised euchromatic DNA, and the arrangement of sequences, such as the placement of rDNA segments adjacent to pericentric heterochromatin 10and/or satellite DNA. Such attributes may be detected using techniques known in the art for the analysis of nucleic acids and chromosomes, such as, for example, in situ hybridization.

A number of site-specific recombination systems may be used in the production of plant chromosomes that are acrocentric and/or contain rDNA 15adjacent to heterochromatin, such as pericentric heterochromatin, as described herein. Such systems include, but are not limited to, Crellox [see, e.g., Dale and Ow (1995) Gene 97:79-85], FLPIFRT [see, e.g., Nigel et al. (1995) The Plant Journal 8:637-652], RIRS [see, e.g., Onouchi et al. (1991) Nuc. Acids Res. 79:6373-6378], GinIgix [see, e.g., Maeser and Kahman 20(1991) Mol. Gen. Genet. 230:170-176] and int/aff. The introduction of att recombination sites into a chromosome and the use of lambda phage integrase recombinase in conjunction therewith to permit engineering of natural chromosomes is described in copending U.S. provisional application Serial No. 60/294,758 by Perkins et al. entitled "CHROMOSOME-BASED 25PLATFORMS" filed on May 30, 2001, U.S. provisional application Serial No. 60/366,891, by Perkins et al. entitled "CHROMOSOME-BASED PLATFORMS" filed on March 21, 2002, U.S. patent application Serial No. 10/161,403, by Perkins et al. entitled "CHROMOSOME-BASED PLATFORMS" filed on May 30, 2002, and PCT International Application No. PCT/US02/17452, by Perkins et al. entitled "CHROMOSOME-BASED PLATFORMS" filed on May 30, 2002, each of which is incorporated herein in its entirety by reference thereto. These systems, as well as others known 5in the art, can be used to specifically excise or invert DNA (for example, in an intrachromosomal recombination), exchange regions of DNA (for example, in an inter-chromosomal recombination) or insert DNA (for example, through recombination between homologous sequences at a recombination site and the DNA to be inserted). The precise event is 10controlled by the orientation of the recombination site DNA sequences.

In particular embodiments of the methods for producing an acrocentric plant chromosome provided herein, nucleic acid containing complementary recombinase recognition sites for site-specific recombination is introduced into a cell containing one or more plant chromosomes wherein 15one of the sites integrates into, or close to, the pericentric heterochromatin and/or satellite DNA (in particular, proximal satellite DNA) of one plant chromosome in the cell. In a further embodiment, nucleic acid containing complementary recombinase recognition sites for site-specific recombination is introduced into a cell containing one or more plant chromosomes wherein 20one of the sites integrates into the distal end of an arm of a plant chromosome in the cell. In these embodiments, recombination between the sites in the presence of a recombinase that recognizes the sites can result in deletion of a portion of an arm of a chromosome, reciprocal translocation between a distal portion of a chromosome arm and a more proximal portion 25of another chromosome arm or reciprocal translocation between pericentric heterochromatin and/or satellite DNA of one chromosomal arm and a more distal portion of another chromosome arm. Each of these recombination events can serve to reduce the length of a chromosome arm and give rise to an acrocentric chromosome.

In another embodiment, a nucleic acid containing a site-specific recombination site is introduced into a cell containing plant chromosomes 5wherein it integrates into the pericentric heterochromatin and/or satellite DNA of one plant chromosome in the cell and nucleic acid containing a complementary site-specific recombination site is introduced into the cell wherein it integrates into the distal end of an arm of another plant chromosome in the cell. In this embodiment, recombination between the "lOsites in the presence of a recombinase that recognizes the sites can result in reciprocal translocation between the pericentric heterochromatin and/or satellite DNA of one chromosome and the distal portion of another chromosome arm thereby bringing these two regions into close proximity on one chromosomal arm and reducing the amount of DNA between the 15pericentric region of the arm and the end of the arm to generate an acrocentric plant chromosome.

These methods for producing an acrocentric plant chromosome may also be conducted such that nucleic acid containing a site-specific recombination site is introduced into a cell containing a plant chromosome 20wherein it integrates into, or close to, the pericentric heterochromatin and/or satellite DNA of a plant chromosome in the cell and nucleic acid containing a complementary site-specific recombination site is introduced into the cell wherein it integrates into the distal end of the same arm of the same chromosome. In this embodiment, recombination between the sites in direct 25(i.e., the same, or head-to-tail) orientation in the presence of a recombinase that recognizes the sites can result in intrachromosomal recombination between the pericentric heterochromatin (and/or satellite DNA) and the distal portion of the chromosomal arm thereby excising DNA between these two regions and reducing the amount of DNA between them to generate an acrocentric plant chromosome.

In particular embodiments of the methods provided herein for producing a plant chromosome containing adjacent regions of rDNA and 5heterochromatin, such as pericentric heterochromatin and/or satellite DNA, nucleic acid containing complementary recombinase recognition sites for site-specific recombination is introduced into a cell containing one or more plant chromosomes wherein one of the sites integrates into heterochromatin of one plant chromosome in the cell. In a further embodiment, nucleic acid 10containing complementary recombinase recognitions sites for site-specific recombination is introduced into a cell containing one or more plant chromosomes wherein one of the sites integrates into rDNA or a nucleolar organizing region (NOR) of a plant chromosome in the cell. In these embodiments, recombination between the sites in the presence of a 1 Brecombinase that recognizes the sites can result in deletion of DNA between a heterochromatic region, such as the pericentric heterochromatin (and/or satellite DNA), and rDNA, inversion of DNA that includes heterochromatin or rDNA of a plant chromosome or reciprocal translocation between heterochromatin of one chromosomal arm and rDNA of another 20chromosomal arm. Each of these recombination events can serve to arrange chromosomal DNA such that a region of heterochromatic DNA, such as pericentric heterochromatin and/or satellite DNA, is adjacent to a region of rDNA on a plant chromosome.

In another embodiment, nucleic acid containing a site-specific 25recombination site is introduced into a cell containing plant chromosomes wherein it integrates into heterochromatin, such as, for example, pericentric heterochromatin and/or satellite DNA, of one plant chromosome in the cell and nucleic acid containing a complementary site-specific recombination site is introduced into the cell wherein it integrates into rDNA of another plant chromosome in the cell. In this embodiment, recombination between the sites can result in reciprocal translocation between the heterochromatin of one chromosome and the rDNA of another chromosome 5thereby bringing these two regions into close proximity on one plant chromosome with little to no euchromatin between them.

These methods for producing a plant chromosome containing adjacent regions of heterochromatic DNA and rDNA may also be conducted such that nucleic acid containing site-specific recombination sites is introduced into a 10cell containing a plant chromosome wherein it integrates into heterochromatin, for example, pericentric heterochromatin and/or satellite DNA, of a plant chromosome and nucleic acid containing a complementary site-specific recombination site is introduced into the cell wherein it integrates into rDNA of the same chromosome. In this embodiment, 15recombination between the sites in direct orientation in the presence of a recombinase that recognizes the sites can result in intrachromosomal recombination between heterochromatin, such as pericentric heterochromatin (and/or satellite DNA), and rDNA thereby excising DNA, including euchromatic DNA, between these two regions. Recombination of 20the sites in indirect (i.e., head-to-head) orientation in the presence of a recombinase can result in inversion of DNA between the sites thereby replacing DNA, such as euchromatin, located between pericentric heterochromatin (and/or satellite DNA) and rDNA on the chromosome with rDNA. Thus, in the resulting plant chromosome, rDNA is located adjacent to 25pericentric heterochromatin (and/or satellite DNA), and DNA that was present between the pericentric heterochromatin (and/or satellite DNA) and the rDNA is located distal to the rDNA in a position previously occupied by the rDNA.

In particular embodiments for producing an acrocentric plant chromosome containing adjacent regions of heterochromatin, such as pericentric heterochromatin (and/or satellite DNA), and rDNA, the short arm of the acrocentric chromosome may be generated in the same recombination 5event that places the heterochromatin and rDNA regions adjacent to each other or in a separate recombination event. For example, nucleic acid containing a site-specific recombination site may be introduced into a cell containing one or more plant chromosomes wherein it integrates into the pericentric heterochromatin of one plant chromosome and nucleic acid 10containing a complementary site-specific recombination site may be introduced into the cell wherein it integrates into rDNA that is located at a distal portion of another plant chromosome or the same arm of the same chromosome. Recombination of the sites in the presence of a recombinase can result in intra- or inter-chromosomal recombination that not only brings 15the pericentric heterochromatin (and/or satellite DNA) and rDNA into close proximity on one chromosomal arm, but also sufficiently reduces the length of that arm such that the resulting chromosome is acrocentric.

If a single recombination event such as this does not generate an acrocentric plant chromosome, multiple recombination events may be used 20to produce an acrocentric plant chromosome containing adjacent regions of heterochromatic DNA and rDNA. For example, nucleic acid containing a site-specific recombination site may be introduced into a cell containing one or more plant chromosomes wherein it integrates into the pericentric heterochromatin (and/or satellite DNA) of one plant chromosome and nucleic 25acid containing a complementary site-specific recombination site may be introduced into the cell wherein it integrates into rDNA of the same or a different plant chromosome. As described above, recombination between the sites in the presence of a recombinase can result in deletion, inversion or reciprocal translocation of DNA to arrange chromosomal DNA such that pericentric heterochromatin (and/or satellite DNA) is adjacent to a region of rDNA on a plant chromosome. In order to reduce the length of the arm of the chromosome on which the adjacent regions of heterochromatin and 5rDNA are located, an additional recombination event can be induced by introducing nucleic acid containing a site-specific recombination site into a cell containing this plant chromosome wherein it integrates into a region of the chromosome distal to the rDNA and nucleic acid containing a complementary site-specific recombination site into the cell wherein it lOintegrates into the distal end of the same chromosome arm or of another plant chromosome arm. Recombination between the recognition sites can result in deletion or reciprocal translocation of DNA to reduce the length of the chromosome arm distal to the rDNA and give rise to an acrocentric plant chromosome containing adjacent regions of heterochromatin and rDNA on 15the short arm of the chromosome.

In each of the aforementioned methods for producing a plant chromosome that is acrocentric and/or contains adjacent regions of heterochromatin and rDNA, the nucleic acid containing the two or more recombination sites may be introduced simultaneously or sequentially into a 20cell or cells using nucleic acid transfer methods described herein or known in the art. The nucleic acids may randomly integrate into plant chromosomes or may be targeted for integration into a particular region or site on a plant chromosome through homologous recombination between sequences in the nucleic acid and sequences within the chromosome. The recombinase 25activity may be provided by introduction of nucleic acid encoding an appropriate recombinase into the cell for expression therein. The recombinase-encoding nucleic acid may be introduced into the cell prior to, during or after introduction of nucleic acids encoding recombination sites.

To facilitate identification of cells containing the transferred nucleic acids and/or in which a recombination event has occurred, nucleic acid encoding a selectable marker may be introduced into the cell. For example, one or both of the nucleic acids containing a recombination site may also 5contain DNA encoding a selectable marker (e.g., a resistance-encoding marker or a reporter molecule) operatively linked to a promoter which is oriented such that integration of the nucleic acid into a chromosome places the marker DNA between two directly oriented recombination sites on an arm of a chromosome. A cell containing the nucleic acid will thus be 10resistant to a selection agent or will detectably express a reporter molecule. Exposure of the cell to the appropriate recombinase can result in a recombination event that excises the DNA between the two recombination sites, which includes DNA encoding the selectable marker. Thus, recombination could be detected as loss of reporter molecule expression or 15decreased resistance to a selection agent. After exposure to a recombinase, the cells into which nucleic acids containing recombination sites have been transferred may be analyzed for the presence of acrocentric plant chromosomes using, for example, FISH analysis and other chromosome visualization techniques.

In another method provided herein for producing a plant chromosome that is acrocentric and/or contains adjacent regions of heterochromatin and rDNA, the recombination event or events that lead to formation of the chromosome occur through crossing of transgenic plants that contain chromosomes which contain complementary site-specific recombination 25sites. Thus, in one embodiment of these methods, nucleic acid containing a recombination site adjacent to nucleic acid encoding a selectable marker is introduced into a first plant cell and a first transgenic plant is generated from the first plant cell. Nucleic acid containing a promoter functional in a plant cell, a recombination site and a recombinase coding region in operative linkage is introduced into a second plant cell from which a second transgenic plant is generated. The first and second transgenic plants are crossed to obtain one or more plants resistant to an agent that selects for cells 5containing the nucleic acid encoding the selectable marker, and a resistant plant that contains cells comprising a plant chromosome that is acrocentric and/or contains adjacent regions of heterochromatin and rDNA is selected.

In an example of this method, nucleic acids containing site-specific recombination sites are introduced into cells of Nicotiana tabacum. The lOnucleic acids are introduced separately by infecting leaf explants with Agrobacterium tumefaciens which carries the kanamycin-resistance gene (KanR). Kanamycin-resistant transgenic plants are generated from the infected leaf explants. One transgenic plant contains nucleic acid encoding a promoterless hygromycin-resistance gene preceded by a /ox-site specific 15recombination sequence (lox-hpt), the other plant contains a cauliflower mosaic virus 35S promoter linked to a /ox sequence and the ere DNA recombinase coding region (35S-lox-cre). The resultant KanR transgenic plants are crossed (see, e.g., protocols of Qin et al. (1994) Proc. Natl. Acad. Sci. U.S.A. 97:1706-1710, 1994). Plants in which the appropriate DNA 20recombination event has occurred are identified by hygromycin-resistance.

The KanR cultivars initially may be screened, such as by FISH, to identify two sets of candidate transgenic plants. One set has one construct integrated in regions adjacent to the pericentric heterochromatin (and/or satellite DNA) on the short arm of any chromosome. The second set of 5candidate plants has the other construct integrated in rDNA, such as the NOR region, of appropriate chromosomes. To obtain reciprocal translocation both sites must be in the same orientation. Therefore a series of crosses may be required, marker-resistant plants generated, and FISH analyses performed to identify an "acrocentric" plant chromosome or chromosomes 10that contain adjacent regions of heterochromatin. As described above, such an acrocentric chromosome may be used for de novo plant artificial chromosome formation, particularly predominantly heterochromatic plant artificial chromosomes. The selection of appropriate plant lines can be done, for example, using marker-assisted selection. 15F. Incorporation of Heterologous Nucleic Acids into Artificial Chromosomes Heterologous nucleic acids can be introduced into artificial chromosomes during or after formation. Incorporation of particular desired nucleic acids into an artificial chromosome during generation thereof may be 20accomplished by including the desired nucleic acids along with the nucleic acid encoding a selectable marker and any other nucleic acids used in artificial chromosome generation (e.g., targeting sequences that direct the heterologous nucleic acid to the pericentric region of a chromosome) in the transformation of a cell to initiate amplification and formation of a artificial 25chromosomes.

Alternatively, heterologous nucleic acids may be incorporated into an artificial chromosome following formation thereof through transfection of a cell containing the artificial chromosome with the heterologous nucleic acids.

In general, incorporation of such nucleic acids into the artificial chromosome is assured through site-directed integration, such as may be accomplished by including nucleic acids homologous or identical to DNA contained within the artificial chromosome in with the heterologous nucleic acid when transferring it to the artificial chromosome. An additional selective marker 5gene may also be included.

Additionally, introduction of nucleic acids, particularly DNA molecules to an artificial chromosome can be accomplished by the use of site-specific recombinases as described herein (see, also, copending U.S. provisional application Serial No. 60/294,758 by Perkins et aL entitled "CHROMOSOME- 10BASED PLATFORMS" filed on May 30, 2001, U.S. provisional application Serial No. 60/366,891, by Perkins eta/, entitled "CHROMOSOME-BASED PLATFORMS" filed on March 21, 2002, U.S. patent application Serial No. /161,403, by Perkins et al. entitled "CHROMOSOME-BASED PLATFORMS" filed on May 30, 2002, and PCT International Application No. 15PCT/US02/17452, by Perkins et aL entitled "CHROMOSOME-BASED PLATFORMS" filed on May 30, 2002; each of which is incorporated in its entirety by reference thereto). Artificial chromosomes can be produced containing recombinase recognition sequences, to allow the site-specific introduction of DNA molecules into the same. Another use for an introduced 20recombinase site is to provide a region for site-specific integration of a new trait by the use of recombinase mediated gene insertion.

G. Introduction of Artificial Chromosomes into Plant Cells and Recovery of Plants Containing Artificial Chromosomes Artificial chromosomes can be introduced into plant cells by a variety 25of methods familiar to those skilled in the art. These methods include chemical and physical methods for introduction of foreign DNA, as well as cell culture methods to transfer chromosomes from one cell to another cell.

Any type of artificial chromosome can be used. Plant artificial chromosomes (PACs) can be prepared by the in vivo and in vitro methods described herein. PACs can be prepared inside plant protoplasts and then transferred to other plant species and tissues, in particular to other plant protoplasts, via fusion in the presence or absence of PEG as described herein (Draper et al. (1982) Plant Cell Physiol. 23:451-458; Krens et at. (1982) 5Nature 72-74). PACs can be isolated from the protoplasts in which they were prepared, encapsulated into liposomes, and delivered to other plant protoplasts (Deshayes et al. (1985) EMBO J. 4:2731-2737). Alternatively, the PACs can be isolated and delivered directly to plant protoplasts, plant cells, or other plant targets via a PEG-mediated process, calcium phosphate-10mediated process, electroporation, microinjection, (particle bombardment), lipid-mediated method with or without sonoporation, sonoporation alone, or any method known in the art as described herein (Haim et al. (1985) Mol. Gen. Genet. 199:161-168; Fromm et al. (1986) Nature 319:791-793; Fromm et al. (1985) Proc. Nat. Acad. Sci. USA 82:5824-5828; Klein et al. 15(1987) Nature 327:70; Klein et al. (1988) Proc. Nat. Acad. Sci. USA 85:8502-8505; and International PCT application publication no. WO 91/00358). Plant artificial chromosomes can also be transferred to other plant species by preparation of protoplast-derived plant microcells, and fusion of the microcells containing the plant artificial chromosome with plant 20cells of other plant species.

Mammalian artificial chromosomes (MACs) can be transferred to plant cells. Mammalian artificial chromosomes are prepared by the in vivo and in vitro methods described in US Patent Nos. 6,025,155 and 6,077,697, and International PCT application No. WO 97/40183. MACs can be prepared as 25microcells, and the microcells can be fused with plant protoplasts in the presence or absence of PEG (Dudits et al. (1976) Hereditas 82:121-123; Wiegland et al. (1987) J. Cell. Sci. Pt. 2 145-149). Alternatively, the MACs can be isolated and delivered directly to plant cells, protoplasts, and other plant targets using a PEG-mediated process, calcium phosphate-mediated process, electroporation, microinjection, lipid-mediated method with or without sonoporation, sonoporation alone, or any method known in the art as described herein and in US Patent Nos. 6,025,155 and 6,077,697, and 5lnternational PCT application publication No. WO 97/40183.

After PACs or MACs are introduced into plant targets and the plant targets are grown and analyzed for transfection, the plant transformed plant targets can be developed using standard conditions into roots, shoots, plantlets, or any structure capable of growing into a plant.

Accordingly, methods for the introduction of artificial chromosomes represent the first step in the production of plant cells and whole plants containing artificial chromosomes from a variety of sources.

The ability to introduce genes into plants, such that they are stably expressed and transmissible from generation to generation, has revolutionized plant biology and opens up new possibilities for using plants as green factories for the production of commercially useful products as well 5as for other applications described herein. There are several approaches to the generation of stably transformed plants, and the adopted approach varies according to the aims of the project. For introduction of artificial chromosomes into plants, a variety of methods may be employed. transgenic plants, the transformation process involves the methods of 10foreign DNA delivery to plant host cells, the growth and analysis of transformed plant host cells, and the generation and regeneration of transgenic plants from transformed plant host cells. 1. Introduction of artificial chromosomes into plant host cells Numerous methods for producing or developing transgenic plants are 15available to those of skill in the art. The method used is primarily a function of the species of plant. Artificial chromosomes containing heterologous DNA, such as artificial chromosomes prepared by the methods described herein, can be introduced into plant host cells, including, but not limited to, plant cells and protoplasts, by, for example, non-vector mediated DNA 20transfer processes (see, also copending U.S. application Serial No. 09/815,979, which describes methods for delivery that can be adapted for use with plant cells and used with plant protoplasts).

Non-vector mediated, or direct, gene transfer systems involve the introduction of heterologous DNA, in particular artificial chromosomes, into 25host cells, including but not limited to plant cells and protoplasts, without the use of a biological vector. The artificial chromosome that is introduced into these plant host cells can lead to the development of transformed, regenerable transgenic plants. The direct gene transfer systems for transgenic plants are designed to overcome the barrier to DNA uptake caused by the cell wall and the plasma membrane of plant cells. The approaches for direct gene transfer include, but are not limited to, chemical, electrical, and physical methods, which can also be adapted to optimize 5transfer of artificial chromosomes (see, e.g., Uchimiya et aL (1989) J. of Biotech. 12: 1-20 for a review of such procedures, see also, e.g., U.S.

Patent Nos. 5,436,392; 5,489,520; Potrykus et al. (1985) Mol. Gen.

Genet. 199:183; Lorz ef al. (1985) Mol. Gen. Genet. 799:178; Fromm et al. (1985) Proc. Natl. Acad. Sci. U.S.A. 82:5824-5828; Uchimiya et at. (1986) 10Mol. Gen. Genet. 204:204; Callis et al. (1987) Genes Dev. 7:1183-2000; Callis et al. (1987) Nuc. Acids Res. 75:5823-5831; Marcotte et al. (1988) Nature 355:454 and Toriyama et al. (1988) Bio/Technology 6:1072-1074). a. Chemical methods Uptake of artificial chromosomes into plant cells, such as protoplasts, 15can be accomplished in the absence or presence of polyethylene glycol (PEG), which is a fusogen, or by any variations of such methods known to those of skill in the art Isee, e.g.. U.S. Patent No. 4,684,611 to Schilperoot et aL; Paskowski et al. (1984) EMBO J. 3:2717-2722; U.S. Patent Nos. 5,231,019 and 5,453,367]. In one approach, plant protoplasts are 20incubated with a solution of foreign DNA, in particular artificial chromosomes, and PEG at a concentration that allows for high cell survival and high efficiency chromosome uptake. The protoplasts are then washed and cultured [Datta and Datta (1999) Meth. in Molecular Biol. 111:335-348]. In an alternative approach, plant protoplasts are incubated with 25artificial chromosomes in the presence of calcium phosphate for direct artificial chromosome uptake (Haim et al. (1985) Mol. Gen. Genet.199:161-168). Alternatively, the artificial chromosome, in particular plant artificial chromosome (PAC), is formed in a plant protoplast which is, in turn, fused with another plant protoplast in the presence or absence of PEG to transfer the PAC to the plant host protoplast. Such methods for treating protoplasts with PEG and foreign DNA are well known in the art (Draper et al. (1982) Plant Cell Physiol. 23:451-458; Krens et at. (1982) Nature 72-74). 5 Another chemical direct gene transfer method involves lipid-mediated delivery of artificial chromosomes to plant protoplasts. In this process, liposomes with encapsulated artificial chromosomes are allowed to fuse with protoplasts alone or in the presence of PEG as the fusogen to transfer the foreign DNA, in particular artificial chromosome, to the plant host protoplast 10(Deshayes et al. (1985) EMBO J. 4:2731-2737; Fraley and Paphadjopoulos (1982) Curr Top Microbiol Immunol 96:171-191).

Another direct gene transfer method involves the use of microcells. The chromosomes can be transferred by preparing microcells containing artificial chromosomes and then fusing the microcells with plant protoplasts. 15 Methods for the preparation and fusion of microcells with other cells are well known in the art (see Example No. 4 and see also, e.g., U.S. Patent Nos. 5,240,840; 4,806,476;5,298,429; 5,396,767; Fournier (1981) Proc. Natl. Acad. Sci. U.S.A. 78:6349-6353; and Lambert et aL. (1991) Proc. Natl. Acad. Sci. U.S.A. 88:5907-59; Dudits et al. (1976) Hereditas 82:121-123; 20Wiegland et al. (1987) J. Cell. Sci. Pt. 2 145-149). b. Electrical methods Electroporation, which involves high-voltage electrical pulses to a solution containing a mixture of protoplasts or plant cells and foreign DNA, in particular artificial chromosomes, to create nanometer-sized, reversible 25pores, is a common method to introduce DNA into plant cells or protoplasts. The exogenous DNA may be added to the protoplasts in any form such as, for example, naked linear, circular or supercoiled DNA, artificial chromosomes encapsulated in liposomes, DNA in spheroplasts, artificial chromosomes in other plant protoplasts, artificial chromosomes complexed with salts, and other methods. The foreign DNA, in particular artificial chromosome, can also include a phenotypic marker to identify plant cells that are successfully transformed.

When plant cells or protoplasts are subjected to short electrical DC (direct current) pulses, they may experience an increase in the permeability of the plasma membrane and/or cell wall to hydrophilic molecules such as nucleic acids, which are normally unable to enter the plant cell directly. Nucleic acids are taken directly into the cell cytoplasm either through these pores or 10as a consequence of the redistribution of membrane components that accompanies closure of the pores. Certain cell wall-degrading enzymes, such as pectin-degrading enzymes, may be employed to render the plant target recipient cells more susceptible to DNA or artificial chromosome uptake by electroporation than untreated cells. Plant recipient cells may also 15be susceptible to transformation by mechanical wounding. To effect transformation by electroporation, friable tissues such as a suspension culture of cells or embryonic callus may be used or immature embryos or other organized tissues may be directly transformed (see, e.g., Fromm et al. (1986) Nature 3/9:791-793). Methods for effecting electroporation are well 20known in the art (see, e.g., U.S. Patent Nos. 4,784,737; 4,970,154; 5,304,486; 5,501,967; 5,501,662; 5,019,034; 5,503,999; see, also Fromm et aL (1985) Proc. Natl. Acad. Sci. U.S.A. 82:5824-5828; Zimmerman et at. (1981) Biophys Biochem Acta 641:160-165; Neuman et al. (1982) EMBO J. 1:841-845; Riggs et al. (1986) Proc. Nat. Acad. Sci. 25USA 83:5602-5606; Lurquin (1997) Mol. Biotechnol. 7:5-35; Bates (1999) Methods in Molecular Biology 111:359-366). Electroporation can be used to introduce nucleic acids into tobacco mesophyll cells (Morikawa et al. (1986) Gene 41:121 -124; leaf bases of rice (Dekeyser et a!. (1990) Plant Cell 2:591-602; immature maize embryos (Songstad et al. (1993) Plant Cell Tiss. Orgn. Cult. 40:1-15; macerated immature maize embryos (D'Halluin et al. (1992) Plant Cell 4:1495-1505; suspension cultured maize cells (Laursen et at. (1994) Plant Mol. Biol. 24: 51-61; and sugar cane (Arencibia et al. 5(1995) Plant Cell Rep. 14:305-309).

Artificial chromosomes may be delivered to plant cells, in particular plant seeds, by the use of electroporation and pollen to derive pollen comprising an artificial chromosome. Methods that may be used for delivery of artificial chromosomes into pollen include, for example, techniques 10described in U.S. Patent No. 5,049,500 and by Negrutiu et al. [in Biotechnology and Ecology of Pollen, Mulcahy et al. eds., (1986) Springer Verlag, N.Y., pp. 65-69] and Fromm et al. [(1986) Nature 319:791; including methods for introducing DNA into mature pollen using various procedures such as heat shock, PEG and electroporation]. The pollen is 15capable of germinating and fertilizing an egg cell, leading to the formation of a plant seed comprising an artificial chromosome. c. Physical methods The physical methods approach for introducing foreign DNA, in particular artificial chromosomes , into plant cells overcomes the cell wall 20barrier to DNA movement. Physical, or mechanical means, are used to introduce transgenes directly into protoplasts or plant cells and include, but are not limited to, microinjection, particle bombardment, and sonoporation. (1) Microinjection Microinjection involves the mechanical injection of heterologous DNA, in particular artificial chromosomes, into plant cells, including cultured cells and cells in intact plant organs and embryoids in tissue culture via very small micropipettes, needles, or syringes (Neuhaus et al. (1987)Theor. AppI Genet. 575:30-36; Reich et al. (1986) Can. J. Bot. 64:1255-1258; Crossway et al. (1986) BioTechniques 4:320-334; Crossway et al. (1986) Mol. Gen. Genet. 20:179; U.S. Patent No. 4,743,548; silicon carbide whiskers (Kaeppler et al. (1990) Plant Cell Rep. 9:415-418; Frame et al. (1994). For example, microinjection of protoplast cells with foreign DNA for transformation of 10plant cells has been reported for barley and tobacco (see, e.g., Holm et al. (2000) Transgenic Res. 9:21-32 and Schnorf et al. Transgenic Res. 1:23-30). Single artificial chromosomes may be front-loaded into microinjection needles and then injected into cells ("pick-and-inject") following procedures as described by Co et al. [(2000) Chromosome Res. 8:183-191], 15 (2) Particle bombardment Microprojectile bombardment (acceleration of small high density particles, which contain the DNA, to high velocity with a particle gun apparatus, which forces the particles to penetrate plant cell walls and membranes) has also been used to introduce heterologous DNA into plant 5cells. Microprojectile bombardment techniques for the introduction of nucleic acids into plant cells, in addition to being an effective means of reproducibly stably transforming plant cells, particularly monocots, do not require isolation of protoplasts or susceptibility of the host cell to Agrobacterium infection. In these methods, nucleic acids are carried 10through the cell wall and into the cytoplasm on the surface of small, typically metal, particles (see, e.g., Klein et a!. (1987) Nature 327:70; Klein et at. (1988) Proc. Natl. Acad. Sci. U.S.A. 85:8502-8505, Klein et al. in Progress in Plant Cellular and Molecular Biology, eds. Nijkamp, H.J.J., Van der Plas, J.H.W., and Van Aartrijk, J., Kluwer Academic Publishers, 15Dordrecht, (1988), p. 56-66 and McCabe et al. (1988) Bio/Technology 6:923-926; Sautter et al. (1991) Biol. Technol. 9:1080-1085; Gordon-Kamm et al. (1990) Plant Cell 2:603-618; Finer et al. (1999) Curr. Top. Microbiol. Immunol. 240:59-80; Vasil and Vasil (1999) Methods in Molecular Biology 111:349-358; Seki et al. (1999) Mo. Biotechnol. 11:251-255). Particles 20may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those containing tungsten, gold or platinum, as well as magnesium sulfate crystals. The metal particles can penetrate through several layers of cells and thus allow the transformation of cells within tissue explants.

In an illustrative embodiment (see, e.g., U.S. Patent No. 6,023,013) of a method for delivering foreign nucleic acids into plant cells, e.g., maize cells, by acceleration, a Biolistics Particle Delivery System may be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with plant (e.g., corn) cells cultured in suspension. The screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. The intervening screen between the projectile apparatus and the cells to be 5bombarded may reduce the size of projectile aggregates and may contribute to a higher frequency of transformation by reducing damage inflicted on the recipient cells by projectiles that are too large.

For the bombardment, cells in suspension may be concentrated on filters or solid culture medium. Alternatively, immature embryos or other 10plant target cells may be arranged on solid culture medium. The cells to be bombarded are typically positioned at an appropriate distance below the microprojectile stopping plate. If desired, one or more screens may also be positioned between the acceleration device and the cells to be bombarded.

The prebombardment culturing conditions and bombardment 15parameters may be optimized to yield the maximum numbers of stable transformants. Both the physical and biological parameters for bombardment are important in this technology. Physical factors include those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles. 20Biological factors include all steps involved in manipulation of cells before and immediately after bombardment, the osmotic adjustment of target cells to help alleviate the trauma associated with bombardment, and also the nature of the transforming nucleic acid, such as linearized DNA, intact supercoiled plasmids, or artificial chromosomes.

Physical parameters that may be adjusted include gap distance, flight distance, tissue distance and helium pressure. In addition, transformation may be optimized by adjusting the osmotic state, tissue hydration and subculture stage or cell cycle of the recipient cells. Ballistic particle acceleration devices are available from Agracetus, Inc. (Madison, Wl) and BioRad (Hercules, CA).

Techniques for transformation of A188-derived maize line using particle bombardment are described in Gordon-Kamm et al. (1990) Plant Cell 52:603-618 and Fromm et al. (1990) Biotechnology 8:833-839. Transformation of rice may also be accomplished via particle bombardment (see, e.g., Christou et al. (1991) Biotechnology 9:957-962). Particle bombardment may also be used to transform wheat (see, e.g., Vasil et al. (1992) Biotechnology 70:667-674 for transformation of cells of type C long-10term regenerable callus; and Weeks et at. (1993) Plant Physiol. 102A011-1084 for transformation of wheat using particle bombardment of immature embryos and immature embryo-derived callus). The production of transgenic barley using bombardment methods is described, for example, by Koprek et al. (1996) Plant Sci. 7/9:79-91. (3) Sonoporation Foreign DNA, in particular artificial chromosomes, may be introduced into plant protoplasts using ultrasound treatment, in particular mild ultrasound treatment (10-100kHz), to create pores for DNA uptake (see e.g. International PCT application publication no. WO 91/00358) or may be 20introduced into plant protoplasts via a sonoporation machine (ImaRx Pharmaceutical Corp., Tucson, AZ).

Alternatively, the delivery of artificial chromosomes into plant host cells is performed by any method described herein or well known in the art. For example, needle-like whiskers (US 5,302,523, 1994, US 5,464,765) 25have been used to delivery foreign DNA.

Suitable plant targets into which foreign DNA, in particular artificial chromosomes, is transferred include, but are not limited to, protoplasts, cell culture cells, cells in plant tissue, meristem cells, microspores, callus, pollen, pollen tubes, microspores, egg-cells, embryo-sacs, zygotes or embryos in different stages of development, seeds, seedlings, roots, stems, leaves, whole plants, algae, or any plant part capable of proliferation and regeneration of plants, (see, e.g., U.S. Patent Nos. 5,990,390; 6,037,526 5and 5,990,390). The growth of the transformed plant targets described herein can be done with tissue-culture or non-tissue culture methods, with the preferred methods being tissue culture methods.

All plant cells into which foreign DNA, in particular artificial chromosomes, are introduced and that is regenerated from the transformed 10cells are used directly for expressed purposes (e.g. herbicide resistance, insect/pest resistance, disease resistance, environmental/stress resistance, nutrient utilization, male sterility, improved nutritional content, production of chemicals or biologicals, non-protein expressing sequences, and preparation and screening of libraries) as described herein or are used to produce 15transformed whole plants for the applications and uses described herein. The particular protocol and means for the introduction of the artificial chromosome into the plant host is adapted or refined to suit the particular plant species or cultivar.

Chromosomes may be transferred to cells by microcell mediated 20chromosome transfer (MMCT) (Telenius et al., Chromosome Research 7:3-7, 1999; Ramulu et al., Methods in Molecular Biology 111: 227-242, 1999). In general, donor plant cultures or donor mammalian cell cultures are incubated in media supplemented with reagents that inhibit DNA synthesis (e.g., hydroxy urea, aphidicolin) and/or reagents that inhibit attachment of 25chromosomes to the mitotic spindle (e.g.,colcemid, colchicines, amiprophos-methyl, cremart). The cell walls of plant cells are digested with enzymes (e.g., cellulase, maceroenzyme) producing protoplasts. Donor plant protoplasts or donor mammalian cells are loaded on a Percoll gradient in the presence of cytochalasin-B (which causes the cell cytoskeleton to depolymerize into monomer protein subunits) and centrifuged at 105 x g. During centrifugation the metaphase chromosomes are extruded through the plasma membrane forming plant 'microprotoplasts' or mammalian 5'microcells.' The microprotoplasts/microcells are filtered through nylon sieves of decreasing pore size (8-3 im) to isolate smaller ones that contain predominately 1 metaphase chromosome. The microprotoplasts/microcells are fused to recipient plant protoplasts or mammalian cells by polyethylene glycol (peg) treatment. The fusion mixture is cultured in appropriate media. 10lf the chromosome of interest is expressing a selection marker gene the fusion mixtures may be cultured in appropriate media supplemented with the appropriate selection drug (e.g. hygromycin, kanamycin). 2. The growth of transformed plant host cells In tissue culture methods, plant cells or protoplasts transformed by 15the chemical, physical, electrical methods described herein are grown, or cultured, under selective conditions. The selective markers are integrated into the heterologous DNA, in particular artificial chromosome, before its introduction to plant hosts or are integrated into the plant host after transfection. An additional marker can be used for double selection. 20Generally, the plant cells or protoplasts are grown for numerous generations, after which the transformed cells are identified.

The transformed cells are subjected to conditions known in the art for callus initiation. Tissue that develops during the initiation period is placed in a regeneration or selection medium where shoot and root development 25occur. The plantlets are analyzed for the determination of transformation (International PCT application publication no. WO 00/60061). In the case of maize, embryonic callus cultures are initiated from immature maize embryos, bombarded with genes, and transformed into plantlets by the methods described in International PCT application publication no. WO 00/60061. In tissue culture methods, Rice calli are transformed with DNA encoding insecticidal proteins CrylA(b) and CrylA(c) for insect resistance. Common tissue culture methods can also be used to transform tobacco and tomato 5(see, e.g., US Patent No. 6,136,320), embryogenic maize calli (US Pat. Nos. 5,508,468; 5,538,877; 5,538,880; 5,780,708; 6,013,863; 5,554,798; 5,990,390; and 5,484,956;) and other crop species, e.g., potato and tobacco (Sijmons et al. (1990) Bio/Technol 8:217-221; tobacco (Vanderkerckhove et al. (1989) Bio/Technol 7:929-932 and Owen and Pen 10eds. Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins, John Wiley & Sons, Chichester, 1996) and rice (Zhu et al. (1994) Plant Cell Tiss Org Cult 36:197-204). 3. Analysis of transformed plant host cells Once foreign DNA, in particular artificial chromosomes, is introduced 15into plant hosts and the cells or protoplasts are grown and developed under the conditions described herein, the plant cells or protoplasts which were transformed with artificial chromosomes are identified. The plant cell, protoplast, callus, leaf disc, or other plant target are screened for the presence of artificial chromosomes by various methods well known in the art 20including, but not limited to, assays for the expression of reporter genes, PCR of the isolated plant chromosomes or DNA, electron microscopy, visualization methods, and in situ hybridization of chromosome painting probe as described herein. Moreover, cells treated with artificial chromosomes are isolated during metaphase using a mitotic arrest agent, 25such as colchicine, and the artificial chromosomes are distinguished from endogenous chromosomes by fluorescence-activated cell sorting, size and density differences, or by any method well known in the art. Alternatively, when a selectable marker gene is transmitted with or as part of the artificial chromosome, selective agents are used to detect the expression of the selectable marker (International PCT application publication no. WO 00/60061; US Patent No. 6,136,320; Owen and Pen Eds. Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins). 5Enzymatic assays, immunological assays, bioassays, germination assays, or chemical assays are used to assess the phenotypic effects of artificial chromosomes such as insect or fungal resistance or any other expression of genes in artificial chromosomes (Cheng et al. (1998) 95:2767-2772; US Patent No. 6,126,320; International PCT application publication no. WO 1000/60061; Owen and Pen eds. Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins, John Wiley & Sons, Chichester, 1996). The plant cells, protoplasts, or other plant hosts that are successfully transformed with artificial chromosomes are used directly to express the gene of interest or are used to generate transgenic plants. 15 Fluorescent in situ hybridization (FISH) may be used to screen for the transfer of artificial chromosomes into plant cells using DNA probes specific for the artificial chromosome (e.g., mouse major satellite DNA probe for murine satellite DNA based artificial chromosomes; or a kanamycin, hygromycin or GUS gene DNA probe for a plant artificial chromosome 20carrying such a gene). Standard FISH techniques for plant cells have been described (de Jong et al., Trends in Plant Science 4: 258-263, 1999).

IdU labeling can be used to determine the optimum conditions for chromosome transfer (microcells) of isolated artificial chromosomes. The incorporated IdU increases the fragility of the chromosome and will increase the probability of cellular mutation. Hence, the cells are fixed within 48-5hours after transfection/fusion and analyzed for chromosome uptake using various procedures. Once the optimum transfer conditions have been determined, long-term expression experiments are performed with unlabeled artificial chromosomes or microcells.

H. Re-generation of transgenic plants 10 Plants containing artificial chromosomes are generated from plant cells, protoplasts, calli, or other plant tissue targets into which foreign DNA, in particular artificial chromosomes, have been introduced. Regeneration techniques for many commercially important plant species are well-known in the art. The artificial chromosome that is inserted into plant hosts to 15produce transgenic plants are PACs or MACs.

Plants are re-generated by the planting of transformed roots, plantlets, seeds, seedlings and structures capable of growing into a whole plant capable of reproduction (see, e.g., US Patent Nos. 6,136,320 and International PCT application No. WO 00/60061). The re-generation of maize 20plants from transformed protoplasts is found, for example, in European Patent Application nos. 0 292 435 and 0 392 225 and International PCT Application Publication no. WO 93/07278; the regeneration of rice following gene transfer is found in Zhang et al. (1988) Plant Cell Rep. 7:379-384; Shimamoto et al. (1989) Nature 338:274-277; Datta et al. (1990) 2BBiotechnology 8:736-740; and the re-generation of fertile transgenic barley by direct DNA transfer to protoplasts is described by Funatsuki et al. (1995) Theor. AppI. Genet. 97:707-712. Alternatively, plants containing artificial chromosomes are obtained by crossing a plant containing an artificial chromosome with another plant to produce plants having an artificial chromosome in their genomes (see e.g. US Patent No. 6,150,585).

Plants containing an artificial chromosome are propagated through seed, cuttings, or vegetatively. The seed from plants containing an artificial chromosome are grown in the field, in pots, indoors, outdoors, in greenhouses, on glass, or in or on any suitable medium, and the resulting 5sexually mature transgenic plants are self-pollinated to generate true breeding plants. The progeny from these transgenic plants become true breeding lines (International PCT application publication Nos. WO 00/60061 and EP 1017268; US Patent Nos. 5,631,152; 5,955,362; 6,015,940; 6,013,523; 6,096,546; 6,037,527; 6,153,812; Weissbach and Weissbach 10(1988) Methods for Plant Molecular Biology, Academic Press, Inc.; Fromm et al. (1990) Bio/Technology 8:833-839; Gordon-Kamm et al. (1990) Plant Cell 2:603-608; Koziel et al. (1993) Bio/Technology 11:194-200; and Golovkin et al. (1993) Plant Sci. 90:41-52). 1. PACs Plant artificial chromosomes (PACs) are prepared by the in vivo and in vitro methods described herein. PACs may be prepared inside plant protoplasts and then transferred to plant targets, in particular to other plant protoplasts, via fusion in the presence or absence of PEG as described herein 5(Draper et al. (1982) Plant Cell Physiol. 23:451-458; Krens et al. (1982) Nature 72-74). PACs are isolated from the protoplasts in which they were prepared, encapsulated into liposomes, and delivered to other plant protoplasts (Deshayes et al. (1985) EMBO J. 4:2731-2737). Alternatively, the PACs are isolated and delivered directly to plant protoplasts, plant cells, 10or other plant targets via a PEG-mediated process, calcium phosphate-mediated process, electroporation, microinjection, sonoporation, or any method known in the art as described herein (Haim et al. (1985) Mol. Gen. Genet. 199:161-168; Fromm et al. (1986) Nature 319:791-793; Fromm et al. (1985) Proc. Nat. Acad. Sci. USA 82:5824-5828; Klein et al. (1987) 15Nature 327:70; Klein et al. (1988) Proc. Nat. Acad. Sci. USA 85:8502-8505; and International PCT application publication no. WO 91/00358). 2. MACs Mammalian artificial chromosomes (MACs) are prepared by the in vivo and in vitro methods described in US Patent Nos. 6,025,155 and 206,077,697, and International PCT application No. WO 97/40183. MACs are prepared as microcells, and the microcells are fused with plant protoplasts in the presence or absence of PEG (Dudits et al. (1976) Hereditas 82:121-123; Wiegland et al. (1987) J. Cell. Sci. Pt. 2 145-149). Alternatively, the MACs are isolated and delivered directly to plant cells, protoplasts, and other plant 25targets a PEG-mediated process, calcium phosphate-mediated process, electroporation, microinjection, sonoporation , or any method known in the art as described herein and in US Patent Nos. 6,025,155 and 6,077,697, and International PCT application publication No. WO 97/40183.

After PACs or MACs are introduced into plant targets and the plant targets are grown and analyzed for transfection, the transformed plant targets are developed using standard conditions into roots, shoots, plantlets, or any structure capable of growing into a plant. Transgenic plants can, in 5turn, be generated by the planting of transformed roots, plantlets, seeds, seedlings and structures capable of growing into a plant. Transgenic plants can be propagated, for example, through seed, cuttings, or vegetative propagation.

I. Applications and Uses of Artificial Chromosomes Artificial chromosomes provide convenient and useful vectors, and in some instances (e.g., in the case of very large heterologous genes) the only vectors, for introduction of heterologous genes into hosts. Virtually any gene of interest is amenable to introduction into a host via artificial chromosomes.

As described herein, there are numerous methods for using artificial chromosomes to introduce coding sequences into plant cells. These include methods for using artificial chromosomes to express genes encoding commercially valuable enzymes and therapeutic compounds in plant cells, introduction of agronomically important traits or applications related to the 20manipulation of large regions of DNA.

The artificial chromosomes provided herein may be used in methods of protein and gene product production, particularly using plant cells as host cells for production of such products, and in cellular production systems in which the artificial chromosomes provide a reliable, stable and efficient 25means for optimizing the biomanufacturing of important compounds for medicine and industry. They are also intended for use in methods of gene therapy and for production of transgenic organisms, particularly plants (discussed above, below and in the EXAMPLES). 1. Production of products in plants Methods for expression of heterologous proteins in plant cells ("molecular farming") are provided. At present, many foreign proteins have been expressed in whole plants or selected plant organs. Plants can offer a 5highly effective and economical means to produce recombinant proteins as they can be grown on a large scale at modest cost. The production of heterologous proteins in plants has included genes that are fused to strong constitutive plant promoters (e.g., 35S from cauliflower mosaic virus (Sijmons et al., 1990, Bio/Technology, 8:217-221, Benfey and Chua, US 105,110,732, Fraley et al., US 5,858,742, McPherson and Kay, US 5,359,142); seed specific promoters (Hall et al., US 5,504,200, Knauf et al., US 5,530,194, Thomas et al., US 5,905,186, Moloney, US 5,792,922, US 5,948,682) or promoters active in other plant organs such as fruit (Radke et al., 1988, Theoret. AppI. Genet., 75:685-694, Bestwick et al., US 155,783,394, Houck and Pear, US 4,943,674) or storage organs such as tubers (Rocha-Sosa et al., US 5,436,393, US 5,723,757). The genes under the control of these promoters can be any protein and include, for example, genes that encode receptors, cytokines, enzymes, proteases, hormones, growth factors, antibodies, tumor suppressor genes, vaccines, therapeutic 20products and multigene pathways.

For example, industrial enzymes that can be produced include, for example, a-amylase, glucanase, phytase and xylanase (see, Goddijn and Pen (1995) Trends Biotechnol. 73:379-387; Pen et at. (1992) Bio/Technology 70:292-296; Horvath et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97:1914-251919; and e.g., Herbers and Sonnewald (1996) in Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins'' Owen and Pen Eds., John Wiley & Sons, West Sussex, England), proteases such as subtilisin and other industrially important enzymes. Additional proteins that can be produced in crops by molecular farming include other industrial enzymes, for example, proteases, carbohydrate modifying enzymes such as glucose oxidase, cellulases, hemicellulases, xylanases, mannanases or pectinases, (e.g. Baszczynski et al., US 5,824,870, US 5,767,379, Bruce et 5al., US 5,804,694). Additionally, the production of enzymes particularly valuable in the pulp and paper industry such as ligninases or xylanases also can be expressed, (Austin-Philips et al., US 5,981,835). Other examples of enzymes include phosphatases, oxidoreductases and phytases, (van Ooijen et al., US 5,714,474).

Additionally, expression and delivery of vaccines in plants has been proposed (Arntzen and Lam, US 6,136,320, US, 5,914,123, Curtiss and Cardineau, US 5,679,880, US 5,679,880, US 5,654,184, Lam and Arntzen, US 5,612,487, US 6,034,298, Rymerson et al., W09937784A1, as well as antibodies (Conrad et al., WO 972900A1, Hein et al., US 5,959,177, Hiatt 15and Hein, US 5,202,422, US 5,639,947, Hiatt et al., US 6,046,037), peptide hormones (Vandekerckhove, J.S., US 5,487,991, Brandle et al., W09967401A2), blood factors and similar therapeutic molecules.

Expression of vaccines in edible plants can provide a means for drug delivery which is cost effective and particularly suited for the administration of 20therapeutic agents in rural or under developed countries. The plant material containing the therapeutic agents could be cultivated and incorporated into the diet (Lam, D.M., and Arntzen, C.J., US 5,484,719). Similarly, plants used for animal feed can be engineered to express veterinary biologies that can provide protection against animal disease, (Rymerson et al., 25W09937784A1). Antibodies also can be produced in plants, including, for example, a gene fusion encoding an antigen-binding single chain Fv protein (scFv) that recognizes the hapten oxazolone (Fiedler and Conrad (1995) Bio/Technology 13:1090-1093) and IgG (Ma et at. (1995) Science 268:716- 719). Monoclonal antibodies for therapeutic and diagnostic applications are of particular interest.

Examples of human biopharmaceuticals that can be expressed in plants include, but are not limited to, albumin (Sijmons et al. (1990)), 5enkephalins (Vandekerckhove et aL (1989) ), interferon-a (Zhu et al. (1994) and GM-CSF (Ganz et al. (1996) in Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins, Owen and Pen Eds., John Wiley & Sons, West Sussex, England, pp. 281-297; and Sardana et al. (1998) in Methods in Biotechnology, Vol. 3: Recombinant Proteins from Plants: 1 ^Production and Isolation of Clinically Useful Compounds, Cunningham and Porter, Eds., Humana Press, New Jersey; pp. 77-87).

Cells containing the artificial chromosomes provided herein can advantageously be used in in vitro plant cell-baged systems for production of proteins, particularly several proteins from one cell line, such as multiple 15proteins involved in a biochemical pathway or multivalent vaccines. The genes encoding the proteins are introduced into the artificial chromosomes which are then introduced into plant cells. Plant cells useful for this purpose are those that grow well in culture, or most preferably, plant cells capable of being regenerated to whole plants. Plants can then be cultivated by 20common methods to produce plant material comprising said heterologous proteins. The heterologous proteins can be subject to purification or the plant tissue or extracts thereof can be used directly for vaccination, amelioration of disease, or processing of material, such as bleaching during pulp and paper processing or enzymatic conversion of industrial materials or 25feedstocks. Alternatively, the heterologous gene(s) of interest are transferred into a production cell line or plant line that already contains artificial chromosomes in a manner that targets the gene(s) to the artificial chromosomes. The cells or plants are grown under conditions whereby the heterologous proteins are expressed. Because the proteins are expressed at high levels in a stable permanent extra-genomic chromosomal system, selective conditions are not required.

Selection of host lines for use in artificial chromosome-based protein 5production systems is within the skill of the art, but often will depend on a variety of factors, including the properties of the heterologous protein to be produced, potential toxicity of the protein in the host cell, any requirements for post-translational modification (e.g., glycosylation, amination, phosphorylation) of the protein, transcription factors available in the cells, 10the type of promoter element(s) being used to drive expression of the heterologous gene, whether production is completely intracellular or the heterologous protein will preferably be secreted from the cell, or be sequestered or localized, and the types of processing enzymes in the cell.

Artificial chromosomes can be engineered as platforms for the 15production of specific molecules in plant cells. For example, production of complex mammalian molecules, such as multichain antibodies, requires a number of protein activities not normally found in plant species. It is possible to produce an artificial chromosome that comprises all of the mammalian activities needed to produce human antibodies, correctly 20modified and processed, by introducing into an artificial chromosome the genes needed to carry out these activities. Said genes would be modified, for example, by placing each gene under the control of a plant promoter, or by placing the master control gene, i.e., a gene that controls expression of the various genes, under the control of a plant promoter. Alternatively, 25mammalian transcriptional control factors could be introduced, under the control of plant active promoters, to be expressed in a plant cell and cause the expression of said target proteins, for example multichain antibodies.

In this fashion, plant artificial chromosomes are developed, each capable of supporting the efficient production of a specific class of valuable products, for example, antibodies, blood clotting factors, etc. Thus, production of products within a class, for example, human antibodies would simply involve the introduction of a specific antibody coding sequence, 5without modification into the artificial chromosome engineered specifically for the production of human antibodies. The artificial chromosome would comprise all of the required genetic activities for the proper expression, translation and post-translational modification of human antibodies. Such artificial chromosomes can be used in a variety of applications, such as, but 10are not limited to, large scale production of numerous specific human antibodies.

Advantages of plant cells as host cell lines in the production of recombinant proteins include, but are not limited to, the following: (1) proteins are post-translationally modified similar to mammalian systems, (2) 15plants can be directed to secrete proteins into stable, dry, intracellular compartments of seeds called endosperm protein bodies, which can easily be collected, (3) the amount of recombinant product that can be produced approaches industrial scale levels and (4) health risks due to contamination with potential pathogens/toxins are minimized.

The artificial chromosome-based system for heterologous protein production has many advantageous features. For example, as described above, because the heterologous DNA is located in an independent, extra-genomic artificial chromosome (as opposed to randomly inserted in an unknown area of the host cell genome or located as extrachromosomal 25element(s) providing only transient expression), it is stably maintained in an active transcription unit and is not subject to ejection via recombination or elimination during cell division. Accordingly, it is unnecessary to include a selection gene in the host cells and thus growth under selective conditions also unnecessary. Furthermore, because the artificial chromosomes are capable of incorporating large segments of DNA, multiple copies of the heterologous gene and linked promoter element(s) can be retained in these chromosomes, thereby providing for high-level expression of the foreign 5protein(s). Alternatively, multiple copies of the gene can be linked to a single promoter element and several different genes can be linked in a fused polygene complex to a single promoter for expression of, for example, all the key proteins constituting a complete metabolic pathway (see, e.g.. Beck von Bodman et aL (1995) Biotechnology 13:587-591). Alternatively, multiple lOcopies of a single gene can be operatively linked to a single promoter, or each or one or several copies can be linked to different promoters or multiple copies of the same promoter. Additionally, because artificial chromosomes have an almost unlimited capacity for integration and expression of foreign genes, they can be used not only for the expression of genes encoding end-15products of interest, but also for the expression of genes associated with optimal maintenance and metabolic management of the host cell, e.g., genes encoding growth factors, as well as genes that facilitate rapid synthesis of correct form of the desired heterologous protein product, e.g., genes encoding processing enzymes and transcription factors as described 20above.

The artificial chromosomes are suitable for expression of any proteins or peptides, including proteins and peptides that require in vivo posttranslational modification for their biological activity. Such proteins include, but are not limited to antibody fragments, full-length antibodies, and 25multimeric antibodies, tumor suppressor proteins, naturally occurring or artificial antibodies and enzymes, heat shock proteins, and others.

Thus, such cell-based "protein factories" employing artificial chromosomes can be generated using artificial chromosomes constructed with multiple copies (theoretically an unlimited number or at least up to a number such that the resulting artificial chromosome is about up to the size of a genomic chromosome (i.e., endogenous)) of protein-encoding genes with appropriate promoters, or multiple genes driven by a single promoter, 5i.e., a fused gene complex (such as a complete metabolic pathway in plant expression system; see, e.g.. Beck von Bodman (1995) Biotechnology 1.3:587-591). Once such an artificial chromosome is constructed, it can be transferred to a suitable plant species capable of being propagated under field conditions, or under conditions that permit the recovery of the intended lOproduct. Plant cell cultures such as algae can be used in a system analogous to mammalian cell culture systems. The advantage of plant based systems such as this include low input costs for growth, rapid growth rates and ability to produce a large biomass economically.

The ability of artificial chromosomes to provide for high-level 15expression of heterologous proteins in host cells is demonstrated, for example, by analysis of mammalian cells containing a mammalian artificial chromosome, H1D3 and G3D5 cell lines described herein. Northern blot analysis of mRNA obtained from these cells reveals that expression of the hygromycin-resistance and a -galactosidase genes in the cells correlates 20with the amplicon number of the megachromosome(s) contained therein.

Transgenic plants producing these compounds are made by the introduction and expression of one or potentially many genes using the artificial chromosomes provided herein. The vast array of possibilities include, but are not limited to, any biological compound which is presently 25produced by any organism such as proteins, nucleic acids, primary and intermediary metabolites, carbohydrate polymers, enzymes for use in bioremediation, enzymes for modifying pathways that produce secondary plant metabolites such as flavonoids or vitamins, enzymes that could produce pharmaceuticals and for introducing enzymes that could produce compounds of interest to the manufacturing industry such as specialty chemicals and plastics. The compounds are produced by the plant, extracted upon harvest and/or processing, and used for any presently 5recognized useful purpose such as pharmaceuticals, fragrances, and industrial enzymes. Alternatively, plants produced in accordance with the methods and compositions provided herein can be made to metabolize certain compounds, such as hazardous wastes, thereby allowing bioremediation of these compounds.

The artificial chromosomes provided herein can be used in methods of protein and gene product production, particularly using plant cells as host cells for production of such products, and in cellular production systems in which the artificial chromosomes provide a reliable, stable and efficient means for optimizing the biomanufacturing of important compounds for 15medicine and industry. 2. Genetic alteration of organisms to possess desired traits Artificial chromosomes are ideally suited for preparing organisms, such as plants, that possess certain desired traits, such as, for example, disease resistance, resistance to harsh environmental conditions, altered growth patterns and enhanced physical characteristics. With respect to 5plants, the choice of the particular nucleic acid that will be delivered to recipient cells via artificial chromosomes often will depend on the purpose of the transformation. One of the major purposes of transformation of crop and tree species is to add some commercially desirable, agronomically important traits to the plant. Such traits include, but are not limited to, 10input and output traits such as herbicide resistance or tolerance, insect resistance or tolerance, disease resistance or tolerance (viral, bacterial, fungal or nematode), stress tolerance and/or resistance, as exemplified by resistance or tolerance to drought, heat, chilling, freezing, excessive moisture, salt stress and oxidative stress, increased yields, food content and 15makeup, physical appearance, male sterility, drydown, standability, prolificacy, starch quantity and quality, oil quantity and quality, protein quantity and quality and amino acid composition. It may be desirable to incorporate one or more genes conferring such desirable traits into host plants. a. Herbicide resistance The genes encoding phosphinothricin acetyltransferase (bar and pat), glyphosate tolerant EPSP synthase genes, the glyphosate degradative enzyme gene gox encoding glyphosate oxidoreductase, deh (encoding a dehalogenase enzyme that inactivates dalapon), herbicide resistant 5{e.g.,sulfonylurea and imidazolinone) acetolactate synthase, and bxn genes (encoding a nitrilase enzyme that degrades bromoxynil) are all examples of herbicide resistant genes for use in plant transformation. The bar and pat genes code for an enzyme, phosphinothricin acetyltransferase (PAT), which inactivates the herbicide phosphinothricin and prevents this compound from 10inhibiting glutamine synthetase enzymes. The enzyme 5- enolpyruvylshikimate 3-phosphate synthase (EPSP synthase) is normally inhibited by the herbicide N-(phosphonomethyl)glycine (glyphosate).

However, genes are known that encode glyphosate-resistant EPSP synthase enzymes. The deh gene encodes the enzyme dalapon dehalogenase and 15confers resistance to the herbicide dalapon. The bxn gene codes for a specific nitrilase enzyme that converts bromoxynil to a non-herbicidal degradation product. b. Insect and other pest resistance Insect-resistant organisms may be prepared in which resistance or 20decreased susceptibility to insect-induced disease is conferred by introduction into the host organism or embryo of artificial chromosomes containing DNA encoding gene products (e.g., ribozymes and proteins that are toxic to certain pathogens) that destroy or attenuate pathogens or limit access of pathogens to the host. Potential insect resistance genes that can 25be introduced into plants via artificial chromosomes include Bacillus thuringiensis crystal toxin genes or Bt genes (see, e.g.,, Watrud et al. (1985) in Engineered Organisms and the Environment). Bt genes may provide resistance to lepidopteran or coleopteran pests such as the European Corn Borer (ECB). Such Bt toxin genes include the CrylA(b) and CrylA(c) genes. Endotoxin genes from other species of B. thuringiensis which affect insect growth or development also may be employed in this regard. Bt gene sequences can be modified to effect increased expression in plants, and 5particularly monocot plants. Means for preparing synthetic genes are well known in the art and are disclosed in, for example, U.S. Patent Nos. 5,500,365 and 5,689,052. Examples of such modified Bt toxin genes include a synthetic Bt CrylA(b) gene (see, e.g., Perlak et al. (1991) Proc.

Natl. Acad. Sci. U.S.A. 88:3324-3328) and the synthetic CrylA(c) gene lOtermed 1800b (see PCT Application publication no. W095/06128).

Examples of the types of genes that may be transferred into plants via artificial chromosomes to generate disease- and/or insect-resistant transgenic plants include, but are not limited to, the crylA(b) and crylA(c) genes which yield products that are highly toxic to two major rice insect 15pests (the striped stem borer and the yellow stem borer) (see, e.g., Cheng et aL (1998) Proc. Natl. Acad. Sci. U.S.A. 95:2767-2772), cry3 genes which encode products that are toxic to Coleopteran insects that attack a variety of plants, including grains and legumes (see, e.g., U.S. Patent No. 6,023,013), genes (e.g., DNA encoding tricothecene 3-O-acetyltransferase) 20that confer resistance to tricothecenes such as those produced by plant fungi (e.g., Fusarium) in plants particularly susceptible to fungi (e.g., wheat, rye, barley, oats, and maize) (see, e.g., PCT Application publication no. WO 00/60061), and genes involved in multi-gene biosynthetic pathways that yield antipathogenic substances that have a deleterious effect on the growth 25of plant pathogens (see, e.g., U.S. Patent No. 5,639,949).

Protease inhibitors may also provide insect resistance (see, e.g., Johnson et aL (1989) and will thus have utility in plant transformation. The use of a protease inhibitor II gene, pinll, from tomato or potato may be particularly useful. The combined effect of the use of a pinll gene with a Bt toxin gene can produce synergistic insecticidal activity. Other genes that encode inhibitors of the insect's digestive system, or those that encode enzymes or co-factors that facilitate the production of inhibitors, also may 5be useful. This group may be exemplified by oryzacystatin and amylase inhibitors such as those from wheat and barley.

Genes encoding lectins may confer additional or alternative insecticide properties. Lectins (originally termed phytohemagglutinins) are multivalent carbohydrate-binding proteins which have the ability to agglutinate red blood 10cells from a range of species. Lectins have been identified as insecticidal agents with activity against weevils, ECB and rootworm (see, e.g., Murdock et al. (1990) Phytochemistry 29:85-89; Czapla & Lang (1990) J. Econ. Entomol. 83:2480-2485). Lectin genes that may be useful include, for example, barley and wheat germ agglutinin (WGA) and rice lectins 15(Gatehouse et al. (1984) J. Sci. Food. Agric. 35;373-380).

Genes controlling the production of large and small polypeptides active against insects when introduced into the insect pests, such as, for example, lytic peptides, peptide hormones and toxins and venoms, may also be useful in generating pest-resistant plants. For example, expression of 20juvenile hormone esterase, directed toward specific insect pests, also may result in insecticidal activity, or cause cessation of metamorphosis (see, e.g., Hammock et al. (1990) Nature 344:458-461).

Transgenic plants expressing genes which encode enzymes that affect the integrity of the insect cuticle are additional examples of genes 25that may be transferred to plants via artificial chromosomes to confer resistance to insects. Such genes include those encoding, for example, chitinase, proteases, lipases and also genes for the production of nikkomycin, a compound that inhibits chitin synthesis, the introduction of any of which may be used to produce insect-resistant plants. Genes that affect insect molting, such as those affecting the production of ecdysteroid UDP-glucosyl transferase, also can be useful transgenes.

Genes that code for enzymes that facilitate the production of 5compounds that reduce the nutritional quality of the host plant to insect pests may also be used to confer insect resistance on plants. It may be possible, for instance, to confer insecticidal activity on a plant by altering its sterol composition. Sterols are obtained by insects from their diet and are used for hormone synthesis and membrane stability. Therefore, alterations 10in plant sterol composition by expression of genes that directly promote the production of undesirable sterols or those that convert desirable sterols into undesirable forms, could have a negative effect on insect growth and/or development and hence endow the plant with insecticidal activity. Lipoxygenases are naturally occurring plant enzymes that have been shown 15to exhibit anti-nutritional effects on insects and to reduce the nutritional quality of their diet. Therefore, transgenic plants with enhanced lipoxygenase activity may be resistant to insect feeding.

Tripsacum dacty/oides is a species of grass that is resistant to certain insects, including corn root worm. Tripsacum may thus include genes 20encoding proteins that are toxic to insects or are involved in the biosynthesis of compounds toxic to insects. Such genes may be useful in conferring resistance to insects. It is known that the basis of insect resistance in Tripsacum is genetic, because said resistance has been transferred to Zea mays via sexual crosses (Branson and Guss, 1972). It is further anticipated 25that other cereal, monocot or dicot plant species may have genes encoding proteins that are toxic to insects which would be useful for producing insect resistant plants.

Further genes encoding proteins characterized as having potential insecticidal activity also may be used as transgenes in accordance herewith. Such genes include, for example, the cowpea trypsin inhibitor (CpT1: Hilder et al., 1987) which may be used as a rootworm deterrent, genes encoding 5avermectin (Avermectin and Abamectin., Campbell, W.C., Ed., 1989: Ikeda et al., 1987) which may prove particularly useful as a corn rootworm deterrent, ribosome inactivating protein genes and even genes that regulate plant structures. Transgenic plants including anti-insect antibody genes and genes that code for enzymes that can convert a non-toxic insecticide (pro-10insecticide) applied to the outside of the plant into an insecticide inside the plant also are contemplated. c. Disease resistance Transgenic organisms, such as plants, that express genes that confer resistance or reduce susceptibility to disease are of particular interest. For 15example, the transgene may encode a protein that is toxic to a pathogen, such as a virus, fungus, mycotoxin-producing organism, nematode or bacterium, but that is not toxic to the transgenic host.

Because multiple genes can be introduced on an artificial chromosome, a series of genes encoding a genetic pathway involved in 20disease resistance or tolerance can be introduced into crop plants. For example, it is known that often numerous genes are expressed upon pathogen invasion, typically one or more "PR", or pathogen related, proteins are expressed in response to invasion of a plant bacterial or fungal pathogen. One or more of the proteins involved in conferring resistance to pathogens 25can be contained within an artificial chromosome and therefore be expressed in a plant cell, in particular a whole transgenic plant as described herein. In addition, production of single-chain Fv recombinant antibodies in plants may extend the range of possibilities for the introduction of pathogen protection in crop plants (see, e.g., Tavladoraki et al. (1993) Nature 366:469-472).

It has been demonstrated that expression of a viral coat protein in a transgenic plant can impart resistance to infection of the plant by that virus and perhaps other closely related viruses (Cuozzo et a!., 1988. Hemenway 5et al., 1988, Abel et al., 1986). Expression of antisense genes targeted at essential viral functions may also impart resistance to viruses. For example, an antisense gene targeted at the gene responsible for replication of viral nucleic acid may inhibit replication and lead to resistance to the virus. Interference with other viral functions through the use of antisense genes 10also may increase resistance to viruses. Further, it may be possible to achieve resistance to viruses through other approaches, including, but not limited to the use of satellite viruses. Artificial chromosomes are ideally suited for carrying a multiplicity of these genes and DNA sequences which are useful for conferring a broad range of resistance to many pathogens. 15 Genes encoding so-called "peptide antibiotics," pathogenesis related (PR) proteins, toxin resistance, and proteins affecting host-pathogen interactions such as morphological may also be useful, particularly in conferring increased resistance to diseases caused by bacteria and fungi. Peptide antibiotics are polypeptide sequences which are inhibitory to growth 20of bacteria and other microorganisms. For example, the classes of peptides referred to as cepropins and magainins inhibit growth of may species of bacteria and fungi. Expression of PR proteins in monocotyledonous plants such as maize may be useful in conferring resistance to bacterial disease. These genes are induced following pathogen attack on a host plant and have 25been divided into at lease five classes of proteins (Bio. Linthorst, and Cornelissen, 1990). Included among the PR proteins are a-1, 3-glucanases, chitinases, and osmotin and other proteins that are believed to function in plant resistance to disease organisms. Other genes have been identified that have antifungal properties, e.g., UDA (stinging nettle lectin) and hevein (Broakaert et al., 1989; Barkai-Golan et a!., 1978). It is known that certain plant diseases are caused by the production of phytotoxins. Resistance to these diseases may be achieved through expression of a gene that encodes 5an enzyme capable of degrading or otherwise inactivating the phytotoxin. It also is contemplated that expression of genes that alter the interactions between the host plant and pathogen may be useful in reducing the ability of the disease organism to invade the tissues of the host plant, e.g., an increase in the waxiness of the leaf cuticle or other morphological 10characteristics. d. Environment or stress resistance Improvement of a plant's ability to tolerate various environmental stresses such as, but not limited to, drought, excess moisture, chilling, freezing, high temperature, salt, and oxidative stress, also can be effected 15through expression of genes therein. It is proposed that benefits may be realized in terms of increased resistance to freezing temperatures through the introduction of an "antifreeze" protein such as that of the Winter Flounder (Cutler et al., 1989) or synthetic gene derivatives thereof.

Improved chilling tolerance also may be conferred through increased 20expression of gIycerol-3-phosphate acetyltransferase in chloroplasts (Wolter et al., 1992). Resistance to oxidative stress in some crop species (often exacerbated by conditions such as chilling temperatures in combination with high light intensities) can be conferred by expression of superoxide dismutase (Gupta et al., 1993), and may be improved by glutathione 25reductase (Bowler et al., 1992). Such strategies may allow for tolerance to freezing in newly emerged fields as well as extending later maturity higher yielding varieties to earlier relative maturity zones.

It is contemplated that the expression of genes that favorably effect plant water content, total water potential, osmotic potential, and turgor will enhance the ability of the plant to tolerate drought. As used herein, the terms "drought resistance" and drought tolerance" are used to refer to a plant's increased resistance or tolerance to stress induced by a reduction in 5water availability, as compared to normal circumstances, and the ability of the plant to function and survive in lower-water environments. The expression of genes encoding for the biosynthesis of osmotically-active solutes, such as polyol compounds, may impart protection against drought. Within this class are genes encoding for mannitol-L-phosphate 10dehydrogenase (Lee and Saier, 1982) and trehalose-6-phosphate synthase {Kaasen et al., 1992). Through the subsequent action of native phosphatases in the cell or by the introduction and coexpression of a specific phosphatase, these introduced genes will result in the accumulation of either mannitol or trehalose, respectively, both of which have been well 15documented as protective compounds able to mitigate the effects of stress. Mannitol accumulation in transgenic tobacco has been verified and preliminary results indicate that plants expressing high levels of this metabolite are able to tolerate an applied osmotic stress (Tarczynski et aL, 1992, 1993).

Similarly, the efficacy of other metabolites in protecting either enzyme function (e.g., alanopine or propionic acid) or membrane integrity (e.g., alanopine) has been documented (Loomis eta/., 1989), and therefore expression of genes encoding for the biosynthesis of these compounds might confer drought resistance in a manner similar to or complimentary to 25mannitol. Other examples of naturally occurring matabolites that are osmotically active and/or provide some direct protective effect during drought and/or desiccation include fructose, erythritol (Coxson et a/., 1992), sorbitol, dulcitol (Karsten et al., 1992), glucosylglycerol (Reed et al., 1984; ErdMann et al., 1992), sucrose, stachyose (Koster arid Leopold, 1988: Blackman et al., 1992), raffinose (Bernal-Lugo and Leopold, 1992), proline (Rensburg et a!., 1993), glycine betaine, ononitol and pinitol (Vernon and Bohnert, 1992). Continued canopy growth and increased reproductive 5fitness during times of stress will be augmented by introduction and expression of genes such as those controlling the osmotically active compounds discussed above and other such compounds. Genes which promote the synthesis of an osmotically active polyol compound include genes which encode the enzymes mannitol-1-phosphate dehydrogenase, 10trehalose-6-phosphate synthase and myoinositol O-methyltransferase.

Artificial chromosomes can carry a multiplicity of genes to provide durable stress tolerance, for example, concomitant expression of proline and ketane and/or poly-ols.

It is contemplated that the expression of specific proteins also may 15increase drought tolerance under certain conditions or in certain crop species. These may include proteins such as Late Embryogenic Proteins (see Dure et ah, 1989). All three classes of LEAs have been demonstrated in maturing (i.e. desiccating) seeds. Within LEA proteins, the Type-ll (dehydrin-type) have generally been implicated in drought and/or desiccation 20tolerance in vegetative plant parts (i.e. Mundy and Chua, 1988: Piatkowski eta/., 1990: Yamaguchi-Shinozaki et al., 1992). Recently, expression of a Type-Ill LEA (HVA-1) in tobacco was found to influence plant height, maturity and drought tolerance (Fitzpatrick, 1993). In rice, expression of the HVA-1 gene influenced tolerance to water deficit and salinity (Xu et a/., 251996). Expression of structural genes from all three LEA groups may therefore confer drought tolerance. Other types of proteins induced during water stress include thiol proteases, aldolases and transmembrane transporters (Guerrero et al., 1999), which may confer various protective and/or repair-type functions during drought stress. It is also is contemplated that genes that effect lipid biosynthesis and hence membrane composition might also be useful in conferring drought resistance on the plant.

Many of these genes for improving drought resistance have 5complementary modes of action. Thus, combinations of these genes might have additive and/or synergistic effects in improving drought resistance in plants. Many of these genes also improve freezing tolerance (or resistance): the physical stresses incurred during freezing and drought are similar in nature and may be mitigated in similar fashion. Benefit may be conferred via 10constitutive expression of these genes, but the preferred means of expressing these genes may be through the use of a turgor-induced promoter (such as the promoters for the turgor-induced genes described in Guerrero et al., 1990 and Shagan et al., 1993 which are incorporated herein by reference). Spatial and temporal expression patterns of these genes may 15enable plants to better withstand stress.

It is proposed that expression of genes that are involved with specific morphological traits that allow for increased water extractions from drying soil would be of benefit. For example, introduction and expression of genes that alter root characteristics may enhance water uptake. It also is 20contemplated that expression of genes that enhance reproductive fitness during times of stress would be of significant value. For example, expression of genes that improve the synchrony of pollen shed and receptiveness of the female flower parts, i.e., silks, would be of benefit. In addition it is proposed that expression of genes that minimize kernel abortion 25during times of stress would increase the amount of grain to be harvested and hence be of value.

Given the overall role of water in determining yield, it is contemplated that enabling plants to utilize water more efficiently, through the introduction and expression of genes, will improve overall performance even when soil water availability is not limiting. By introducing genes that improve the ability of plants to maximize water usage across a full range of stresses relating to water availability, yield stability or consistency of yield 5performance may be realized. e. Plant agronomic characteristics Plants possessing desired traits that might, for example, enhance utility, processibility and commercial value of the organisms in areas such as the agricultural and ornamental plant industries may also be generated using lOartificial chromosomes in the same manner as described above for production of disease-resistant organisms. In such instances, the artificial chromosomes that are introduced into the organism or embryo contain DNA encoding gene products that serve to confer the desired trait in the organism.

For example, transgenic plants having improved flavor properties, stability and/or quality are of commercial interest. One possible method for generating such plants may include the expression of transgenes, e.g., genes encoding cystathionine gamma synthase (CGS), that result in increased free methionine levels (see, e.g., PCT Application publication no. 20WO 00/55303).

Two of the factors determining where crop plants can be grown are the average daily temperature during the growing season and the length of time between frosts. Within the areas where it is possible to grow a particular crop, there are varying limitations on the maximal time it is 25allowed to grow to maturity and be harvested. For example, a variety to be grown in a particular area is selected for its ability to mature and dry down to harvestable moisture content within the required period of time with maximum possible yield. Therefore, crops of varying maturities are developed for different growing locations. Apart from the need to dry down sufficiently to permit harvest, it is desirable to have maximal drying take place in the field to minimize the amount of energy required for additional drying post-harvest. Also, the more readily a product such as grain can dry 5down, the more time there is available for growth and kernel fill. Genes that influence maturity and/or dry down can be identified and introduced into plant lines using transformation techniques to create new varieties adapted to different growing locations or the same growing location, but having improved yield to moisture ratio at harvest. Expression of genes that are 10involved in regulation of plant development may be especially useful.

Genes that would improve standability and other plant growth characteristics may also be introduced into plants. Expression of new genes in plants which confer stronger stalks, improved root systems, or prevent or reduce ear droppage would be of great value to the farmer. Introduction and 15expression of genes that increase the total amount of photoassimilate available by, for example, increasing light distribution and/or interception would be advantageous. In addition, the expression of genes that increase the efficiency of photosynthesis and/or the leaf canopy would further increase gains in productivity. Expression of a phytochrome gene in crop 20plants may be advantageous. Expression of such a gene may reduce apical dominance, confer semidwarfism on a plant, and increase shade tolerance (U.S. Patent No. 5,268,526). Such approaches would allow for increased plant populations in the field. f. Nutrient utilization 25 The ability to utilize available nutrients may be a limiting factor in growth of crop plants. It may be possible to alter nutrient uptake, tolerate pH extremes, mobilization through the plant, storage pools, and availability for metabolic activities by the introduction of new agents. These modifications would allow a plant such as maize to more efficiently utilize available nutrients. An increase in the activity of, for example, an enzyme that is normally present in the plant and involved in nutrient utilization may increase the availability of a nutrient. An example of such an enzyme would 5be phytase. It is further contemplated that enhanced nitrogen utilization by a plant is desirable. Expression of a glutamate dehydrogenase gene in plants, e.g., E. coli gdhA genes, may lead to enhanced resistance to the herbicide glufosinate by incorporation of excess ammonia into glutamate, thereby detoxifying the ammonia. Gene expression may make a nutrient 10source available that was previously not accessible, e.g., an enzyme that releases a component of nutrient value from a more complex molecule, perhaps a macromolecule. Alternatively, artificial chromosomes can carry the multiplicity of genes governing nodulation and nitrogen fixation in legumes. The artificial chromosomes could be used to promote nodulation in 15non-legume species. g. Male sterility Male sterility is useful in the production of hybrid seed. Male sterility may be produced through gene expression. For example, it has been shown that expression of genes that encode proteins that interfere with 20development of the male inflorescence and/or gametophyte result in male sterility. Chimeric ribonuclease genes that express in the anthers of transgenic tobacco and oilseed rape have been demonstrated to lead to male sterility (Mariani et al., 1990). Other methods of conferring male sterility have been described, including gene encoding antisense RNA capable of 25causing male sterility (U.S. Patent Nos. 6,184,439, 6,191,343 and 5,728,926) and methods utilizing two genes to confer sterility, see, e.g., U.S. Patent No. 5,426,041.

A number of mutations were discovered in maize that confer cytoplasmic male sterility. One mutation in particular, referred to as T cytoplasm, also correlates with sensitivity to Southern corn leaf blight. A DNA sequence, designated TURF-13 (Levings, 1990), was identified that 5correlates with T cytoplasm. It is proposed that it would be possible through the introduction of TURF-13 via transformation, to separate male sterility from disease sensitivity. As it is necessary to be able to restore male fertility for breeding purposes and for grain production, it is proposed that genes encoding restoration of male fertility also may be introduced. 10 h. Improved nutritional content Genes may be introduced into plants to improve the nutrient quality or content of a particular crop. Introduction of genes that alter the nutrient composition of a crop may greatly enhance the feed or food value. For example, the protein of many grains is suboptimal for feed and food 15purposes especially when fed to pigs, poultry, and humans. The protein is deficient in several amino acids that are essential in the diet of these species, requiring the addition of supplements to the grain. Limiting essential amino acids may include lysine, methionine, tryptophan, threonine, valine, arginine, and histidine. Some amino acids become limiting only after 20corn is supplemented with other inputs for feed formulations. The levels of these essential amino acids in seeds and grain may be elevated by mechanisms which include, but are not limited to, the introduction of genes to increase the biosynthesis of the amino acids, increase the storage of the amino acids in proteins, or increase transport of the amino acids to the 25seeds or grain.

The protein composition of a crop may be altered to improve the balance of amino acids in a variety of ways including elevating expression of native proteins, decreasing expression of those with poor composition, changing the composition of native proteins, or introducing genes encoding entirely new proteins possessing superior composition.

The introduction of genes that alter the oil content of a crop plant may also be of value. Increases in oil content may result in increases in 5metabolizable-energy-content and density of seeds for use in feed and food. The introduced genes may encode enzymes that remove or reduce rate-limitations or regulated steps in fatty acid or lipid biosynthesis. Such genes may include, but are not limited to, those that encode acetyl-CoA carboxylase, ACP-acyltransferase, a-ketoacyl-ACP synthase, plus other well 10known fatty acid biosynthetic activities. Other possibilities are genes that encode proteins that do not possess enzymatic activity such as acyl-carrier proteins. Genes may be introduced that alter the balance of fatty acids present in the oil providing a more healthful or nutritive feedstuff. The introduced DNA also may encode sequences that block expression of 15enzymes involved in fatty acid biosynthesis, altering the proportions of fatty acids present in crops.

Genes may be introduced that enhance the nutritive value of the starch component of crops, for example by increasing, or in some cases decreasing, the degree of branching, resulting in improved utilization of the 20starch in livestock by delaying its metabolism. Additionally, other major constituents of a crop may be altered, including genes that affect a variety of other nutritive, processing, or other quality aspects. For example, pigmentation may be increased or decreased.

Feed or food crops may also possess insufficient quantities of 25vitamins, requiring supplementation to provide adequate nutritive value. Introduction of genes that enhance vitamin biosynthesis may be envisioned including, for example, vitamins A (e.g. rice with Vitamin A or golden rice), E, B12 choline, and the like. Mineral content may also be sub-optimal. Thus genes that affect the accumulation or availability of compounds containing phosphorus, sulfur, calcium, manganese, zinc, and iron among others would be valuable.

Numerous other examples of improvements of crops may be effected 5using the artificial chromosomes, with appropriate heterologous genes contained therein, in accordance with the methods and compositions provided herein. The improvements may not necessarily involve grain, but may, for example, improve the value of a crop for silage. Introduction of DNA to accomplish this might include sequences that alter lignin production 10such as those that result in the "brown midrib" phenotype associated with superior feed value for cattle.

In addition to direct improvements in feed or food value, genes also may be introduced which improve the processing of crops and improve the value of the products resulting from the processing. One use of crops is via 15wetmilling. Thus, genes that increase the efficiency and reduce the cost of such processing, for example, by decreasing steeping time may also find use. Improving the value of wetmilling products may include altering the quantity or quality of starch, oil, corn gluten meal, or the components of gluten feed. Elevation of starch may be achieved through the identification 20and elimination of rate limiting steps in starch biosynthesis or by decreasing levels of the other components of crops resulting in proportional increases in starch.

Oil is another product of wetmilling, the value of which may be improved by introduction and expression of genes. Oil properties may be altered to improve its performance in the production and use of cooking oil, shortenings, lubricants or other oil-derived products or improvements of its 5health attributes when used in the food-related applications. Fatty acids also may be synthesized which upon extraction can serve as starting materials for chemical syntheses. The changes in oil properties may be achieved by altering the type, level, or lipid arrangement of the fatty acids present in the oil. This in turn may be accomplished by the addition of 10genes that encode enzymes that catalyze the synthesis of new fatty acids and the lipids possessing them or by increasing levels of native fatty acids while possibly reducing levels of precursors. Alternatively, DNA sequences may be introduced which slow or block steps in fatty acid biosynthesis resulting in the increase in precursor fatty acid intermediates. Genes that 15might be added include desaturases, epoxidases, hydratases, dehydratases and other enzymes that catalyze reactions involving fatty acid intermediates. Representative examples of catalytic steps that might be blocked include the desaturations from stearic to oleic acid and oleic to linolenic acid resulting in the respective accumulations of stearic and oleic acids. Another 20example is the blockage of elongation steps resulting in the accumulation of C8 to C12 saturated fatty acids. i. Production of chemicals or biologicals Transgenic plants can be used as protein production systems to generate recombinant products ranging from industrial enzymes, viral antigens, vaccines, antibodies, human blood proteins, cytokines, growth factors, enkephalins, serum albumin and other proteins of clinical relevance 5and pharmaceuticals. For example, enzymes including a-amylase, glucanase, phytase and xylanase (see, Goddijn and Pen (1995) Trends Biotechnol. 13:379-387; Pen et al. (1992) Bio/Technology 70:292-296; Horvath et al. (2000) Proc. Natl. Acad. Sci. U.S.A. 97:1914-1919; and e.g., Herbers and Sonnewald (1996) in Transgenic Plants: A Production System 10for Industrial and Pharmaceutical Proteins" Owen and Pen Eds., John Wiley & Sons, West Sussex, England).

Examples of medically relevant proteins that may be produced in plants include surface antigens of viral pathogens, such as hepatitis B virus and transmissible gastroenteritis virus spike protein, for use in vaccines. 15The proteins thus produced may be isolated and administered through standard vaccine introduction methods or through the consumption of the edible transgenic plant as food which can be taken orally (see, e.g., U.S. Patent No. 6,136,320 and Mason et al. (1992) Proc. NatL Acad. Sci. U.S.A. 89:11745-11749). HIV, rhinovirus, malarial and rabies virus antigens are 20additional examples of that may be expressed in plants as candidate vaccines (see, e.g., Porta et aL (1994) Virol. 202:949-955; Turpen et al. (1995) Bio/Technology 73:53-57; and McGarvey et al. (1995) Bio/Technology 73:1484-1487). Antibodies may also be produced in plants, including, for example, a gene fusion encoding an antigen-binding single 25chain Fv protein (scFv) that recognizes the hapten oxazolone (Fiedler and Conrad (1995) Bio/Technology 73:1090-1093) and IgG (Ma et aL (1995) Science 268:716-719).

Examples of human biopharmaceuticais that may be expressed in plants include, but are not limited to, albumin (Sijmons et al. (1990)), enkephalins (Vandekerckhove et at. (1989) ), interferon-a (Zhu et at. (1994) and GM-CSF (Ganz et al. (1996) in Transgenic Plants: A Production System for Industrial and Pharmaceutical Proteins, Owen and Pen Eds., John Wiley 5& Sons, West Sussex, England, pp. 281-297; and Sardana et al. (1998) in Methods in Biotechnology, Vol. 3: Recombinant Proteins from Plants: Production and Isolation of Clinically Useful Compounds, Cunningham and Porter, Eds., Humana Press, New Jersey; pp. 77-87).

Transgenic plants producing these compounds are made possible by 10the introduction and expression of one or potentially many genes using the artificial chromosomes provided herein. The vast array of possibilities include, but are not limited to, any biological compound which is presently produced by any organism such as proteins, nucleic acids, primary and intermediary metabolites, carbohydrate polymers, enzymes for uses in l5bioremediation, enzymes for modifying pathways that produce secondary plant metabolites such as flavonoids or vitamins, enzymes that could produce pharmaceuticals and for introducing enzymes that could produce compounds of interest to the manufacturing industry such as specialty chemicals and plastics. The compounds may be produced by the plant, 20extracted upon harvest and/or processing, and used for any presently recognized useful purpose such as pharmaceuticals, fragrances, and industrial enzymes to name a few. Alternatively, plants produced in accordance with the methods and compositions provided herein may be made to metabolize certain compounds, such as hazardous wastes, thereby 25allowing bioremediation of these compounds. j. Non-protein-expressing sequences Nucleic acids may be introduced into plants that are designed to down-regulate or suppress a plant-encoded gene. A number of different means to achieve down regulation have been demonstrated in the art, 5including antisense RNA, ribozymes and co-suppression. The use of antisense RNA to suppress plant genes is described, for example, in U.S. Patent Nos. 4,801,540, 5,107,065 and 5,453,566. In such methods, an "antisense" gene is constructed that encodes an RNA that is complementary to the mRNA of a resident plant gene, such that expression of the antisense 10gene inhibits the translation of the mRNA of the resident plant gene. Thus, the activity of the resident gene is down-regulated.

An additional method of down regulating gene activities involves ribozymes, or catalytic hammerhead hairpin RNA structures. The use of ribozymes is described, for example, in U.S. Patent Nos. 4,987,071, 155,037,746, 5,116,742 and 5,354,855. These methods rely on the expression of small catalytic "hammerhead" RNA molecules that are capable of binding to and cleaving specific RNA sequences. Ribozymes designed to specifically recognize a resident plant mRNA can be used to cleave the mRNA and prevent its proper expression.

Essentially a more or less equivalent down-regulation control of gene activities by ribozymes and antisense can be achieved by adding additional copies of the gene to be regulated. The process is referred to as co-suppression and is described in, for example, U.S. Patent Nos. 5,034,323, 5,283,184 and 5,231,020.

Numerous plant genes may be targeted for down regulation. For example, a gene may be down-regulated that encodes an enzyme that catalyzes a reaction in a plant. Reduction of the enzyme activity may reduce or eliminate products of the reaction which include any enzymatically synthesized compound in the plant such as fatty acids, amino acids, carbohydrates, nucleic acids and the like. Alternatively, the protein may be a storage protein, such as zein, or a structural protein, the decreased expression of which may lead to changes in seed amino acid composition or 5plant morphological changes, respectively. The possibilities cited above are provided only by way of example and do not represent the full range of applications. (1). Antisense RNA Genes may be constructed, which when transcribed, produce 10antisense RNA that is complementary to all or part(s) of a targeted messenger RNA(s). The antisense RNA reduces production of the polypeptide product of the messenger RNA. The polypeptide product may be any protein encoded by the plant genome. The aforementioned genes will be referred to as antisense genes. An antisense gene may thus be 15introduced into a plant by transformation methods to produce a transgenic plant with reduced expression of a selected protein of interest. For example, the protein may be an enzyme that catalyzes a reaction in the plant. Reduction of the enzyme activity may reduce or eliminate products of the reaction which include any enzymatically synthesized compound in the plant 20such as fatty acids, amino acids, carbohydrates, nucleic acids and the like. Alternatively, the protein may be a storage protein, such as a zein, or a structural protein, the decreased expression of which may lead to changes in seed amino acid composition or plant morphological changes respectively. The possibilities cited above are provided only by way of example and do 25not represent the* full range of applications. ;(2.) Ribozymes ;Genes also may be constructed or isolated, which when transcribed, produce RNA enzymes (ribozymes) which can act as endoribonucleases and ;-183- ;catalyze the cleavage of RNA molecules with selected sequences. The cleavage of selected messenger RNAs can result in the reduced production of their encoded polypeptide products. These genes may be used to prepare transgenic plants which possess them. The transgenic plants may possess 5reduced levels of polypeptides including, but not limited to, the polypeptides cited above. ;Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-specific fashion. Ribozymes have specific catalytic domains that possess endonuclease activity (Kim and Cech, 1987; Gerlach et at., 1987; 10Forster and Symons, 1987). For example, a large number of ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phophoesters in an oligonucleotide substrate (Cech et aL, 1981; Michel and Westhof, 1990); Reinhold-Hurek and Shub, 1992). This specificity has been attributed to the requirement 15that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction. ;Ribozyme catalysis has primarily been observed as part of sequence-specific cleavage/ligation reactions involving nucleic acids (Joyce, 1989; ;Cech et a!., 1981). For example, U.S. Patent 5,354,855 reports that certain 20ribozymes can act as endonucleases with a sequence specificity greater than that of known ribonucleases and approaching that of the DNA restriction enzymes. ;Several different ribozyme motifs have been described with RNA cleavage activity (Symons, 1992). Examples include sequences from the 25Group I self splicing introns including Tobacco Ringspot Virus (Prody et aL, 1986), Avacado Sunblotch Viroid (Palukaitis et aL, 1979; Symons, 1981) and Lucerne Transient Streak Virus (Forster and Symons, 1987). Sequences from these and related viruses are referred to as hammerhead ribozyme ;-184- ;based on a predicted folded secondary structure. ;Other suitable ribozymes include sequences from RNase P with RNA cleavage activity (Yuan et aL, 1992; Yuan and Altman, 1994; U.S. Patents 5,168,053 and 5,624,824), hairpin ribozyme structures (Berzal-Herranz et 5aL, 1992; Chowrira et aL, 1993) and Hepatitis Delta virus based ribozymes (U.S. Patent 5,625,047). The general design and optimization of ribozyme directed RNA cleavage activity has been discussed in detail (Haselhoff and Gerlach, 1988; Symons, 1992; Chowrira et al., 1994; Thompson et aL, 1995). ;10 The other variable on ribozyme design is the selection of a cleavage site on a given target RNA. Ribozymes are targeted to a given sequence by virtue of annealing to a site by complementary base pair interactions. Two stretches of homology are required for this targeting. These stretches of homologous sequences flank the catalytic ribozyme structure defined above. 15 Each stretch of homologous sequence can vary in length from 7 to 15 nucleotides. The only requirement for defining the homologous sequences is that, on the target RNA, they are separated by a specific sequence which is the cleavage site. For a hammerhead ribozyme, the cleavage site is a dinucleotide sequence on the target RNA consisting of a uracil (U) followed 20by either an adenine, cytosine or uracil (A, C or U) (Perriman et aL, 1992; Thompson et al., 1995). The frequency of this dinucleotide occurring in any given RNA is statistically 3 out of 16. Therefore, for a given target messenger RNA of 1,000 bases, 187 dinucleotide cleavage sites are statistically possible. ;-185- ;Designing and testing ribozymes for efficient cleavage of a target RNA is a process well known to those skilled in the art. Examples of scientific methods for designing and testing ribozymes are described by Chowrira et al. (1994) and Lieber and Strauss (1995), each incorporated by reference. The identification of operative and preferred sequences 5for use in down regulating a given gene is simply a matter of preparing and testing a given sequence, and is a routinely practiced "screening" method known to those of skill in the art. ;(3.) Induction of gene silencing It also is possible that genes may be introduced to produce transgenic 10plants which have reduced expression of a native gene product by the mechanism of co-suppression. It has been demonstrated in tobacco, ;tomato, and petunia (Goring et al., 1991; Smith et aL, 1990; Napoli et aL, 1990; van der Krol et aL, 1990) that expression of the sense transcript of a native gene will reduce or eliminate expression of the native gene in a 15manner similar to that observed for antisense genes. The introduced gene may encode all or part of the targeting native protein but its translation may not be required for reduction of levels of that native protein. ;(4.) Non-RNA-expressing sequences ;-186- ;DNA elements including those of transposable elements such as Ds, Ac, or MU, may be inserted into a gene to cause mutations. These DNA elements may be inserted in order to inactivate (or activate) a gene and thereby "tag" a particular trait. In this instance the transposable element 5does not cause instability of the tagged mutation, because the utility of the element does not depend on its ability to move in the genome. Once a desired trait is tagged, the introduced DNA sequence may be used to clone the corresponding gene, e.g., using the introduced DNA sequence as a PCR primer together with PCR gene cloning techniques (Shapiro, 1983; 10Dellaporta et at., 1988). Once identified, the entire gene(s) for the particular trait, including control or regulatory regions where desired, may be isolated, cloned and manipulated as desired. The utility of DNA elements introduced into an organism for purposes of gene tagging is independent of the DNA sequence and does not depend on any biological activity of the DNA 15sequence, i.e., transcription into RNA or translation into protein. The sole function of the DNA element is to disrupt the DNA sequence of a gene. ;It is contemplated that unexpressed DNA sequences, including synthetic sequences, could be introduced into cells as proprietary "labels" of those cells and plants and seeds thereof. It would not be necessary for a 20label DNA element to disrupt the function of a gene endogenous to the host organism, as the sole function of this DNA would be to identify the origin of the organism. For example, one could introduce a unique DNA sequence into a plant and this DNA element would identify all cells, plants, and progeny of these cells as having arisen from that labeled source. It is 25proposed that inclusion of label DNAs would enable one to distinguish proprietary germplasm or germplasm derived from such, from unlabelled germplasm. ;-187- ;Another possible element which may be introduced is a matrix attachment region element (MAR), such as the chicken lysozyme A element (Stief, 1989), which can be positioned around an expressible gene of interest to effect an increase in overall expression of the gene and diminish 5position dependent effects upon incorporation into the plant genome (Stief et aL, 1989; Phi-Van et aL, 1990). Sequences such as MARs can be included on the artificial chromosome to enhance gene expression. ;3. Transgenic models for evaluation of genes and discovery of new traits ;10 Of significant interest is the use of plants and plant cells containing artificial chromosomes for the evaluation of new genetic combinations and discovery of new traits. Artificial chromosomes, by virtue of the fact that they can contain significant amounts of DNA can also therefore encode numerous genes and accordingly a multiplicity of traits. It is contemplated 15here that artificial chromosomes, when formed from one plant species, can be evaluated in a second plant species. The resultant phenotypic changes observed, for example, can indicate the nature of the genes contained within the DNA containing the artificial chromosome, and hence permit the identification of new genetic activities. Artificial chromosomes containing 20euchromatic DNA or partially containing euchromatic DNA can serve as a valuable source of new traits when transferred to an alien plant cell environment. For example, it is contemplated that artificial chromosomes derived from dicot plant species can be introduced into monocot plant species by transferring a dicot artificial chromosome, the dicot artificial 25chromosome containing a region of euchromatic DNA containing expressed genes. ;The artificial chromosomes can be generated or manipulated in such a fashion that a large region of naturally occurring plant DNA becomes incorporated into the artificial chromosome. This allows the artificial ;-188- ;chromosome to contain new genetic activities and hence carry new traits. For example, an artificial chromosome can be introduced into a wild relative of a crop plant under conditions whereby a portion of the DNA present in the chromosomes of the wild relative is transferred to the artificial 5chromosome. After isolation of the artificial chromosome, this naturally occurring region of DNA from the wild relative, now located on the artificial chromosome can be introduced into the domesticated crop species and the genes encoded within the transferred DNA expressed and evaluated for utility. New traits and gene systems can be discovered in this fashion. 10 Artificial chromosomes modified to recombine with plant DNA offer many advantages for the discovery and evaluation of traits in different plant species. When the artificial chromosome containing DNA from one plant species is introduced into a new plant species, new traits and genes can be introduced. This use of an artificial chromosome allows for the ability to 15overcome the sexual barrier that prevents transfer of genes from one plant species to another species. Using artificial chromosomes in this fashion allows for many potentially valuable traits to be identified including traits that are typically found in wild species. Other valuable applications for artificial chromosomes include the ability to transfer large regions of DNA 20from one plant species to another, DNA encoding potentially valuable traits such as altered oil, carbohydrate or protein composition, multiple genes encoding enzymes capable of producing valuable plant secondary metabolites, genetic systems encoding valuable agronomic traits such as disease and insect resistance, genes encoding functions that allow 25association with soil bacterium such as growth promoting bacteria or nitrogen fixing bacteria, or genes encoding traits that confer freezing, drought or other stress tolerances. In this fashion, artificial chromosomes can be used to discover regions of plant DNA that encode valuable traits. ;-189- ;The artificial chromosome can also be designed to allow the transfer and subsequent incorporation of these valuable traits now located on the artificial chromosome into the natural chromosomes of a plant species. In this fashion the artificial chromosomes can be used to transfer large regions 5of DNA encoding traits normally found in one plant species into another plant species. In this fashion, it is possible to derive a plant cell that no longer needs to carry an artificial chromosome to posses the new trait. ;Thus the artificial chromosome would serve as the transfer mechanism to permit the formation of plants with greater degree of genetic diversity. 10 An artificial chromosome can be designed in a variety of ways to accomplish the afore-mentioned purposes. An artificial chromosome can be modified to contain sequences that promote homologous recombination within plant cells, or be modified to contain a genetic system that functions as a site-specific recombination system. For example, the DNA sequence of 15Arabidopsis is now known. To construct an artificial chromosome capable of recombining with a specific region of Arabidopsis DNA, a sequence of Arabidopsis DNA, normally located near a chromosomal location encoding genes of potential interest can be introduced into an artificial chromosome by methods provided herein. It may be desirable to include a second region 20of DNA within the artificial chromosome that provides a second flanking sequence to the region encoding genes of potential interest, to promote a double recombination event which would ensure transfer of the entire chromosomal region encoding genes of potential interest to the artificial chromosome. The modified artificial chromosome, containing the DNA 25sequences capable of homologous recombination region can then be introduced into Arabidopsis cells and the homologous recombination event is selected. ;It is convenient to include a marker gene to allow for the selection of ;-190- ;a homologous recombination event. The marker gene is preferably inactive unless activated by an appropriate homologous recombination event. For example, US 5,272,071, describes a method where an inactive plant gene is activated by a recombination event such that desired homologous 5recombination events can be easily scored. Similarly, US 5,501,967 describes a method for the selection of homologous recombination events by activation of a silent selection gene first introduced into the plant DNA, the gene being activated by an appropriate homologous recombination event. ;Both of these methods can be applied to enable a selective process to be lOincluded in to select for recombination between an artificial chromosome and a plant chromosome. Once the homologous recombination event is detected, the artificial chromosome, once selected, is isolated and introduced into a recipient cell, for example, tobacco, corn, wheat or rice, and the expression of the newly introduced DNA sequences evaluated. 15Selection of recombinant events can take place in cell culture, or following seed formation and screening of seedling plants or seed itself. ;Phenotypic changes in the recipient plant cells containing the artificial chromosome, or in regenerated plants containing the artificial chromosome, allows for the evaluation of the nature of the traits encoded by the genes of 20interest, for example, Arabidopsis DNA, under conditions naturally found in plant cells, including the naturally occurring arrangement of DNA sequences responsible for the developmental control of the traits in the normal chromosomal environment. ;Traits such as durable fungal or bacterial disease resistance, new oil 25and carbohydrate compositions, valuable secondary metabolites such as phytosterols, flavonoids, efficient nitrogen fixation or mineral utilization, resistance to extremes of drought, heat or cold are all found within different populations of plant species and are often governed by multiple genes. The ;-191- ;use of single gene transformation technologies does not permit the evaluation of the multiplicity of genes controlling many valuable traits. Thus, incorporation of these genes into artificial chromosomes allows the rapid evaluation of the utility of these genetic combinations in heterologous plant 5species. ;The large scale order and structure of the artificial chromosome provides a number of unique advantages in screening for new utilities or new phenotypes within heterologous plant species. The size of new DNA that can be carried by an artificial chromosome can be millions of base pairs of DNA, 10representing potentially numerous genes that may have different or new utility in a heterologous plant cell. The artificial chromosome is a "natural" environment for gene expression, the problems of variable gene expression and silencing seen for genes transferred by random insertion into a genome should not be observed. Similarly, there is no need to engineer the genes for 15expression, and the genes inserted would not need to be recombinant genes. Thus, transferred genes are fully expected to be expressed in the typical temporal and spatial fashion as observed in the species from where the genes were initially isolated. A valuable feature for these utilities is the ability to isolate the artificial chromosomes and to further isolate, manipulate and 20introduce into other cells artificial chromosomes carrying unique genetic compositions. ;Thus, the use of artificial chromosomes and homologous recombination in plant cells can be used to isolate and identify many valuable crop traits. In addition to the use of artificial chromosomes for the isolation and testing of 25large regions of naturally occurring DNA, methods for the use of artificial chromosomes and cloned DNA are also contemplated. Similar to that described above, artificial chromosomes can be used to carry large regions of cloned DNA, including that derived from other plant species. ;-192- ;The ability to incorporate DNA elements into artificial chromosomes as they are being formed allows for the development of artificial chromosomes specifically engineered as a platform for testing of new genetic combinations, or "genomic" discoveries for model species such as Arabidopsis. Specific 5"recombinase" systems can be used in plant cells to excise or re-arrange genes; these same systems can be used to derive new gene combinations contained on an artificial chromosome. In this regard, it is contemplated that the use of site specific recombination sequences can have considerable utility in developing artificial chromosomes containing DNA sequences recognized by 10recombinase enzymes and capable of accepting DNA sequences containing same. The use of site-specific recombination as a means to target an introduced DNA to a specific locus has been demonstrated in the art and such methods can be employed. The recombinase systems can also be used to transfer the cloned DNA regions contained within the artificial chromosome to I5the naturally occurring plant chromosomes. ;Many site specific recombinases have been described in the literature (Kilby et al., Trends in Genetics, 9(12): 413-418, 1993). Among these are: an activity identified as R encoded by the pSR1 plasmid of Zygosaccharomyes rouxii, FLP encoded for the 2im circular plasmid from Saccharomyces lOcerevisiae and Cre-lox from the phage P1. ;The integration function of site specific recombinases is contemplated as a means to assist in the derivation of genetic combinations on artificial chromosomes. In order to accomplish this, it is contemplated that a first step of introducing site-specific recombinase sites into the genome of a plant cell in 25an essentially random manner is conducted, such that the plant cell has one or more site-specific recombinase recognition sequences on one or more of the plant chromosomes. An artificial chromosome is then introduced into the pant cell, the artificial chromosome engineered to contain a recombinase ;-193- ;recognition site capable of being recognized by a site specific recombinase. Optionally a gene encoding a recombinase enzyme is also included, preferably under the control of an inducible promoter. Expression of the site specific recombinase enzyme in the plant cell, either by induction of a inducible 5recombinase gene, or transient expression of a recombinase sequence causes a site-specific recombination event to take place, leading to the insertion of a region of the plant chromosomal DNA containing the recombinase recognition site into the recombinase recognition site of the artificial chromosome, forming an artificial chromosome containing plant chromosomal DNA. The lOartificial chromosome can be isolated and introduced into a heterologous host, preferably a plant host, and expression of the newly introduced plant chromosomal DNA can be monitored and evaluated for desirable phenotypic changes. Accordingly, carrying out this recombination with a population of plant cells wherein the chromosomally located recombinase recognition site is 15randomly scattered throughout the chromosomes of the plant can lead to the formation of a population of artificial chromosomes, each with a different region of plant chromosomal DNA, each representing a new genetic combination. ;This particular method involves the precise site-specific insertion of 20chromosomal DNA into the artificial chromosome. This precision has been demonstrated in the art. For example, Fukushige and Sauer (Proc. Natl. Acad. Sci. USA, 89:7905-7909, 1992) demonstrated that the Cre-Iox homologous recombination system could be successfully employed to introduce DNA into a predefined locus in a chromosome of mammalian cells. 25ln this demonstration a promoter-less antibiotic resistance gene modified to include a /ox sequence at the 5' end of the coding region was introduced into CHO cells. Cells were re-transformed by electroporation with a plasmid that contained a promoter with a lox sequence and a transiently expressed Cre ;-194- ;recombinase gene. Under the conditions employed, the expression of the Cre enzyme catalyzed the homologous recombination between the lox site in the chromosomally located promoter-less antibiotic resistance gene and the lox site in the introduced promoter sequence leading to the formation of a 5functional antibiotic resistance gene. The authors demonstrated efficient and correct targeting of the introduced sequence, 54 of 56 lines analyzed corresponded to the predicted single copy insertion of the DNA due to Cre catalyzed site specific homologous recombination between the lox sequences. ;10 The use of the same Cre-lox system has been demonstrated in plants (Dale and Ow, Gene 91:79-85, 1995) to specifically excise, delete or insert DNA. The precise event is controlled by the orientation of lox DNA sequences, in cis the lox sequences direct the Cre recombinase to either delete (/ox sequences in direct orientation) or invert (lox sequences in inverted 15orientation) DNA flanked by the sequences, while in trans the /ox sequences can direct a homologous recombination event resulting in the insertion of a recombinant DNA. Accordingly a lox sequence may be first added to a genome of a plant species capable of being transformed and regenerated to a whole plant to serve as a recombinase target DNA sequence for 20recombination with an artificial chromosome. The lox sequence may be optimally modified to further contain a selectable marker which is inactive but can be activated by insertion of the lox recombinase recognition sequence into the artificial chromosome. ;A promoterless marker gene or selectable marker gene linked to the 25recombinase recognition sequence, which is first inserted into the chromosomes of a plant cell can be used to engineer a platform chromosome. A promoter is linked to a recombinase recognition site, in an orientation that allows the promoter to control the expression of the marker or selectable ;-195- ;marker gene upon recombination within the artificial chromosome. Upon a site-specific recombination event between a recombinase recognition site in a plant chromosome and the recombinase recognition site within the introduced artificial chromosome, a cell is derived with a recombined artificial 5chromosome, the artificial chromosome containing an active marker or selectable marker activity that permits the identification and or selection of the ceil. ;The artificial chromosomes can be transferred to other plant species and the functionality of the new combinations tested. The ability to conduct lOsuch an inter-chromosomal transfer of sequences has been demonstrated in the art. For example, the use of the Cre-lox recombinase system to cause a chromosome recombination event between two chromatids of different chromosomes has been shown ;Any number of recombination systems may be employed (see, U.S. 15provisional application Serial No. 10/161,403 filed the same day herewith). Such systems include, but are not limited to, bacterially derived systems such as the Int/aff system of phage lambda and the GinIgix system. ;More than one recombination system may be employed, including, for example, one recombinase system for the introduction of DNA into an artificial 20chromosome, and a second recombinase system for the subsequent transfer of the newly introduced DNA contained within an artificial chromosome into the naturally occurring chromosome of a second plant species. The choice of the specific recombination system used will be dependent on the nature of the modification contemplated. ;25 By having the ability to isolate an artificial chromosome and in particular artificial chromosomes containing plant chromosomal DNA introduced via site-specific recombination and re-introduce the chromosome into other cells, particularly plant cells, these new combinations can be ;-196- ;evaluated in different crop species without the need to first isolate and modify the genes, or carry out multiple transformations or gene transfers to achieve the same combination isolation and testing combinations of the genes in plants. The use of a site specific recombinase and artificial chromosomes also Sallows the convenient recovery of the plant chromosomal region into other recombinant DNA vectors and systems for manipulation and study. ;The artificial chromosomes can be engineered as platforms to accept large regions of cloned DNA, such as that contained in Bacterial Artificial Chromosomes (BACs) or Yeast Artificial Chromosomes (YACs). It is further 10contemplated, that as a result of the typical structure of amplification-based artificial chromosomes, such as, for example, SATACS (or ACes), containing tandemly repeated DNA blocks, that more than cloned DNA sequence can be introduced by recombination processes. In particular, recombination within a predefined region of the tandemly repeated DNA within the artificial 15chromosome provides a mechanism to "stack" numerous regions of cloned DNA, including large regions of DNA contained within BACs or YACs clones. Thus, multiple combinations of genes can be introduced onto artificial chromosomes and these combinations tested for functionality. In particular, it is contemplated that multiple YACs or BACs can be stacked onto an artificial 20chromosomes, the BACs or YACs containing multiple genes of complex pathways or multiple genetic pathways. The BACs or YACs are typically selected based on genetic information available within the public domain, for example from the Arabidopsis Information Management System (http://aims.cps.msu.edu/aims/index.html) or the information related to the 25plant DNA sequences available from the Institute for Genomic Research (http://www.tigr.org) and other sites known to those skilled in the art. Alternatively, clones can be chosen at random and evaluated for functionality. ;It is contemplated that combinations providing a desired phenotype can be ;-197- ;identified by isolation of the artificial chromosome containing the combination and analyzing the nature of the inserted cloned DNA. ;In another embodiment of the methods provided herein for discovering genes associated with plant traits, the artificial chromosome used to transfer 5plant DNA to a host cell for evaluation therein will contain large regions of plant DNA, in particular plant euchromatin, as a result of the process by which the artificial chromosome is produced. In particular, the artificial chromosome may be an amplification-based artificial chromosome, including, but not limited to: (1) a minichromosome arising from breakage of a dicentric chromosome, 10(2) an artificial chromosome containing one or more regions of repeating nucleic acid units wherein the repeat region(s) contain substantially equivalent amounts of euchromatic and heterochromatic nucleic acid, (3) an artificial chromosome containing one or more regions of repeating nucleic acid units wherein the repeat region(s) is made up predominantly of euchromatic DNA or 15contains about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than 90% euchromatic DNA, (4) an artificial chromosome containing one or more regions of repeating nucleic acid units wherein the artificial chromosome is made up of substantially equivalent amounts of heterochromatin and euchromatin, (5) an artificial chromosome that contains 20one or more regions of repeating nucleic acid units having common nucleic acid sequences that represent euchromatic and heterochromatic nucleic acid and (6) a sausage-like structure that contains a portion or all of a euchromatin-containing arm of a plant chromosome. ;In these methods for discovering genes associated with plant traits, 25because the artificial chromosome used to transfer plant DNA to a host cell for evaluation therein is generated to already contain large amounts of plant DNA, in particular plant euchromatin, there is no need to introduce plant euchromatin into the artificial chromosomes, by homologous or site-specific ;-198- ;recombination. ;4. Use of artificial chromosomes for preparation and screening of libraries ;Since large fragments of DNA can be incorporated into artificial 5chromosomes (ACs), they are well-suited for use as cloning vehicles that can accommodate entire genomes in the preparation of genomic DNA libraries, which then can be readily screened for functionality as described above or for specific gene sequences for further modification and study. For example, it is possible to use artificial chromosomes to prepare artificial chromosome 10libraries containing plant genomic DNA library useful in the identification and isolation of functional DNA components such as genes, centromeric DNA and telomeric DNA from a variety of different species of plants. ;The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention. 15 Example 1 ;Generation of Arabidopsis protoplasts ;Plant protoplasts are typically generated from plant cells following standard techniques (for example, Maheshwari et a!., Crit. Rev. Plant Sci. 74:149-178, 1995; Ramulu et al., Methods in Molecular Biology 111 20227-242, 1999). Typically plant protoplasts are prepared from fresh plant tissue, e.g., leaf, or can be prepared by converting cell suspension cultures to protoplasts by removal of the cell walls enzymatically. For production of Arabidopsis protoplasts, the methods of Karesh et al. (Plant Cell Reports 9: 575-578, 1991) and Mathur et al. (Plant Cell Reports 14:21-226, 1995) were 25used to generate Arabidopsis suspension cultures by modifications thereof as described below. These cells were maintained in liquid culture and subcultured as required, usually between 7 and 10 days in culture. ;Establishment of suspension cultures ;Cell suspension cultures derived from root callus of Arabidopsis thaliana ;-199- ;cv. Columbia, RLD and Landsburg I erecta'were used. Calli were induced from roots of 3 week-old seedlings on callus induction medium containing MS basic media (Murashige and Skoog (1962) Physiol. Plant 15:473-497) with 3% sucrose, 0.5mg/l naphthalene acetic acid (NAA), 0.05 mg/l Kinetin (Sigma 5Aldrich Canada). The cell suspension cultures were grown from the calli in liquid callus induction medium at 22°C with shaking at 120 rpm. They were subcultured every 7 days. ;Generation of protoplasts ;-200- ;One gram of 4-5 day-old suspension culture was incubated in 6 ml enzyme solution containing 1% Cellulase 'Onozuka' R-10 and 0.25% ;Macerozyme R-10 in 35 g/l CaCI2-2H20 (Hartmann et al. (1998) Plant Mol. Biol. 36:741 -754) and incubated at 22°C in the dark with shaking at 70 rpm 5for 15 h. The protoplast mixture was poured through a 100 im nylon mesh sieve and centrifuged at 250xg for 5 min. The protoplasts were washed with ;35 g/l CaCI2-2H20 and resuspended in 10 ml floating medium containing B5 medium (Gamborg et al. (1968) Exp. Cell Res. 50:151-158) with 144 g/l sucrose and 1 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D). The protoplasts 10were centrifuged at 80xg for 10 min, collected at the interface and used immediately for transfection. ;Example 2 ;Generation of Tobacco Mesophyll Protoplasts ;-201- ;Mesophyll protoplasts were generated from leaves of sterile plantlets of N. tabacum cv. Xanthi. The plantlets were grown aseptically on MSO medium (MS basal media, 3% sucrose, 0.05% morpholinoethanesulfonic acid (MES), ;1.0 mg/l benzyl adenine (BA), 0.1 mg/l NAA and 0.8% agar, pH 5.8) at 22°C 5under a 16/8 h photoperiod (see also Bilang et al. (1994) Plant Molecular Biology Manual A1A-6). Fully expanded leaves (2x4 cm) were cut in half, the main vein removed and the upper epidermis scored with parallel cuts. Leaf pieces were immersed in 6 ml enzyme solution containing 1.2% Cellulase xOnozuka' R-10 and 0.4% Macerozyme R-10 in K4 medium (Nagy and Maliga ;10(1976) Z. Pflanzenpysiol. 78:453-455) and incubated at 22°C for 15 h without shaking. The protoplasts were purified by pouring through a 100 im nylon mesh sieve. Suspension of protoplasts was carefully overlayed with 1 ml W5 solution (Bilang et al. (1994) Plant Molecular Biology Manual A1A-Q) and centrifuged at 80xg for 10 min. Protoplasts were then resuspended in W5 ;15solution at a density of 1 x 106 protoplasts/ml and stored at 4°C for 1 to 2 hours prior to treatment, for example, DNA uptake or chromosome transfer. ;Example 3 ;Production of Tobacco Protoplasts from Suspension Cultures ;Tobacco BY-2 protoplasts are prepared from suspension cultures according 20to the method of Nagata et al. [(1981) Molecular and General Genetics, 784:161-165]. ;Example 4 ;Generation of Brassica Hypocotyl Protoplasts ;Genotypes of Brassica napus, B. oleracea, B. juncea and B. carinata 25may be used to generate protoplasts. Seeds of Brassica napus were surface-sterilized (for 2 min with 70% ethanol, then for 20 min with 2.4% sodium hypochlorite containing one drop of Tween 20 per 100 ml). Seeds were rinsed thoroughly with sterile distilled water and grown aseptically on ;-202- ;autoclaved germination medium (half-strength basal Murashige and Skoog's medium (MS), 1% sucrose, 0.8% agar, pH 5.8). Unless otherwise indicated, the protoplast generation procedures were performed aseptically and solutions and media were filter-sterilized. Alternatively, protoplasts can be generated 5and cultured successfully from different explants using various protocol modifications (for example, Kao et al. (1991) Plant Science 75:63-72; Kao et aL (1990) Plant Cell Rep. 9:311-315; Kao and Seguin-Swartz (1987) Plant CellTiss. Org. Cult. 10:79-90; Kao (1977) Mol. Gen. Genet. 150:225-230). ;Generation of Hypocotyl Protoplasts 10 Hypocotyls were excised from 4 or 5 day-old seedlings grown aseptically in the dark with or without light exposure for a few hours prior to use. The explants were cut transversely into 2-5 mm pieces and incubated in enzyme solution (salts, vitamins and organic acids of Kao's medium (Kao ;(1977) Mol. Gen. Genet 150:225-230), 0.4 g/l CaCI2-2H20, 13% sucrose, 151% Cellulase'Onozuka R10', 0.1% Pectolyase Y23, pH 5.6) in petri dishes, in darkness, without agitation for 14-18 hours, then with agitation on a rotary shaker (ca. 50 rpm) for 15-30 min. ;The mixture was filtered through a 63 im nylon screen into centrifuge tubes, and an equal volume of 17.5% sucrose was added to each tube. 20Following centrifugation (ca. 100xg, 8 min), the protoplast band that formed at the top of each tube was collected. Protoplasts were washed 3 times by resuspension in wash solution [solution W5 of Menczel and Wolfe (1984, Plant Cell Rep 3:196-198) at a reduced strength (0.8X)] followed by centrifugation at 100xg for 3-5 min and discarding the supernatant. 25 Protoplasts were cultured in Kao's medium containing the salts, vitamins and organic acids with 30 g/l sucrose, 68.4 g/l glucose, 0.5 mg/l NAA, 0.5 mg/l BA, 0.5 mg/l 2,4-D, pH 5.7, at a density of 1 X 105 per ml and incubated at 25°C, 16 h photoperiod, in dim fluorescent light (25 iEm"2 s"1). ;-203- ;After 5-8 days in culture, 1-1.5 ml of feeder medium containing the above medium except with 55.8 g/l glucose instead of 68.4 g/l, were added to each dish, and the dishes were placed under brighter fluorescent light (50 iEm 2 s"1). At about 14 days, 1-2 ml of medium were removed from each dish, and 52-3 ml of feeder medium containing basal B5 medium (Gamborg et at. (1968) Exp. Cell Res. 50:151-158), 3% sucrose, 3.8% glucose, 0.5 mg/l BA, 0.5 mg/l NAA, and 0.5 mg/l 2,4-D, pH 5.7, were added. At about 21 days, if microcolonies have not yet formed, the cultures can be fed with the last feeder medium except with 2.2% glucose instead of 3.8%. Protoplast 10cultures can be washed when necessary by adding new feeder medium, gently swirling petri dishes, allowing cells to settle, removing most of the supernatant and adding fresh medium to the dishes. ;At 3-5 weeks, microcolonies were embedded with medium containing a 1:1 mixture of the last feeder medium and proliferation medium which 15contains the components of the feeder medium with 0.9% glucose and 1.6% agarose to make a concentration of 0.8% in the final mixture. Cultures were incubated as described above in bright fluorescent light (80-100 iEm"2 s"1). After 10 days-2 weeks, green colonies were plated onto the regeneration medium. ;20 Example 5 ;Preparation of a Transformation Vector Useful for the Induction of Plant Artificial Chromosome Formation ;Plant artificial chromosomes (PACs) can be generated by introducing nucleic acid, such as DNA, which can include an amplification-inducing DNA 25and/or a targeting DNA, for example rDNA or lambda DNA, into a plant cell, allowing the cell to grow, and then identifying from among the resulting cells those that include a chromosome with a structure that is distinct from that of any chromosome that existed in the cell prior to introduction of the nucleic ;-204- ;acid. The structure of a PAC reflects amplification of chromosomal DNA, for example, segmented, repeat region-containing and heterochromatic structures. It is also possible to select cells that contain structures that are precursors to PACs, for example, chromosomes containing more than one centromere 5and/or fragments thereof, and culture and/or manipulate them to ultimately generate a PAC within the cell. ;In the method of generating PACs, the nucleic acid can be introduced into a variety of plant cells. The nucleic acid can include targeting DNA and/or a plant expressible DNA encoding one or multiple selectable markers (e.g., 10DNA encoding bialophos (bar) resistance) or scorable markers (e.g., DNA encoding GFP). Examples of targeting DNA include, but are not limited to, N. tabacum rDNA intergenic spacer sequence (IGS) and Arabidopsis rDNA such as the 18S, 5.8S, 26S rDNA and/or the intergenic spacer sequence. The DNA can be introduced using a variety of methods, including, but not limited to IBAgrobacterium-mediated methods, PEG-mediated DNA uptake and electroporation using, for example, standard procedures according to Hartmann et al [(1998) Plant Molecular Biology 36:741]. The cell into which such DNA is introduced can be grown under selective conditions and can initially be grown under non-selective conditions and then transferred to 20selective media. The cells or protoplasts can be placed on plates containing a selection agent to grow, for example, individual calli. Resistant calli can be scored for scorable marker expression. Metaphase spreads of resistance cultures can be prepared, and the metaphase chromosomes examined by FISH analysis using specific probes in order to detect amplification of regions of the 25chromosomes. Cells that have artificial chromosomes with functioning centromeres or artificial chromosomal intermediate structures, including, but not limited to, dicentric chromosomes, formerly dicentric chromosomes, minichromosomes, heterochromatin structures (e.g. sausage chromosomes), ;-205- ;and stable self-replicating artificial chromosomal intermediates as described herein, are identified and cultured. In particular, the cells containing self-replicating artificial chromosomes are identified. ;The DNA introduced into a plant cell for the generation of PACs can be 5in any form, including in the form of a vector. An exemplary vector for use in methods of generating PACs can be prepared as follows. ;For the production of artificial chromosomes, plant transformation vectors, as exemplified by pAglla and pAgllb, containing a selectable marker, a targeting sequence, and a scorable marker were constructed using 10procedures well known in the art to combine the various fragments. The vectors can be prepared using vector pAgl as a base vector and inserting the following DNA fragments into pAgl: DNA encoding a-glucoronidase under the control of the nopaline synthase (NOS) promoter fragment and flanked at the 3' end by the NOS terminator fragment, a fragment of mouse satellite 15DNA and an N. tabacum rDNA intergenic spacer sequence (IGS). In constructing plant transformation vectors, vector pAg2 can also be used as the base vector. ;1. Construction of pAG1 ;Vector pAgl (SEQ. ID. NO: 1; see Figure 1) is a derivative of the 20CAMBIA vector named pCambia 3300 (Center for the Application of Molecular Biology to International Agriculture, i.e., CAMBIA, Canberra, Australia; www.cambia.org), which is a modified version of vector pCambia 1300 to which DNA from the bar gene conferring resistance to phosphinothricin has been added. The nucleotide sequence of pCambia 3300 25is provided in SEQ. ID. NO: 2. pCambia 3300 also contains a lacZ alpha sequence containing a polylinker region. ;pAgl was constructed by inserting two new functional DNA fragments into the polylinker of pCambia 3300: one sequence containing an attB site and ;-206- ;a promoterless zeomycin resistance-encoding DNA flanked at the 3' end by a SV40 polyA signal sequence, and a second sequence containing DNA from the hygromycin resistance gene (hygromycin phosphotransferase) conferring resistance to hygromycin for selection in plants. Although the zeomycin-SV40 5polyA signal fusion is not expected to provide the basis for zeomycin selection in plant cells, it can be activated in mammalian cells by insertion of a functional promoter element into the attB site by site-specific recombination catalyzed by the Lambda att integrase. Thus, the inclusion of the attB-zeomycin sequences allows for evaluation of functionality of plant artificial lOchromosomes in mammalian cells by activation of the zeomycin resistance-encoding DNA, and provides an att site for further insertion of new DNA sequences into plant artificial chromosomes formed as a result of using pAgl for plant transformation. The second functional DNA fragment allows for selection of plant cells with hygromycin. Thus, pAgl contains DNA from the 15bar gene confering resistance to phosphinothricin, DNA from the hygromycin resistance gene, both resistance-encoding DNAs under the control of a separate cauliflower mosaic virus (CaMV) 35S promoter, and the attB-promoterless zeomycin resistance-encoding DNA. ;pAgl is a binary vector containing Agrobacterium right and left T-DNA 20border sequences for use in Agrobacterium-med\aX.edi transformation of plant cells or protoplasts with the DNA located between the border sequences. pAgl also contains the pBR322 Ori for replication in E.coli. pAgl was constructed by ligating /7/m/lll/Psfl-digested p3300attBZeo with Hind\\\IPst\-digested pBSCaMV35SHyg as follows (see Figure 2). 25 a. Generation of p3300attBZeo ;-207- ;Plasmid pCambia 3300 was digested with Psfl/Ec/136 II and ligated with Psfl/Sful-digested pLITattBZeo (the nucleotide sequence of pLITattBZeo is provided in SEQ. ID. NO: 19 to generate p3300attBZeo which contains an attB site, a promoterless zeomycin resistance-encoding DNA flanked at the 3' 5end by a SV40 polyA signal, and a reconstructed Psfl site. ;b. Generation of pBSCaMV35SHyg ;A DNA fragment containing DNA encoding hygromycin phosphotransferase flanked by the CaMV 35S promoter and the CaMV 35S polyA signal sequence was obtained by PCR amplification of plasmid pCambia 101302 (GenBank Accession No. AF234298 and SEQ. ID. NO: 3). The primers used in the amplification reaction were as follows: ;CaMV35SpolyA: ;5'-CTGAATTAACGCCGAATTAATTCGGGGGATCTG-3' SEQ. ID. NO: 4 CaMV35Spr: ;155'-CTAGAGCAGCTTGCCAACATGGTGGAGCA-3' SEQ. ID. NO: 5 The 2100-bp PCR fragment was ligated with fcoRV-digested pBluescript II SK+ (Stratagene, La Jolla, CA, U.S.A.) to generate pBSCaMV35SHyg. c. Generation of pAgl ;-208- ;To generate pAgl, pBSCaMV35SHyg was digested with Hind\\\fPst\ and ligated with Hind\\\/Pst\-d\gested p3300attBZeo. Thus, pAgl contains the pCambia 3300 backbone with DNA conferring resistance to phosphinothricin and hygromycin under the control of separate CaMV 35S promoters, an attB-5promoterless zeomycin resistance-encoding DNA recombination cassette and unique sites for adding additional markers, e.g., DNA encoding GFP. The attB site facilitates the addition of new DNA sequences to plant or animal, e.g., mammalian, artificial chromosomes, including PACs formed as a result of using the pAgl vector, or derivatives thereof, in the production of PACs. The 10attB site provides a convenient site for recombinase-mediated insertion of DNAs containing a homologous att site. ;2. pAG2 ;-209- ;The vector pAg2 (SEQ. ID. NO: 6; see Figure 3) is a derivative of vector pAgl formed by adding DNA encoding a green fluorescent protein (GFP), under the control of a NOS promoter and flanked at the 3' end by a NOS polyA signal, to pAgl. pAg2 was constructed as follows (see Figure 4). 5 A DNA fragment containing the NOS promoter was obtained by digestion of pGEM-T-NOS, or pGEMEasyNOS (SEQ. ID. NO: 7), containing the NOS promoter in the cloning vector pGEM-T-Easy (Promega Biotech, Madison, Wl, U.S.A.), with Xba\INco\ and was ligated to an Xba\/Nco\ fragment of pCambia 1302 containing DNA encoding GFP (without the CaMV 35S promoter) to 10generate p1302NOS (SEQ. ID. NO: 8) containing GFP-encoding DNA in operable association with the NOS promoter. Plasmid p1302NOS was digested with Smal/fis/WI to yield a fragment containing the NOS promoter and GFP-encoding DNA. The fragment was ligated with P/r?el/5s/WI-digested pAgl to generate pAg2. Thus, pAg2 contains DNA from the bar gene 15conferring resistance to phosphinothricin, DNA conferring resistance to hygromycin, both resistance-encoding DNAs under the control of a cauliflower mosaic virus 35S promoter, DNA encoding kanamycin resistance, a GFP gene under the control of a NOS promoter and the attB-zeomycin resistance-encoding DNA. One of skill in the art will appreciate that other fragments can 20be used to generate the pAgl and pAg2 derivatives and that other heterologous DNA can be incorporated into pAgl and pAg2 derivatives using methods well known in the art. ;3. pAglla and pAgllb transformation vectors ;Vectors pAglla and pAgllb were constructed by inserting the following 25DNA fragments into pAgl: DNA encoding a-g|ucoronidase, the nopaline synthase terminator fragment, the nopaline synthase (NOS) promoter fragment, a fragment of mouse satellite DNA and an N. tabacum rDNA intergenic spacer sequence (IGS). The construction of pAglla and pAgllb was ;-210- ;as follows (see Figure 5). ;An N. tabacum rDNA intergenic spacer (IGS) sequence (SEQ. ID. NO: 9); see also GenBank Accession No. Y08422; see also Borysyuk et al. (2000) Nature Biotechnology 78:1303-1306; Borysyuk et al. (1997) Plant Mol. 5Biol.35:655-660; U.S. Patent Nos. 6,100,092 and 6,355,860) was obtained by PCR amplification of tobacco genomic DNA. The IGS can be used as a targeting sequence by virtue of its homology to tobacco rDNA genes; the sequence is also an amplification promoter sequence in plants. This fragment was amplified using standard PCR conditions (e.g., as described by Promega 10Biotech, Madison, Wl, U.S.A.) from tobacco genomic DNA using the primers shown below: ;NTIGS-FI ;5'- GTG CTA GCC AAT GTT TAA CAA GAT G- 3' (SEQ ID No. 10) and NTIGS-RI ;155'-ATG TCT TAA AAA AAA AAA CCC AAG TGA C- 3' (SEQ ID No. 11) Following amplification, the fragment was cloned into pGEM-T Easy to give pIGS-l. ;A fragment of mouse satellite DNA (Msatl fragment; GenBank Accession No. V00846; and SEQ ID No. 12) was amplified via PCR from 20pSAT-1 using the following primers: ;MSAT-F1 ;5'- AAT ACC GCG GAA GCT TGA CCT GGA ATA TCG C -3'(SEQ ID No. 13) and ;MSAT-Ri ;255'-ATA ACC GCG GAG TCC TTC AGT GTG CA T- 3' (SEQ ID No. 14) ;This amplification added a Sacll and a Hind\\\ site at the 5'end and a Sacll site at the 3' end of the PCR fragment. This fragment was then cloned into the Sacll site in plGS-1 to give pMIGS-1, providing a eukaryotic centromere- ;-211- ;specific DNA and a convenient DNA sequence for detection via FISH. ;A functional marker gene containing a NOS-promoter:GUS:NOS terminator fusion was then constructed containing the NOS promoter (GenBank Accession No. U09365; SEQ ID No. 15), £. coli ^-glucuronidase 5coding sequence (from the GUS gene; GenBank Accession No. S69414; and SEQ ID No. 16), and the nopaline synthase terminator sequence (GenBank Accession No. U09365; SEQ ID No. 18). The NOS promoter in pGEM-T-NOS was added to a promoterless GUS gene in pBlueScript (Stratagene, La Jolla, CA, U.S.A.) using Not\!Spe\ to form pNGN-1, which has the NOS promoter in 10the opposite orientation relative to the GUS gene. ;pMIGS-1 was digested with Not\ISpe\ to yield a fragment containing the mouse major satellite DNA and the tobacco IGS which was then added to /Vofl-digested pNGN-1 to yield pNGN-2. The NOS promoter was then re-oriented to provide a functional GUS gene, yielding pNGN-3, by digestion 15and religation with Spel. Plasmid pNGN-3 was then digested with HindW, and t ;the HincM fragment containing the a-giucuronidase coding sequence and the rDNA intergenic spacer, along with the Msat sequence, was added to pAG-1 to form pAglla, using the unique HincM site in pAgl located near the right T-DNA border of pAgl, within the T-DNA region. ;-212- ;Another plasmid vector, referred to as pAgllb, was also recovered, which contained the inserted Hind\II fragment in the opposite orientation relative to that observed in pAglla. Thus, pAglla and pAgllb differ only in the orientation of the Hind\\\ fragment containing the mouse major satellite 5sequence, the GUS DNA sequence and the IGS sequence (see Figure 6). The nucleotide sequence of pAglla is provided in SEQ. ID. NO: 21. ;Vectors pAgl, pAg2, pAglla and pAgllb, as well as similarly designed vectors containing a recombination site and a promoter (e.g., plant or animal promoter), and possibly other regulatory sequences, in operable association 10with DNA encoding a protein or other product for the expression in a host cell, such as a plant or animal cell, can be used in the transfer of any protein (or other product)-encoding nucleic acid of interest into a cell for expression thereof. For example, any protein (or other product)-encoding nucleic acid of interest (in operable association with transcriptional regulatory suitable for use 15in a particular host cell) can be inserted into any of the vectors pAgl, pAg2, pAglla and pAgllb and thereby incorporated into a plant, animal or other artificial chromosome, particularly a platform artificial chromosome ACes, as described herein. ;Example 6 ;20 Agrobacterium-Mediated Transformation of Plant Cells ;Plant cells were transformed via Agrobacterium-mediated transformation according to standard procedures (see, for example, Horsch et al. (1988) Plant Molecular Biology Manual, >45:1-9, Kluwer Academic Publisher, Dordrecht, Belgium). Briefly, Agrobacterium strain GV 3101/pMP90 25(see Koncz and Schell (1986) Molecular and General Genetics 204:383-396) was transformed with pAglla and pAgllb (see Example 5) by heat shock, and the plasmid integrity of pAglla and pAgllb after transformation was verified by Hind\\\ digest pattern. pAglla/pMP90 or pAgllb/pMP90 were cultured in 5 ml ;-213- ;AB minimum medium (Horsch et at. (1988) Plant Molecular Biology Manual >45:1-9, Kluwer Academic Publisher, Dordrecht, Belgium) containing 25 ig/ml kanamycin and 25 ig/ml gentamycin at 28°C for two days. ;Leaf disks of tobacco and Arabidopsis and root segments of 5Arabidopsis were prepared as follows: tobacco leaves from 3 to 4 week-old explants were cut into 1 cm in diameter, and Arabidopsis leaves were taken from 3 week-old seedlings and transversely cut in two halves. Roots of 3 week-old Arabidopsis were excised into segments of 1 cm in length. Co-cultivation was carried out by immersing leaf disks or root segments in 10bacterial culture for 2 minutes and then transferring the infected tissues to culture medium without antibiotics for 2 days at 22°C for 16-hours/day under cool white fluorescent light. The leaf disks of tobacco and Arabidopsis were cultured on MS104 medium (MS, 3% sucrose, 0.05% MES, 1.0 mg/l BA, 0.1 mg/l NAA and 0.8% agar, pH 5.8) and root segments on callus-inducing 15medium, CIM 0.5/0.05 (B5, 2% glucose, 0.05% MES, 0.5 mg/l 2,4-D, 0.05 mg/l kinetin and 0.8% agar, pH 5.8). ;The transformed leaf disks and root segments were then transferred to selection medium of MS104 or CIM 0.5/0.05, respectively, containing 20 mg/l hygromycin and 300 mg/l Timentin for the elimination of Agrobacterium. The 20selection medium was refreshed every two weeks and green shoots regenerated. Plants were analyzed for the expression of the DNA encoding GUS by standard histochemical and fluorescent assays and evidence of amplification of the inserted DNA by quantitative PCR. Numerous plants were obtained that expressed high levels of GUS, and multiple copies of the GUS 25gene were observed by Fluorescent In Situ Hybridization (FISH) and PCR analysis. Thus, amplification of the chromosomal regions containing the inserted DNA was observed. One of skill in the art will appreciate that GUS expression, or the expression of any other gene, can be assessed using ;-214- ;methods well known in the art. ;Example 7 ;Transfection and culture of Arabidopsis protoplasts E. coii strain Stb14 (Gibco Life Sciences) was transformed with pAglla, 5pAgllb, and one of two targeting plasmids containing the rDNA repeat sequence from Arabidopsis (plasmid pJHD-14A or the 26S rDNA from Arabidopsis plasmid pJHD2-19A, as described by Doelling et al. [(1993) Proc. Natl. Acad. Sci. U.S.A. 90:7528-7532]) via electroporation according to standard procedures. A single colony was grown up in 250 ml LB medium 10containing 50 ig/ml kanamycin (for selection based on the kanamycin resistance-encoding DNA in pAglla and pAgllb) or 50 ig/ml ampicillin (for selection based on the ampicillin resistance-encoding DNA in pJHD-14A & ;pJHD2-19A) and cultured at 30°C with shaking at 225 rpm for 16 hours. The plasmids were isolated according to standard procedures well known in the 15art. The structural integrity of the plasmids was checked by restriction digestion pattern, and the plasmids were linearized with restriction enzymes. Plasmids were sterilized with chloroform and 70% ethanol before use for transfection. ;Arabidopsis protoplasts were resuspended in the culture medium (see 20Example 1) at a density of 2 x 106 protoplasts/ml. A 300 il protoplast suspension was pipetted into a 15 ml tube, and 30 i| of plasmid (pAglla or pAgllb) and targeting DNA (pJHD-14A or pJHD2-19A) was added containing 10 ig plasmid and 100 ig targeting sequence followed immediately by slowly adding 300 i| of 10% PEG. The targeting plasmids were included in 25the transfection procedure in order ensure that the amount of rDNA targeting DNA (i.e., tobacco rDNA from pAglla or b and Arabidopsis DNA from the targeting vectors) was sufficient to effect recombination of the introduced DNA at a homologous site in an Arabidopsis chromosome. DNA was typically ;-215- ;used in a ratio of 10:1, targeting DNA (pJHD-14A or pJDH2-19A, or Lambda DNA) to plasmid DNA (pAglla or pAgllb, or a selectable marker plasmid), or in a ratio of 5:1. Generally, the number of base pairs of targeting DNA to be sufficient for insertion into a plant chromosome is at least about 50 bp, or 5about 60 bp, or about 70 bp, or about 80 bp, or about 90 bp, or about 100 bp, or about 150 bp, or about 200 bp, or about 300 bp, or about 400 bp, or about 500 bp, or about 600 bp, or about 700 bp, or about 800 bp, or about 900 bp, or about 1 kb, or about 2 kb or about 3 kb, or about 4 kb, or about 5 kb, or about 6 kb, or about 7 kb, or about 8 kb, or about 9 kb, or about 10 kb 10or more. The amount and length of targeting DNA sufficient to effect introduction into a chromosome can be determined empirically and can vary for different plant species. ;The mixture was shaken gently, and immediately 300 i| of 10% PEG solution was added slowly with gentle shaking. The protoplast mixture was 15incubated at 22°C for 10-15 min with several cycles of gentle shaking. DNA uptake was quenched by the addition of 5 ml 72.4 g/l Ca(N03)2. The protoplasts were then centrifuged at 80xg for 7 min and resuspended in culture medium. For selection, 10 to 40 mg/l hygromycin was added to protoplast cultures 14 days after transfection, and the culture medium was 20refreshed every 7 days. The protoplast cultures could also be selected after embedding in 0.6% agarose by transferring to a culture medium containing 20 ;mg/l hygromycin. The cultures were incubated for 14 days or longer at 22°C. The Arabidopsis protoplasts were analyzed for the presence and expression of the DNA encoding GUS. Recovered microcalli strongly expressed GUS and 25were resistant to selective agents, indicating amplification of the inserted DNA. Alternatively, the transfection of Arabidopsis protoplasts can be conducted without using targeting DNA sequences since pAglla and pAgllb include a region of rDNA (i.e. the tobacco rDNA IGS) that can act as a ;-216- ;targeting sequence as long as a sufficient amount of pAglla/b plasmid is used in the transfection procedure. Example 8 ;Transfection and Culture of Tobacco Protoplasts As described in Example 7, £. coli strain Stbl4 was transformed with 5pAglla, pAgllb, pJHD-14A (targeting DNA) and pJHD2-19A (targeting DNA) via electroporation, and plasmid DNA was recovered and linearized with restriction enzymes. Plasmids were sterilized with chloroform and 70% ethanol before use for transfection. ;The tobacco protoplasts (see Examples 2 and 3) were resuspended in 10the culture medium (see Example 2) at a density of 2 x 106 protoplasts/ml. A 300 i| protoplast suspension was pipetted into a 15 ml tube, and 30 i| of plasmid and targeting DNA was added as described in Example 7. The mixture was shaken gently, and immediately 300 i| of 10% PEG solution was added slowly with gentle shaking. The tobacco protoplast mixture was 15incubated at 22°C for 10-15 min with several cycles of gentle shaking. DNA uptake was quenched by the addition of 5 ml 72.4 g/L Ca(N03)2. The protoplasts were then centrifuged at 80xg for 7 min and resuspended in culture medium. ;The recovery of viable tobacco protoplasts following DNA uptake 20ranged from 65-75% following treatment. Typically greater than 35% of the protoplasts initiated cell division within 7 days of treatment. Protoplast cells were analyzed for gene expression (in this case for the expression of the reporter DNA GUS, but alternatively, the expression of other genes can be monitored). Between 4% and 6% of the recovered cells exhibited GUS 25expression. ;The protoplasts were subject to selection procedures to recover transformed cells. For selection of tobacco cells, 10 to 40 mg/l hygromycin was added to protoplast cultures 10-14 days after transfection, and the ;-217- ;culture medium was refreshed every 7 days. Leaf disc selection was performed in the presence of 40 mg/l hygromycin. Transformed microcalli were recovered and analyzed for the expression of the GUS reporter gene. GUS positive calli were isolated and subjected to FISH analysis (see Example 513). Plant cells that exhibited amplification of the inserted DNA were identified. ;Example 9 ;Transfection and Culture of Brassica Protoplasts ;-218- ;Brassica protoplasts (see Example 4), following the final washing step after filtering through a 63 im nylon screen and centrifugation, are collected and used for DNA transfection as described in Example 8. Brassica protoplast cultures following DNA uptake or transformation by Agrobacterium can be 5selected with either hygromycin or giufosinate ammonium in liquid culture or in embedded semi-solid cultures. The effective concentration of hygromycin is 10 to 40 mg/l for 2 to 4 weeks or continuously, whereas that for giufosinate ammonium is 2 to 60 mg/l for 5 days to 2 weeks. Selection can impede growth, and additional transfers to similar media may be required. 10 Example 10 ;Plant Regeneration from Brassica Protoplasts Colonies of Brassica protoplasts (1 mm or larger in diameter) are plated onto regeneration medium (basal Murashige and Skoog's medium, 1% sucrose, 2 mg/l BA, 0.01 mg/l NAA, 0.8% agarose, pH 5.6). Cultures are 15incubated under the conditions described in Example 4. Cultures are transferred onto fresh regeneration medium every 2 weeks. Regenerated shoots are transferred onto autoclaved rooting medium (basal Murashige and Skoog's medium, 1% sucrose, 0.1 mg/l NAA, 0.8% agar, pH 5.8) and incubated under dim fluorescent light (25 iEm"2 s"1). Plantlets are potted in a 20soil-less mix (for example, Terra-lite Redi-Earth, W.R. Grace & Co., Canada Ltd., Ajax, Ontario) containing fertilizer (Nutricote 1414-14 type 100, Plant Products Co. Ltd, Brampton, Ontario) and grown in a growth room ;(20°C/15°C, 16 h photoperiod, 100-140 iEm"2 s"1) with fluorescent and incandescent light at soil level. Plantlets are covered with transparent plastic 25cups for one week to allow for acclimatization. ;Example 11 Isolation of Nuclei from Protoplasts ;-219- ;To facilitate analysis, plant cells can be subjected to nuclei isolation, and the isolated nuclei can be analyzed by FISH or PCR. To isolate the nuclei, protoplast calli were reprotoplasted according to the procedure of Mathur et al. with modifications (see Mathur et al. Plant Cell Report (1995) 14\ 5221-226). The protoplast calli were digested with 1.2% Cellulase 'Onozuka' R-10 and 0.4% w/v Macerozyme R-10 in nuclei isolation buffer (10 mM MES-pH 5.5, 0.2M sucrose, 2.5 mM EDTA, 2.5 mM DTT, 0.1 mM spermine, 10 mM NaCI, 10 mM KCI and 0.15% Triton X-100) for 3 hours. After centrifugation at 80 x g for 10 minutes, the pellets of protoplasts were 10resuspended in hypertonic buffer of 12.5% W5 solution (Hinnisdaels et al. (1994) Plant Molecular Biology Manual G2:1-13, Kluwer Academic Publisher, Belgium) for 10 minutes. To promote disruption of protoplasts, the protoplast suspension was forced through a syringe needle four times. The disrupted protoplasts were filtered through 5 im meshes to remove debris and 15centrifuged at 200 x g for 10 min. By repeated washing of the pellet in a nuclei isolation buffer containing phenylmethylsulfonylfluoride (PMSF) and centrifugation at 200 x g for 10 minutes, nuclei were collected as a white pellet freed from cytoplasm contamination and cellular debris. Samples were fixed in 3:1 methanol:glacial acetic acid and were analyzed by FISH. 20 Example 12 ;Mitotic Arrest of Plant Cells for Detection of Amplification and Artificial Chromosome Formation ;-220- ;In general, plant cells or protoplasts are typically cultured for two or more generations prior to mitotic arrest. Typically, 5 ig/ml colchicine is added to the cultures for 12 hours to accumulate mitotic plant cells. The mitotic cells are harvested by gentle centrifugation. Alternatively, plant cells 5{grown on plastic or in suspension) can be arrested in different stages of the cell cycle with chemical agents other than colchicine, such as, but not limited to, hydroxyurea, vinblastine, colcemid or aphidicolin or through the deprivation of nutrients, hormones, or growth factors. Chemical agents that arrest the cells in stages other than mitosis, such as, but not limited to, hydroxyurea and 10aphidicolin, are used to synchronize the cycles of all cells in the population and are then removed from the cell medium to allow the cells to proceed, more or less simultaneously, to mitosis at which time they can be harvested to disperse the chromosomes. ;Example 13 ;15 Detection of Amplification and Artificial Chromosome Formation by ;Fluorescence in situ hybridization (FISH) ;A variety of plant cells can analyzed by fluorescence in situ hybridization (FISH) methods (Fransz et al. (1996) Plant J. 9:421-430; Fransz et al. (1998) Plant J. 13:867-876; Wilkes et al. (1995) Chromosome Research 203:466-472; Busch et al. (1994) Chromosome Research 2:15-20; Nkongolo (1993) Genome 36:701-705; Leitch et at. (1994) Methods in Molecular Biology 28:177-185; Murata et aL. (1997) Plant J. 12:31-37) to identify amplification events and artificial chromosome formation. ;FISH is used to detect specific DNA sequences on chromosomes, in 25particular to detect regions of plant chromosomes that have undergone amplification as a result of the introduction of heterologous DNA as described herein, or to detect artificial chromosome formation in plant cells. FISH chromosome spreads of Arabidopsis and tobacco plant cells into which ;-221- ;heterologous DNA has been introduced are generated using colchicine or similar cell cycle arresting agents and various DNA probes (e.g. rDNA probe, Lambda DNA probe, selectable marker probe). The cells are analyzed for the presence of amplified regions of chromosomes, in particular amplification of 5the rDNA regions, and those cells exhibiting amplification are further cultured and analyzed for the formation of artificial chromosomes. ;-222- ;The chromosomes of plant cells subjected to introduction of heterologous DNA and growth to generate artificial chromosomes can also be analyzed by scanning electron microscopy. Preparation of mitotic chromosomes for scanning electron microscopy can be performed using 5methods known in the art (see, e.g., Sumner (1991) Chromosome 100:410-418). The chromosomes can be observed, for example, with a Hitachi S-800 field emission scanning electron microscope operated with an accelerating voltage of 25kV. ;Example 14 ;10 Detection of Amplification and Artificial Chromosome Formation by ;Idu Labeling of Chromosomes ;-223- ;The structure of the chromosomes in plant cells can be analyzed by labeling the chromosomes with iododeoxyuridine (IdU), or other nucleotide analog, and using an IdU-specific antibody to visualize the chromosome structure. Plant cell cultures selected following introduction of heterologous 5DNA are labeled with IdU following standard protocols (Fujishige and Taniguchi (1998) Chromosome Research 6:611-619; Yanpaisan et al. (1998) Biotechnology and Bioengineering, 56:515-528; Trick and Bates (1996) Plant Cell Reports, 15:986-990; Binarova et al. (1993) Theoretical and Applied Genetics, 87:9-16; Wang et al. (1991) Journal of Plant Physiology, 10738:200-203). Plant cells in culture, typically suspension culture, are used. A series of sub-cultures are initiated, and IdU labeling is performed as described above. Cells are allowed to incorporate IdU for up to a week, depending on the doubling time of the culture. Labeled chromosomes can be detected in plant cells (Fujishige and Taniguchi (1998) Chromosome Research 156:611-619; Binarova et al. (1993) Theoretical and Applied Genetics 87:9-16) and in mammalian cells (Gratzner and Leif (1981) Cytometry 7:385-393) using procedures well known in the art. IdU-labeled chromosomes are detected by immunocytochemical techniques. An anti-ldU fluorescein isothiocyanate (FITC)-conjugated B44 clone antibody (Becton Dickinson) is used to bind the 20idU-DNA adduct in the DNA and is detected by fluorescence microscopy (490 nm excitation, 519 nm emission). Analysis of labeled chromosomes reveals the presence of amplified DNA regions and the formation of artificial chromosomes. ;Example 15 ;25 Isolation of Metaphase Chromosomes from Protoplasts ;-224- ;Artificial chromosomes, once detected in plant cells, may be isolated for transfer to other organisms and in particular other plant species. Several procedures may be used to isolate metaphase chromosomes from mitotic— arrested plant cells, including, but not limited to, a polyamine-based buffer 5system (Cram et at. (1990) Methods in Cell Biology 33:377-3821), a modified hexylene glycol buffer system (Hadlaczky et aL (1982) Chromosoma 86:643-65), a magnesium sulfate buffer system (Van den Engh et al. (1988) Cytometry 9:266-270 and Van den Engh et aL (1984) Cytometry 5:108), an acetic acid fixation buffer system (Stoehr et aL (1982) Histochemistry 1074:57-61), and a technique utilizing hypotonic KCI and propidium iodide (Cram et aL (1994) XVII meeting of the International Society for Analytical Cytology, October 16-21, Tutorial IV Chromosome Analysis and Sorting with Commercial Flow Cytometers; Cram et a!. (1990) Methods in Cell Biology 33:376; de Jong et al. (1999) Cytometry 35:129-133). ;-225- ;In an exemplary procedure, a hexylene glycol buffer is used to isolate plant chromosomes from mitotic-arrested plant cells that have been converted to protoplasts (Hadlaczky et aL (1982) Chromosoma 85:643-659). Chromosomes are isolated from about 106 mitotic cells re-suspended in a 5glycine-hexylene glycol buffer (100 mM glycine, 1% hexylene glycol, pH 8.4-8.6, adjusted with a solution of saturated Ca(OH)2) supplemented with 0.1% Triton X-100 (GHT buffer). The cells are incubated for 10 minutes at ;37°C, and the chromosomes are purified by differential centrifugation to pellet the nuclei (200xg for 20 min) and sucrose gradient centrifugation (5-30% ;10sucrose, 5600xg for 60 min, 0-4°C). To avoid proteolytic degradation of chromosomal proteins, 1 mM PMSF (phenylmethylsulfonylfluoride) is used in the presence of 1 % isopropyl alcohol. The proteins can be extracted from the isolated chromosomes using dextran sulfate-heparin (DSH) extraction, and the chromosomes can be visualized via electron microscopy using techniques 15known in the art (Hadlaczky et al. (1982) Chromosoma (Bert.) 86:643-659; Hadlaczky et at. (1981) Chromosoma (Berl.) 87:537-555). Additionally, modifications of these procedures, including, but not limited to, modification of the buffer composition (Carrano et al. (1979) Proc. Natl. Acad. Sci. U.S.A. 76:1382-1384) and variation of the centrifugation time or speed, to 20accommodate different plant species can be implemented by any skilled artisan. ;Example 16 ;Transfer of Artificial Chromosomes into Plant Cells: Transfer of Mammalian Artificial Chromosomes into a Dicot Plant: Arabidopsis ;-226- ;One method of delivery of mammalian artificial chromosomes (MACs) into plant cells is the formation of microcells containing murine MACs and the CaP04-mediated uptake or the PEG-mediated fusion of these microcells with plant protoplasts. In this example, microcells and plant protoplasts, such as 5but not limited to tobacco and Arabidopsis protoplasts, were mixed (in a series of 25:1, 10:1, 5:1, or 2:1 microcells:protoplasts ratio) and fusion was observed. Protocols for the formation of microcells are known in the art and are described, for example, in US Patent Nos. 5,240,840, 4,806,476 and 5,298,429 and in Fournier Proc. Natl. Acad. Sci. U.S.A. (1981) 1078:6349-6353 and Lambert et al. Proc. Natl. Acad. Sci. U.S.A. (1991) 88: 5907-5912. The murine microcells can be labeled with Idu or the IVIACs stained with a specific dye such as, but not limited to, e.g., propidium iodide or DAPI, prior to fusion with plant protoplasts including, but not limited to, Arabidopsis and tobacco protoplasts, to facilitate detection of the presence of 15lVIACs in the protoplasts. ;In this example, MACs were introduced into Arabidopsis cells using microcell-PEG mediated fusion. Microcells were formed from murine cells containing an artificial chromosome (see U.S. Patent No. 6,077,697) and were fused with freshly prepared Arabidopsis protoplasts in a ratio of 10:1, 20microcells to protoplasts. Fusion occurred in the presence of 25% PEG 6000, 204 mM CaCI2, pH 6.9 within the first 5 minutes of mixing. Typically less than about one minute of mixing is required to observe fusion between microcells and protoplasts. Fused cells were washed with 240 mM CaCI2, then floated on top of a solution of 204mM sucrose in B5 salts. Cells were 25then transferred to cell suspension culture media (MS, 87mM sucrose, 2.7 iM naphthalene acetic acid, 0.23 iM kinetin, pH 5.8). Empirical observations can be used to determine the optimal concentration and composition of PEG and the concentration of calcium that provides the highest ;-227- ;degree of fusion with the least toxicity. ;Fused protoplasts were allowed to grow for one or more generations. The presence of a mouse chromosomal sequence, including MACs, was demonstrated by southern hybridization with MAC probes, by FISH analysis 5and by PCR analysis using, for example, satellite sequences known to exist on the MAC chromosome. Thus, the mouse sequences were detected in the Arabidopsis protoplasts. ;To further demonstrate the transfer of mouse chromosomal sequence to Arabidopsis protoplasts, Arabidopsis plant cell nuclei were isolated 10according to Example 11 and were subjected to FISH analysis according to Example 13, using the mouse major satellite DNA (SEQ ID No. 12). A portion of the nuclei contained a significant signal using the mouse major satellite DNA, indicating successful transfer of at least a mouse chromosome and/or MAC to the Arabidopsis nuclei. ;-228- ;Similarly, PACs may be introduced into Arabidopsis protoplasts using PEG- and/or calcium-mediated fusion procedures. Generation of microprotoplasts and protoplasts can be conducted as described, for example, in Example 1. Microprotoplasts formed from plant cells containing a plant 5artificial chromosome are fused with freshly prepared Arabidopsis protoplasts, for example, in a ratio of 10:1, microprotoplasts to protoplasts. Protoplasts from other plants, including but not limited to, tobacco, wheat, maize and rice, can also be used as the recipient of MACs and/or PACs. Fused protoplasts are recovered and allowed to grow for one or more generations. 10The presence of the transferred PACs can be analyzed using methods such as, for example, those described herein (including Southern hybridization with PAC probes, FISH analysis and PCR analysis using DNA sequences specific to the PAC). ;Example 17 ;15 Transfer of Artificial Chromosomes into Plant Cells: Transfer of ;Mammalian Artificial Chromosomes into a Second Dicot Plant: Tobacco ;MACs were introduced into tobacco cells using microcell-PEG mediated fusion using the same microcells, MAC, and protocol as described in Example 16. Microcells were formed from murine cells containing an artificial 20chromosome and were fused with freshly prepared tobacco BY-2 protoplasts in a ratio of 10:1, microcells to protoplasts. Fusion occurred in the presence of 20% PEG 4000 and 100-200 mM calcium chloride. Empirical observations are used to determine the optimal concentration and composition of PEG and the concentration of calcium that provides the highest degree of fusion with 25the least toxicity. ;-229- ;DAPI staining of the microcells (e.g. by preincubation of the microcells with DAPI by adding DAPI to the microcells to a final concentration of 1 ig/ml) allowed visualization of the fusion and transfer of the chromosomes to the tobacco protoplasts. Fused protoplasts were recovered and allowed to 5grow for one or more generations. The fused protoplasts can be analyzed for the presence of a MAC in a number of ways, including those described herein. ;Fused tobacco cell nuclei were isolated from tobacco protoplasts that had been fused with microcells according to Example 11 and were subjected to FISH analysis according to Example 13, using the mouse major satellite DNA 10(SEQ ID No. 12). Numerous nuclei were found to have incorporated a mouse chromosome. ;Example 18 ;Transfer of isolated Artificial Chromosomes by Lipid-Mediated Transfer into a Monocot Plant: Rice ;-230- ;Isolated murine artificial chromosomes (MACs) prepared by sorting through a FACS apparatus (de Jong et al. Cytometry (1999) 35:129-133) were transferred into rice plant protoplasts by cationic lipid-mediated transfection of the purified MAC. Purified MACs (see Example 15 and U.S. 5Patent No. 6,077,697) were mixed with LipofectAMINE 2000 (Gibco, Md, USA) as follows. Typically, 15 i| of LipofectAMINE 2000 were added to 1 X 106 artificial chromosomes in liquid buffer, the solution allowed to complex for up to three hours, and then the solution was added to freshly prepared 1 X 105 rice protoplasts prepared using standard protoplast methods well known 10in the art. The uptake of the lipid-complexed artificial chromosome was monitored by adding to the mixture of protoplasts and purified artificial chromosomes a fluorescent dye that stains DNA. Microscopic examination of the protoplast/artificial chromosome mixture over the next several hours allowed the visualization of the artificial chromosome being transported across 15the protoplast cellular membrane and the presence of the readily identifiable MAC in the cytoplasm of the rice plant cell. ;The same procedure as described in this Example for cationic lipid-mediated transfer of an isolated MAC into rice protoplasts can be used to transfer isolated MACs, as well as PACs, into rice and other plant protoplasts, 20including but not limited to, tobacco, wheat, maize and Arabidopsis. Fused protoplasts are recovered and allowed to grow for one or more generations. The presence of the transferred MACs and PACs can be analyzed using methods such as, for example, those described herein (including, but not limited to, Southern hybridization with PAC probes, FISH analysis and PCR 25analysis using DNA sequences specific to the PAC). ;Example 19 ;Delivery of Plant Regulatory and Coding Sequences via a Promoterless attBZeo Marker Gene in pAg2 onto a MAC Platform ;-231- ;As described in Examples 6-15, the plasmid pAg2, comprising plant regulatory and selectable marker genes (SEQ ID NO: 6; prepared as set forth in Example 5) can be used for the production of a MAC containing said plant expressible genes. In this example, pAg2, by virtue of the attBZeo DNA 5sequences contained on the plasmid, is used for the loading of plant regulatory and selectable marker genes onto MACs in mammalian cells using the attB sequences to recombine with attP sequences present on a platform MAC. In this example, platform MACs are produced with attP sequences and the plasmid pAg2 is then loaded onto the platform MAC. New MACs so 10produced are useful for introduction into plan cells by virtue of the plant expressible markers contained therein. ;A. Construction of Platform MAC containing pSV40attPsensePUR (Figure 7; SEQ ID NO: 26). ;An example of a selectable marker system for the creation of a MAC-I5based platform into which the plasmid pAg2 can target plant regulatory and coding sequences is shown in Figure 7. This system includes a vector containing the SV40 early promoter immediately followed by (1) a 282 base pair (bp) sequence containing the bacteriophage lambda attP site and (2) the puromycin resistance marker. Initially a Pvu\\IStu\ fragment containing the 20SV40 early promoter from plasmid pPUR (Clontech Laboratories, Inc., Palo Alto, CA; SEQ ID No. 22) was subcloned into the £co/?l/CRI site of pNEB193 (a PUC19 derivative obtained from New England Biolabs, Beverly, MA; SEQ ID No. 23) generating the plasmid pSV40193. ;The attP site was PCR amplified from lambda genome (GenBank 25Accession # NC 001416) using the following primers: ;attPUP: CCTTGCGCTAATGCTCTGTTACAGG SEQ ID No. 24 attPDWN: CAGAGGCAGGGAGTGGGACAAAATTG SEQ ID No. 25 After amplification and purification of the resulting fragment, the attP site was cloned into the Sma\ site of pSV40193 and the orientation of the ;-232- ;attP site was determined by DNA sequence analysis (plasmid pSV40193attP). The gene encoding puromycin resistance (Puro) was isolated by digesting the plasmid pPUR (Clontech Laboratories, Inc. Palo Alto, CA) with Age\!BamH\ followed by filling in the overhangs with Klenow and subsequently cloned into 5the >4scl site downstream of the attP site of pSV40193attP generating the plasmid pSV40193attPsensePUR (Figure 7; SEQ ID NO:26)). ;-233- ;The plasmid pSV40193attPsensePUR was digested with Seal and co-transfected with the plasmid pFK161 into mouse LMtk- cells and platform artificial chromosomes were identified and isolated as described herein. Briefly, Puromycin resistant colonies were isolated and subsequently tested for 5artificial chromosome formation via fluorescent in situ hybridization (FISH) (using mouse major and minor DNA repeat sequences, the puromycin gene and telomeres sequences as probes), and the fluorescent activating cell sorted (FACS). From this sort, a subclone was isolated containing an artificial chromosome, designated B19-38. FISH analysis of the B19-38 subclone 10demonstrated the presence of telomeres and mouse minor on the MAC. DOT PCR has been done revealing the absence of uncharacterized euchromatic regions on the MAC. The process for generating this exemplary MAC platform containing multiple site-specific recombination sites is summarized in Figure 5. This MAC chromosome may subsequently be engineered to contain 15target gene expression nucleic acids using the lambda integrase mediated site-specific recombination system as described below. ;B. Construction of Targeting Vector. ;The construction of the targeting vector pAg2 is set forth in Example 5 ;herein. ;20C. Transfection of Promoterless Marker and Selection With Drug (See Figure 9). ;-234- ;The mouse LMtk- cell line containing the MAC B19-38 (constructed as set forth above and also referred to as a 2nd generation platform ACE), is plated onto four 10cm dishes at approximately 5 million cells per dish. The cells are incubated overnight in DMEM with 10% fetal calf serum at 37°C and 55% CO2. The following day the cells are transfected with 5ig of the vector pAg2 (prepared as described in Example 5 above) and 5ig of pCXLamlntR (encoding a lambda integrase having an E to R amino acid substitution at position 174), for a total of 10ig per 10cm dish. Lipofectamine Plus reagent is used to transfect the cells according to the manufacturers protocol. Two 10days post-transfection zeocin is added to the medium at 500ug/ml. The cells are maintained in selective medium until colonies are formed. The colonies are then ring-cloned and genomic DNA is analyzed. ;D. Analysis Of Clones (PCR, SEQUENCING). ;Genomic DNA (including MACs) is isolated from each of the candidate 15clones with the Wizard kit (Promega) and following the manufacturers protocol. The following primer set is used to analyze the genomic DNA isolated from the zeocin resistant clones: 5PacSV40 CT GTT A ATT A ACT GT GGA AT GT GTG TCAGTTAGGGTG (SEQ ID NO: 28); Antisense Zeo - TGAACAGGGTCACGTCGTCC (SEQ ID NO: 29). PCR 20amplification using the above primers and genomic DNA, which included MACs, from the candidate clones results in a PCR product indicating the correct sequence for the desired site-specific integration event. ;The MACs containing the pAg2 vector are identified and used for transfer into plant (such as described in Examples 16 and 17) or animal cells 25for the expression of the desired coding sequences contained therein. The MACs containing pAg2 carry two plan selectable markers (hygromycin resistance, resistance to phosphinothricin) and a visual selectable marker (green fluorescent protein). ;-235- ;Example 20 ;Construction of Plant-derived Shuttle Artificial Chromosome. ;In another embodiment, the plant artificial chromosomes provided herein are useful as selectable shuttle vectors that are able to move one or 5more desired genes back and forth between plant and mammalian cells. In this particular embodiment, the plant artificial chromosome is bi-functional in that proper integration of donor nucleic acid can be selected for in both plant and mammalian cells. ;For example, a plant artificial chromosome is prepared as described in 10Examples 6-15 above using the plasmid pAg2 (Example 5; SEQ ID NO: 6) that has been modified to include the SV40attPsensePur coding region from the plasmid pSV40193attPsensePur (described above in Example 19.A.). Thus, the resulting plant-derived shuttle artificial chromosome contains DNA from the bar gene conferring resistance to phosphinothricin in plant cells, DNA from 15the hygromycin resistance gene conferring resistance to hygromycin in plant cells, both resistance-encoding DNAs under the control of a separate cauliflower mosaic virus (CaMV) 35S promoter, the attB-promoterless zeomycin resistance-encoding DNA, and DNA conferring resistance to puromycin under the control of a mammalian SV40 promoter. Accordingly, 20the presence of the shuttle PAC in either a plant or mammalian cell can be selected for by treatment with, for example, either hygromycin (plant) or puromycin (mammalian). ;Because the resulting plant-derived shuttle artificial chromosome contains at least one SV40attP site therein similar to the platform MAC 25prepared in Example 19.A. above, a donor vector containing an attB-selectable marker sequence, such as a plasmid comprising an attBzeo (e.g. pAg2) can be used to selectively introduce desired heterologous nucleic acids from any species (such as plants, animals, insects and the like) into the shuttle artificial ;55 3 4 9 7 ;-236- ;chromosome that is present in a mammalian cell. ;Likewise, a plant promoter region, such as CaMV35S, can be used to replace the SV40 promoter in the SV40attPPur region of the modified pAg2 plasmid described above. In this embodiment, because the resulting plant-5derived shuttle artificial chromosome contains at least one CaMV35SattP site therein analogous to the platform MAC prepared in Example 19.A. above, a donor vector containing an attB-selectable marker sequence, such as a plasmid having attBkanamycin, or other plant selectable or scorable marker can be used to selectively introduce desired heterologous nucleic acids from 10any species (such as plants, animals, insects and the like) into the shuttle artificial chromosome that is present in a plant cell. ;Since modifications will be apparent to those of skill in this art, it is intended that this invention be limited by only the scope of the appended claims. ;237 *

Claims (1)

1. Claims: 2. 4. 5. 6. 7 • 8. 9. 10. 11. 12. A method, comprising: a) introducing nucleic acid into a plant chromosome in a plant cell, wherein: the chromosome is an acrocentric chromosome; and the cell has not been treated to produce the acrocentric chromosome; b) culturing the cell through at least one cell division; and c) selecting a cell containing: a sausage chromosome derived from an acrocentric chromosome; or an acrocentric chromosome comprising amplified heterochromatin; or an artificial chromosome derived from the acrocentric chromosome. The method of claim 1, wherein the acrocentric chromosome in step a) contains adjacent regions of rDNA and heterochromatic DNA. The method of claim 1 or claim 2, wherein the plant cell is a protoplast. The method of any one of claims 1-3, wherein the plant cell is from a plant species selected from among Arabidopsis, Nicotiana, Solanum, Lycopersicon, Daucus, Hordeum, Zea mays, Brassica, Triticum and Oryza. The method of any one of claims 1-4, wherein the short arm of the acrocentric chromosome in step a) contains adjacent regions of rDNA and heterochromatic DNA. The method of claim 5, wherein the heterochromatic DNA is pericentric heterochromatin. The method of any one of claims 1-6, wherein the nucleic acid introduced into the cell comprises a nucleic acid sequence that facilitates amplification of a region of a plant chromosome or that targets the nucleic acid to an amplifiable region of a plant chromosome. The method of any one of claims 1-7, wherein the nucleic acid introduced into the cell comprises one or more nucleic acids selected from among rDNA, lambda phage DNA and/or satellite DNA. The method of any one of claims 1-8, wherein the nucleic acid introduced into the cell comprises rDNA and is from a plant selected from among Arabidopsis, Nicotiana, Solanum, Lycopersicon, Daucus, Hordeum, Zea mays, Brassica, Triticum and Oryza. The method of any of claims 1-9, wherein the nucleic acid introduced into the cell comprises a nucleic acid sequence that facilitates identification of cells containing the nucleic acid. The method of claim 10, wherein the nucleic acid sequence encodes a fluorescent protein. The method of claim 11, wherein the protein is a green fluorescent protein r 4 238 13. The method of any one of claims 1-10, wherein the nucleic acid introduced into the cell comprises nucleic acid encoding a selectable marker. 14. The method of claim 13, wherein the selectable marker confers resistance to phosphinothricin, ammonium giufosinate, glyphosate, kanamycin, hygromycin, dihydrofolate or sulfonylurea. 15. The method of any one of claims 1-14, wherein the artificial chromosome comprises heterologous nucleic acid encoding a gene product. 16. The method of any one of claims 1-15, wherein the nucleic acid molecule that is introduced into the cell comprises a recognition site for a recombinase. 17. The method of any of one claims 1-16, wherein the chromosome in the selected cell contains a recognition site for recombination. 18. The method of claim 16 or claim 17, wherein the recognition site comprises an att site. CHROMOS MOLECULAR SYSTEMS INC and AGRISOMA INC By their authorized agents JAMES AND WELLS WO 2002/096923 PCT/US2002/017451 55 34 -1- SEQUENCE LISTING 110> CHROMOS MOLECULAR SYSTEMS, INC. Perez, Carl Fabijanski, Steven Perkins, Edward 120> Plant Artificial Chromosomes, Uses thereof, and Methods of Preparing Plant Artificial Chromosomes 130> 24601-419PC :14 0> Not Yet Assigned :141> Herewith :150> US 60/294,687 :151> 2001-05-30 <150> US 60/296,329 <151> 2001-06-04 <160> 51 <170> FastSEQ for Windows Version 4.0 <210> 1 <211> 11182 <212> DNA <213> Artificial Sequence <220> <223> pAgl plasmid <400> 1 catgccaacc acagggttcc cctcgggatc aaagtacttt gatccaaccc ctccgctgct 60 atagtgcagt cggcttctga cgttcagtgc agccgtcttc tgaaaacgac atgtcgcaca 120 agtcctaagt tacgcgacag gctgccgccc tgcccttttc ctggcgtttt cttgtcgcgt 180 gttttagtcg cataaagtag aatacttgcg actagaaccg gagacattac gccatgaaca 240 agagcgccgc cgctggcctg ctgggctatg cccgcgtcag caccgacgac caggacttga 300 ccaaccaacg ggccgaactg cacgcggccg gctgcaccaa gctgttttcc gagaagatca 360 ccggcaccag gcgcgaccgc ccggagctgg ccaggatgct tgaccaccta cgccctggcg 420 acgttgtgac agtgaccagg ctagaccgcc tggcccgcag cacccgcgac ctactggaca 480 ttgccgagcg catccacgag gccggcgcgg gcctgcgtag cctggcagag ccgtgggccg 540 acaccaccac gccggccggc cgcatggtgt tgaccgtgtt cgccggcatt gccgagttcg 600 agcgttccct aatcatcgac cgcacccgga gcgggcgcga ggccgccaag gcccgaggcg 660 tgaagtttgg cccccgccct accctcaccc cggcacagat cgcgcacgcc cgcgagctga 720 tcgaccagga aagccgcacc gtaaaagagg ccgctgcact gcttggcgtg catcgctcga 780 ccctgtaccg cgcacttgag cgcagcgagg aagtgacgcc caccgaggcc aggcggcgcg 840 gtgccttccg tgaggacgca ttcaccgaag ccgacgccct ggcggccgcc gagaatgaac 900 gccaagsgga acaagcatga aaccgcacca ggacggccag gacgaaccgt ttttcattac 960 ccaagagatc gaggcggaga tcatcgcggc cgggtacgtg ttcgagccgc ccgcgcacgt 1020 ctcsaccgtg cggctgcatg aaatcctggc cggtttgtct gatgccaagc tggcggcctg 1080 gccggccagc ttggccgctg aagaaaccga gcgccgccgt ctaaaaaggt gatgtgtatt 1140 tgagtasaac agcttgcgtc atgcggtcgc tgcgtatatg atgcgatgag taaataaaca 1200 aatacgcaag gggaacgcat gaaqgttatc gctgtactta accagaaagg cgggtcaggc 1260 aagacgacca tcgcaaccca tctagcccgc gccctgcaac tcgccggggc cgatgttctg 1320 ttagtccatt ccgatcccca gggcagtgcc cgcgattggg cggccgtgcg ggaagatcaa 1380 ccgctaaccg ttgtcggcat cgaccgcccg acgattgacc gcgacgtgaa ggccatcggc 1440 cggcgcgact tcgtagtgat cgaccgaacg ccccaggcgg cggacttggc tgtgtccgcg 1500 atcaaggcag ccgacttcgt gctcattccg gtgcagccaa gcccttacga catatgggcc 1560 accgccgacc tggtggagct ggttaagcag cgcattgagg tcacagatgg aaggctacaa 1620 gcggcctttg tcgtgtcgcg ggcgatcaaa ggcacgcgca tcggcggtga ggttgccgag 1680 gcqctggccg cgtacgagct gcccattctt cagtcccgta tcacgcagcg cgtgagctac 1740 ccaggcactg ccgccgccgg cacaaccgtt cttgaatcag aacccgaggg cgacgctgcc 1800 cgcgaggtcc aggcgctggc cgctcasatt aaatcaaaac tcatttgagt taatgaggta 1860 aagagaesat gagcaaaagc acaaacacgc taagtgccgg ccgtccgagc gcacgcagca 1920 gcaaggctgc aacgttggcc aacctcgcag acacgccagc catgaagcgg gtcaactttc 1980 WO 2002/096923 PCT/US2002/017451 -2- agttgccggc ggaggatcac accaagctga ttaccgagct gctatctgaa tacatcgcac atgagtsgat gaattttagc ggctaaagga accgacgccg tggaatgccc catgtgtgga tgggttgtct gccgaccctg caatggcact cggtcgcaaa ccatccggcc ccgtacaaat gaagttgaag gccgcgcagg ccgcccagcg tgaatcgtgg caagcggccg ctgatcgaat cggtgcgccg tcgattagga agccgcccaa gatgctctat gacgtgggca cccgcgatag tctgtcgaag cgtgaccgac gagctggcga cgtagaggtt tccgcagggc cggccggcat gatggcggtt tcccatctaa ccgaatccat gcccggccgc gtgttccgtc cacacgttgc tggcggaaag cagaaagacg acctggtaga tgccatgcag cgtacgaaga aggccaagaa agccttgatt agccgctaca agatcgtaaa gatcgagcta gctgattgga tgtaccgcga gacggttcac cccgattact ttttgatcga ggcacgccgc gccgcaggca aggcagaagc cagtggcagc gccggagagt tcaagaagtt aaatgacctg ccggagtacg atttgaagga catgcgctac cgcaacctga tcgagggcga gatgctaggg caaattgccc tagcagggga tagcacgtac attgggaacc caaagccgta cccaaagccg tacattggga accggtcaca aggcgatttt tccgcctaaa actctttaaa ctgtgcataa ctgtctggcc agcgcacagc gtcgctgcgc tccctacgcc ccgccgcttc aaaaatggct ggcctacggc caggcaatct actcgaccgc cggcgcccac atcaaggcac aaaacctctg acacatgcag ctcccggaga ggagcagaca agcccgtcag ggcgcgtcag tgacccagtc acgtagcgat agcggagtgt gattgtactg agagtgcacc atatgcggtg ataccgcatc aggcgctctt ccgcttcctc gctgcggcga gcggtatcag ctcactcaaa ggataacgca ggaaagaaca tgtgagcaaa ggccgcgttg ctggcgtttt tccataggct acgctcaagt cagaggtggc gaaacccgac tggaagctcc ctcgtgcgct ctcctgttcc ctttctccct tcgggaagcg tggcgctttc ggtgtaqgtc gttcgctcca agctgggctg ctgcgcctta tccggtaact atcgtcttga actggcagca gccactggta acaggattag gttcttgaag tggtggccta actacggcta tctgctgaag ccagttacct tcggaaaaag caccgctggt agcggtggtt tttttgtttg atctcaagaa gatcctttga tcttttctac acgttaaggg attttggtca tgcattctag atattttatt ttctcccaat caggcttgat ctgttcttcc ccgatatcct ccctgatcga gtccgccctg ccgcttctcc caagatcaat gatgttgctg tctcccaggt cgccgtggga ctttaaaaaa tcatacaact cacgcggatc gcaatccaca tcggccagat cgttattcag taagctattc gtatagagac aatccgatat cgcatacagc tcgataatct tttcagggct gacgccatcg gcctcactca tcagcagatt cacctttgga acaggcagct ttccttccag atcataggtg gtccctttat accggctatc tcccaccagc ttatatacct tagcaggaga tttttcgatc agttttttca attccggtga tcctcttttc tacagtattt aaaaataccc aattcactgt tccttgcatt ctaaaacctt ttttcaaagt tggcgtataa cataatatcg caggcagcaa cgctctgtca tcattacaat agatgtacgc ggtacgccaa ggcaagacca 2040 agctaccaga gtaaatgagc aaatgaataa 2100 ggcggcatgg aaaatcaaga acaaccaggc 2160 ggaacaggcg gttggccagg cgtaagcggc 2220 ggaaccccca agcccgagga atcggcgtga 2280 cggcgcggcg ctgggtgatg acctggtgga 2340 gcaacgcatc gaggcagaag cacgccccgg 2400 ccgcaaagaa tcccggcaac cgccggcagc 2460 gagcgacgag caaccagatt ttttcgttcc 2520 tcgcagcatc atggacgtgg ccgttttccg 2580 ggtgatccgc tacgagcttc cagacgggca 2640 ggccagtgtg tgggattacg acctggtact 2700 gaaccgatac cgggaaggga agggagacaa 2760 ggacgtactc aagttctgcc ggcgagccga 2820 aacctgcatt cggttaaaca ccacgcacgt 2880 cggccgcctg gtgacggtat ccgagggtga 2940 gagcgaaacc gggcagccgg agtacatcga 3000 gatcacagaa ggcaagaacc cggacgtgct 3060 tcccggcatc ggccgttttc tctaccgcct 3120 cagatggttg ttcaagacga tctacgaacg 3180 ctgtttcacc gtgcgcaagc tgatcgggtc 3240 ggaggcgggg caggctggcc cgatcctagt 3300 agcatccgcc ggttcctaat gtacggagca 3360 aaaaggtcga aaaggtctct ttcctgtgga 3420 cattgggaac cggaacccgt acattgggaa 3480 catgtaagtg actgatataa aagagaaaaa 3540 acttattaaa actcttaaaa cccgcctggc 3600 cgaagagctg caaaaagcgc ctacccttcg 3660 gcgtcggcct atcgcggccg ctggccgctc 3720 accagggcgc ggacaagccg cgccgtcgcc 3780 cctgcctcgc gcgtttcggt gatgacggtg 3840 cggtcacagc ttgtctgtaa gcggatgccg 3900 cgggtgttgg cgggtgtcgg ggcgcagcca 3960 atactggctt aactatgcgg catcagagca 4020 tgaaataccg cacagatgcg taaggagaaa 4080 gctcactgac tcgctgcgct cggtcgttcg 4140 ggcggtaata cggttatcca cagaatcagg 4200 aggccagcaa aaggccagga accgtaaaaa 4260 ccgcccccct gacgagcatc acaaaaatcg 4320 aggactataa agataccagg cgtttccccc 4380 gaccctgccg cttaccggat acctgtccgc 4440 tcatagctca cgctgtaggt atctcagttc 4500 tgtgcacgaa ccccccgttc agcccgaccg 4560 gtccaacccg gtaagacacg acttatcgcc 4620 cagagcgagg tatgtaggcg gtgctacaga 4680 cactagaagg acagtatttg gtatctgcgc 4740 agttggtagc tcttgatccg gcaaacaaac 4800 caagcagcag attacgcgca gaaaaaaagg 4860 ggggtctgac gctcagtgga acgaaaactc 4920 gtactaaaac sattcatcca gtaaaatata 4980 ccccagtaag tcaaaaaata gctcgacata 5040 ccggacgcag aaggcaatgt cataccactt 5100 aaagccactt actttgccat ctttcacaaa 5160 aaagacaagt tcctcttcgg gcttttccgt 5220 tttaaatgga gtgtcttctt cccagttttc 5280 taagtaatcc aattcggcta agcggctgtc 5340 gtcgatggag tgaaagagcc tgatgcactc 5400 ttgttcatct tcatactctt ccgagcaaag 5460 gctccagcca tcatgccgtt caaagtgcag 5520 ccatagcatc atgtcctttt cccgttccac 5580 cgtcattttt aaatataggt tttcattttc 5640 cattccttcc gtatctttta cgcagcggta 5700 tattctcatt ttagccattt attatttcct 5760 caagaagcta attataacaa gacgaactcc 5820 aaataccaga ssacagcttt ttcaaagttg 5880 acggagccga ttttgaaacc gcggtgatca 5940 caacatgcta ccctccgcga aatcatccat 6000 WO 2002/096923 PCT/TJS2002/017451 -3- gtttcaaacc cggcagctta gttgccgttc ttccgaatag catcqgtaac atgagcaaag 6060 tctgccgcct tacaacggct ctcccgctga cgccgtcccg gactgatggg ctgcctgtat 6120 cgagtggtga ttttgtgccg agctgccggt cggggagctg ttggctggct ggtggcagga 6180 tatattgtgg tgtaaacaaa ttgacgctta cacsacttaa taacacattg cggacgtttt 6240 taatgtactg aattaacgcc gaattaattc gggggatctg gattttagta ctggattttg 6300 gttttaggaa ttagaaattt tattgataga agtattttac aaatacaaat acatactaag 6360 ggtttcttat atgctcaaca catgagcgaa accctatagg aaccctaatt cccttatctg 6420 ggaactactc acacattatt atggagaaac tcgagtcaaa tctcggtgac gggcaggacc 6480 ggacggggcg gtaccggcag gctgaagtcc agctgccaga aacccacgtc atgccagttc 6540 ccgtgcttga agccggccgc ccgcagcatg ccgcgggggg catatecgag cgcctcgtgc 6600 atgcgcacgc tcgggtcgtt gggcagcccg atgacagcga ccacgctctt gaagccctgt 6660 gcctccaggg acttcagcag gtgggtgtag agcgtggagc ccagtcccgt ccgctggtgg 6720 cggggggaga cgtacacggt cgactcggcc gtccagtcgt aggcgttgcg tgccttccag 6780 gggcccgcgt aggcgatgcc ggcgacctcg ccgtccacct cggcgacgag ccagggatag 6840 cgctcccgca gacggacgag gtcgtccgtc cactcctgcg gttcctgcgg ctcggtacgg 6900 aagttgaccg tgcttgtctc gatgtsgtgg ttgacgatgg tgcagaccgc cggcatgtcc 6960 gcctcggtgg cacggcggat gtcggccggg cgtcgttctg ggctcatggt agactcgaga 7020 gagatagatt tgtagagaga gactggtgat ttcagcgtgt cctctccaaa tgaaatgaac 7080 ttccttatat agaggaaggt cttgcgaagg atagtgggat tgtgcgtcat cccttacgtc 7140 agtggagata tcacatcaat ccacttgctt tgaagacgtg gttgcaacgt cttctttttc 7200 cacgatgctc ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag aggcatcttg 7260 sacgatagcc tttcctttat cgcaatgatg gcatttgtag gtgccacctt ccttttctac 7320 tgtccttttg atgaagtgac agatagctgg gcaatggaat ccgaggaggt ttcccgatat 7380 taccctttgt tgaaaagtct caatagccct ttggtcttct gagactgtat ctttgatatt 7440 cttggagtag acgagagtgt cgtgctccac catgttatca catcaatcca cttgctttga 7500 agacgtggtt ggaacgtctt ctttttccac gatgctcctc gtgggtgggg gtccatcttt 7560 gggaccactg tcggcagagg catcttgaac gatagccttt cctttatcgc aatgatggca 7620 tttgtaggtg ccaccttcct tttctactgt ccttttgatg aagtgacaga tagctgggca 7680 atggaatccg aggaggtttc ccgatattac cctttgttga aaagtctcaa tagccctttg 7740 gtcttctgag actgtatctt tgatattctt ggagtagacg agagtgtcgt gctccaccat 7800 gttggcaagc tgctctagcc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat 7860 taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 7920 aatgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt 7980 atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat 8040 tacgaattcg agccttgact agagggtcga cggtatacag acatgataag atacattgat 8100 gagtttggac aaaccacaac tagaatgcag tgaaaaaaat gctttatttg tgaaatttgt 8160 gatgctattg ctttatttgt aaccattata agctgcaata aacaagttgg ggtgggcgaa 8220 gaactccagc atgagatccc cgcgctggag gatcatccag ccggcgtccc ggaaaacgat 8280 tccgaagccc aacctttcat agaaggcggc ggtggaatcg aaatctcgta gcacgtgtca 8340 gtcctgctcc tcggccacga agtgcacgca gttgccggcc gggtcgcgca gggcgaactc 8400 ccgcccccac ggctgctcgc cgatctcggt catggccggc ccggaggcgt cccggaagtt 8460 cgtggacacg acctccgacc actcggcgta cagctcgtcc aggccgcgca cccacaccca 8520 ggccagggtg ttgtccggca ccacctggtc ctggaccgcg ctgatgaaca gggtcacgtc 8580 gtcccggacc acaccggcga agtcgtcctc cacgaagtcc cgggagaacc cgagccggtc 8640 ggtccagaac tcgaccgctc cggcgacgtc gcgcgcggtg agcaccggaa cggcactggt 8700 caacttggcc atggatccag atttcgctca agttagtata aaaaagcagg cttcaatcct 8760 gcaggaattc gatcgacact ctcgtctact ccaagaatat caaagataca gtctcagaag 8820 accaaagggc tattgagact tttcaacaaa gggtaatatc gggaaacctc ctcggattcc 8880 attgcccagc tatctgtcac ttcatcaaaa ggacagtaga aaaggaaggt ggcacctaca 8940 aatgccstca ttgcgataaa ggaaaggcta tcgttcaaga tgcctctgcc gacagtggtc 9000 ccaaagatgg acccccaccc acgaggagca tcgtggaaaa agaagacgtt ccaaccacgt 9060 cttcaaagca agtggattga tgtgataaca tggtggagca cgacactctc gtctactcca 9120 agaatatcaa agatacagtc tcsgascacc aaagggctat tgagactttt caacaaaggg 9180 taatatcggg aaacctcctc ggattccatt gcccagctat ctgtcacttc atcaaaagga 9240 cagtagaaaa ggaaggtggc acctacaaat gccatcattg cgataaagaa aaggctatcg 9300 ttcaagatgc ctctgccgac agtggtccca aagatggacc cccacccacg aggagcatcg 9360 tggaaaaaga agacgttcca accacgtctt caaagcaagt ggattgatgt gatatctcca 9420 ctgacgtaag ggatgacgca caatcccact atccttcgca agaccttcct ctatataagg 9480 aagttcattt catttggaga ggacacgctg aaatcaccag tctctctcta caaatctatc 9540 tctctcgagc tttcgcagat ccggcggggc aatgagatat gaaaaagcct gaactcaccg 9600 cgacgtctgt cgagaagttt ctgatcgaaa agttcgacag cgtctccgac ctgatgcagc 9660 tctcggaggg cgaagaatct cgtgctttca gcttcgatgt aggagagcgt ggatatgtcc S720 tgcgggtaaa tagctgcgcc gatggtttct acaaagatca ttatgtttat cggcactttg 9780 catcggccgc gctcccgatt ccgcaagtgc ttgacattga ggagtttagc gagagcctga 9840 cctattgcat ctcccgccgt acacagggtg tcacgttgca acacctgcct gaaaccgaac 9900 tgcccgctgt tctacaaccg gtcgcgcagg ctatggatgc catcgctgcg gccgatctta 9S60 gccacacgag cgggttcggc ccattcggac cgcasggaat cggtcaatac actacatggc 10020 WO 2002/096923 PCMJS2002/017451 -4- gtgatttcat atgcgccatt gctgatcccc atgtgtatca ctggcaaact gtgatggacg 10080 acaccgtcag tgcgtccatc gcgcaggctc tcgatgagct catgctttgg gccgaggact 10140 gccccgaagt ccggcacctc gtgcacgcgg atttcggctc caacaatgtc ctgacggaca 10200 atggccgcat aacagcggtc attgactgga gcgaggcgat gttcggggat tcccaatacg 10260 aggtcgccaa catcttcttc tggacgccgt ggttggcttg tatggagcag cagacgcgct 10320 acttcgagcg gaggcatccg gagcttgcag gatcgccacg actccgggcg tatatgctcc 10380 gcattggtct tgaccaactc tatcagsgct tggttgacgg caatttcgat gatgcagctt 10440 gggcgcaggg tcgatgcaac gcaatcgtcc gatccggagc cgggactgtc aggcgtacac 10500 aaatcgcccg cagaagcgcg gccgtctgga ccgatggctg tgtagaagta ctcgccgata 10560 gtggaaaccg acgccccagc actcgtccga gggcaaagaa atagagtaga tgccgaccgg 10620 atctgtcgat cgacaagctc gagtttctcc ataataatgt gtgagtagtt cccagataag 10680 ggaattaggg ttcctatagg gtttcgctca tgtgttgagc atataagaaa cccttagtat 10740 gtatttgtat ttgtaaaata cttctatcaa tsaaatttct aattcctaaa accaaaatcc 10800 agtactaaaa tccagatccc ccgaattaat tcggcgttaa ttcagatcaa gcttggcact 10860 ggccgtcgtt ttacaacgtc gtgactggga aaaccctggc gttacccaac ttaatcgcct 10920 tgcagcacat ccccctttcg ccagctggcg taatagcgaa gaagcccgca ccgatcgccc 10980 ttcccaacag ttgcgcagcc tgaatggcga atgctagagc agcttgagct tggatcagat 11040 tgtcgtttcc cgccttcagt ttaaactatc agtgtttgac aggatatatt ggcgggtaaa 11100 cctaagagaa aagagcgttt attagaataa cggatattta aaagggcgtg aaaaggttta 11160 tccgttcgtc catttgtatg tg 11182 <210> 2 <211> 8428 <212> DNA <213> Artificial Sequence <220> <223> pCambia3300 plasmid <400> 2 catgccaacc acagggttcc cctcgggatc aaagtacttt gatccaaccc ctccgctgct 60 atagtgcagt cggcttctga cgttcagtgc agccgtcttc tgaaaacgac atgtcgcaca 120 agtcctaagt tacgcgacag gctgccgccc tgcccttttc ctggcgtttt cttgtcgcgt 180 gttttagtcg cataaagtag aatacttgcg actagaaccg gagacattac gccatgaaca 240 agagcgccgc cgctggcctg ctggactatg cccgcatcag caccgacgac caggacttga 300 ccaaccaacg ggccgaactg cacgcggccg gctgcaccaa gctgttttcc gagaagatca 360 ccggcaccag gcgcgaccgc ccggagctgg ccaggatgct tgaccaccta cgccctggcg 420 acgttgtgac agtgaccagg ctagaccgcc tggcccgcag cacccgcgac ctactggaca 480 ttgccgagcg catccaggag gccggcgcgg gcctgcgtag cctagcagag ccgtgggccg 540 acaccaccac gccggccggc cgcatggtgt tgaccgtgtt cgccggcatt gccgagttcg 600 agcgttccct aatcatcgac cgcacccgga gcgggcgcga ggccgccaag gcccgaggcg 660 tgaagtttgg cccccgccct accctcaccc cggcacagat cgcgcacgcc cgcgagctga 720 tcgaccagga aggccgcacc gtcaaagagg cggctgcact gcttggcgtg catcgctcga 780 ccctgtaccg cgcacttgag cgcagcgagg aagtgacgcc caccgaggcc aggcggcgcg 840 gtgccttccg tgaggacgca ttgaccgagg ccgacgccct ggcggccgcc gagaatgaac 900 gccaagagga acaagcatga aaccgcacca ggacggccag gacgaaccgt ttttcattac 960 cgaagagatc gaggcggaga tgatcgcggc cgggtacgtg ttcgagccgc ccgcgcacgt 1020 ctcaaccgtg cggctgcatg aaatcctggc cggtttgtct gatgccaagc tggcggcctg 1080 gccggccagc ttggccgctg aagaaaccga gcgccgccgt ctaaaaaggt gatgtgtatt 1140 tgagtaaaac agcttgcgtc atgcggtcgc tgcgtatatg atgcgatgag taaataaaca 1200 aatacgcaag gggaacgcat gaaggttatc gctgtactta accagaaagg cgggtcaggc 1260 aagacgacca tcgcaaccca tctagcccgc gccctgcaac tcgccggggc cgatgttctg 1320 ttagtcgatt ccgatcccca gggcagtgcc cgccattggg cggccgtgcg ggaagatcaa 1380 ccgctaaccg ttgtcggcat cgaccgcccg acgattcacc gcgacgtgaa ggccatcggc 1440 cggcgcgact tcgtagtgat cgacggagcg ccccaggcgg cggacttggc tgtgtccgcg 1500 atcaaggcag ccgacttcgt gctgattccg gtgcagccaa gcccttacga catatgggcc 1560 accgccgacc tggtggagct ggttaagcag cgcattcagg tcacggatgg aaggctacaa 1620 gcggcctttg tcgtgtcgcg ggcgatcaaa gacacgcgca tcggcggtga ggttgccgag 1680 gcgctggccg ggtacgagct gcccattctt cagtcccgta tcacgcagcg cgtgagctac 1740 ccaggcactg ccgccgccgg cacaaccgtt cttgaatcag aacccgaggg cgacgctgcc 1800 cgcgaggtcc aggcgctggc cactgaaatt aaatcaaaac tcatttgagt taatgaggta 1860 aagagaaaat gagcaaaagc acaaacacgc taagtgccgg ccgtccgagc gcacgcagca 1920 gcaaggctgc aacgttggcc agcctggcag acacgtcagc catgaagcgg gtcaactttc 1980 agttgccggc ggaggatcac accaagctga agatg^iacgc ggtacgccaa ggcaagacca 2040 ttaccgagct gctatctgsa tacatcgcgc agctaccaga gtaaatgagc aaatgaataa 2100 atgagtagat gaattttagc ggctaaagga ggcggcatag aaaatcasga acaaccaggc 2160 accgacgccg tggaataccc catgtgtgga ggaacgggcg gttggccagg cgtaagcggc 2220 WO 2002/096923 PCT/US2002/017-151 -5- tgggttgtct gccggccctg caatggcact cgaaccccca agcccgacga atcggcgtga 2280 cggtcgcaaa ccatccggcc cggtacaaat cggcgcggcg ctgggtgatg acctggtgga 2340 gaagttgasg gccgcgcagg ccgcccagcg gcaacgcatc gaggcagaag cacgccccgg 2400 tgaatcgtgg caagcggccg ctgatcgaat ccgcaaacaa tcccggcaac cgccggcagc 2460 cggtgcgccg tcgattagga agccgcccaa gggcgaccag caaccagatt ttttcgttcc 2520 gatgctctat gacgtgggca cccgcgatag tcgcagcatc atggacgtgg ccgttttccg 2580 tctgtcgaag cgtgaccgac gagctggcca ggtgatccgc tacgagcttc cagacgggca 2640 cgtagaggtt tccgcagggc cggccggcat ggccagtgtg tgggattacg acctggtact 2700 gatggcggtt tcccatctaa ccgaatccat gaaccgatac cgggaaggga agggagacaa 2760 gcccggccgc gtgttccgtc cacacgttgc ggacgtactc aagttctgcc ggcgagccga 2820 tggcggaaag cagaaagacg acctggtaga aacctgcatt cggttaaaca ccacgcacgt 2880 tgccatgcag cgtacgaaga aggccaagaa cggccgcctg gtgacggtat ccgagggtga 2940 agccttgatt agccgctaca agatcgtaaa gagcgaaacc gggcggccgg agtacatcga 3000 gatcgagcta gctgattgga tgtaccgcga gatcacagaa ggcaagaacc cagacgtgct 3060 gacggttcac cccgattact ttttgatcga tcccggcatc ggccgttttc tctaccgcct 3120 ggcacgccgc gccgcaggca aggcagaagc cagatggttg ttcaagacga tctacgaacg 3180 cagtggcagc gccggagagt tcaagaagtt ctgtttcacc gtgcgcaagc tgatcgggtc 3240 aaatgacctg ccggagtacg atttgaagga ggaggcgggg caggctggcc cgatcctagt 3300 catgcgctac cgcaacctga tcgagggcga agcatccgcc ggttcctaat gtacggagca 3360 gatgctaggg caaattgccc tagcaaggga aaaaggtcga aaaggtctct ttcctgtgga 3420 tagcacgtac attgggaacc caaagccgta cattgggaac cggaacccgt acattgggaa 3480 cccaaagccg tacattggga accggtcaca catgtaagtg actgatataa aagagaaaaa 3540 aggcgatttt tccgcctaaa actctttaaa acttattaaa actcttaaaa cccgcctggc 3600 ctgtgcataa ctgtctggcc agcgcacagc cgaagagctg caaaaagcgc ctacccttcg 3660 gtcgctgcgc tccctacgcc ccgccgcttc gcgtcggcct atcgcggccg ctggccgctc 3720 aaaaatggct ggcctacggc caggcaatct accagggcgc ggacaagccg cgccgtcgcc 3780 actcgaccgc cggcgcccac atcaaggcac cctgcctcgc gcgtttcggt gatgacggtg 3840 aaaacctctg acacatgcag ctcccggaga cagtcacagc ttgtctgtaa gcggatgccg 3900 ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca 3960 tgacccagtc acgtagcgat agcggagtgt atactggctt aactatgcgg catcagagca 4020 gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg taaggacaaa 4080 ataccgcatc aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg 4140 gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg 4200 ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa 4260 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 4320 acgctcaagt cagaggtggc gasacccgac aggactataa agataccagg cgtttccccc 4380 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 4440 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 4500 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 4560 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 4620 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 4680 gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc 4740 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 4800 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 4860 atctcaagaa gatcctttga tcttttctac ggggtctcac gctcagtgga acgaaaactc 4920 acgttaaggg attttggtca tgcattctsg gtactaaaac aattcatcca gtasaatata 4980 atattttatt ttctcccaat caggcttgat ccccagtaag tcaaaaaata gctcgacata 5040 ctgttcttcc ccgatatcct ccctgstcga ccggacgcag aaggcaatgt cataccactt 5100 gtccgccctg ccgcttctcc caagatcaat aaagccactt actttgccat ctttcacaaa 5160 gatgttgctg tctcccaggt cgccgtggga asagacaagt tcctcttcgg gcttttccgt 5220 ctttaaaaaa tcatacagct cgcgcggatc tttaaatgga gtgtcttctt cccagttttc 5280 gcaatccaca tcggccagat cgttattcag taagtaatcc aattcggcta agcggctgtc 5340 taagctattc gtatagggac aatccgatat gtcgatggag tgsaagagcc tgatgcactc 5400 cgcatacagc tcgataatct tttcagggct ttgttcatct tcatactctt ccgagcaaag 5460 gacgccatcg gcctcactca tgagcagatt gctccagcca tcatgccgtt caaagtgcag 5520 gacctttgga acaggcagct ttccttccag ccatagcatc atgtcctttt cccgttccac 5580 atcataggtg gtccctttat accggctgtc cgtcattttt aaatataggt tttcattttc 5640 tcccaccagc ttatatacct tagcaggaga cattccttcc gtatctttta cgcagcggta 5700 tttttcgatc agttttttca attccggtga tattctcatt ttagccattt attatttcct 5760 tcctcttttc tacagtattt aaagataccc caagaagcta attataacaa gacgaactcc 5820 aattcactgt tccttgcatt ctaaaacctt saataccaga aaacagcttt ttcaaagttg 5880 ttttcaaagt tggcgtatsa- catsgtatcg acccagccga ttttgaaacc gcggtgatca 5940 caggcagcaa cgctctgtca tcgttacaat csacatqcta ccctccgcga gatcatccgt 6000 gtttcaaacc cggcagctta gttgccgttc ttcccaatag catcggtaac atgaacaaag 6060 tctgccgcct tacaacggct ctcccgctga cgccgtcccg gactgatggg ctgcctgtat 6120 cgagtagtga ttttgtgccg agctgccgqt cgggcagctg ttggctggct ggtggcagga 6180 tatattgtgg tgtaaacaaa ttgacgctta gecaacttaa taacacattg cgcacgtttt 6240 WO 2(102/(196923 PCT/US2002/017451 -6- taatgtactg aattaacgcc gaattaattc g999gatctg gattttagta ctggattttg 6300 gttttaggaa ttagaaattt tattaataca agtattttac aaatacaaat acatactaag 6360 ggtttcttat atgctcaaca catgagcgaa accctatagg aaccctaatt cccttatctg 6420 ggaactactc acacattatt atcgagaaac tcgsgtcaaa tctcggtgac gggcaggacc 6480 ggacgaggcg gtaccagcag gctgaagtcc agctaccaaa aacccacatc atgccagttc 6540 ccgtgcttca agccggccgc ccgcagcatg ccgcgggggg catatccgag cgcctcgtgc 6600 atgcgcacgc tcgagtcgtt gggcagcccg atgacagcga ccacgctctt caagccctgt 6660 gcctccaggg acttcagcag gtaggtgtag agcgtggagc ccagtcccgt ccgctggtgg 6720 cggggggaga cgtacacggt cgactcggcc gtccagtcgt aggcgttgcg tgccttccag 6780 oggcccgcgt aggcgatgcc ggcgacctcg ccgtccacct cggcgacgag ccagggatag 6840 cgctcccgca gacggacgag gtcgtccgtc cactcctgcg gttcctgcgg ctcggtacgg 6900 aagttcaccg tgcttgtctc gatgtagtgg ttgacgatgg tgcagaccgc cggcatgtcc 6960 gcctcggtgg cacggcggat gtcggccggg cgtcgttctg ggctcatggt agactcgaga 7020 gagatagatt tgtagagaga gactggtgat ttcagcgtgt cctctccaaa tgaaatgaac 7080 ttccttatat agaggaaggt cttgcgaagg atagtgggat tgtgcgtcat cccttacgtc 7140 agtggagata tcacatcaat ccacttgctt tgaagacgtg gttggaacgt cttctttttc 7200 cacgatgctc ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag aagcatcttg 7260 aacgatagcc tttcctttat cgcaatgatg gcatttgtag gtgccacctt ccttttctac 7320 tgtccttttg atgaagtgac agatagctgg gcaatggaat ccgaggaggt ttcccgatat 7380 taccctttgt tgaaaagtct caatagccct ttggtcttct gagactgtat ctttgatatt 7440 cttggagtag acgagagtgt cgtgctccac catgttatca catcaatcca cttgctttga 7500 agacgtggtt ggaacgtctt ctttttccac gatgctcctc gtgggtgggg gtccatcttt 7560 gggaccactg tcggcagagg catcttgaac gatagccttt cctttatcgc aatgatggca 7620 tttgtaggtg ccaccttcct tttctactgt ccttttgatg aagtgacaga tagctgggca 7680 atggaatccg aggaggtttc ccgatattac cctttgttga aaagtctcaa tagccctttg 7740 gtcttctgag actgtatctt tgatattctt ggagtagacg agagtgtcgt gctccaccat 7800 gttggcaagc tgctctagcc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat 7860 taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 7920 satgtgagtt agctcactca ttaggcaccc caggctttac actttatgct tccggctcgt 7980 atgttgtgtg gaattgtgag cggataacaa tttcacacag gaaacagcta tgaccatgat 8040 tacgaattcg agctcggtac ccggggatcc tctagagtcg acctgcaggc atgcaagctt 8100 ggcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa 8160 tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg cccgcaccga 8220 tcgcccttcc caacagttgc gcagcctgaa tggcgaatgc tagagcagct tgagcttgga 8280 tcagattgtc gtttcccgcc ttcagtttaa actatcagtg tttgacagga tatattggcg 8340 ggtaaaccta agagaaaaga gcgtttatta gaataacgga tatttaaaag ggcgtgaaaa 8400 ggtttatccg ttcgtccatt tgtatgtg 8428 <210> 3 <211> 10549 <212> DNA <213> Artificial Sequence <220> <223> pCambial302 plasmid <300> <308> Genbank #AF234298 <309> 2000-04-24 <400> 3 catggtagat ctgactagta tgaattagat ggtgatgtta tgcaacatac ggaaaactta gtggccaaca cttgtcacta tcatatgaag cggcacgact gaccatcttc ttcaaggacg agacaccctc gtcaacagga cctcggccac aagttggaat gcaaaagaac ggcatcaaag gcaactcgct gatcattatc agacsaccat tscctgtcca ccacatggtc cttcttgagt atacaaagct agccsccacc cccatcgttc aaacatttgg cgatgattat catataattt gcatgacgtt atttatgaga aaggagaaca acttttcact ggagttgtcc caattcttgt 60 atgggcacaa attttctgtc agtggagagg gtgaaggtga 120 cccttaaatt tatttacact actagaaaac tacctgttcc 180 ctttctctta tggtattcaa tgcttttcaa gatacccaga 240 tcttcaagag cgccatgcct gagggatacg tgcaggagag 300 acgggaacta caagacacgt gctgaagtca agtttgaggg 360 tcgagcttaa gggaatcgat ttcaaggagg acggaaacat 420 acaactacaa ctcccacaac gtatacatca tggccgacaa 480 ccaacttcaa gacccgccac aacatcgaag acggcggcgt 540 aacaaaatac tccaattggc gatagccctg tccttttacc 600 cacaatctgc cctttcgaaa gatcccaacg aaaagagaga 660 ttgtsacagc tgctgggatt acacatggca tggatgaact 720 accaccacca cgtgtgaatt gg~yaccagc tcgaatttcc 780 caataaagtt tcttaagatt gastcctgtt gccggtcttg 840 ctgttgaatt acattaagca tgtaataatt aacatgtaat 900 tcggttttta tgattagagt cccgcaatta tacatttaat 960 WO 20(12/(196923 PCT/US2002/017451 -7- scgccataca aaacaaaata tagcgcacaa ctatgttact agatcgggaa ttaaactatc cctaacacaa asgagcgttt attagaataa tccgttcgtc catttgtatg tgcatgccaa ttgatccaac ccctccgctg ctatagtgca tctcaaaacg acatgtcgca caagtcctaa tcctggcgtt ttcttgtcgc gtgctttagt cggsgacatt acgccatgaa caagagcgcc agcaccqacg accaggactt gaccaaccaa aagctgtttt ccgagaagat caccggcacc cttgaccacc tacgccctgg cgacgttgtg agcacccgcg acctactgga cattgccgag agcctggcag agccgtgggc cgacaccacc ttcgccggca ttgccgagtt cgagcgttcc gaggccgcca aggcccgagg cgtgaagttt atcgcgcacg cccgcgagct gatcgaccag ctgcttggcg tgcatcgctc gaccctgtac cccaccgagg ccaggcggcg cggtgccttc ctggcggccg ccgagaatga acgccaagag aggacgaacc gtttttcatt accgaagaga tgttcgagcc gcccgcgcac gtctcaaccg ctgatgccaa gctggcggcc tggccggcca gtctaaaaag gtgatgtgta tttgagtaaa tgatgcgatg agtaaataaa caaatacgca taaccagaaa ggcgggtcag gcaagacgac actcgccggg gccgatgttc tgttagtcga ggcggccgtg cgggaagatc aaccgctaac ccgcgacgtg aaggccatcg gccggcgcga ggcggacttg gctgtgtccg cgatcaaggc aagcccttac gacatatggg ccaccgccga ggtcacggat ggaaggctac aagcggcctt catcggcggt gaggttgccg aggcgctggc tatcacgcag cgcgtgagct acccaggcac agaacccgag ggcgacgctg cccgcgaggt actcatttga gttaatgagg taaagagaaa ggccgtccga gcgcacgcag cagcaaggct gccatgaagc gggtcaactt tcagttgccg gcggtacgcc aaggcaagac cattaccgag gagtaaatga gcaaatgaat aaatgagtag ggaaaatcaa gaacaaccag gcaccgacgc cggttggcca ggcgtaagcg gctgggttgt caagcccgag gaatcggcgt gacggtcgca cgctgggtga tgacctggtg gagaagttga tcgaggcaga agcacgcccc ggtgaatcgt aatcccggca accgccggca gccggtgcgc agcaaccaga ttttttcgtt ccgatgctct tcatggacgt ggccgttttc cgtctgtcga gctaccagct tccagacggg cacgtagagg tgtgggatta cgacctggta ctgatggcgg accggcaagg gaagggagac aagcccggcc tcaagttctg ccggcgagcc gatggcggaa ttcggttaaa caccacgcac gttgccatgc tggtgacggt atccgagggt gaagccttga ccgogcggcc ggagtacatc gagatcgagc aaggcaacaa cccggacgtg ctgacggttc tcggccgttt tctctaccgc ctggcacgcc tgttcaagac gatctacgaa cgcagtggca ccgtgcgcaa gctgatcagg tcaaatgacc cgcaggctgg cccgatccta gtcatgcgct ccggttccta atgtacggag cagatgctag gaaaaggtct ctttcctgtg gatagcacgt accggaaccc gtacattggg aacccaaagc tgactaatat aaaagagaaa aaagocgatt aaactcttaa aacccgcctg qcctgtgcat tgcaaaaagc occtaccctt cggtcgctgc ctatcgcgqc cgctggccgc tcaaaaatgg gcgcacaagc cgcgccgtcg ccaccccacc actaggataa attatcgcgc gcggtgtcat 1020 agtgtttgac aggatatatt ggcgggtaaa 1080 cggatattta aaagggcgtg aaaaggttta 1140 ccacagggtt cccctcggga tcaaagtact 1200 gtcggcttct gacgttcagt gcagccgtct 1260 gttacgcgac aggctgccgc cctgcccttt 1320 cgcataaagt agaatacttg cgactagaac 1380 gccgctggcc tgctgggcta tgcccgcgtc 1440 cgggccgaac tgcacgcggc cggctgcacc 1500 aggcgcgacc gcccggagct ggccaggatg 1560 acagtgacca ggctagaccg cctggcccgc 1620 cgcatccagg aggccggcgc gggcctgcgt 1680 acgccggccg gccgcatggt gttgaccgtg 1740 ctaatcatcg accgcacccg gagcgggcgc 1800 ggcccccgcc ctaccctcac cccggcacag 1860 gaaggccgca ccgtgaaaga ggcggctgca 1920 cgcgcacttg agcgcagcga ggaagtgacg 1980 cgtgaggacg cattgaccga ggccgacgcc 2040 gaacaagcat gaaaccgcac caggacggcc 2100 tcgaggcgga gatgatcgcg gccgggtacg 2160 tgcggctgca tgaaatcctg gccggtttgt 2220 gcttggccgc tgaagaaacc gagcgccgcc 2280 acagcttgcg tcatgcggtc gctgcgtata 2340 aggggaacgc atgaaggtta tcgctgtact 2400 catcgcaacc catctagccc gcgccctgca 2460 ttccgatccc cagggcagtg cccgcgattg 2520 cgttgtcggc atcgaccgcc cgacgattga 2580 cttcgtagtg atcgacggag cgccccaggc 2640 agccgacttc gtgctgattc cggtgcagcc 2700 cctggtggag ctggttaagc agcgcattga 2760 tgtcgtgtcg cgggcgatca aaggcacgcg 2820 cgggtacgag ctgcccattc ttgagtcccg 2880 tgccgccgcc ggcacaaccg ttcttgaatc 2940 ccaggcgctg gccgctgaaa ttaaatcaaa 3000 atgagcaaaa gcacaaacac gctaagtgcc 3060 gcaacgttgg ccagcctggc agacacgcca 3120 gcggaggatc acaccaagct gaagatgtac 3180 ctgctatctg aatacatcgc gcagctacca 3240 atgaatttta gcggctaaag gaggcggcat 3300 cgtggaatgc cccatgtgtg gaggaacggg 3360 ctgccggccc tgcaatggca ctggaacccc 3420 aaccatccgg cccggtacaa atcggcgcgg 3480 aggccgcgca ggccgcccag cggcaacgca 3540 ggcaagcggc cgctgatcga atccgcaaag 3600 cgtcgattag gaagccgccc aagggcgacg 3660 atgacgtggg cacccgccat agtcgcagca 3720 agcgtgaccg acgagctggc gaggtgatcc 3780 tttccgcagg gccggccggc atggccagtg 3840 tttcccatct aaccgaatcc atgaaccgat 3900 gcgtgttccg tccacacgtt gcggacgtac 3960 agcagaaaga cgacctggta gaaacctgca 4020 agcgtacgaa gaaggccaag aacggccgcc 4080 ttagccgcta caagatcgta aagagcgaaa 4140 tagctgattg gatgtaccgc gagatcacag 4200 accccgatta ctttttgatc gatcccggca 4260 gcgccgcagg caaggcagaa gccagatggt 4320 gcgccggaga gttcaagaag ttctgtttca 4380 tgccggagta cgatttgaag gaggaggcgg 4440 accgcaacct gatcgagggc gaagcatccg 4500 ggcaaattgc cctagcaggg gaaaaaggtc 4560 acattqggaa cccaaagccg tacattggga 4620 cgtacattgg caaccggtca cacatgtaag 4680 tttccgccta aaactcttta aaacttatta 4740 aactgtctgg ccagcgcaca gccgaagagc 4800 gctccctacg ccccgccgct tcgcgtcggc 4860 ctggcctacg gccaggcaat ctaccaaagc 4920 gccggcgccc acatcaaggc accctgcctc 4980 WO 2002/096923 PCT/US2002/01745] -8- gcgcgtttcg gtgatcacgg tgaaaacctc gcttgtctgt aagcggatgc cgggagcaga ggcqggtgtc ggggcgcagc catgacccag ttaactstgc ggcatcagag cagattgtac cgcacagatg cgtaaggaga asataccgca actcgctgcg ctcggtcgtt cggctgcggc tacggttatc cacagaatca gggcataacg aaaaggccag gaaccgtaaa aaogccgcgt ctgacgagca tcacasaaat cgacgctcaa aaagatacca ggcgtttccc cctggaagct cgcttaccgg atacctgtcc gcctttctcc caccctgtag gtatctcagt tcggtgtagg aaccccccgt tcagcccgac cgctgcgcct cggtsagaca cgacttatcg ccactagcag ggtatgtagg cggtgctaca gagttcttga ggacagtatt tggtatctgc gctctgctga gctcttgatc cggcaaacaa accaccgctg agattacgcg cagaaaaaaa ggatctcaag acgctcagtg gaacgaaaac tcacgttaag acaattcatc cagtaaaata taatatttta agtcaaaaaa tagctcgaca tactgttctt agaaggcaat gtcataccac ttgtccgccc ttactttgcc atctttcaca aagatgttgc gttcctcttc gggcttttcc gtctttaaaa gagtgtcttc ttcccagttt tcgcaatcca ccaattcggc taagcggctg tctaagctat agtgaaagag cctgatgcac tccgcataca cttcatactc ttccgagcaa aggacgccat catcatgccg ttcaaagtgc aggacctttg tcatgtcctt ttcccgttcc acatcatagg ttaaatatag gttttcattt tctcccacca ccgtatcttt tacgcagcgg tatttttcga ttttagccat ttattatttc cttcctcttt taattataac aagacgaact ccaattcact gaaaacagct ttttcaaagt tgttttcaaa gattttgaaa ccgcggtgat cacaggcagc taccctccgc gagatcatcc gtgtttcsaa agcatcggta acatgagcaa agtctgccgc cggactgatg ggctgcctgt atcgagtggt tgttggctgg ctggtggcag gatatattgt aataacacat tgcggacgtt tttaatgtac tggattttag tactggattt tggttttagg acssatacaa atacatacta agggtttctt ggaaccctaa ttcccttatc tgggaactac gtcgatccac agatccggtc ggcatctact gcgtcggttt ccactatcgg cgagtacttc tctgcgggcg atttgtgtac gcccgacagt tccaccctgc gcccaagctg catcatcgaa gtcaagacca atgcggagca tatacgcccg cctccgctcg aagtagcgcg tctgctgctc gatgttggcg acctcgtatt gggaatcccc tgttatgcgg ccattgtccg tcaggacatt ccggacttcg gggcagtcct cggcccaaag cgcactgacg gtgtcgtcca tcacagtttg gcatatgaaa tcacgccatg tagtgtattg cccgctcgtc tggctaagat cggccgcagc tagaacagcg ggcagttcgg tttcaggcag ggagatgcaa taggtcaggc tctcgctaaa gagcgcggcc gatgcaaagt gccgataaac gctatttacc cgcagaacat atccacgccc ttcgccctcc gagagctgca tcaggtcgga ctcgacagac gtcgcggtga gttcaggctt gaaagctcga gagagataga tttgtagaga aatgaaatga acttccttat atagaagaag atcccttacg tcagtggaga tatcacatca gtcttctttt tccacgatgc tcctcgtggg acaggcatct tgaacgatag cctttccttt tgacacatgc agctcccgga gacggtcaca 5040 caagcccgtc agggcgcgtc agcgggtgtt 5100 tcacgtagcg atagcggagt gtatactggc 5160 tgagagtgca ccatatgcgg tgtgaaatac 5220 tceggcgctc ttccgcttcc tcgctcactg 5280 gagcggtatc agctcactca aaggcggtaa 5340 caggaaagaa catgtgagca aaaggccagc 5400 tgctggcgtt tttccatagg ctccgccccc 5460 gtcagaggtg gcgaaacccg acaggactat 5520 ccctcgtgcg ctctcctgtt ccgaccctgc 5580 cttcgggaag cgtggcgctt tctcatagct 5640 tcgttcgctc caagctgggc tgtgtgcacg 5700 tatccggtaa ctatcgtctt gagtccaacc 5760 cagccactgg taacaggatt agcagagcga 5820 agtggtggcc taactacggc tacactagaa 5880 agccagttac cttcggaaaa agagttggta 5940 gtagcggtgg tttttttgtt tgcaagcagc 6000 aagatccttt gatcttttct acggggtctg 6060 ggattttggt catgcattct aggtacta'aa 6120 ttttctccca atcaggcttg atccccagta 6180 ccccgatatc ctccctgatc gaccggacgc 624 0 tgccgcttct cccaagatca ataaagccac 6300 tgtctcccag gtcgccgtgg gaaaagacaa 6360 aatcatacag ctcgcgcgga tctttaaatg 6420 catcggccag atcgttattc agtaagtaat 6480 tcgtataggg acaatccgat atgtcgatgg 6540 gctcgataat cttttcaggg ctttgttcat 6600 cggcctcact catgagcaga ttgctccagc 6660 gaacaggcag ctttccttcc agccatagca 6720 tggtcccttt ataccggctg tccgtcattt 6780 gcttatatac cttagcagga gacattcctt 6840 tcagtttttt caattccggt gatattctca 6900 tctacagtat ttaaagatac cccaagaagc 6960 gttccttgca ttctaaaacc ttaaatacca 7020 gttggcgtat aacatagtat cgacggagcc 7080 aacgctctgt catcgttaca atcaacatgc 7140 cccggcagct tagttgccgt tcttccgaat 7200 cttacaacgg ctctcccgct gacgccgtcc 7260 gattttgtgc cgagctgccg gtcggggagc 7320 ggtgtaaaca aattgacgct tagacaactt 7380 tgaattaacg ccgaattaat tcgggggatc 7440 aattagaaat tttattgata gaagtatttt 7500 atatgctcaa cacatgagcg aaaccctata 7560 tcacacatta ttatggagaa actcgagctt 7620 ctatttcttt gccctcggac gagtgctggg 7680 tacacagcca tcggtccaga cggccgcgct 7740 cccggctccg gatcggacga ttgcgtcgca 7800 attgccgtca accaagctct gatagagttg 7860 gagtcgtggc gatcctgcaa gctccggatg 7920 catacaagcc aaccacggcc tccagaagaa 7980 gaacatcgcc tcgctccagt caatgaccgc 8040 gttggagccg aaatccgcgt gcacgaggtg 8100 catcagctca tcgagagcct gcgcgacgga 8160 ccagtgatac acatggggat cagcaatcgc 8220 accgattcct tgcggtccga atgggccgaa 8280 gatcgcatcc atagcctccg cgaccggttg 8340 gtcttgcaac gtgacaccct gtgcacggcg 8400 ctccccaatg tcaagcactt ccggaatcgg 8460 ataacgatct ttgtagaaac catcggcgca 8520 tcctacatcg aagctgaaag cacgagattc 8580 gacgctgtcg aacttttcga tcagaaactt 8640 tttcatatct cattgccccc cgggatctgc 8700 gagactggtg atttcagcgt gtcctctcca 8760 gtcttgcgaa ggatagtggg attgtgcgtc 8820 atccacttgc tttgaagacg tggttggaac 8880 tgggggtcca tctttgggac cactgtcggc 8940 atcgcaatqa taocatttgt aggtqccacc 9000 WO 2002/096923 PCT/US2002/017451 ttccttttct actgtccttt tgatgaagtg gtttcccgat attacccttt gttgaaaagt atctttgata ttcttggagt agacgagagt cacttgcttt gaagacgtgg ttggaacgtc cggtccatct ttgggaccac tgtcggcaga gcaatgatgg catttgtagg tgccaccttc gatagctggg caatggaatc cgaggaggtt satagccctt tggtcttctg agactgtatc gtgctccacc atgttggcaa gctgctctag tggccgattc attaatgcag ctcgcacgac cgcaacgcaa ttaatgtgag ttagctcact cttccggctc gtatgttgtg tggaattgtg tatgaccatg attacgaatt cgagctcggt gcatgcaagc ttggcactgg ccgtcgtttt tacccaactt aatcgccttg cagcacatcc ggcccgcacc gatcgccctt cccaacagtt cttgagcttg gatcagattg tcgtttcccg tcaaatagag gacctaacag aactcgccgt cttacgactc aatgacaaga agaaaatctt ctactccaaa aatatcaaag atacagtctc acaaagggta atatccggaa acctcctcgg tgtgaagata gtggaaaagg aaggtggctc ggccatcgtt gaagatgcct ctgccgacag gagcatcgtg gaaaaagaag acgttccaac tatctccact gacgtaaggg atgacgcaca tatataagga agttcatttc atttggagag -9- acagatagct gggcaatgga atccgaggag 9060 ctcaatagcc ctttggtctt ctgagactgt 9120 gtcgtgctcc accatgttat cacatcaatc 9180 ttctttttcc acgatgctcc tcgtgggtgg 9240 ggcatcttga acgatagcct ttcctttatc 9300 cttttctact gtccttttga tgaagtgaca 9360 tcccgatatt accctttgtt gaaaagtctc 9420 tttgatattc ttggagtaga cgagagtgtc 9480 ccaatacgca aaccgcctct ccccgcgcgt 9540 aggtttcccg actggaaagc gggcagtgag 9600 cattaggcac cccaggcttt acactttatg 9660 agcggataac aatttcacac aggaaacagc 9720 acccggggat cctctagagt cgacctgcag 9780 acaacgtcgt cactgggaaa accctggcgt 9840 ccctttcgcc agctggcgta atagcgaaga 9900 gcgcagcctg aatggcgaat gctagagcag 9960 ccttcagttt agcttcatgg agtcaaagat 10020 aaagactggc gaacagttca tacagagtct 10080 cgtcaacatg gtggagcacg acacacttgt 10140 agaagaccaa agggcaattg agacttttca 10200 attccattgc ccagctatct gtcactttat 10260 ctacaaatgc catcattgcg ataaaggaaa 10320 tggtcccaaa gatggacccc cacccacgag 10380 cacgtcttca aagcaagtgg attgatgtga 10440 atcccactat ccttcgcaag acccttcctc 10500 aacacggggg actcttgac 10549 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> CaMV35SpolyA Primer <400> 4 ctgaattaac gccgaattaa ttcgggggat ctg 33 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> CaMV35Spr Primer <400> 5 ctagagcagc ttgccaacat ggtggagca <210> 6 <211> 12592 <212> DNA <213> Artificial Sequence 29 <220> <223> pAg2 Plasmid <400> 6 gtacgaagaa gccgctacaa ctgattggat ccgattactt ccgcaggcaa ccggagagtt ccgagtacga gcaacctgat aaattaccct ggccaagaac gatcgtaasg gtaccgccag tttgatcgat gacacaagcc caagaagttc tttgaaggag cgagggccsa aacaoaacaa oaccgcctgg agcgaaaccg atcacagaag cccggcatcg agatggttgt tgtttcaccg gaggcggggc gcatccgccg aaaggtcgsa tgacggtatc ggcggccgga gcaagaaccc gccgttttct tcaagacgat tgcgcaagct aggctggccc gttcctaatg aaggtctctt cgagggtgaa gtacatcgag ggacgtgctg ctaccgcctg ctacgaacgc catcgggtca catcctagtc t acggagcag tcctqtggat gccttgatta 60 atcgagctag 120 acggttcacc 180 gcacgccgcg 240 agtggcagcg 300 aatgacctgc 360 atgcgctacc 420 atgctagggc 4 80 agcacgtaca 540 WO 2002/096923 PCT/US2002/017451 -10- ttgggaaccc aaagccgtac attgggaacc ggaacccgta cattgggaac ccaaagccgt 600 acattgggaa ccggtcacac atgtaagtga ctgatataaa agagaaaaaa ggcgattttt 660 ccgcctaaaa ctctttaaaa cttattaaaa ctcttaaaac ccgcctggcc tgtgcataac 720 tgtctggcca gcgcacagcc gaagagctgc aaasaacgcc tacccttcgg tcgctgcgct 780 ccctacgccc cgccgcttcg cgtcggccta tcgcggccgc tggccgctca aaaatggctg 840 gcctacggcc agacaatcta ccagggcgcg cacaagccgc gccgtcgcca ctcgaccgcc 900 cgcgcccaca tcaaggcacc ctgcctcgcg cgtttcggtg atgacggtga aaacctctga 960 cacatgcagc tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa 1020 gcccgtcagg gcgcgtcagc gggtgttggc gggtgtcggg gcgcagccat gacccagtca 1080 cgtagcgata gcggagtgta tactggctta actatgcggc atcagagcag attgtactga 1140 gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca 1200 ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag 1260 cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag 1320 gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc 1380 tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc 1440 agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc 1500 tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt 1560 cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg gtgtaggtcg 1620 ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat 1680 ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag 1740 ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt 1800 ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc 1860 cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta 1920 gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag 1980 atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga 2040 ttttggtcat gcattctagg tactaaaaca attcatccag taaaatataa tattttattt 2100 tctcccaatc aggcttgatc cccagtaagt caaaaaatag ctcgacatac tgttcttccc 2160 cgatatcctc cctgatcgac cggacgcaga aggcaatgtc ataccacttg tccgccctgc 2220 cgcttctccc aagatcaata aagccactta ctttgccatc tttcacaaag atgttgctgt 2280 ctcccaggtc gccgtgggaa aagacaagtt cctcttcggg cttttccgtc tttaaaaaat 2340 catacagctc gcgcggatct ttaaatggag tgtcttcttc ccagttttcg caatccacat 2400 cggccagatc gttattcagt aagtaatcca attcggctaa gcggctgtct aagctattcg 2460 tatagggaca atccgatatg tcgatggagt gaaagagcct gatgcactcc gcatacagct 2520 cgataatctt ttcagggctt tgttcatctt catactcttc cgagcaaagg acgccatcgg 2580 cctcactcat gagcagattg ctccagccat catgccgttc aaagtgcagg acctttggaa 2640 caggcagctt tccttccagc catagcatca tgtccttttc ccgttccaca tcataggtgg 2700 tccctttata ccggctgtcc gtcattttta aatataggtt ttcattttct cccaccagct 2760 tatatacctt agcaggagac attccttccg tatcttttac gcagcggtat ttttcgatca 2820 gttttttcaa ttccggtgat attctcattt tagccattta ttatttcctt cctcttttct 2880 acagtattta aagatacccc aagaagctaa ttataacaag acgaactcca attcactgtt 2940 ccttgcattc taaaacctta aataccagaa aacagctttt tcaaagttgt tttcaaagtt 3000 ggcgtataac atagtatcga cggagccgat tttgaaaccg cggtgatcac aggcagcaac 3060 gctctgtcat cgttacaatc sacatgctac cctccgcgag atcatccgtg tttcaaaccc 3120 ggcagcttag ttgccgttct tccgaatagc atcggtaaca tgagcaaagt ctgccgcctt 3180 acaacggctc tcccgctgac gccgtcccgg actgatgggc tgcctgtatc gagtggtgat 3240 tttgtgccga gctgccggtc ggggagctgt tggctggctg gtggcaggat atattgtggt 3300 gtaaacaaat tgacgcttag acaacttaat aacacattgc ggacgttttt aatgtactga 3360 attaacgccg aattaattcg ggggatctgg attttagtac tggattttgg ttttaggaat 3420 tagaaatttt attgatacaa gtattttaca aatacaaata catactaagg gtttcttata 3480 tgctcaacac atgagcgaaa ccctatagga accctaattc ccttatctgg gaactactca 3540 cacattatta tggagaaact cgagtcaaat ctcggtgacg ggcaggaccg gacggggcgg 3600 taccggcagg ctgaagtcca gctgccagaa acccacgtca tgccagttcc cgtgcttgaa 3660 gccggccgcc cgcagcatgc cgcgaggggc atatccgagc gcctcgtgca tgcgcacgct 3720 c999tc9tt9 ggcaacccga tgacagcgac cacgctcttg aagccctgtg cctccaggga 3780 cttcagcagg tgggtgtaga gcgtggagcc cagtcccgtc cgctggtggc ggggggagac 3840 gtacacggtc gactcggccg tccagtcgta ggcgttgcgt gccttccagg ggcccgcgta 3900 ggcgatgccg gcgacctcgc cgtccacctc ggcgacgagc cagggatagc gctcccgcag 3960 acggacgagg tcgtccgtcc actcctgcgg ttcctgcggc tcggtacgga agttgaccgt 4020 gcttgtctcg atgtagtggt tgacgatggt gcagaccgcc ggcatgtccg cctcggtggc 4080 acggcggatg tcggccgggc gtcgttctgg gctcatggta gactcgagag agatagattt 4140 gtagagagag actggtgatt tcagcgtgtc ctctccaaat gaaatgaact tccttatata 4200 gaggaaggtc ttgcgaagga tagtgggatt gtgcgtcatc ccttacgtca gtggagatat 4260 cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc 4320 tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga ggcatcttga acgatagcct 4380 ttcctttatc gcaatgatgg catttgtagg tgccaccttc cttttctact gtccttttga 4440 tgaagtgaca gatagctggg caatggaatc cgagqacqtt tcccgatatt accctttgtt 4500 gaaaagtctc aatagccctt tggtcttctg agactgtatc tttgatattc ttggagtaga 4560 WO 201)2/096923 PCT/US2002/017451 -n- cgagagtgtc gtgctccacc atgttatcac gsacgtcttc tttttccacg atgctcctcg cggcagaggc atcttgaacg atagcctttc caccttcctt ttctactgtc cttttgatga ggaggtttcc cgatattacc ctttgttgaa ctgtatcttt gatattcttg gagtagacga gctctagcca atacgcaaac cgcctctccc gcacgacagg tttcccgact ggaaagcggg gctcactcat taggcacccc aggctttaca aattgtgagc ggataacaat ttcacacagg gccttgacta gagggtcgac ggtatacaca aaccacaact agaatgcagt gaaaaaaatg tttatttgta accattataa gctgcaataa tgagatcccc gcgctggagg atcatccagc acctttcata gaaggcggcg gtggaatcga cggccacgaa gtgcacgcag ttgccggccg gctgctcgcc gatctcggtc atggccggcc cctccgacca ctcggcgtac agctcgtcca tgtccggcac cacctggtcc tggaccgcgc caccggcgaa gtcgtcctcc acgaagtccc cgaccgctcc ggcgacgtcg cgcgcggtga tggatccaga tttcgctcaa gttagtataa atcgacactc tcgtctactc caagaatatc attgagactt ttcaacaaag ggtaatatcg atctgtcact tcatcaaaag gacagtagaa tgcgataaag gaaaggctat cgttcaagat cccccaccca cgaggagcat cgtggaaaaa gtggattgat gtgataacat ggtggagcac gatacagtct cagaagacca aagggctatt aacctcctcg gattccattg cccagctatc gaaggtagca cctacaaatg ccatcattgc tctgccgaca gtggtcccaa agatggaccc gacgttccaa ccacgtcttc aaagcaagtg gatgacgcac aatcccacta tccttcgcaa atttggagag gacacgctga aatcaccagt ttcgcagatc cgggggggca atgagatatg gagaagtttc tgatcgaaaa gttcgacagc gaagaatctc gtgctttcag cttcgatgta agctgcgccg atggtttcta caaagatcgt ctcccgattc cggaagtgct tgacattggg tcccgccgtg cacagggtgt cacgttgcaa ctacaaccgg tcgcggaggc tatggatgcg gggttcggcc cattcggacc gcaaggaatc tgcgcgattg ctgatcccca tgtgtatcac gcgtccgtcg cgcaggctct cgatgagctg cggcacctcg tgcacgcgga tttcggctcc acagcggtca ttgactgcag cgaggcgatg atcttcttct ggaggccgtg gttggcttgt aggcatccgg agcttgcagg atcgccacga caccaactct atcagagctt ggttgacggc cgatgcgacg caatcgtccg atccggagcc agaagcgcgg ccgtctggac cgatggctgt cgccccagca ctcgtccgag ggcaaagaaa gacaagctcg agtttctcca taataatgtg tcctataggg tttcgctcat gtgttgagca tgtaaaatac ttctatcaat aaaatttcta ccagatcccc cgaattsatt cggcgttaat tacaacgtcg tgactgggaa aaccctggcg cccctttcgc cagctggcgt aatagcgaag tgcgcagcct gaatggcgaa tgctagagca gccttcagtt tgggcatcct ctagactgaa agaattaagg gagtcacgtt atgacccccg tggaactgac agaaccgcaa cgttgaagga tgsgctaagc acatacatca csaaccatta atcagctaac aaatatttct tgtcaaaaat gtatccaatt agagtctcat attcactctc atcgaattcc cgcggccgcc atgatagatc atcaatccac ttgctttgaa gacgtggttg 4620 t999t29999 tccatctttg ggaccactgt 4680 ctttatcgca atgatggcat ttgtaggtgc 4740 agtgacagat agctgggcaa tggaatccga 4800 aagtctcaat agccctttgg tcttctgaga 4860 gagtgtcgtg ctccaccatg ttggcaagct 4920 cgcgcgttgg ccgattcatt aatgcagctg 4980 cagtgagcgc aacacaatta atgtgagtta 5040 ctttatgctt ccgactcgta tgttgtgtgg 5100 aaacagctat gaccatgatt acgaattcga 5160 catgataaga tacattgatg agtttggaca 5220 ctttatttgt gaaatttgtg atgctattgc 5280 acaagttggg gtgggcgaag aactccagca 5340 cggcgtcccg gaaaacgatt ccgaagccca 5400 aatctcgtag cacgtgtcag tcctgctcct 5460 ggtcgcgcag ggcgaactcc cgcccccacg 5520 c99a99c9tc ccggaagttc gtggacacga 5580 ggccgcgcac ccacacccag gccagggtgt 5640 tgatgaacag ggtcacgtcg tcccggacca 5700 gggagaaccc gagccggtcg gtccagaact 5760 gcaccggaac ggcactggtc aacttggcca 5820 aaaagcaggc ttcaatcctg caggaattcg 5880 aaagatacag tctcagaaga ccaaagggct 5940 agaaacctcc tcggattcca ttgcccagct 6000 aaggaaggtg gcacctacaa atgccatcat 6060 gcctctgccg acagtggtcc caaagatgga 6120 gaagacgttc caaccacgtc ttcaaagcaa 6180 gacactctcg tctactccaa gaatatcaaa 6240 gagacttttc aacaaagggt aatatcggga 6300 tgtcacttca tcaaaaggac agtagaaaag 6360 gataaaggaa aggctatcgt tcaagatgcc 6420 ccacccacga ggagcatcgt ggaaaaagaa 6480 gattgatgtg atatctccac tgacgtaagg 6540 gaccttcctc tatataagga agttcatttc 6600 ctctctctac aaatctatct ctctcgagct 6660 aaaaagcctg aactcaccgc gacgtctgtc 6720 gtctccgacc tgatgcagct ctcggagggc 6780 ggsgggcgtg gatatgtcct, gcgggtaaat 6840 tatgtttatc ggcactttgc atcggccgcg 6900 gagtttagcg agagcctgac ctattgcatc 6960 gacctgcctg aaaccgaact gcccgctgtt 7020 atcgctgcgg ccgatcttag ccagacgagc 7080 ggtcaataca ctacatggcg tgatttcata 7140 tggcaaactg tgatggacga caccgtcagt 7200 atgctttggg ccgaggactg ccccgaagtc 7260 aacaatgtcc tgacggacaa tggccgcata 7320 ttcggggatt cccsatacga ggtcgccaac 7380 atggagcagc agacgcgcta cttcgagcgg 7440 ctccgggcgt atatgctccg cattggtctt 7500 aatttcgatg atgcagcttg ggcgcagggt 7560 gggactgtcg ggcgtacaca aatcgcccgc 7620 gtagaagtac tcgccgatag tggaaaccga 7680 tagagtagat gccgaccgga tctgtcgatc 7740 tgagtaattc ccagataagg gaattagggt 7800 tataagaaac ccttagtatg tatttgtatt 7860 attcctaaaa ccaaaatcca gtactaaaat 7920 tcagatcaag cttggcactg gccgtcgttt 7980 ttacccaact taatcgcctt gcagcacatc 8040 aggcccgcac ccatcgccct tcccaacagt 8100 gcttgagctt agatcagatt gtcgtttccc 8160 ggcggaaaac gacaatctga tcatgagcga 8220 ccgatcacgc gggacaagcc gttttacgtt 8280 gccactcagc cgcoggtttc tggagtttaa 8340 ttgcgcgttc aaaagtcgcc taaggtcact 8400 gctccactga cattccataa attcccctcg 8460 aatccasata atctgcaccg gatctcgaaa 8520 tgactaataa agcagaagaa cttttcactg 8580 WO 2002/096923 PCT/US2002/017451 gagttgtccc aattcttgtt gaattagatg gtggagaggg tgaaggtgat gcaacatacg ctggaaaact acctgttccg tggccaacac gcttttcaag atacccagat catatgasgc sgggatacgt gcacgagagg accatcttct ctgaagtcaa gtttgaggga gacaccctcg tcaaggagga cggaaacatc ctcggccaca tatacatcat ggccgacaag caaaacaacg acatcgaaga cggcggcgtg caactcgctg atggccctgt ccttttacca gacaaccatt atcccaacga aaagagagac cacatggtcc cacatggcat ggatgaacta tacaaagcta gtgaccagct cgaatttccc cgatcgttca aatcctgttg ccggtcttgc gatgattatc gtaataatta acatgtaatg catgacgtta ccgcaattat acatttaata cgcgatagaa ttatcgcgcg cggtgtcatc tatgttacta ggatatattg gcgggtaaac ctaagagaaa aagggcgtga aaaggtttat ccgttcgtcc ccctcgggat caaagtactt tgatccaacc acgttcagtg cagccgtctt ctgaaaacga ggctgccgcc ctgccctttt cctggcgttt gaatacttgc gactagaacc ggagacatta gctgggctat gcccgcgtca gcaccgacga gcacgcggcc agctgcacca agctgttttc cccggagctg gccaggatgc ttgaccacct gctagaccgc ctggcccgca gcacccgcga ggccggcgcg ggcctgcgta gcctggcaga ccgcatggtg ttgaccgtgt tcgccggcat ccgcacccgg agcgggcgcg aggccgccaa taccctcacc ccggcacaga tcgcgcacgc cgtgaaagag gcggctgcac tgcttggcgt gcgcagcgag gaagtgacgc ccaccgaggc attgaccgag gccgacgccc tggcggccgc aaaccgcacc aggacggcca ggacgaaccg atgatcgcgg ccgggtacgt gttcgagccg gaaatcctgg ccggtttgtc tgatgccaag gaagaaaccg agcgccgccg tctaaaaagg catgcggtcg ctgcgtatat gatgcgatga tgaaggttat cgctgtactt aaccagaaag atctagcccg cgccctgcaa ctcgccgggg agggcagtgc ccgcgattgg gcggccgtgc tcgaccgccc gacgattgac cgcgacgtga tcgacggagc gccccaggcg gcggacttgg tgctgattcc ggtgcagcca agcccttacg tggttaagca gcgcattgag gtcacggatg gggcgatcaa aggcacgcgc atcggcggtg tgcccattct tgagtcccgt atcacgcagc gcacaaccgt tcttgaatca gaacccgagg ccgctgaaat taaatcaaaa ctcatttgag cacaaacacg ctaagtgccg gccgtccgag cagcctggca gacacgccag ccatgaagcg caccaagctg aagatgtacg cggtacgcca atacatcgcg cagctaccag agtaaatgag cggctaaaqg aggcggcatg gaaaatcaag ccatgtgtgg aggaacgggc ggttggccag gcaatggcac tggaaccccc aagcccgagg ccggtacaaa tcggcgcggc gctgggtgat gccgcccagc ggcaacgcat cgaggcagaa gctgatcgaa tccgcaaaga atcccagcaa aagccgccca agggcgacga gcaaccagat acccgcgata gtcgcagcat catggacgtg cgagctggcg aggtgatccg ctacgagctt ccggccggca tggccagtgt gtgggattac accgaatcca tcaaccgata ccgggaaggg ccacacgttg cggacgtact caagttctgc gacctggtag aaacctgcat tcggttaaac -12- gtgatgttaa tgggcacaaa ttttctgtca 8640 gaaaacttac ccttaaattt atttgcacta 8700 ttgtcactac tttctcttat ggtgttcaat 8760 ggcacgactt cttcaagagc gccatgcctg 8820 tcaaggacga cgggaactac aagacacgtg 8880 tcaacacgat cgagcttaag ggaatcgatt 8940 agttggaata caactacaac tcccacaacg 9000 qcatcaaagc caacttcaag acccaccaca 9060 atcattatca acaaaatact ccaattggcg 9120 acctgtccac acaatctgcc ctttcgaaag 9180 ttcttgagtt tgtaacagct gctgggatta 9240 gccaccacca ccaccaccac gtgtgaattg 9300 aacatttggc aataaagttt cttaagattg 9360 atataatttc tgttgaatta cgttaagcat 9420 tttatgagat gggtttttat gattagagtc 9480 aacaaaatat agcgcgcaaa ctaggataaa 9540 gatcgggaat taaactatca gtgtttgaca 9600 agagcgttta ttagaataac ggatatttaa 9660 atttgtatgt gcatgccaac cacagggttc 9720 cctccgctgc tatagtgcag tcggcttctg 9780 catgtcgcac aagtcctaag ttacgcgaca 9840 tcttgtcgcg tgttttagtc gcataaagta 9900 cgccatgaac aagagcgccg ccgctggcct 9960 ccaggacttg accaaccaac gggccgaact 10020 cgagaagatc accggcacca ggcgcgaccg 10080 acgccctggc gacgttgtga cagtgaccag 10140 cctactggac attgccgagc gcatccagga 10200 gccgtgggcc gacaccacca cgccggccgg 10260 tgccgagttc gagcgttccc taatcatcga 10320 ggcccgaggc gtgaagtttg gcccccgccc 10380 ccgcgagctg atcgaccagg aaggccgcac 10440 gcatcgctcg accctgtacc gcgcacttga 10500 caggcggcgc ggtgccttcc gtgaggacgc 10560 cgagaatgaa cgccaagagg aacaagcatg 10620 tttttcatta ccgaagagat cgaggcggag 10680 cccgcgcacg tctcaaccgt gcggctgcat 10740 ctggcggcct ggccggccag cttggccgct 10800 tgatgtgtat ttgagtaaaa cagcttgcgt 10860 gtaaataaac aaatacgcaa ggggaacgca 10920 gcgggtcagg caagacgacc atcgcaaccc 10980 ccgatgttct gttagtcgat tccgatcccc 11040 gggaagatca accgctaacc gttgtcggca 11100 aggccatcgg ccggcgcgac ttcgtagtga 11160 ctgtgtccgc gatcaaggca gccgacttcg 11220 acatatgggc caccgccgac ctggtggagc 11280 gaaggctaca agcggccttt gtcgtgtcgc 11340 aggttgccga ggcgctggcc gggtacgagc 11400 gcgtgagcta cccaggcact gccgccgccg 11460 gcgacgctgc ccgcgaggtc caggcgctgg 11520 ttaatgaggt aaagagaaaa tgagcaaaag 11580 cgcacgcagc agcaaggctg caacgttggc 11640 ggtcaacttt cagttgccgg cggaggatca 11700 aggcaagacc attaccgagc tgctatctga 11760 caaatgaata aatgagtaga tgaattttag 11820 aacaaccagg caccgacgcc gtggaatgcc 11880 gcgtaagcgg ctgggttgtc tgccggccct 11940 aatcggcgtg acggtcgcaa accatccggc 12000 gacctggtgg agaagttgaa ggccgcgcag 12060 gcacgccccg gtgaatcgtg gcaagcggcc 12120 ccgccggcag ccggtgcgcc gtcgattagg 12180 tttttcgttc cgatgctcta tgacgtgggc 12240 gccgttttcc gtctgtcgaa gcgtgaccga 12300 ccagacgggc acgtagaggt ttccgcaggg 12360 gacctggtac tgatggcggt ttcccatcta 12420 aagggagaca agcccggccg cgtgttccgt 12480 cggcgagccg atggcggaaa gcagaaagac 12540 accacqcacg ttaccatqca ac 12592 WO 2002/096923 PCT/US2002/0] 7451 <210> 7 <211> 3357 <212> DNA <213> Artificial Sequence <220> <223> pGEMEasyNOS Plasmid <400> 7 tatcactagt gaattcgcgg ccgcctgcag tggatgcata gcttgagtat tctatagtgt tagctgtttc ctgtgtgaaa ttgttatccg agcataaagt gtaaagcctg gggtgcctaa cgctcactgc ccgctttcca gtcgggaaac caacgcgcgg ggagaggcgg tttgcgtatt tcgctgcgct cggtcgttcg gctgcggcga cggttatcca cagaatcagg ggataacgca aaggccagga accgtaaaaa ggccgcgttg gacgagcatc acasaaatcg acgctcaagt agataccagg cgtttccccc tggaagctcc cttaccagat acctgtccgc ctttctccct cgctgtaggt atctcagttc ggtgtaggtc ccccccgttc agcccgaccg ctgcgcctta gtaagacacg acttatcgcc actggcagca tatgtaggcg gtgctacaga gttcttgaag acagtatttg gtatctgcgc tctgctgaag tcttgatccg gcaaacaaac caccgctggt attacgcgca gaaaaaaagg atctcaagaa gctcagtgga acgaaaactc acgttaaggg ttcacctaga tccttttaaa ttaaaaatga taaacttggt ctgacagtta ccaatgctta ctatttcgtt catccatagt tgcctgactc ggcttaccat ctggccccag tgctgcaatg gatttatcag caataaacca gccagccgga ttatccgcct ccatccagtc tattaattgt gttaatagtt tgcgcaacgt tgttgccatt tttggtatgg cttcattcag ctccggttcc atgttgtgca aaaaagcggt tagctccttc gccgcagtgt tatcactcat ggttatggca tccgtaagat gcttttctgt gactggtgag atgcggcgac cgagttgctc ttgcccggcg agaactttaa aagtgctcat cattggaaaa ttaccgctgt tgagatccag ttcgatgtaa tcttttactt tcaccagcgt ttctgggtga aagggaataa gggcgacacg gaaatgttga tgaagcattt atcagggtta ttgtctcatg aataaacaaa taqgggttcc gcgcacattt aataccgcac agatgcgtaa ggagaaaata ttgttasaat tcgcgttaaa tttttgttaa atcggcaaaa tcccttataa atcaaasgaa gtttggaaca agagtccact attaaagaac gtctatcagg gcgatggccc actacgtgaa aggtgccgta aagcactaaa tcggaaccct gcaaagccgg cgaacgtggc gagaaacgaa gcgctcgcaa gtgtagcggt cacgctgcgc ccgctacsgg gcgcgtccat tcgccattca tgcgggcctc ttcgctatta cgccagctgg gttgggtaac gccagggttt tcccagtcac aatacgactc actatagggc gsattgggcc gccgcgggaa ttcgattctc gagatccggt gactctaatt ggataccgag gggaatttat atatttgcta gctgatagtg accttaggcg gtatgtgctt agctcattsa actccsgaaa ggttctgtca gttccaaacg tesaacggct tcactccctt aattctccgc tcatgatcag -13- gtcgaccata tgggagagct cccaacgcgt 60 cacctsaata gcttggcgta atcatggtca 120 ctcacaattc cacacaacat acgagccgga 180 tgagtgagct aactcacatt aattgcgttg 240 ctgtcgtgcc agctgcatta atgaatcggc 300 gggcgctctt ccgcttcctc gctcactgac 360 gcggtatcag ctcactcaaa ggcggtaata 420 ggaaagaaca tgtgagcaaa aggccagcaa 480 ctggcgtttt tccataggct ccgcccccct 540 cagaggtggc gaaacccgac aggactataa 600 ctcgtgcgct ctcctgttcc gaccctgccg 660 tcgggaagcg tggcgctttc tcatagctca 720 gttcgctcca agctgggctg tgtgcacgaa 780 tccggtaact atcgtcttga gtccaacccg 840 gccactggta acaggattag cagagcgagg 900 tggtggccta actacggcta cactagaaga 960 ccagttacct tcggaaaaag agttggtagc 1020 agcggtggtt tttttgtttg caagcagcag 1080 gatcctttga tcttttctac ogggtctgac 1140 attttggtca tgagattatc aaaaaggatc 1200 agttttaaat caatctaaag tatatatgag 1260 atcagtgagg cacctatctc agcgatctgt 1320 cccgtcgtgt agataactac gatacgggag 1380 ataccgcgag acccacgctc accggctcca 1440 agggccgagc gcagaagtgg tcctgcaact 1500 tgccgggaag ctagagtaag tagttcgcca 1560 actacaggca tcgtggtgtc acgctcgtcg 1620 caacgatcaa ggcgagttac atgatccccc 1680 ggtcctccga tcgttgtcag aagtaagttg 1740 gcactgcata attctcttac tgtcatgcca 1800 tactcaacca agtcattctg agaatagtgt 1860 tcaatacggg ataataccgc gccacatagc 1920 cgttcttcgg ggcgaaaact ctcaaggatc 1980 cccactcgtg cacccaactg atcttcagca 2040 gcsaaaacag gaaggcaaaa tgccgcaaaa 2100 atactcatac tcttcctttt tcaatattat 2160 agcggataca tatttgaatg tatttagaaa 2220 ccccgaaaag tgccacctga tgcggtgtga 2280 ccgcatcagg aaattgtaag cgttaatatt 2340 atcagctcat tttttaacca ataggccgaa 2400 tagaccgaga tagggttgag tgttgttcca 2460 gtggactcca acgtcaaagg gcgaaaaacc 2520 ccatcaccct aatcaagttt tttggggtcg 2580 sasgggagcc ccccatttag agcttgacgg 2640 gogaagaaag cgaaaggagc aggcgctagg 2700 gtaaccacca cacccgccgc gcttaatgcg 2760 ggctgcgcaa ctgttgagaa gggcgatcgg 2820 cgaaaggggg atgtgctaca aggcgattaa 2880 gacgttgtaa aaccacggcc agtgaattgt 2940 cgacgtcgca tgctcccggc cgccatggcg 3000 gcagattatt tggattgaga gtgaatatga 3060 ggaacgtcag tggagcattt ttgacaagaa 3120 acttttgaac gcacaataat ggtttctgac 3180 cccgcggctg agtggctcct tcaacgttgc 3240 tgtcccgcgt catcggcggg agtcataacg 3300 attgtcgttt cccgccttca gtctaga 3357 <210> 8 WO 2002/096923 PCT/US2002/017451 -14- <211> 10122 <212> DNA <213> Artificial Sequence <220> <223> pl302NOS Plasmid <400> 6 catggtagat ctgactagta aaggagaaga acttttcact ggagttgtcc caattcttgt 60 tgaattagat ggtgatgtta atgggcacaa attttctgtc agtggagagg gtgaaggtga 120 tgcsacatac ggaaaactta cccttaaatt tatttgcact actggaaaac tacctgttcc 180 gtggccaaca cttgtcacta ctttctctta tggtgttcaa tgcttttcaa gatacccaga 240 tcatatgaag cggcacgact tcttcaagag cgccatgcct gagggatacg tgcaggagag 300 gaccatcttc ttcaaggacg acgggaacta caagacacgt gctgaagtca agtttgaggg 360 agacaccctc gtcaacagga tcgagcttaa gggsatcgat ttcaaggagg acggaaacat 420 cctcggccac aagttggaat acsactacaa ctcccacaac gtatacatca tggccgacaa 480 gcaaaagaac ggcatcaaag ccaacttcaa gacccgccac aacatcgaag acggcggcgt 540 gcaactcgct gatcattatc aacaaaatac tccaattggc gatggccctg tccttttacc 600 agacaaccat tacctgtcca cacaatctgc cctttcgaaa gatcccaacg aaaagagaga 660 ccacatggtc cttcttgagt ttgtaacagc tgctgggatt acacatggca tggatgaact 720 atacaaagct agccaccacc accaccacca cgtgtgaatt ggtgaccagc tcgaatttcc 780 cccatcgttc aaacatttgg caatasagtt tcttaacatt gaatcctgtt gccggtcttg 840 cgatgattat catataattt ctgttgaatt acgttaagca tgtaataatt aacatgtaat 900 gcatgacgtt atttatgaga tgggttttta tgattagagt cccgcaatta tacatttaat 960 acgcgataga aaacaaaata tagcgcgcaa actagcataa attatcgcgc gcggtgtcat 1020 ctatgttact agatcgggaa ttaaactatc agtgtttgac aggatatatt ggcgggtaaa 1080 cctaagagaa aagagcgttt attagaataa cggatattta aaagggcgtg aaaaggttta 1140 tccgttcgtc catttgtatg tgcatgccaa ccacagggtt cccctcggga tcaaagtact 1200 ttgatccaac ccctccgctg ctatagtgca gtcggcttct gacgttcagt gcagccgtct 1260 tctgaaaacg acatgtcgca caagtcctaa gttacgcgac aggctgccgc cctgcccttt 1320 tcctggcgtt ttcttgtcgc gtgttttagt cgcataaagt agaatacttg cgactagaac 1380 cggagacatt acgccatgaa caagagcgcc gccgctggcc tgctgggcta" tgcccgcgtc 1440 agcaccgacg accaggactt gaccaaccaa cgggccgaac tgcacgcggc cggctgcacc 1500 aagctgtttt ccgagaagat caccggcacc aggcgcgacc gcccggagct ggccaggatg 1560 cttgaccacc tacgccctgg cgacgttgtg acagtgacca ggctagaccg cctggcccgc 1620 agcacccgcg acctactgga cattgccgag cgcatccagg aggccggcgc gggcctgcgt 1680 agcctggcag agccgtgggc cgacaccacc acgccggccg gccgcatggt gttgaccgtg 1740 ttcgccggca ttgccgagtt cgagcgttcc ctaatcatcg accgcacccg gagcgggcgc 1800 gaggccgcca aggcccgagg cgtgaagttt ggcccccgcc ctaccctcac cccggcacag 1860 atcgcgcacg cccgcgagct gatcgaccag gaaggccgca ccgtgaaaga ggcggctgca 1920 ctgcttggcg tgcatcgctc gaccctgtac cgcgcacttg agcgcagcga ggaagtgacg 1980 cccaccgagg ccaagcggcg cggtgccttc cgtgaggacg cattgaccga ggccgacgcc 2040 ctggcggccg ccgagaatga acgccaagag gaacaagcat gaaaccgcac caggacggcc 2100 aggacgaacc gtttttcatt accgaagaga tcgaggcgga catgatcgcg gccgggtacg 2160 tgttcgagcc gcccgcgcac gtctcaaccg tgcggctgca tgaaatcctg gccggtttgt 2220 ctgatgccaa gctggcggcc tggccggcca gcttggccgc tgaagaaacc gagcgccgcc 2280 gtctaaaaag gtgatgtgta tttgagtaaa acagcttgcg tcatgcggtc gctgcgtata 2340 tcatgcgatg agtaaataaa caaatacgca aggggaacgc atgaaggtta tcgctgtact 2400 taaccagaaa ggcgggtcag gcaagacgac catcgcaacc catctagccc gcgccctgca 2460 actcgccggg gccgatgttc tgttagtcga ttccgatccc cagggcagtg cccgcgattg 2520 ggcggccgtg cgggaagatc aaccgctaac cgttgtcggc atcgaccgcc cgacgattga 2580 ccgcgacgtg aaggccatcg gccggcgcga cttcgtagtg atcgacggag cgccccaggc 264 0 cgcggacttg gctgtgtccg cgatcaaggc agccgacttc gtgctgattc cggtgcagcc 2700 aagcccttac gacatatggg ccaccgccga cctggtggag ctqgttaagc agcgcattga 2760 ggtcacggat ggaaggctac aagcggcctt tgtcgtgtcg cgggcgatca aaggcacgcg 2820 catcggcggt gaggttgccg aggcgctggc cgggtacgag ctgcccattc ttgagtcccg 2880 tatcacgcag cgcgtgagct acccaggcac tgccgccgcc ggcacaaccg ttcttgaatc 2940 agaacccgag ggcgacgctg cccgcgaggt ccaagcgctg gccgctgaaa ttaaatcaaa 3000 actcatttga gttaatgagg taaagagaaa atgagcaaaa gcacaaacac gctaagtgcc 3060 ggccgtccga gcgcacgcag cagcaaggct gcaacgttgg ccagcctggc agacacgcca 3120 gccatgaagc gggtcaactt tcagttgccg gcggaggatc acaccaagct gaagatgtac 3180 gcggtacgcc aaggcaagac cattaccgag ctgctatctg aatacatcgc gcagctacca 3240 csotaaatga gcaaatgaat aaatgagtag atgaatttta gc ~>ctaaag gaggcggcat 3300 ggaaaatcaa gaacaaccag gcaccgacgc cgtc-jaatgc cc tqtgtg gaggaacggg 3360 ccgttggcca cgcgtaagcg gctgggttgt ctgccggccc tc. ^atggca ctggaacccc 3420 casgccccag gaatcggcgt gacggtcgca aaccatccgg cc ' -gtacaa atcggcgcgg 3480 cgctgggtga cgacctggtg cagaagttga aggccgcgca ggccgcccag cggcaacgca 3540 WO 2002/096923 PCT/US2002/017451 -15- tcgaggcaga agcacgcccc ggtcaatcgt ggcaagcggc cgctcatcga atccgcaaag 3600 aatcccggca accgccggca gccggtgcgc cgtcgattag caagccgccc aagggcgacg 3660 agcaaccaga ttttttcgtt ccgatgctct atgacgtggg cacccgcgat agtcgcagca 3720 tcatgcacgt ggccgttttc cgtctgtcga agcgtgaccg acgagctggc gaggtgatcc 3780 gctacgagct tccagacggg cacgtagegg tttccgcagg qccggccggc atggccagtg 3840 tgtgggatta cgacctggta ctgatggcgg tttcccatct aaccgaatcc atgaaccgat 3900 accgggaagg gaagggagac aagcccggcc gcgtgttccg tccacacgtt gcggacgtac 3960 tcaagttctg ccggcgagcc gatggcggaa agcagaaaga cgacctggta gaaacctgca 4020 ttcggttaaa caccacgcac gttgccatgc agcgtacgaa gaaggccaag aacggccgcc 4080 tqgtgacggt atccgagggt gaagccttga ttagccgcta caagatcgta aagagcgaaa 4140 ccgggcggcc ggagtacatc gagatcgagc tagctgattg gatgtaccgc gagatcacag 4200 aaggcaagaa cccggacgtg ctgacggttc accccgatta ctttttgatc gatcccggca 4260 tcggccgttt tctctaccgc ctggcacgcc gcgccgcagg caaggcagaa gccagatggt 4320 tgttcaagac gatctacgaa cgcagtggca gcgccggaga gttcaagaag ttctgtttca 4380 ccgtgcgcaa gctgatcggg tcaaatgacc tgccggagta cgatttgaag gaggaggcgg 4440 qgcaggctgg cccgatccta gtcatgcgct accgcaacct gatcgagggc gaagcatccg 4 500 ccggttccta atgtacggag cagatgctag agcaaattgc cctagcaggg gaaaaaggtc 4560 gaaaaggtct ctttcctgtg gatagcacgt acattgggaa cccaaagccg tacattggga 4620 accggaaccc gtacattggg aacccaaagc cgtacattgg gaaccggtca cacatgtaag 4680 tqactgatat aaaagagaaa aaaggcgatt tttccgccta aaactcttta aaacttatta 4740 aaactcttaa aacccgcctg gcctgtgcat aactgtctgg ccagcgcaca gccgaagagc 4 800 tgcaaaaagc gcctaccctt cggtcgctgc gctccctacg ccccgccgct tcgcgtcggc 4 860 ctatcgcggc cgctggccgc tcaaaaatgg ctggcctacg gccaggcaat ctaccagggc 4 920 gcggacaagc cgcgccgtcg ccactcgacc gccggcgccc acatcaaggc accctgcctc 4 980 gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc agctcccgga gacggtcaca 5040 gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt 5100 ggcgggtgtc ggggcgcagc catgacccag tcacgtagcg atagcggagt gtatactggc 5160 ttaactatgc ggcatcagag cagattgtac tgagagtgca ccatatgcgg tgtgaaatac 5220 cgcacagatg cgtaaggaga aaataccgca tcaggcgctc ttccgcttcc tcgctcactg 5280 actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa 5340 tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc 54 00 aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc 5460 ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat 5520 aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc 5580 cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct 5640 cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg 5700 aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 5760 cqgtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga 5820 agtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa 5880' agacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta 5940 gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc 6000 agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg 6060 acgctcagtg aaacgaaaac tcacgttaag ggattttggt catgcattct aggtactaaa 6120 acaattcatc cagtaaaata taatatttta ttttctccca atcaggcttg atccccagta 6180 agtcaaasaa tagctcgaca tactgttctt ccccgatatc ctccctgatc gaccggacgc 6240 agaaggcaat gtcataccac ttgtccgccc tgccgcttct cccaagatca ataaagccac 6300 ttactttgcc atctttcaca asgatgttgc tgtctcccag gtcgccgtgg gaaaagacaa 6360 qttcctcttc gggcttttcc gtctttaaaa aatcatacag ctcgcgcgga tctttaaatg 6420 qagtgtcttc ttcccagttt tcgcaatcca catcggccag atcgttattc agtaagtaat 6480 ccaattcggc taagcggctg tctaagctat tcgtataggg acaatccgat atgtcgatgg 6540 agtgaaagag cctgatgcac tccgcataca gctcgataat cttttcaggg ctttgttcat 6600 cttcatactc ttccgagcaa acgacgccat cggcctcact catgagcaga ttgctccagc 6660 catcat'gccg ttcaaagtgc aggacctttg gaacaggcag ctttccttcc agccatagca 6720 tcatgtcctt ttcccgttcc acatcatagg tggtcccttt ataccggctg tccgtcattt 6780 ttaaatatag gttttcattt tctcccacca gcttatatac cttagcagga gacattcctt 6840 ccgtatcttt tacgcagcgg tatttttcga tcagtttttt caattccggt gatattctca 6900 ttttagccat ttattatttc cttcctcttt tctacagtat ttaaagatac cccaagaagc 6960 taattataac aagacgaact ccaattcact gttccttgca ttctaaaacc ttaaatacca 7020 caaaacagct ttttcaaagt tgttttcaaa gttggcgtat aacatagtat cgacggagcc 7080 gattttgaaa ccgcggtgat cacaggcagc aacgctctgt catcgttaca atcaacatgc 7140 taccctccgc gagatcatcc gtgtttcaaa cccggcagct tagttgccgt tcttccgaat 7200 agcatcggta acatgagcaa agtctgccgc cttacaacgg ctctcccgct gacgccgtcc 7260 cqcactgatg ggctgcctgt atcgagtggt gattttgtgc ccagctgccg gtcggggagc 7320 tgttggctgg ctggtggcag gatatattgt ggtgtaaaca aattgacgct tagacaactt 7380 sataacacat tgcggacgtt tttaatgtac tgaattaacg ccgaattaat tcgggggatc 7440 tggattttag tactggattt tggttttagg aattacaaat tttattgata gaagtatttt 7500 acaaatacaa atacatacta agggtttctt atatgctcaa cacatgagcg aaaccctata 7560 WO 2002/096923 PCT/US2002/0] 7451 -16- cgaaccctaa ttcccttatc tgggaactac tcacacatta ttatggagaa actcgagctt 7620 gtcgatcgac agatccggtc qgcatctact ctatttcttt accctcogac gagtgctggg 7680 gcgtcggttt ccactatcgg cgagtacttc tacacagcca tcggtccaga cggccgcgct 7740 tctgcgggcg atttgtgtac gcccgacagt cccggctccg gatcggacga ttgcgtcgca 7800 tcgaccctgc gcccaagctg catcatcgaa attgccgtca accaagctct gatagagttg 7860 gtcsagacca atgcgcagca tatacgcccg gagtcgtggc catcctgcaa gctccggatg 7920 cctccgctcg aagtagcgcg tctgctgctc catacaagcc aaccacggcc tccagaagaa 7980 gatgttggcg acctcgtatt gggaatcccc gaacatcgcc tcgctccagt caatgaccgc 8040 tgttatgcgg ccattgtccg tcaggacatt gttggagccg aaatccgcgt gcacgaggtg 8100 ccggacttcg aggcagtcct cggcccaaag catcagctca tcgagagcct gcgcgacgga 8160 cgcactgacg gtgtcgtcca tcacagtttg ccagtgatac acatggggat cagcaatcgc 8220 gcatatgaaa tcacgccatg tagtgtattg accgattcct tgcggtccga atgggccgaa 8280 cccgctcgtc tggctaegat cggccgcagc gatcgcatcc atagcctccg cgaccggttg 8340 tagaacagcg ggcagttcgg tttcaggcag gtcttgcaac gtgacaccct gtgcacggcg 8400 ggagatgcaa taggtcaggc tctcgctaaa ctccccaatg tcaagcactt ccggaatcgg 8460 gagcgcggcc gatgcaaagt gccgataaac ataacgatct ttgtagaaac catcggcgca 8520 gctatttacc cgcaggacat atccacgccc tcctacatcg aagctgaaag cacgagattc 8580 ttcgccctcc gagsgctgca tcaggtcgga gacgctgtcg aacttttcga tcagaaactt 8640 ctcgacagac gtcgcggtga gttcaggctt tttcatatct cattgccccc ccggatctgc 8700 gaaagctcga gagagataga tttgtagaga gagactggtg atttcagcgt gtcctctcca 8760 aatgaaatga acttccttat atagaggaag gtcttgcgaa ggatagtggg attgtgcgtc 8820 atcccttacg tcagtggaga tatcacatca atccacttgc tttgaagacg tggttggaac 8880 gtcttctttt tccacgatgc tcctcgtggg tgggggtcca tctttgggac cactgtcggc 8940 agaggcatct tgaacgatag cctttccttt atcgcaatga tggcatttgt aggtgccacc 9000 ttccttttct actgtccttt tgatgaagtg acagatagct gggcaatgga atccgaggag 9060 gtttcccgat attacccttt gttgaaaagt ctcaatagcc ctttggtctt ctgagactgt 9120 atctttgata ttcttggagt agacgagagt gtcgtgctcc accatgttat cacatcaatc 9180 cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc acgatgctcc tcgtgggtgg 9240 gqgtccatct ttgggaccac tgtcggcaga ggcatcttga acgatagcct ttcctttatc 9300 gcaatgatgg catttgtagg tgccaccttc cttttctact gtccttttga tgaagtgaca 9360 gatagctggg caatggaatc cgaggaggtt tcccgatatt accctttgtt gaaaagtctc 9420 aatagccctt tggtcttctg agactgtatc tttgatattc ttggagtaga cgagagtgtc 9480 gtgctccacc atgttggcaa gctgctctag ccaatacgca aaccgcctct ccccgcgcgt 9540 tggccgattc attaatgcag ctggcacgac aggtttcccg actggaaagc gggcagtgag 9600 cgcaacgcaa ttaatgtgag ttagctcact cattaggcac cccaggcttt acactttatg 9660 cttccggctc gtatgttgtg tggaattgtg agcggataac aatttcacac aggaaacagc 9720 tatgaccatg attacgaatt cgagctcggt acccggggat cctctagact gaaggcggga 9780 aacgacaatc tgatcatgag cggagaatta agggagtcac gttatgaccc ccgccgatga 9840 cgcgggacaa gccgttttac gtttggaact gacagaaccg caacgttgaa ggagccactc 9900 agccgcgggt ttctggagtt taatgagcta agcacatacg tcagaaacca ttattgcgcg 9960 ttcaaaagtc gcctaaggtc actatcagct agcaaatatt tcttgtcaaa aatgctccac 10020 tgacgttcca taaattcccc tcggtatcca attagagtct catattcact ctcaatccaa 10080 ataatctgca ccggatctcg agaatcgaat tcccgcggcc gc 1012.2 <210> 9 <211> 621 <212> DNA <213> Artificial Sequence <220> <223> N. tabacum rDNA intergnic spacer (IGS) sequence <300> <308> Genbank SY08422 <309> 1997-10-31 <400> 9 gtgctagcca gctggcggtg tgcagcggtg gttattggtg ttacatattt tgttttataa ttctccattg attttttcgt tttacaatgt tttggtgttg atgtttaaca atgcaaaatt tttgatatcg gttggtcatc tttattaaat aatattttat ttttttctat tttataataa ttsaaagtca tacatqtcta agatgtcaag gcggtggttc gaatcactta tatatatttt ttatgcattg tattttatgt atttataata atstttatta tttgtgaata ttatgattct cacaatgaat gagcggtagt tggtqgttgt tataataata tttgtatttt gttatattat attttcttat aaaaaaatat tattcoctcc ctoqccaaaa gttggtggtt gatcggcgat cacaatggag ttaagtattt taaatagttt tacttgatat ttttttttgt tatttttgta gttgtacttc catgtctact agtggtcgtg ggttggtgtt gtgcgtcatg tacctatttt ttatcgtact attggaaatt tttattatgt aaatatatca tttttgt gca cctgtcactt 60 120 180 240 300 360 420 480 540 600 WO 2002/096923 PCT/US2002/017451 gggttttttt ttttaagaca t <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer NTIGS-F1 <400> 10 gtgctagcca atgtttaaca agatg <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer NTIGS-RI <400> 11 atgtcttaaa aaaaaaaacc caagtgac <210> 12 <211> 233 <212> DNA <213> Mus musculus -17- 621 25 <300> <308> Genbank SV00846 <309> 1989-07-06 <400> 12 gacctggaat atagcgagaa cgtgaaatat ggcgaggaaa cgtggaatat ggcaagaaaa tgaaaaatga cgaaatcact aactgaaaat cacggaaaat actgaaaaag gtggaaaatt ctgaaaatca tcgaaaatga aaaaaacgtg aaaaatgaga gagaaataca cactttagga 60 tagaaatgtc cactgtagga 120 gaaacatcca cttgacgact 180 aatgcacact gaa 233 <210> 13 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer MSAT-F1 <400> 13 aataccgcgg aaacttcacc tggaatatcg c 31 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer MSAT-RI <400> 14 ataaccgcgg sgtccttcag tgtgcat 27 <210> 15 <211> 277 <212> DNA <213> Artificial Seq-aence <220> WO 2002/096923 PCT/US2002/017451 -18- <223> Nopaline Synthase Promoter Fragment <300> <308> Genebank nU09365 <309> 1997-10-17 <4 00> .15 gagctcgaat ttccccgatc gttcaaacat ttgacsataa agtttcttaa gattgaatcc 60 tgttgccggt cttgcgatga ttatcatata atttctgttg aattacgtta agcatgtaat 120 aattaacatg taatgcatga cgttatttat gagatgggtt tttatgatta gagtcccgca 180 attatacatt taatacgcga tagaaaacsa aatatagcgc gcaaactagg ataaattatc 240 gcgcgcggtg tcatctatgt tactagatcg ggaattc 277 <210> 16 <211> 1812 <212> DNA <213> Escherichia coli <220> <221> CDS <222> (1)...(1812) <223> Beta-glucuronidase <300> <308> Genbank #S69414 <3 09> 1994-09-23 <4 00> 16 atg tta cgt cct gta gaa acc cca acc cgt gaa ate aaa aaa ctc gac 48 Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu lie Lys Lys Leu Asp 15 10 15 ggc ctg tgg gca ttc agt ctg gat cgc gaa aac tgt gga att gat cag 96 Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly lie Asp Gin 20 25 30 cgt tgg tog gaa age gcg tta caa gaa age egg gca att get gtg cca 144 Arg Trp Trp Glu Ser Ala Leu Gin Glu Ser Arg Ala lie Ala Val Pro 35 40 45 ggc agt ttt aac gat cag ttc gee gat gca gat att cgt aat tat gcg 192 Gly Ser Phe Asn Asp Gin Phe Ala Asp Ala Asp lie Arg Asn Tyr Ala 50 55 60 ggc aac gtc tgg tat cag cgc gaa gtc ttt ata ccg aaa ggt tgg gca 240 Gly Asn Val Trp Tyr Gin Arg Glu Val Phe lie Pro Lys Gly Trp Ala 65 70 75 80 ggc cag cgt ate gtg ctg cgt ttc gat gcg gtc act cat tac ggc aaa 288 Gly Gin .Arg lie Val Leu Arg Phe Asp Ala Val Thr His' Tyr Gly Lys 85 90 95 gtg tgg gtc aat aat cag gaa gtg atg gag cat cag ggc ggc tat acg 336 Val Trp Val Asn Asn Gin Glu Val Met Glu His Gin Gly Gly Tvr Thr 100 105 110 cca ttt gaa gec gat gtc acg ccg tat gtt att gcc ggg aaa agt gta 384 Pro Phe Glu Ala Asp Val Thr Pro Tyr Val lie Ala Gly Lys Ser Val 115 120 125 cgt ate acc gtt tgt gtg aac aac gaa ctg aac tgg cag act ate ccg 432 Arg lie Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gin Thr lie Pro 130 135 140 ccg gga atg gtg att acc gac caa aac ggc aag aaa aag cag tct tac 480 Pro Gly Met Val He Thr Asp Glu Asn Gly Lys Lys Lys Gin Ser Tyr 145 150 155 160 WO 2002/096923 PCT/US2002/017451 -19- ttc cat gat ttc ttt aac tat gcc gga ate cat cgc age gta atg etc 528 Phe His Asp Phe Phe Asn Tyr Ala Gly lie His Arg Ser Val Met Leu 165 170 175 tac acc acg ccg aac acc tgg gtg gac cat ate acc gtg gtg acg cat Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp lie Thr Val Val Thr His 180 185 190 576 gtc gcg caa gac tgt aac cac gcg tct gtt gac tgg cag gtg gtg gcc 624 Val Ala Gin Asp Cys Asn His Ala Ser Val Asp Trp Gin Val Val Ala 195 200 205 aat ggt gat gtc age gtt gaa ctg cgt cat gcg gat caa cag gtg gtt 672 Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gin Gin Val Val 210 215 220 gca act gga caa ggc act age ggg act ttg caa gtg gtg aat ccg cac 720 Ala Thr Gly Gin Gly Thr Ser Gly Thr Leu Gin Val Val Asn Pro His 225 230 235 240 ctc tgg caa ccg ggt gaa ggt tat ctc tat gaa ctg tgc gtc aca gcc 768 Leu Trp Gin Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255 aaa age cag aca gag tgt gat ate tac ccg ctt cgc gtc ggc ate egg 816 Lys Ser Gin Thr Glu Cys Asp He Tyr Pro Leu Arg Val Gly lie Arg 260 265 270 tea gtg gca gtg aag ggc gaa cag ttc ctg att aac cac aaa ccg ttc 864 Ser Val Ala Val Lys Gly Glu Gin Phe Leu lie Asn His Lys Pro Phe 275 280 285 tac ttt act ggc ttt ggt cgt cat gaa gat gcg cac ttg cgt ggc aaa 912 Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Leu Arg Gly Lys 290 295 300 gga ttc gat aac gtg ctg atg gtg cac cac cac gca tta atg gac tgg 960 Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310 315 320 att ggg gcc aac tcc tac cgt acc teg cat tac cct tac get gaa gag 1008 lie Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 atg ctc gac tgg gca gat gaa cat ggc ate gtg gtg att gat gaa act 1056 Met Leu Asp Trp Ala Asp Glu His Gly lie Val Val lie Asp Glu Thr 340 345 350 get get gtc ggc ttt aac ctc tct tta ggc att ggt ttc gaa gcg ggc 1104 Ala Ala Val Gly Phe Asn Leu Ser Leu Gly lie Gly Phe Glu Ala Gly 355 360 365 aac aag ccg aaa gaa ctg tac age caa gag gca gtc aac ggg gaa act 1152 Asn Lys Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 cag caa gcg cac tta cag gcg att aaa gag ctg ata gcg cgt gac aaa 1200 Gin Gin Ala His Leu Gin Ala lie Lys Glu Leu lie Ala Arg Asp Lys 385 390 395 400 aac cac cca age gtg gtg atg tgg agt att gcc aac gaa ccg gat acc 1248 Asn His Pro Ser Val Val Met Trp Ser lie Ala Asn Glu Pro Asp Thr 405 410 415 cgt ccg caa cgt gca egg caa tat ttc gcg cca ctg gcg gaa gca acg 1296 Arg Pro Gin Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr WO 2002/096923 PCT/US2002/017451 -20- 420 425 430 cgt aaa ctc gac ccg acg cgt ccg ate acc tgc gtc aat gta atg ttc 1344 Arg Lys Leu Asp Pro Thr Arg Pro lie Thr Cys Val Asn Val Met Phe 4 35 4 40 445 tgc gac get cac acc gat acc ate age gat ctc ttt gat gtg ctg tgc 1392 Cys Asp Ala His Thr Asp Thr lie Ser Asp Leu Phe Asp Val Leu Cys 450 455 460 ctg aac cgt tat tac gga tgg tat gtc caa age ggc gat ttg caa acg 1440 Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gin Ser Gly Asp Leu Glu Thr 465 470 475 480 gca gag aag gta ctg gaa aaa gaa ctt ctg gcc tgg cag gag aaa ctg 1488 Ala Glu Lys Val Leu Glu Lys Glu Leu Leu Ala Trp Gin Glu Lys Leu 485 490 495 cat cag ccg att ate ate acc gaa tac ggc gtg gat acg tta gcc ggg 1536 His Gin Pro lie lie lie Thr Glu Tyr Gly Val Asp Thr Leu Ala Gly 500 505 510 ctg cac tea atg tac acc gac atg tgg agt gaa gag tat cag tgt gca 1584 Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gin Cys Ala 515 520 525 tgg ctg gat atg tat cac cgc gtc ttt gat cgc gtc age gcc gtc gtc 1632 Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val 530 535 540 ggt gaa cag gta tgg aat ttc gcc gat ttt gcg acc teg caa ggc ata 1680 Gly Glu Gin Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gin Gly lie 545 550 555 560 ttg cgc gtt ggc ggt aac aag aaa ggg ate ttc act cgc gac cgc aaa 1728 Leu Arg Val Gly Gly Asn Lys Lys Gly lie Phe Thr Arg Asp Arg Lys 565 570 575 ccg aag teg gcg get ttt ctg ctg caa aaa cgc tgg act ggc atg aac 1776 Pro Lys Ser Ala Ala Phe Leu Leu Gin Lys Arg Trp Thr Gly Met Asn 580 585 590 ttc ggt gaa aaa ccg cag cag gga ggc aaa caa tga 1812 Phe Gly Glu Lys Pro Gin Gin Gly Gly Lys Gin * 595 * 600 <210> 17 <211> 603 <212> PRT <213> Escherichia coli <300> <308> Genbank SS69414 <309> 1994-09-23 <4 00> 17 Met Leu Arg Pro Val Glu Thr Pro Thr Arg Glu lie Lys Lys Leu Asp 1 5 10 ' 15 Gly Leu Trp Ala Phe Ser Leu Asp Arg Glu Asn Cys Gly lie Asp Gin 20 25 30 Ara Trp Trp Glu Ser Ala Leu Gin Glu Ser Arg Ala He Ala Val Pro 35 40 45 Gly Ser Phe Asn Asp Gin Phe Ala Asp Ala Asp lie Arg Asn Tyr Ala 50 55 60 Gly Asn Val Trp Tyr Gin Arg Glu Val Phe lie Pro Lvs Gly Trp Ala 65 70 75 80 WO 2002/096923 PCT/US2002/017451 -21- Gly Gin Arg lie Val Leu Arg Phe Asp Ala Val Thr His Tyr Gly Lys 85 90 95 Val Trp Val A.sn Asn Gin Glu Val Met Glu His Gin Gly Gly Tyr Thr 100 105 110 Pro Phe Glu Ala Asp Val Thr Pro Tyr Val lie Ala Gly Lys Ser Val 115 120 125 Arg lie Thr Val Cys Val Asn Asn Glu Leu Asn Trp Gin Thr lie Pro 130 135 140 Pro Gly Met Val lie Thr Asp Glu Asn Gly Lys Lys Lys Gin Ser Tyr 145 150 155 160 Phe His Asp Phe Phe Asn Tyr Ala Gly He His A.rg Ser Val Met Leu 165 170 175 Tyr Thr Thr Pro Asn Thr Trp Val Asp Asp lie Thr Val Val Thr His 180 185 190 Val Ala Gin Asp Cys Asn His Ala Ser Val Asp Trp Gin Val Val Ala 195 200 205 Asn Gly Asp Val Ser Val Glu Leu Arg Asp Ala Asp Gin Gin Val Val 210 215 220 Ala Thr Gly Gin Gly Thr Ser Gly Thr Leu Gin Val Val Asn Pro His 225 230 235 240 Leu Trp Gin Pro Gly Glu Gly Tyr Leu Tyr Glu Leu Cys Val Thr Ala 245 250 255 Lys Ser Gin Thr Glu Cys Asp lie Tyr Pro Leu Arg Val Gly lie Arg 260 265 270 Ser Val Ala Val Lys Gly Glu Gin Phe Leu lie A.sn His Lys Pro Phe 275 280 285 Tyr Phe Thr Gly Phe Gly Arg His Glu A.sp Ala Asp Leu Arg Gly Lys 290 295 300 Gly Phe Asp Asn Val Leu Met Val His Asp His Ala Leu Met Asp Trp 305 310 315 320 lie Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu 325 330 335 Met Leu Asp Trp Ala Asp Glu His Gly lie Val Val lie Asp Glu Thr 340 345 350 Ala Ala Val Gly Phe A.sn Leu Ser Leu Gly lie Gly Phe Glu Ala Gly 355 360 365 Asn Lys Pro Lys Glu Leu Tyr Ser Glu Glu Ala Val Asn Gly Glu Thr 370 375 380 Gin Gin Ala His Leu Gin Ala lie Lys Glu Leu lie Ala Arg Asp Lys 385 390 395 400 Asn His Pro Ser Val Val Met Trp Ser lie Ala Asn Glu Pro Asp Thr 405 410 415 Arg Pro Gin Gly Ala Arg Glu Tyr Phe Ala Pro Leu Ala Glu Ala Thr 420 425 430 Arg Lys Leu Asp Pro Thr Arg Pro lie Thr Cys Val Asn Val Met Phe 435 440 445 Cys Asp Ala His Thr Asp Thr He Ser Asp Leu Phe A.sp Val Leu Cys 450 455 460 Leu Asn Arg Tyr Tyr Gly Trp Tyr Val Gin Ser Gly Asp Leu Glu Thr 465 470 475 480 Ala Glu Lys Val Leu Glu Lys Glu Leu Leu Ala Trp Gin Glu Lys Leu 485 490 495 His Gin Pro lie lie He Thr Glu Tyr Gly Val A.sp Thr Leu Ala Gly 500 505 510 Leu His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Gin Cys Ala 515 520 525 Trp Leu Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Val Val 530 535 540 Gly Glu Gin Val Trp Asn Phe Ala Asp Phe Ala Thr Ser Gin Gly lie 545 550 555 560 Leu Arg Val Gly Gly Asn Lys Lys Gly lie Phe Thr Arg Asp Arg Lys 565 570 575 Pro Lvs Ser Ala Ala Phe Leu Leu Gin Lys Arg Trp Thr Gly Met Asn 580 585 590 Phe Gly Glu Lys Pro Gin Gin Gly Gly Lys Gin 595 600 WO 2002/096923 PCT/US2002/017-451 -22- <210> 18 <211> 277 <212> DNA <213> Artificial Sequence <220> <223> Nopaline Synthase Terminator Sequence <300> <308> Genbank #1309365 <309> 1995-10-17 <400> 18 gagctcgaat ttccccgatc gttcaaacat ttggcaataa agtttcttaa gattgaatcc 60 tgttgccggt cttgcgatga ttatcatata atttctgttg aattacgtta agcatgtaat 120 aattaacatg tsatgcatga cgttatttat gagatgggtt tttatgatta gagtcccgca 180 attatacatt taatacgcga tagaaaacaa aatatagcgc gcaaactagg ataaattatc 240 gcgcgcggtg tcatctatgt tactagatcg ggaattc 277 <210> 19 <211> 3438 <212> DNA <213> Artificial Sequence <220> <223> pLIT38attBZeo Plasmid <400> 19 tcgaccctct gtcgtgactg tcgccagctg gcctgsatgg gttaactacg tttctaaata ataatattga ttttgcggca tgctgaagat gatccttgag gctatgtggc acactattct tggcatgaca caacttactt gggggatcat cgacgagcgt tggcgaacta agttgcagga tggagccggt ctcccgtatc acagatcgct ctcatatata aagattgtat aatttttgtt aaatcaaaag ctattaasga ccactacgtg aatcggaacc gaaaggaagg cgctgcgcgt atctaggtga ttccactgag ctgcgcgtaa ccggatcaag ccaaatactg ccgcctacat tcgtgtctta tgsacggagg tacctacsgc agtcaaggcc ggaaaaccct gcgtaatagc cgaatggcgc tcaggtggca cattcaaata ca85O0a5Q3 ttttgccttc cagttgggtg agttttcgcc gcggtattat cagaatgact gtaagagaat ctgacaacga gtaactcgcc gacaccacga cttactctag ccacttctgc gagcgtgggt gtagttatct gagataggtg ctttagattg aagcaaatat aaatcagctc aatagcccga acgtggactc aaccatcacc ctaaagggag gaagaaagcg aaccaccaca agatcctttt cgtcagaccc tctgctgctt agctaccaac ttcttctagt acctcgct ct ccgggttgga gttcgtgcac gtgagctatg ttaagtgagt ggcgttaccc gaagaggccc ttcgcttggt cttttcgggg tgtatccgct gtatgagtat ctgtttttgc cacgagtggg ccgaagaacg cccgtgttga tggttgagta tatgcagtgc tcggaggacc ttgatcgttg tgcctgtagc cttcccggca gctcggccct ctcgcggtat acacgacggg cctcactgat atttaccccg ttaaattgta attttttaac gatagggttg caacgtcaaa caaatcaagt cccccgattt aaaggagcgg cccgccgcgc tgataatctc cgtagaaaag 0Cdo3C5a33 tctttttccg gtagccgtag gctaatcctg ctcaagaega acagcccagc sgaaagcgcc cgtattacgg aacttaatcg gcaccgatcg aataaagccc aaatgtgcgc catgagacaa tcaacatttc tcacccagaa ttacatcgaa ttctccaatg cgccgggcaa ctcaccagtc tgccataacc gaaggagcta ggaaccggag aatggcaaca acaattaata tccggctggc cattgcagca gagtcaggca taagcattgg gttgataatc aacgttaata caataggccg agtgttgttc gggcgaaaaa tttttggggt agagcttgac gcgctagggc ttaatgcgcc atgaccaaaa atcaaaggat asaccaccgc aaggtaactg ttaggccacc ttaccagtgg taqttaccgg ttgcagccaa acacttccca actggccgtc ccttgcagca cccttcccaa gcttcggcgg ggaaccccta taaccctgat cgtgtcgccc acgctggtga ctggatctca atgagcactt gagcaactcg acagaaaagc atgagtaata accgcttttt ctgaatgaag acgttgcgca gactgqatgg tggtttattg ctggggccag actatggatg taactgtcag agaaaagccc ttttgttaaa aaatcggcaa cagtttggaa ccgtctatca cgaggtgccg ggggaaagcg gctggcaagt gctacagggc tcccttaacg cttcttgaga taccagcggt gcttcagcag acttcaagaa ctgctgccag ataaggcgca ccacctacac aacogagaaa gttttacaac catccccctt cagttgcgca gctttttttt tttgtttatt aaatgcttca ttattccctt aagtaaaaga acagcggtaa ttaaagttct gtcgccgcat atcttacgga acactgcggc tgcacaacat ccataccaaa aactattaac aggcggataa ctgataaatc atggtaagcc aaccaaatag accaagttta caaaaacagg attcgcgtta aatcccttat caagagtcca gggcgatggc taaagcacta aacgtggcga gtagcggtca gcgtaaaagg tgagttttcg tccttttttt ggtttgtttg agcgcagata ctctgtagca tggccataag gcggtcgggc cgaactgaga ggcggacagg 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2160 2220 2280 2340 WO 2002/096923 PCT/US2002/0] 7451 -23- tatccggtaa gcctggtatc tgatgctcat ttcctagcct accccaggct acaatttcac ctagtgaagc tgctttttta ccggtgctca ttctccccgg ttcatcagcg cgcggcctgg gcctccgggc cgcgacccgg cgagatttcg gacgccggct aacttgttta aataaagcat tatcatgtct <210> 20 <211> 3451 <212> DNA <213> Artificial Sequence <220> <223> Hindlll Fragment containing the beta-glucuronidase coding sequence, the rDNA intergenic spacer, and the Mastl sequence <400> 20 aagcttgacc tggaatatcg cgagtaaact gaaaatcacg gaaaataaga aatacacact 60 ttaggacgtg aaatatggcg aggaaaactg aaaaaggtgg aaaatttaga aatgtccact 120 gtaggacgtg gaatatggca agaaaactga aaatcatgga aaatgagaaa catccacttg 180 acgacttgaa aaatgacgaa atcactaaaa aacgtgaaaa atgagaaatg cacactgaag 240 gactccgcgg gaattcgatt gtgctagcca atgtttaaca agatgtcaag cacaatgaat 300 gttggtggtt ggtggtcgtg gctggcggtg gtggaaaatt gcggtggttc gagcggtagt 360 gatcggcgat ggttggtgtt tgcagcggtg tttgatatcg gaatcactta tggtggttgt 420 cacaatggag gtgcgtcatg gttattggtg gttagtcatc tatatatttt tataataata 480 ttaagtattt tacctatttt ttacatattt tttattaaat ttatgcattg tttgtatttt 540 taaatagttt ttatcgtact tgttttataa aatattttat tattttatgt gttatattat 600 tacttgatgt attaaaaatt ttctccattg ttttttctat atttataata attttcttat 660 ttttttttgt tttattatgt attttttcgt tttataataa atatttatta aaaaaaatat 720 tatttttgta aaatatatca tttacaatgt ttaaaagtca tttgtgaata tattagctaa 780 gttgtacttc tttttgtgca tttggtgttg tacatgtcta ttatgattct ctggccaaaa 840 catgtctact cctgtcactt gggttttttt ttttaagaca taatcactag tgattatatc 900 tagactgaag gcgggaaacg acaatctgat catgagcgga gaattaaggg agtcacgtta 960 tgacccccgc cgatgacgcg agacaagccg ttttacgttt gcaactcaca gaaccgcaac 1020 gttgsaggag ccactcagcc gcgggtttct ggagtttaat gagctaagca catacgtcag 1080 aaaccattat tgcgcgttca aaagtcgcct aaggtcacta tcsgctagca aatatttctt 1140 gtcaaaaatg ctccactgac gttccataaa ttcccctcgg tatccaatta gagtctcata 1200 ttcactctca atccaaataa tctgcaccgg atctcgagat cgaattcccg cggccgcgaa 1260 ttcactagtg gatccccggg tacggtcagt cccttatgtt acgtcctgta gaaaccccaa 1320 cccgtgaaat caaaaaactc gacggcctgt gggcattcag tctggatcgc gaaaactgtg 1380 gaattgagca gcgttggtag gaaagcgcgt tacaagaaag ccgggcaatt gctgtgccag 1440 gcagttttaa caatcagttc gccgatgcag atattcgtaa ttatgtgggc aacgtctggt 1500 atcagcgcga agtctttata ccgaaaggtt gggcaggcca gcgtatcgtg ctgcgtttcg 1560 atgcggtcac tcattacggc aaagtgtagg tcaataatca ggaagtgatg gagcatcagg 1620 gcggctatac gccatttgaa gccgatgtca cgccgtatgt tattgccggg aaaagtgtac 1680 gtatcacagt ttgtgtgaac aacgaactga actggcagac tatcccgccg ggaatggtga 1740 ttaccgacga aaacagcaag aaaaagcagt cttacttcca tgatttcttt aactacgccg 1800 gcatccatcg cagcgtaatg ctctacacca cgccgaacac ctgggtggac gatatcaccg 1860 tgatgacgca tgtcgcgcaa gactgtaacc acgcgtctgt tgactggcag gtggtggcca 1920 atggtcatgt cagcgttgaa ctgcgtgatg cgcatcaaca ggtggttgca actggacaag 1980 gcaccagcgg cactttgcaa gtggtgaatc cacacctctg gcaaccgggt gaaggttatc 2040 tctatgaact gtacgtcaca gccaaaagcc acacagagtg tcatatctac ccgctgcgcg 2100 tcggcatccg gtcaatggca gtgaagggcg aacagttcct gatcaaccac aaaccgttct 2160 gcggcagggt cggaacaaga gagcccacga gggagcttcc acggggaaac 2400 tttatagtcc tgtcgggttt caccacctct gacttgagcg tcgatttttg 2460 caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 2520 tttgctggcc ttttgctcac atgtaatgtg agttagctca ctcattaggc 2580 ttacacttta tgcttccggc tcgtatgttg tgtggaattg tgagcggata 2640 acaggaaaca gctatgacca tgattacgcc aagctacgta atacgactca 2700 ccgtgcaatt gaagcccgct ggcgccaagc ttctctgcag cattgaagcc 2760 tactaacttg agcgaaatct ggatccatgg ccaagttgac cagtgccgtt 2820 ccgcgcgcga egtcgccgga gcagtcgagt tctggaccga ccggctcggg 2880 acttcgtgga ggacgacttc gccggtgtgg tccgggacga cgtgaccctg 2940 cggtccagga ccaggtggtg cccgacaaca ccctggcctg ggtgtgggtg 3000 acgagctgta cgccgagtgg tcgcaagtcg tgtccacgaa cttccgggac 3060 cggccatgac cgagatcggc gagcagccgt gggggcggga gttcgccctg 3120 ccggcaactg cgtgcacttc gtggccgagg agcaggactg acacgtgcta 3180 attccaccgc cgccttctat gaaaggttgg gcttcggaat cgttttccgg 3240 ggatgatcct ccagcgcggg gatctcatgc tggagttctt cgcccacccc 3300 ttgcagctta taatggttac aastaaagca atagcatcac aaatttcaca 3360 ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 3420 gtataccg 3438 WO 2002/096923 PCT/US2002/0174 -24- actttactgg ctttggccgt catgaagatg cggatttgcg cggcaaagga ttcgataacg 2220 tgctgatggt gcacgatcac gcattaatgg actggattag ggccaactcc taccgtacct 2280 cgcattaccc ttacgctgaa gagatgctcg actgggcaga tgaacatggc atcgtggtga 2340 ttgatgaaac tgcagctgtc ggctttaacc tctctttagg cattggtttc gaagcgggca 2400 acaagccgaa agaactgtac agcgaagaqg cagtcaacgg ggaaactcag caggcgcact 2460 tacaggcgat taaagagctg atagcgcgtg acaaaaacca cccaagcgtg gtgatgtgga 2520 gtattgccaa cgaaccggat acccgtccgc aaggtgcacg ggaatatttc gcgccactgg 2580 cggaagcaac gcgtaaactc gatccgacgc gtccgatcac ctgcgtcaat gtaatgttct 2640 gcgacgctca caccgatacc atcagcgatc tctttgatgt gctgtgcctg aaccgttatt 2700 acggttggta tgtccaaagc ggcgatttgg aaacggcaga gaaggtactg gaaaaagaac 2760 ttctggcctg gcaggagaaa ctgcatcagc cgattatcat caccgaatac ggcgtggata 2820 cgttagccgg gctgcactca atgtacaccg acatgtggag tgaagagtat cagtgtgcat 2880 ggctggatat gtatcaccgc gtctttgatc gcgtcagcgc cgtcgtcggt gaacaggtat 2940 ggaatttcgc cgattttgcg acctcgcaag gcatattgcg cgttggcggt aacaagaagg 3000 ggatcttcac ccgcgaccgc aaaccgaagt cggcggcttt tctgctgcaa aaacgctgga 3060 ctggcatgaa cttcggtgaa aaaccgcagc agggaggcaa acaatgaatc aacaactctc 3120 ctggcgcacc atcgtcggct acagcctcgg gaattgcgta ccgagctcga atttccccga 3180 tcgttcaaac atttggcaat aaagtttctt aagattgaat cctgttgccg gtcttgcgat 3240 gattatcata taatttctgt tgaattacgt taagcatgta ataattaaca tgtaatgcat 3300 gacgttattt atgagatggg tttttatgat tagagtcccg caattataca tttaatacgc 3360 gatagaaaac aaaatatagc gcgcaaacta ggataaatta tcgcgcgcgg tgtcatctat 3420 gttactagat cgggaattcg atatcaagct t 3451 <210> 21 <211> 14627 <212> DNA <213> Artificial Sequence <220> <223> pAglla Plasmid <400> 21 catgccaacc acagggttcc cctcgggatc atagtgcagt cggcttctga cgttcagtgc agtcctaagt tacgcgacag gctgccgccc gttttagtcg cataaagtag aatacttgcg agagcgccgc cgctggcctg ctgggctatg ccaaccaacg ggccgaactg cacgcggccg ccggcaccag gcgcgaccgc ccggagctgg acgttgtgac agtgaccagg ctagaccgcc ttgccgagcg catccagga.g gccggcgcgg acaccaccac gccggccggc cgcatggtgt agcgttccct aatcatcgac cgcacccgga tgaagtttgg cccccgccct accctcaccc tcgaccagga aggccgcacc gtgaaagagg ccctgtaccg cgcacttgag cgcagcgagg gtgccttccg tgaggacgca ttgaccgagg gccaagagga acaagcatga aaccgcacca cgaagagatc caggcggaga tgatcgcggc ctcaaccgtg cggctgcatg aaatcctggc gccggccagc ttggccgctg aagaaaccga tgagtaaaac agcttgcgtc atgcggtcgc aatacgcaag qggaacgcat gaaggttatc aagacgacca tcgcaaccca tctagcccgc ttagtcgatt ccgatcccca gggcagtgcc ccgctaaccg ttgtcggcat cgaccgcccg cggcgcgact tcgtagtgat cgacggagcg atcaaggcag ccgacttcgt gctgattccg accgccgacc tggtggagct ggttaagcag gcggcctttg tcgtgtcgcg ggcgatcaaa gcgctggccg agtacgagct gcccattctt ccaggcactg ccgccgccgg cacaaccgtt cgcgaggtcc aggcgctggc cgctgaaatt aagaaaaaat gagcaaaagc acaaacacgc gcasggctgc aacgttggcc agcctggcag agttgccggc cgaggatcac accaagctga ttaccqaqct actatctgaa tacstcacoc aaagtacttt gatccaaccc ctccgctgct 60 agccgtcttc tgaaaacgac atgtcgcaca 120 tgcccttttc ctggcgtttt cttgtcgcgt 180 actagaaccg gagacattac gccatgaaca 240 cccgcgtcag caccgacgac caggacttga 300 gctgcaccaa gctgttttcc gagaagatca 360 ccaggatgct tgaccaccta cgccctggcg 420 tggcccgcag cacccgcgac ctactggaca 480 gcctgcgtag cctggcagag ccgtgggccg 540 tgaccgtgtt cgccggcatt gccgagttcg 600 gcgggcgcga ggccgccaag gcccgaggcg 660 cggcacagat cgcgcacgcc cgcgagctga 720 cggctgcact gcttggcgtg catcgctcga 780 aagtgacgcc caccgaggcc aggcggcgcg 840 ccgacgccct ggcggccgcc gagaatgaac 900 ggacggccag gacgaaccgt ttttcattac 960 cgggtacgtg ttcgagccgc ccgcgcacgt 1020 cggtttgtct gatgccaagc tggcggcctg 1080 gcgccgccgt ctaaaaaggt gatgtgtatt 1140 tgcgtatatg atgcgatgag taaataaaca 1200 gctgtactta accagaaagg cgagtcaggc 1260 gccctgcaac tcgccggggc cgatgttctg 1320 cgcgattggg cggccgtgcg ggaagatcaa 1380 acgattgacc gcgacgtgaa ggccatcggc 1440 ccccaggcgg cggacttggc tgtgtccgcg 1500 gtgcagccaa gcccttacga catatgggcc 1560 cgcattgagg tcacggatgg aaggctacaa 1620 ggcacgcgca tcggcggtga ggttgccgag 1680 gagtcccgta tcacgcagcg cgtgagctac 1740 cttgaatcag aacccgaggg cgacgctgcc 1800 asatcaaaac tcatttgagt taatgaggta 1860 taagtgccgg ccgtccgagc gcacgcagca 1920 acacgccagc catcaagcgg gtcaactttc 1980 agatgtacgc ggtacgccaa ggcaagacca 2040 agctaccaga gtaaatqagc aaatqaataa 2100 WO 2002/096923 PCT/US2002/017451 atgagtagat gaattttagc ggctaaagga accgacgccg tggaatgccc catgtgtgga tgggttgtct gccggccctg caatggcact cggtcgcaaa ccatccagcc cagtacaaat gaagttgaag gccgcgcacg ccgcccagcg tgaatcgtgg caagcggccg ctgatcgaat cggtgcgccg tcgattagga agccgcccaa gatgctctat gacgtgggca cccgcgatag tctgtcgaag cgtgaccgac gagctggcga cgtagaggtt tccgcagggc cggccggcat gatggcggtt tcccatctaa ccgaatccat gcccggccgc gtgttccgtc cacacgttgc tggcggaaag cagaaagacg acctggtaga tgccatgcag cgtacgaaga acgccaagaa agccttgatt agccgctaca agatcgtaaa gatcgagcta gctgattgga tgtaccgcga gacggttcac cccgattact ttttgatcga ggcacgccgc gccgcaggca aggcagaagc cagtggcagc gccggagagt tcaagaagtt aaatgacctg ccggagtacg atttgasgga catgcgctac cgcaacctga tcgagggcga gatgctaggg caaattgccc tagcagggga tagcacgtac attaggaacc caaagccgta cccaaagccg tacattggga accggtcaca aggcgatttt tccgcctaaa actctttaaa ctgtgcataa ctgtctggcc agcgcacagc gtcgctgcgc tccctacgcc ccgccgcttc aaaaatagct ggcctacggc caggcaatct actcgaccgc cggcgcccac atcaaggcac aaaacctctg acacatgcag ctcccggaga ggagcagaca agcccgtcag ggcgcgtcag tgacccagtc acgtagcgat agcggagtgt gattgtactg agagtgcacc atatgcggtg ataccgcatc aggcgctctt ccgcttcctc gctgcggcga gcggtatcag ctcactcaaa ggataacgca ggaaagaaca tgtgagcaaa ggccgcgttg ctggcgtttt tccataggct acgctcaagt cagaggtggc gaaacccgac tggaagctcc ctcgtgcgct ctcctgttcc ctttctccct tcggcaagcg tggcgctttc ggtgtaggtc gttcgctcca agctgggctg ctgcgcctta tccggtaact atcgtcttga actggcagca gccactggta acaggattag gttcttgaag tggtggccta actacggcta tctgctgaag ccagttacct tcggaaaaag caccgctggt agcggtggtt tttttgtttg atctcaagaa gatcctttga tcttttctac acgttaaggg attttggtca tgcattctag atattttatt ttctcccaat caggcttgat ctgttcttcc ccgatatcct ccctgatcga gtccgccctg ccgcttctcc caagatcaat gatgttgctg tctcccaggt cgccgtggga ctttaaaaaa tcatacagct cgcgcggatc gcaatccaca tcggccagat cgttattcag taagctattc gtatagggac aatccgatat cgcatacagc tcgataatct tttcagggct gacgccatcg gcctcactca tgagcagatt gacctttgga acaggcagct ttccttccag atcataggtg gtccctttat accggctgtc tcccaccagc ttatatacct tagcaggaga tttttcgatc agttttttca attccggtga tcctcttttc tacagtattt aaagataccc aattcactgt tccttgcatt ctaaaacctt ttttcaaagt tggcgtataa catagtatcg caggcagcaa cgctctgtca tcgttacaat gtttcaaacc cagcagctta gttgccgttc tctaccocct tacaaccgct ctcccactga -25- ggcggcatcg aaaatcaaga acaaccaggc 2160 ggaacgggcg gttggccagg cgtaagcggc 2220 agaaccccca agcccgagga atcggcgtga 2280 ccgcgcgacg ctcggtgatg acctggtgga 2340 gcaacgcatc caggcagaag cacgccccgg 2400 ccgcaaagaa tcccggcaac cgccggcagc 2460 gggcgacgag caaccagatt ttttcgttcc 2520 tcgcagcatc atggacgtgg ccgttttccg 2580 ggtgatccgc tacgagcttc cagacgggca 2640 ggccagtgtg taggattacg acctggtact 2700 gaaccgatac cgagaaggga agggagacaa 2760 ggacgtactc aagttctgcc ggcgagccga 2820 aacctgcatt cggttaaaca ccacgcacgt 2880 cggccgcctg gtgacggtat ccgagggtga 2940 gagcgaaacc gggcggccgg agtacatcga 3000 gatcacagaa ggcaagaacc cggacgtgct 3060 tcccggcatc ggccgttttc tctaccgcct 3120 cagatggttg ttcaagacga tctacgaacg 3180 ctgtttcacc gtgcgcaagc tgatcgggtc 3240 ggaggcgggg caggctggcc cgatcctagt 33 00 agcatccgcc ggttcctaat gtacggagca 3360 aaaaggtcga aaaggtctct ttcctgtgga 3420 cattgggaac cggaacccgt acattgggaa 34 80 catgtaagtg actgatataa aagagaaaaa 3540 acttattaaa actcttaaaa cccgcctggc 3600 cgaagagctg caaaaagcgc ctacccttcg 3660 gcgtcggcct atcgcggccg ctggccgctc 3720 accagggcgc ggacaagccg cgccgtcgcc 3780 cctgcctcgc gcgtttcggt gatgacggtg 3840 cggtcacagc ttgtctgtaa gcggatgccg 3900 cgggtgttgg cgggtgtcgg ggcgcagcca 3960 atactaactt aactatgcgg catcagagca 4020 tgaaataccg cacagatgcg taaggagaaa 4080 gctcactgac tcgctgcgct cggtcgttcg 4140 ggcggtaata cggttatcca cagaatcagg 4200 aggccagcaa aaggccagga accgtaaaaa 4260 ccgcccccct gacgagcatc acaaaaatcg 4320 aggactataa agataccagg cgtttccccc 4380 gaccctgccg cttaccggat acctgtccgc 4440 tcatagctca cgctgtaggt atctcagttc 4500 tgtgcacgaa ccccccgttc agcccgaccg 4560 gtccaacccg gtaagacacg acttatcgcc 4620 cagagcgagg tatgtaggcg gtgctacaga 4680 cactagaagg acagtatttg gtatctgcgc 4740 agttggtagc tcttgatccg gcaaacaaac 4800 caagcagcag attacgcgca gaaaaaaagg 4860 ggggtctgac gctcagtgga acgaaaactc 4920 gtactssaac aattcatcca gtaaaatata 4980 ccccagtaag tcaaaaaata gctcgacata 5040 ccggacgcag aacgcaatgt cataccactt 5100 aaagccactt actttgccat ctttcacaaa 5160 aaagacaagt tcctcttcgg gcttttccgt 5220 tttaaatcga gtgtcttctt cccagttttc 5280 taagtaatcc aattcggcta agcggctgtc 5340 gtcgatagag tgaaagagcc tgatgcactc 5400 ttgttcatct tcatactctt ccgagcaaag 5460 gctccagcca tcatgccgtt caaagtgcag 5520 ccatagcatc atgtcctttt cccgttccac 5580 cgtcattttt aaatataggt tttcattttc 5640 cattccttcc gtatctttta cgcagcggta 5700 tattctcatt ttagccattt attatttcct 5760 caagaagcta attataacaa gacgaactcc 5820 aaataccaga aaacagcttt ttcaaagttg 5880 acggagccga ttttaaaacc gcggtgatca £940 caacatgcta ccctccgcga gatcatccgt 6000 ttccaaatag catcggtaac atgagcaaag 6060 cgccgtcccg gactgatggg ctgcctatat 6120 WO 2002/096923 PCTAJS2002/017451 -26- cgagtcgtga ttttgtgccg agctgccggt tatattgtgg tgtaaacaaa ttgacgctta taatgtactg aattaacgcc gaattaattc gttttaggaa ttacaaattt tattgataga ggtttcttat atgctcaaca catgagcgaa ggaactactc acacattatt atggagaaac ggacggggcg gtaccggcag gctgaagtcc ccgtgcttga agccggccqc ccgcagcatg atgcgcacgc tcgggtcgtt gggcagcccg gcctccaagg acttcagcag gtgggtgtag cggggggaga cgtacacggt cgactcggcc aggcccgcgt aggcgatgcc ggcgacctcg cgctcccgca gacggacgag gtcgtccgtc aagttgaccg tgcttgtctc gatgtagtgg gcctcggtgg cacggcggat gtcggccggg gagatagatt tgtagagaga gactggtgat ttccttatat agaggaaggt cttgcgaagg agtggagata tcacatcaat ccacttgctt cacgatgctc ctcgtgggtg ggggtccatc aacgatagcc tttcctttat cgcaatgatg tgtccttttg atgaagtgac agatagctgg taccctttgt tgaaaagtct caatagccct cttggagtag acgagagtgt cgtgctccac agacgtggtt ggaacgtctt ctttttccac gggaccactg tcggcagagg catcttgaac tttgtaggtg ccaccttcct tttctactgt atggaatccg aggaggtttc ccgatattac gtcttctgag actgtatctt tgatattctt gttggcaagc tgctctagcc aatacgcaaa taatgcagct ggcacgacag gtttcccgac aatgtgagtt agctcactca ttaggcaccc atgttgtgtg gaattgtgag cggataacaa tacgaattcg agccttgact agagggtcga gagtttggac aaaccacaac tagaatgcag gatgctattg ctttatttgt aaccattata gaactccagc atgagatccc cgcgctggag tccgaagccc sacctttcat agaaggcggc gtcctgctcc tcggccacga agtgcacgca ccgcccccac ggctgctcgc cgatctcggt cgtggacacg acctccgacc actcggcgta ggccagggtg ttgtccggca ccacctggtc gtcccggacc acaccggcga agtcgtcctc ggtccagaac tcgaccgctc cggcgacgtc caacttggcc atggatccag atttcgctca gcaggaattc gatcgacact ctcgtctact accaaagagc tattgagact tttcaacaaa attgcccagc tatctgtcac ttcatcaaaa aatgccatca ttgcgataaa ggaaaggcta ccaaagatgg acccccaccc acgaggagca cttcaaagca agtggattga tgtgataaca agaatatcaa agatacagtc tcagaagacc taatatcagg aaacctcctc ggattccatt cagtagaaaa ggaaggtggc acctacaaat ttcaagatgc ctctgccgac agtggtccca tggaaaaaga aqacgttcca accacgtctt ctgacgtaag ggatgacgca caatcccact aagttcattt catttggaga ggacacgctg tctctcgagc tttcgcagat ccgggggggc cgacgtctgt cgagaagttt ctgatcgaaa tctcggaggg cgaagaatct cgtgctttca tgcgggtaaa taactgcgcc gatagtttct catcggccgc gctcccgatt ccggaagtgc cctattgcat ctcccgccgt gcacagggtg tgcccgctgt tctacaaccg gtcgcggagg gccaaacgag cgggttcggc ccattcggac gtgatttcat atgcgcgatt gctgatcccc acaccgtcag tgcgtccgtc gcgcaagctc c9929agctg ttggctggct ggtggcagga 6180 gacaacttaa taacacattg cggacgtttt 6240 gggggatctg gattttagta ctggattttg 6300 agtattttac aaatacaaat acatactaag 6360 accctatagg aaccctaatt cccttatctg 6420 tccagtcsaa tctcggtgac gggcaggacc 6480 agctgccaga aacccacgtc atgccagttc 6540 ccgcgggggg catatccgag cgcctcgtgc 6600 atgacagcga ccacgctctt gaagccctgt 6660 agcgtggagc ccagtcccgt ccgctggtgg 6720 gtccagtcgt aggcgttgcg tgccttccag 6780 ccgtccacct cggcgacgag ccagggatag 6840 cactcctgcg gttcctgcgg ctcggtacgg 6900 ttgacgatgg tgcagaccgc cggcatgtcc 6960 cgtcgttctg ggctcatggt agactcgaga 7020 ttcagcgtgt cctctccaaa tgaaatgaac 7080 atagtgggat tgtgcgtcat cccttacgtc 7140 tgaagacgtg gttggaacgt cttctttttc 7200 tttgggacca ctgtcggcag aggcatcttg 7260 gcatttgtag gtgccacctt ccttttctac 7320 gcaatggaat ccgaggaggt ttcccgatat 7380 ttggtcttct gagactgtat ctttgatatt 7440 catgttatca catcaatcca cttgctttga 7500 gatgctcctc gtgggtgggg gtccatcttt 7560 gatagccttt cctttatcgc aatgatggca 7620 ccttttgatg aagtgacaga tagctgggca 7680 cctttgttga aaagtctcaa tagccctttg 7740 ggagtagacg agagtgtcgt gctccaccat 7800 ccgcctctcc ccgcgcgttg gccgattcat 7860 tggaaagcgg gcagtgagcg caacgcaatt 7920 caggctttac actttatgct tccggctcgt 7980 tttcacacag gaaacagcta tgaccatgat 8040 cggtatacag acatgataag atacattgat 8100 tgaaaaaaat gctttatttg tgaaatttgt 8160 agctgcaata aacaagttgg ggtgggcgaa 8220 gatcatccag ccggcgtccc ggaaaacgat 8280 ggtggaatcg aaatctcgta gcacgtgtca 8340 gttgccggcc gggtcgcgca gggcgaactc 8400 catggccggc ccggaggcgt cccggaagtt 8460 cagctcgtcc aggccgcgca cccacaccca 8520 ctggaccgcg ctgatgaaca gggtcacgtc 8580 cacgaagtcc cgggagaacc cgagccggtc 8640 gcgcgcggtg agcaccggaa cggcactggt 8700 agttagtata aaaaagcagg cttcaatcct 8760 ccaagaatat caaagataca gtctcagaag 8820 gggtaatatc gggaaacctc ctcggattcc 8880 ggacagtaga aaaggaaggt ggcacctaca 8940 tcgttcaaga tgcctctgcc gacagtggtc 9000 tcgtggaaaa agaagacgtt ccaaccacgt 9060 tggtggagca cgacactctc gtctactcca 9120 aaagggctat tgagactttt caacaaaggg 9180 gcccagctat ctgtcacttc atcaaaagga 9240 gccatcattg cgataaagga aaggctatcg 9300 aagatggacc cccacccacg aggagcatcg 9360 caaagcaagt ggattgatgt gatatctcca 9420 atccttcgca agaccttcct ctatataagg 9480 aaatcaccag tctctctcta caaatctatc 9540 aatgagatat gaaaaagcct gaactcaccg 9600 agttcgacag cgtctccgac ctgatgcagc 9660 gcttcgatgt aggagggcgt ggatatgtcc 9720 acaaagatcg ttatgtttat cggcactttg 9780 ttgacattgg ggagtttagc gagagcctga 9840 tcacgttgca agacctgcct caaaccgaac 9900 ctatgcatgc gatcgctgcg gccgatctta 9960 cgcaaggaat cggtcaatac actacatggc 10020 atgtatatca ctggcaaact gtaatggacg 10080 tccstgagct gatgctttag acccaacact 10140 WO 2002/096923 PCT/US2002/017451 -27- gccccgaagt ccggcacctc gtgcacgcgg atttcggctc caacaatgtc ctgacggaca 10200 atggccgcat aacagcagtc attgactgga gcgaaacgat gttcqgggat tcccaatacg 10260 aggtcgccaa catcttcttc tggaggccgt ggttggcttg tatggagcag cagacgcgct 10320 acttcgagcg gaggcatccg gagcttgcag gatcgccacg actccgggcg tatatgctcc 10380 gcattggtct tgaccaactc tatcagagct tggttgacgg caatttcgat gatgcagctt 10440 gggcgcaggg tcgatgcgac gcaatcgtcc gatccggagc cgggactgtc gggegtacac 10500 aaatcgcccg cagaagcgcg gccgtctgga ccgatggctg tgtagaagta ctcgccgata 10560 gtggaaaccg acgccccagc actcgtccga gggcaaagaa atagagtaga tgccgaccgg 10620 atctgtcgat cgacaagctc gagtttctcc ataataatgt gtgagtagtt cccagataag 10680 ggaattaggg ttcctatagg gtttcgctca tgtgttgagc atataagaaa cccttagtat 10740 gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa accaaaatcc 10800 agtactaaaa tccagatccc ccgaattaat tcggcgttaa ttcagatcaa gcttgacctg 10860 gaatatcgcg agtaaactga aaatcacgga aaatgagaaa tacacacttt aggacgtgaa 10920 atatggcgag gaaaactgaa aaaggtggaa aatttagaaa tgtccactgt aggacgtgga 10980 atatggcaag aaaactgaaa atcatggaaa atgagaaaca tccacttgac gacttgaaaa 11040 atgacgaaat cactaaaaaa cgtgaaaaat gagaaatgca cactgaagga ctccgcggga 11100 attcgattgt gctagccaat gtttaacaag atgtcaagca caatgaatgt tggtggttgg 11160 tggtcgtggc tggcggtagt ggaaaattgc ggtggttcga gcggtagtga tcggcgatgg 11220 ttggtgtttg cagcggtgtt tgatatcgga atcacttatg gtggttgtca caatggaggt 11280 gcgtcatggt tattggtggt tggtcatcta tatattttta taataatatt aagtatttta 11340 cctatttttt acatattttt tattaaattt atgcattgtt tgtattttta aatagttttt 11400 atcgtacttg ttttataaaa tattttatta ttttatgtgt tatattatta cttgatgtat 11460 tggaaatttt ctccattgtt ttttctatat ttataataat tttcttattt ttttttgttt 11520 tattatgtat tttttcgttt tataataaat atttattaaa aaaaatatta tttttgtaaa 11580 atatatcatt tacaatgttt aaaagtcatt tgtgaatata ttagctaagt tgtacttctt 11640 tttgtgcatt tggtgttgta catgtctatt atgattctct ggccaaaaca tgtctactcc 11700 tgtcacttgg gttttttttt ttaagacata atcactagtg attatatcta gactgaaggc 11760 gggaaacgac aatctgatca tgagcggaga attaagggag tcacgttatg acccccgccg 11820 atgacgcggg acaagccgtt ttacgtttgg aactgacaga accgcaacgt tgaaggagcc 11880 actcagccgc gggtttctgg agtttaatga gctaagcaca tacgtcagaa accattattg 11940 cgcgttcaaa agtcgcctaa ggtcactatc agctagcaaa tatttcttgt caaaaatgct 12000 ccactgacgt tccataaatt cccctcggta tccaattaga gtctcatatt cactctcaat 12060 ccaaataatc tgcaccggat ctcgagatcg aattcccgcg gccgcgaatt cactagtgga 12120 tccccgggta cggtcagtcc cttatgttac gtcctgtaga aaccccaacc cgtgaaatca 12180 aaaaactcga cggcctgtgg gcattcagtc tggatcgcga aaactgtgga attgagcagc 12240 gttggtggga aagcgcgtta caagaaagcc gggcaattgc tgtgccaggc agttttaacg 12300 atcagttcgc cgatgcagat attcgtaatt atgtgggcaa cgtctggtat cagcgcgaag 12360 tctttatacc gaaaggttgg gcaggccagc gtatcgtgct gcgtttcgat gcggtcactc 12420 attacggcaa agtgtgggtc aataatcagg aagtgatgga gcatcagggc ggctatacgc 12480 catttgaagc cgatgtcacg ccgtatgtta ttgccgggaa aagtgtacgt atcacagttt 12540 gtgtgaacaa cgaactgaac tggcagacta tcccgccggg aatggtgatt accgacgaaa 12600 acggcaagaa aaagcagtct tacttccatg atttctttaa ctacgccggg atccatcgca 12660 gcgtaatgct ctacaccacg ccgaacacct gggtggacga tatcaccgtg gtgacgcatg 12720 tcgcgcaaga ctgtaaccac gcgtctgttg actggcaggt ggtggccaat ggtgatgtca 12780 gcgttgaact gcgtgatgcg gatcaacagg tggttgcaac tggacaaggc accagcggga 12840 ctttgcaagt ggtgaatccg cacctctggc aaccgggtga aggttatctc tatgaactgt 12900 acgtcacagc caaaagccag acagagtgtg atatctaccc gctgcgcgtc ggcatccggt 12960 cagtggcagt gaagggcgaa cagttcctga tcaaccacaa accgttctac tttactggct 13020 ttggccgtca tgaagatgcg gatttgcgcg gcaaaggatt cgataacgtg ctgatggtgc 13080 acgatcacgc attaatggac tggattgggg ccaactccta ccgtacctcg cattaccctt 13140 acgctgaaga gatgctcgac tgggcagatg aacatagcat cgtggtgatt gatgaaactg 13200 cagctgtcgg ctttaacctc tctttaggca ttggtttcga agcgggcaac aagccgaaag 13260 aactgtacag cgaagaggca gtcaacgggg aaactcagca ggcgcactta caggcgatta 13320 aagagctgat agcgcgtgac aaaaaccacc caagcgtggt gatgtggagt attgccaacg 13380 aaccggatac ccgtccgcaa ggtgcacggg aatatttcgc gccactggcg gaagcaacgc 13440 gtaaactcga tccgacgcgt ccgatcacct gcgtcaatgt aatgttctgc gacgctcaca 13500 ccgataccat cagcgatctc tttgatgtgc tgtgcctgaa ccgttattac ggttggtatg 13560 tccaaagcgg cgatttggaa acggcagaga aggtactgga aaaagaactt ctggcctggc 13620 aggagaaact gcatcagccg attatcatca ccgaatacgg cgtggatacg ttagccgggc 13680 tgcactcaat gtacaccgac atgtggagtg aagagtatca gtgtgcatgg ctggatatgt 13740 atcaccgcgt ctttgatcgc gtcagcgccg tcgtcggtga acaggtatgg aatttcgccg 13800 attttgcgac ctcgcaaggc atattgcgcg ttggcggtaa caagaagggg atcttcaccc 13860 gcgaccgcaa accgaagtcg gcggcttttc tgctgcaaaa acgctggact ggcatgaact 13920 tcagtgaaaa accgcagcag ggaggcaaac aatgaatcaa caactctcct ggcgcaccat 13980 cgtcggctac agcctcgaga attgcgtacc gagctcgaat ttccccgatc gttcaaacat 14040 ttggcaataa agtttcttaa gattgaatcc tgttgccggt cttgcgatga ttatcatata 14100 atttctgttg aattacgtta agcatgtaat aattaacatg taatgcatga cgttatttat 14160 WO 2002/096923 PCT/US2002/017-151 -28- gagatgggtt tttatgatta gagtcccgca attatacatt taatacgcga tsgaaaacaa 14220 aatatagcgc gcasactagg ataaattatc gcgcgcggtg tcatctatgt tactagatcg 14280 ggaattcgat atcaagcttg ccactggccg tcgttttaca acgtcgtgac taggaaaacc 14340 ctggcgttac ccaacttaat cgccttgcag cacatccccc tttcgccagc tggcgtaata 14400 gcgaagaagc ccgcaccgat cgcccttccc aacagttgcg cagcctgaat ggcgaatgct 14460 agagcagctt gagcttggat cagattgtcg tttcccgcct tcagtttaaa ctatcagtgt 14520 ttgacaggat atattggcgg gtaaacctaa gagaaaagag cgtttattag aataacggat 14580 atttaaaagg gcgtgaaaag gtttatccgt tcgtccattt gtatgtg 14627 <210> 22 <211> 4257 <212> DNA <213> Artificial Sequence <220> <223> pPUR Plasmid <400> 22 ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag gctccccagc aggcagaagt 60 atgcaaagca tgcatctcaa ttagtcagca accaggtgtg gaaagtcccc aggctcccca 120 gcaggcagaa gtatgcaaag catgcatctc aattagtcag caaccatagt cccgccccta 180 actccgccca tcccgcccct aactccgccc agttccgccc attctccgcc ccatggctga 240 ctaatttttt ttatttatgc agaggccgag gccgcctcgg cctctgagct attccagaag 300 tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa agcttgcatg cctgcaggtc 360 ggccgccacg accggtgccg ccaccatccc ctgacccacg cccctgaccc ctcacaagga 420 gacgaccttc catgaccgag tacaagccca cggtgcgcct cgccacccgc gacgacgtcc 480 cccgggccgt acgcaccctc gccgccgcgt tcgccgacta ccccgccacg cgccacaccg 540 tcgacccgga ccgccacatc gagcgggtca ccgagctgca agaactcttc ctcacgcgcg 600 tcgggctcga catcggcaag gtgtgggtcg cggacgacgg cgccgcggtg gcggtctgga 660 ccacgccgga gagcgtcgaa gcgggggcgg tgttcgccga gatcggcccg cgcatggccg 720 agttgagcgg ttcccggctg gccgcgcagc aacagatgga aggcctcctg gcgccgcacc 780 ggcccaagga gcccgcgtgg ttcctggcca ccgtcggcgt ctcgcccgac caccagggca 840 agggtctggg cagcgccgtc gtgctccccg gsgtggaggc ggccgagcgc gccggggtgc 900 ccgccttcct ggagacctcc gcgccccgca acctcccctt ctacgagcgg ctcggcttca 960 ccgtcaccgc cgacgtcgag gtgcccgaag gaccgcgcac ctggtgcatg acccgcaagc 1020 ccggtgcctg acgcccgccc cacgacccgc agcgcccgac cgaaaggagc gcacgacccc 1080 atggctccga ccgaagccga cccgggcagc cccgccgacc ccgcacccgc ccccgaggcc 1140 caccgactct agaggatcat aatcagccat accacatttg tagaggtttt acttgcttta 1200 aaaaacctcc cacacctccc cctgaacctg aaacataaaa tgaatgcaat tgttgttgtt 1260 aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 1320 aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 1380 tatcatgtct ggatccccag gaagctcctc tgtgtcctca taaaccctaa cctcctctac 1440 ttgagaggac attccaatca taggctgccc atccaccctc tgtgtcctcc tgttaattag 1500 gtcacttaac aaaaaggaaa ttgggtsggg gtttttcaca gaccgctttc taagggtaat 1560 tttaaaatat ctgggaagtc ccttccactg ctgtgttcca gaagtgttgg taaacagccc 1620 acaaatgtca acagcagaaa catacaagct gtcagctttg cacaagggcc caacaccctg 1680 ctcatcaaga agcactgtgg ttgctgtgtt agtaatgtgc aaaacaggag gcacattttc 1740 cccacctgtg taggttccaa aatatctagt gttttcattt ttacttggat caggaaccca 1800 gcactccact ggataagcat tatccttatc caaaacagcc ttgtggtcag tgttcatctg 1860 ctgactgtca actgtagcat tttttggggt tacagtttga gcaggatatt tggtcctgta 1920 gtttgctaac acaccctgca gctccaaagg ttccccacca acagcaaaaa aatgaaaatt 1980 tgacccttga atgggttttc cagcaccatt ttcatgagtt ttttgtgtcc ctgaatgcaa 2040 gtttaacata gcagttaccc caataacctc agttttaaca gtaacagctt cccacatcaa 2100 aatatttcca caggttaagt cctcatttaa attaggcaaa ggaattcttg aagacgaaag 2160 ggcctcgtga tacgcctatt■tttataggtt aatgtcatga taataatggt ttcttagacg 2220 tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta tttgtttatt tttctaaata 2280 cattcaaata tgtatccgct catgagscaa taaccctgat aaatgcttca ataatattga 2340 aaaaggasga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca 2400 ttttgccttc ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat 2460 cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag 2520 agttttcgcc cccaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc 2580 gcggtattat cccgtgttga cgcc^ggcaa gagcaactcg gtccceacat acactattct 2640 cagaatgact tggttgagta ctca.cagtc acagaaaagc atcttacaga tggcatgaca 2700 gtaagagaat tatgcagtgc tgccataacc atgagtgata acactccggc caacttactt 2760 ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat gggggatcat 2820 gtaactcgcc ttgatcgttg ggaaccggag ctcaatgaag ccataccaaa cgacgagcat 2880 gacaccEcga tgcctgcagc aatggcaaca acgttgcgca aactattaac tggcgaacta 2940 WO 2002/096923 PCT/US2002/017-151 -29- cttactctag cttcccggca acaattaata gactggatgg aggcggataa agttgcagga 3000 ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt 3060 gagcgtgggt ctcgcggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc 3120 gtagttatct acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct 3180 gagataggtg cctcactgat taagcattgg taactgtcag accaagttta ctcatatata 3240 ctttagattg atttaaaact tcatttttaa tttaaaagga tctaggtgaa gatccttttt 3300 gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc gtcagacccc 3360 gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 3420 caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 3480 ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg 3540 tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 3600 ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 3660 tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 3720 cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagctatga 3780 gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 3840 ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 3900 gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggagggcgg 3960 agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 4020 tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc 4080 tttgagtgag ctgataccgc tcgccgcagc ccaacgaccg agcgcagcga gtcagtgagc 4140 gaggaagcgg aagagcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca 4200 caccgcatat ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccag 4257 <210> 23 <211> 2713 <212> DNA <213> Artificial Sequence <220> <223> pNEB193 Plasmid <400> 23 tcgcgcgttt cggtgatgac ggtgaaaacc cagcttgtct gtaagcggat gccgggagca ttggcgggtg tcggggctgg cttaactatg accatatgcg gtgtgaaata ccgcacagat attcgccatt caggctgcgc aactgttggg tacgccagct ggcgaaaggg ggatgtgctg tttcccsgtc acgacgttgt aaaacgacgg gcgccggatc cttaattaag tctagagtcg gcgtaatcat ggtcatagct gtttcctgtg aacatacgag ccggaagcat aaagtgtaaa acattaattg cgttgcgctc actgcccgct cattaatgaa tcggccaacg cgcggggaga tcctcgctca ctgactcgct gcgctcggtc tcaaaggcgg taatacggtt atccacagaa gcaaaaggcc agcaaaaggc caggaaccgt aggctccgcc cccctgacga gcatcacaaa ccgacaggac tataaagata ccaggcgttt gttccgaccc tgccgcttac cggatacctg ctttctcata gctcacgctg taggtatctc ggctgtgtgc acgaaccccc cgttcagccc cttgagtcca acccggtaag acacgactta attagcagag cgaggtatgt aggcggtgct ggctacacta gaaggacagt atttggtatc aaaagagttg gtagctcttg atccggcaaa gtttgcaagc agcagattac gcgcagaaaa tctacggggt ctgacgctca gtggaacgaa ttatcaaaaa ggatcttcac ctagatcctt taaagtatat atgagtaaac ttggtctgac atctcagcga tctgtctatt tcgttcatcc actacgatac gggagggctt accatctggc cgctcaccgg ctccagattt atcagcaata agtggtcctg caactttatc cgcctccatc gtaagtsgtt cgccagttaa tagtttgcgc gtgtcacgct cgtcgtttgg tatggcttca gttacatcat cccccatgtt gtgcaaaaaa tctgacacat gcagctcccg gagacggtca 60 gacaagcccg tcagggcgcg tcagcgggtg 120 cggcatcaga gcagattgta ctgagagtgc 180 gcgtaaggag aaaataccgc atcaggcgcc 240 aagggcgatc ggtgcgggcc tcttcgctat 300 caaggcgatt aagttgggta acgccagggt 360 ccagtgaatt cgagctcggt acccgggggc 420 actgtttaaa cctgcaggca tgcaagcttg 480 tgaaattgtt atccgctcac aattccacac 540 gcctggggtg cctaatgagt gagctaactc 600 ttccagtcgg gaaacctgtc gtgccagctg 660 ggcggtttgc gtattgggcg ctcttccgct 720 gttcggctgc ggcgagcggt atcagctcac 780 tcaggggata acgcaggaaa gaacatgtga 840 aaaaaggccg cgttgctggc gtttttccat 900 aatcgacgct caagtcagag gtggcgaaac 960 ccccctggaa gctccctcgt gcgctctcct 1020 tccgcctttc tcccttcggg aagcgtggcg 1080 agttcggtgt aggtcgttcg ctccaagctg 1140 gaccgctgcg ccttatccgg taactatcgt 1200 tcgccactgg cagcagccac tggtaacagg 1260 acagagttct tgaagtggtg gcctaactac 1320 tgcgctctgc tgaagccagt taccttcgga 1380 caaaccaccg ctggtagcgg tggttttttt 1440 aaaggatctc aagaagatcc tttgatcttt 1500 aactcacgtt aagggatttt ggtcatgaga 1560 ttaaattaaa aatgaagttt taaatcaatc 1620 agttaccaat gcttaatcag tgaggcacct 1680 atagttgcct gactccccgt cgtgtagata 1740 cccagtgctg caatgatacc gcgagaccca 1800 aaccagccag ccggaagggc cgagcgcaga 1860 cagtctatta attgttgccg ggaagctaga 1920 aacgttgttg ccattgctac aggcatcgtg 1980 ttcagctccg gttcccaacg atcaaggcga 2040 gcgqttagct ccttcaqtcc tcccatcgtt 2100 WO 2002/096923 PCT/US2002/017451 -30- gtcagsagta cttactgtca ttctgagaat accgcgccac aaactctcaa sactcatctt caaaatgcca ctttttcaat gaatgtattt cctgacgtct aaaccctttc agttggccgc tgccatccgt agtgtatgcg atagcagaac ggatcttacc cagcatcttt caaaaaaggg attattgaag agaaaaataa aagaaaccat gtc agtattatca aagatgcttt gcgaccgagt tttaaaagtg gctgttgaga tactttcacc aataagggcg catttatcag acaaataggg tattatcatg ctcatggtta tctgtgactg tgctcttgcc ctcatcattg tccagttcga agcgtttctg acacggaaat ggttattgtc gttccgcgca acattaacct tgacagcact gtgagtactc cggcgtcaat gaaaacgttc tgtaacccac agtgagcaaa gttgaatact tcatgagcgg catttccccg ataaaaatag gcataattct aaccaagtca acgggataat ttcggggcga tcgtgcaccc aacaggaagg catactcttc atacatattt aaaagtgcca gcgtatcacg 2160 2220 2280 2340 2400 2460 2520 2580 2640 2700 2713 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attPUP Primer <400> 24 ccttgcgcta atgctctgtt acagg 25 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> attPDWN Primer <400> 25 cagaggcagg gagtgggaca aaattg 26 <210> 26 <211> 4346 <212 > DNA <213> Artificial Sequence <220> <223> pSV40193attPsensePUR Plasmid <400> 26 ccggtgccgc atgaccgagt cgcaccctcg cgccacatcg atcggcaagg agcgtcgaag tcccggctgg cccgcgtggt agcgccgtcg gagacctccg gacgtcgagg cgcccgcccc cgaagccgac gaggatcata acacctcccc tgcagcttat tttttcactg qatccgcgcc gcttqgcqta cacacaacat aactcacatt sgctgcatta ccgcttcctc ctcactcaaa caccatcccc acaagcccac ccgccgcgtt agcgggtcac tgtgggtcgc cgggggcggt ccgcgcagca tcctggccac tgctccccgg cgccccgcaa tgcccgaagg acgacccgca ccgggcggcc atcagccata ctgaacctga aatggttaca cattctagtt ggatccttaa atcatggtca acgagccgaa aattgcgttg atgaatcggc gctcactgac gqcaqtaata tgacccacgc ggtgcgcctc cgccgactac ccagctgcaa ggacgacggc gttcgccgag acagatggaa cgtcggcgtc agtggaggcg cctccccttc accgcgcacc gcgcccgacc ccgccgaccc ccacatttgt aacataaaat aataaagcaa gtggtttgtc ttaagtctag tagctgtttc agcataaagt cgctcactgc caacgcgcgg tcgctgcgct ccattatcca ccctgacccc gccacccgcg cccgccacgc gaactcttcc gccgcggtgg atcggcccgc ggcctcctgg tcgcccgacc gccgagcgcg tacgagcggc tggtgcatga gaaaggagcg cgcacccgcc agaggtttta gaatgcaatt taacatcaca caaactcatc agtcgactgt ctgtgtgaaa gtaaagcctg ccgctttcca ggagaggcag cggtcgttcg cagaatcagg tcacaaggag acgacgtccc gccacaccgt tcacgcgcgt cggtctgcac gcatggccga cgccgcaccg accagggcaa cccgggtgcc tcggcttcac cccgcaagcc cacgacccca cccgaggccc cttgctttaa gttgttgtta aatttcacaa aatgtatctt ttaaacctgc ttgttatccg gggtgcctaa gtcgggaaac tttgcgtatt gctgcggcga cqataacgca acgaccttcc ccgggccgta cgacccggac cgggctcgac cacgccggag gttgagcggt gcccaaggag gggtctgagc cgccttcctg cgtcaccgcc cggtgcctga tggctccgac accgactcta aaaacctccc acttgtttat ataaagcatt atcatgtctg aggcatgcaa ctcacaattc tgagtgagct ctgtcgtgcc gggcgctctt gcggtatcag ggaaagaaca 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 WO 2002/096923 PCT/US2002/017-151 -31- tgtgagcaaa BQQCC3GC3S aacQCCSgga tccataggct ccgcccccct gacgagcatc gsaacccgac aggactataa acataccaag ctcctgttcc gaccctgccg cttaccgcat tggcgctttc tcatagctca cgctgtaggt agctgggctg tgtgcacgaa ccccccgttc atcgtcttga gtccaacccg gtsacacacg acaggattag cagagcgagg tatgtaggcg actacagcta cactagaagg acagtatttg tcggaaaaag agttggtagc tcttgatccg tttttgtttg caagcagcag attacgcgca tcttttctac ggggtctgac gctcagtgga tgagattatc aaaaaggatc ttcacctaga caatctaaag tatatatgag taaacttggt cacctatctc agcgatctgt ctatttcgtt agataactac gatacgggag agcttaccat acccacgctc accggctcca gatttatcag gcagaagtgg tcctgcaact ttatccgcct ctagagtaag tagttcgcca gttaatagtt tcgtggtgtc acgctcgtcg tttggtatgg ggcgagttac atgatccccc atgttgtgca tcgttgtcag aagtaagttg gccgcagtgt attctcttac tgtcatgcca tccgtaagat agtcattctg agaatagtgt atacggcgac ataataccgc gccacatagc agaactttaa ggcgaaaact ctcaaggatc ttaccgctgt cacccaactg atcttcagca tcttttactt gaaggcaaaa tgccgcaaaa aagggaataa tcttcctttt tcaatattat tgaagcattt tatttgaatg tatttagaaa aataaacaaa tgccacctga cgtctaagaa accattatta tcacgaggcc ctttcgtctc gcgcgtttcg agctcccgga gacggtcaca gcttgtctgt agggcgcgtc agcgggtgtt ggcgggtgtc agattgtact gagagtgcac catatgcagt aataccgcat caggcgccat tcgccattca tgcgggcctc ttcgctatta cgccagctgg gttgggtaac gccagggttt tcccagtcac agctgtggaa tgtgtgtcag ttagggtgtg gtatgcaaag catgcatctc aattagtcag cagcaggcag aagtatgcaa agcatgcatc taactccgcc catcccgccc ctaactccgc gactaatttt ttttatttat gcagaggccg agtsgtgagg aggctttttt ggsggctcgg tcactaatac catctaagta gttgattcat tatgtagtct gttttttatg caaaatctaa gtttctcgtt cagctttttt atactaagtt tgttgcaacg aacaggtcac tatcagtcaa cccactccct gcctctgggg ggcgcg accgtaaaaa ggccgcgttg ctggcgtttt 1500 acaaaaatcg acgctcaagt cagaggtggc 1560 cgtttccccc tggaagctcc ctcgtgcgct 1620 acctgtccgc ctttctccct tcgggaagcg 1680 atctcagttc ggtgtaggtc gttcgctcca 1740 agcccgaccg ctgcgcctta tccagtaact 1800 acttatcgcc actggcagca gccactggta 1860 gtgctacaga gttcttgaag tggtggccta 1920 gtatctgcgc tctgctgaag ccagttacct 1980 gcaaacaaac caccgctggt agcggtggtt 2040 gaaaaaaagg atctcaagaa gatcctttga 2100 acgaasactc acgttaaggg attttggtca 2160 tccttttaaa ttaaaaatga agttttaaat 2220 ctgacagtta ccaatgctta atcagtgagg 2280 catccatagt tgcctgactc cccgtcgtgt 2340 ctggccccag tgctgcaatg ataccgcgag 2400 caataaacca gccagccgga agggccgagc 2460 ccatccagtc tattaattgt tgccgggaag 2520 tgcgcaacgt tgttgccatt gctacaggca 2580 cttcattcag ctccggttcc caacgatcaa 2640 aaaaagcggt tagctccttc ggtcctccga 2700 tatcactcat ggttatggca gcactgcata 2760 gcttttctgt gactggtgag tactcaacca 2820 cgagttgctc ttgcccggcg tcaatacggg 2880 aagtgctcat cattggaaaa cgttcttcgg 2940 tgagatccag ttcgatgtaa cccactcgtg 3000 tcaccagcgt ttctgggtga gcaaaaacag 3060 gggcgacacg gsaatgttga atactcatac 3120 atcagggtta ttgtctcatg agcggataca 3180 taggggttcc gcacacattt ccccgaaaag 3240 tcatgacatt aacctataaa aataggcgta 3300 gtgatgacgg tgaaaacctc tgacacatgc 3360 aagcggatgc cgggagcaga caagcccgtc 3420 ggggctggct taactatgcg gcatcagagc 3480 gtgaaatacc gcacagatgc gtaaggagaa 3540 ggctgcgcaa ctgttgggaa gggcgatcgg 3600 cgaaaggggg atgtgctgca aagcgattaa 3660 gacgttgtaa aacgacggcc agtgaattcg 3720 gaaagtcccc aggctcccca gcaggcagaa 3780 caaccaggtg tggaaagtcc ccaggctccc 3840 tcaattagtc agcaaccata gtcccgcccc 3900 ccagttccgc ccattctccg ccccatggct 3960 aggccgcctc agcctctgag ctattccaga 4020 tacccccttg cgctaatgct ctgttacagg 4080 agtgactgca tatgttgtgt tttacagtat 4140 tttaatatat tgatatttat atcattttac 4200 ggcattataa aaaagcattg cttatcaatt 4260 aataaaatca ttatttgatt tcaattttgt 4320 4346 <210> 27 <211> 5855 <212> DNA <213> Artificial Sequence <220> <223> pCXLamlntR Plasmid <400> 27 gtcgacattg attattgact agttattaat gcccatatat ggagttccgc attacataac ccaacgaccc ccgcccattg acgtcaataa agactttcca ttgacgtcaa taagtggact atcaagtata tcstatgcca agtacgcccc cctggcatta tacccaatac atgaccttat tattagtcat cgctattacc atcggtcgag atctcccccc cctccccacc cccaattttg agtaatcaat tacggagtca ttagttcata 60 ttacggtaaa tagcccgcct ggctgaccgc 120 tgacgtatgt tcccatagta acgccaatag 180 atttacggta aactgcccac ttggcagtac 240 ctattgacgt caatcacggt aaatggcccg 300 gggactttcc tacttggcag tacatctacg 360 gtgagcccca cgttctgctt cactctcccc 420 tatttattta ttttttaatt attttgtgca 480 WO 2002/096923 PCT/US2002/017-151 -32- gcgatggggg cgggaggggg gggggcgcgc gccaggcgag gcggggcggg gcgaggggcg 54 0 gggcggggcg aggcagagag gtgcggcggc agccaatcag accagcgcgc tccgaaagtt 600 tccttttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcagcgggc 660 gggsgtcgct gcgttgcctt cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc 720 ccggctctga ctgaccgcgt tactcccaca ggtgagcagg cgggacggcc cttctcctcc 780 gggctgtaat tagcgcttgg tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag 840 ccttaaaggg ctccgggagg gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg 900 tgtgtgtgtg cgtggggagc gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg 960 cgggcgcggc gcggggcttt gtgcgctccg cgtgtgcgcg aggggagcgc ggccgagggc 1020 ggtgccccgc ggtgcggggg ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg 1080 tgggggggtg agcagggggt gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc 1140 cctccccgag ttgctgagca cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc 1200 gcggggctcg ccgtgccggg cggggagtgg cggcaggtgg gggtgccggg cggggcgggg 1260 ccgcctcggg ccggggaggg ctcgggggag gggcgcggcg gccccggagc gccggcggct 1320 gtcgaggcgc ggcgagccgc agccattgcc ttttatggta atcgtgcgag agggcgcagg 1380 gacttccttt gtcccaaatc tggcggagcc gaaatctggg aggcgccgcc gcaccccctc 1440 tagcgggcgc gggcgaagcg gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt 1500 cgtgcgtcgc cgcgccgccg tccccttctc catctccagc ctcggggctg ccgcaggggg 1560 acggctgcct tcggggggga cggggcaggg cggggttcgg cttctggcgt gtgaccggcg 1620 gctctagagc ctctgctaac catgttcatg ccttcttctt tttcctacag ctcctgggca 1680 acgtgctggt tgttgtgctg tctcatcatt ttggcaaaga attcatggga agaaggcgaa 1740 gtcatgagcg ccgggattta ccccctaacc tttatataag aaacaatgga tattactgct 1800 acagggaccc aaggacgggt aaagagtttg gattaggcag agacaggcga atcgcaatca 1860 ctgaagctat acaggccaac attgagttat tttcaggaca caaacacaag cctctgacag 1920 cgagaatcaa cagtgataat tccgttacgt tacattcatg gcttgatcgc tacgaaaaaa 1980 tcctggccag cagaggaatc aagcagaaga cactcataaa ttacatgagc aaaattaaag 2040 caataaggag gggtctgcct gatgctccac ttgaagacat caccacaaaa gaaattgcgg 2100 caatgctcaa tggatacata cacgagggca aggcggcgtc agccaagtta atcagatcaa 2160 cactgagcga tgcattccga gaggcaatag ctgaaggcca tataacaaca aaccatgtcg 2220 ctgccactcg cgcagcaaaa tctagagtaa ggagatcaag acttacggct gacgaatacc 2280 tgaaaattta tcaagcagca gaatcatcac catgttggct cagacttgca atggaactgg 2340 ctgttgttac cgggcaacga gttggtgatt tatgcgaaat gaagtggtct gatatcgtag 2400 atggatatct ttatgtcgag caaagcaaaa caggcgtaaa aattgccatc ccaacagcat 2460 tgcatattga tgctctcgga atatcaatga aggaaacact tgataaatgc aaagagattc 2520 ttggcggaga aaccataatt gcatctactc gtcgcgaacc gctttcatcc ggcacagtat 2580 caaggtattt tatgcgcgca cgaaaagcat caggtctttc cttcgaaggg gatccgccta 2640 cctttcacga gttgcgcagt ttgtctgcaa gactctatga gaagcagata agcgataagt 2700 ttgctcaaca tcttctcggg cataagtcgg acaccatggc atcacagtat cgtgatgaca 2760 gaggcaggga gtgggacaaa attgaaatca aataagaatt cactcctcag gtgcaggctg 2820 cctatcagaa ggtagtggct ggtgtggcca atgccctggc tcacaaatac cactgagatc 2880 tttttccctc tgccaaaaat tatggggaca tcatgaagcc ccttgagcat ctgacttctg 2940 gctaataaag gaaatttatt ttcattgcaa tagtgtgttg gaattttttg tgtctctcac 3000 tcggaaggac atatgggagg gcaaatcatt taaaacatca gaatgagtat ttggtttaga 3060 gtttggcaac atatgccata tgctggctgc catgaacaaa ggtggctata aagaggtcat 3120 cagtatatga aacagccccc tgctgtccat tccttattcc atagaaaagc cttgacttga 3180 agttagattt tttttatatt ttgttttgtg ttattttttt ctttaacatc cctaaaattt 3240 tccttacatg ttttactagc cagatttttc ctcctctcct gactactccc agtcatagct 3300 gtccctcttc tcttatgaag atccctcgac ctgcagccca agcttggcgt aatcatggtc 3360 atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca tacgagccgg 3420 aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat taattgcgtt 3480 gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagcggatcc gcatctcaat 3540 tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt 3600 tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc 3660 gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt 3720 tgcaaaaagc taacttgttt attgcagctt ataatggtta caaataaagc aatagcatca 3780 caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca 3840 tcaatgtatc ttatcatgtc tggatccgct gcattaatga atcggccaac gcgcggggag 3900 aggcggtttg cgtattgcgc gctcttccgc ttcctcgctc actgactcgc tgcgctccgt 3960 cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 4020 atcaggggat aacgcagcaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 4080 taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 4140 aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 4200 tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgct^a ccggatacct 4260 gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa tgctcacgct gtaggtatct 4320 cagttcggtg taagtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 4380 cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 4440 atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 4500 WO 2002/096923 PCT/US2002/01745] tacagagttc ttgaagtcgt ggcctaacta ctgcgctctg ctgaagccag ttaccttcgg acaaaccacc gctggtagcg gtggtttttt aaaaggatct caagaagatc ctttgatctt aaactcacgt tsagggattt tggtcatgag tttaaattaa aaatgaagtt ttaaatcaat cagttaccaa tgcttaatca gtgaggcacc catagttgcc tgactccccg tcgtgtagat ccccagtgct gcaatgatac cgcgagaccc aaaccagcca gccggaaggg ccgagcgcag ccagtctatt aattgttgcc gggaagctag caacgttgtt gccattgcta caggcatcgt attcagctcc ggttcccaac gatcaaggcg agcggttagc tccttcggtc ctccgatcgt actcatggtt atggcagcac tgcataattc ttctgtgact ggtgagtact caaccaagtc ttgctcttgc ccggcgtcaa tacgagataa gctcatcatt ggaaaacgtt cttcggggcg atccagttcg atgtaaccca ctcgtgcacc cagcgtttct gggtgagcaa aaacaggaag gacacggaaa tgttgaatac tcatactctt gggttattgt ctcatgagcg gatacatatt ggttccgcgc acatttcccc gaaaagtgcc <210> 28 <211> 37 <212> DNA <213> Artificial Sequence -33- cggctacact agaaggacag tatttggtat 4560 aaaaagagtt ggtagctctt gatccggcaa 4620 tgtttgcaag cagcagatta cgcgcagaaa 4680 ttctacgggg tctgacgctc agtggaacga 4740 attatcaaaa aggatcttca cctacatcct 4800 ctaaagtata tatgagtaaa cttgatctga 4860 tatctcagcg atctgtctat ttcgttcatc 4920 aactacgata cgggagggct taccatctgg 4980 acgctcaccg gctccagatt tatcagcsat 5040 aaatggtcct gcaactttat ccgcctccat 5100 agtaagtagt tcgccagtta atagtttgcg 5160 ggtgtcacgc tcgtcgtttg gtatggcttc 5220 agttacatga tcccccatgt tgtgcaaaaa 5280 tgtcagaagt aagttggccg cagtgttatc 5340 tcttactgtc atgccatccg taagatgctt 5400 attctgagaa tagtgtatgc agcgaccgag 5460 taccgcgcca catagcagaa ctttaaaagt 5520 asaactctca aggatcttac cgctgttgag 5580 caactgatct tcagcatctt ttactttcac 5640 gcaaaatgcc gcaaaaaagg gaataagggc 5700 cctttttcaa tattattgaa gcatttatca 5760 tgaatgtatt tagaaaaata aacaaatagg 5820 acctg 5855 <220> <223> 5PacSV40 Primer <400> 28 ctgttaatta actgtggaat gtgtgtcagt tagggtg 37 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Antisense Zeo Primer <400> 29 tgaacagggt cacgtcgtcc <210> 30 <211> 1032 <212> DNA <213> Escherichia Coli *<220> <221> CDS <222> (1) . . .(1032) <223> nucleotide sequence encoding 20 Cre recombinase <400> 30 atg tcc aat tta ctg acc gta cac caa aat ttg cct gca tta ccg gtc 48 Met Ser Asn Leu Leu Thr Val His Gin Asn Leu Pro Ala Leu Pro Val 15 10 15 gat gca acg agt gat gag gtt cgc aag aac ctg atg gac atg ttc agg 96 Asp Ala Thr Ser Asp Glu Val Arg Lys Asn Leu Met Asp Met Phe Arg 20 25 30 gat cgc cag gcg ttt tct gag cat acc tgg aaa atg ctt ctg tcc gtt 144 A.sp Arg Gin Ala Phe Ser Glu His Thr Trp Lys Met Leu Leu Ser Val WO 2002/096923 PCT/US2002/017451 -34- 35 40 45 tgc cag teg tgg gcg gca tgg tgc aag ttg aat aac egg aaa tgg ttt 192 Cys Arg Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn Arg Lys Trp Phe 50 55 60 ccc gca gaa cct gaa gat gtt cgc gat tat ctt eta tat ctt cag gcg 240 Pro Ala Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu Tyr Leu Gin Ala 65 70 75 80 C9C 99t ct9 9ca 9ta aaa act atc ca9 caa cat ttg ggc cag eta aac 288 Arg Gly Leu Ala Val Lys Thr lie Gin Gin His Leu Gly Gin Leu Asn 85 90 95 atg ctt cat cgt egg tcc ggg ctg cca cga cca agt gac age aat get 336 Met Leu His Arg Arg Ser Gly Leu Pro Arg Pro Ser Asp Ser Asn Ala 100 105 110 gtt tea ctg gtt atg egg egg atc cga aaa gaa aac gtt gat gcc ggt 384 Val Ser Leu Val Met Arg Arg lie Arg Lys Glu Asn Val Asp Ala Gly 115 120 125 gaa cgt gca aaa cag get eta gcg ttc gaa cgc act gat ttc gac cag 432 Glu Arg Ala Lys Gin Ala Leu Ala Phe Glu Arg Thr Asp Phe Asp Gin 130 135 140 gtt cgt tea ctc atg gaa aat age gat cgc tgc cag gat ata cgt aat 4 80 Val Arg Ser Leu Met Glu Asn Ser Asp Arg Cys Gin Asp lie Arg Asn l«i5 150 155 160 ctg gca ttt ctg ggg att get tat aac acc ctg tta cgt ata gcc gaa 528 Leu Ala Phe Leu Gly lie Ala Tyr Asn Thr Leu Leu Arg lie Ala Glu 165 170 175 att gcc agg atc agg gtt aaa gat atc tea cgt act gac ggt ggg aga 576 lie Ala Arg lie Arg Val Lys Asp lie Ser Arg Thr Asp Gly Gly Arg 180 185 190 atg tta atc cat att ggc aga acg aaa acg ctg gtt age acc gca ggt 624 Met Leu lie His lie Gly Arg Thr Lys Thr Leu Val Ser Thr Ala Gly 195 200 205 gta gag aag gca ctt age ctg ggg gta act aaa ctg gtc gag cga tgg 672 Val Glu Lys Ala Leu Ser Leu Gly Val Thr Lys Leu Val Glu Arg Trp 210 215 220 att tcc gtc tct ggt gta get gat gat ccg aat aac tac ctg ttt tgc 720 lie Ser Val Ser Gly Val Ala Asp A.sp Pro Asn Asn Tyr Leu Phe Cys 225 230 235 240 egg gtc aga aaa aat ggt gtt gcc gcg cca tct gcc acc age cag eta 768 Arg Val A.rg Lys Asn Gly Val Ala Ala Pro Ser Ala Thr Ser Gin Leu 245 250 255 tea act cgc gcc ctg gaa ggg att ttt gaa gca act cat cga ttg att 816 Ser Thr Arg Ala Leu Glu Gly lie Phe Glu Ala Thr His Arg Leu lie 260 265 270 tac ggc get aag gat gac tct ggt cag aga tac ctg gcc tgg tct gga 864 Tyr Gly Ala Lys Asp Asp Ser Gly Gin Arg Tyr Leu Ala Trp Ser Gly 275 280 285 cac agt gcc cgt gtc gga gcc gcg cga gat atg gcc cgc get gga gtt 912 His Ser Ala Arg Val Gly Ala Ala Arg Asp Met Ala Arg Ala Gly Val 290 295 300 tea ata ccg gag atc atg caa act ggt ggc tgg acc aat gta aat att 960 WO 2002/096923 PCT/US2002/017451 -35- Ser lie Pro Glu lie Met Gin Ala Gly Gly Trp Thr Asn Val A.sn lie 305 310 315 320 gtc atg sac tat atc cgt aac ctg gat agt gaa aca ggg gca atg gtg 1008 Val Met Asn Tyr lie Arg A.sn Leu Asp Ser Glu Thr Gly Ala Met Val 325 330 335 cgc ctg ctg gaa gat ggc gat tag 1032 Arg Leu Leu Glu Asp Gly Asp * 340 <210> 31 <211> 343 <212> PRT <213> Escherichia Coli <400> 31 Met Ser Asn Leu Leu Thr Val His Gin Asn Leu Pro Ala Leu Pro Val 15 10 15 Asp Ala Thr Ser Asp Glu Val A.rg Lys Asn Leu Met A.sp Met Phe Arg 20 25 30 Asp Arg Gin Ala Phe Ser Glu His Thr Trp Lys Met Leu Leu Ser Val 35 40 45 Cys Arg Ser Trp Ala Ala Trp Cys Lys Leu Asn Asn Arg Lys Trp Phe 50 55 60 Pro Ala Glu Pro Glu Asp Val Arg Asp Tyr Leu Leu Tyr Leu Gin Ala 65 70 75 80 Arg Gly Leu Ala Val Lys Thr lie Gin Gin His Leu Gly Gin Leu Asn 85 90 95 Met Leu His Arg Arg Ser Gly Leu Pro Arg Pro Ser Asp Ser Asn Ala 100 105 110 Val Ser Leu Val Met Arg Arg lie Arg Lys Glu Asn Val A.sp Ala Gly 115 120 125 Glu Arg Ala Lys Gin Ala Leu Ala Phe Glu Arg Thr Asp Phe Asp Gin 130 135 140 Val Arg Ser Leu Met Glu Asn Ser A.sp Arg Cys Gin Asp lie Arg Asn 145 150 155 160 Leu Ala Phe Leu Gly lie Ala Tyr Asn Thr Leu Leu Arg lie Ala Glu 165 170 175 lie Ala A.rg lie Arg Val Lys Asp lie Ser Arg Thr Asp Gly Gly Arg 180 185 190 Met Leu lie His lie Gly Arg Thr Lys Thr Leu Val Ser Thr Ala Gly 195 200 205 Val Glu Lys Ala Leu Ser Leu Gly Val Thr Lys Leu Val Glu Arg Trp 210 215 220 lie Ser Val Ser Gly Val Ala Asp Asp Pro Asn Asn Tyr Leu Phe Cys 225 230 235 240 Arg Val Arg Lys Asn Gly Val Ala Ala Pro Ser Ala Thr Ser Gin Leu 245 250 255 Ser Thr Arg Ala Leu Glu Gly lie Phe Glu Ala Thr His Arg Leu lie 260 265 270 Tyr Gly Ala Lys Asp Asp Ser Gly Gin Arg Tyr Leu Ala Trp Ser Gly 275 280 285 His Ser Ala Arg Val Gly Ala Ala Arg Asp Met Ala Arg Ala Gly Val 290 295 300 Ser lie Pro Glu lie Met Gin Ala Gly Gly Trp Thr A.sn Val Asn lie 305 310 315 320 Val Met Asn Tyr lie Arg Asn Leu Asp Ser Glu Thr Gly Ala Met Val 325 330 335 Arg Leu Leu Glu Asp Gly Asp 340 <210> 32 <211> 33 <212> DNA <213> Artificial Sequence WO 20(12/096923 PCT/US2002/0] 7451 -36- <220> <223> attBl recognition sequence <400> 32 tgaagcctgc ttttttatac taacttgsgc gaa 33 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> m-att recognition sequence <221> misc_difference <222> 18 <223> n is a or g or c or t/u <400> 33 rkycwgcttt yktrtacnaa stsgb 25 <210> 34 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> m-attB recognition sequence <221> misc_difference <222> 18 <223> n is a or c or g or t/u <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> m-attR recognition sequence <221> misc_difference <222? 18 <223> n is a or g or c or t/u <400> 35 gttcagcttt cktrtacnaa ctsgb 25 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223? m-attL recognition sequence <221> misc_difference <222> 18 <223> n is a or g or c or t/u <400> 34 agccwgcttt yktrtacnaa ctsgb 25 <400> 36 agccwgcttt cktrtacnaa atsab 25 <210> 37 WO 2002/096923 PCT/US2002/01745] -37- <211> 25 <212> DNA <213> Artificial Sequence <220> <223> m-attPl recognition sequence <221> misc_difference <222> 18 <223> n is a or g or c or t/u <400> 37 gttcagcttt yktrtacnaa gtsgb 25 <210> 38 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attB2 recognition sequence <400> 38 agcctgcttt cttgtacaaa cttgt 25 <210> 39 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attB3 recognition sequence <400> 39 acccagcttt cttgtacaaa cttgt 25 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sttRl recognition sequence <400> 40 gttcagcttt tttgtacaaa cttgt 25 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attR2 recognition sequence <400> 41 gttcagcttt cttgtacaaa cttgt 25 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attR3 recognition sequence <400> 42 WO 2002/096923 PCT/US2002/01745] -38- gttcagcttt cttgtacaaa gttgg 25 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attLl recognition sequence <400> 43 agcctgcttt tttgtacaaa gttgg 25 <210> 44 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attL2 recognition sequence <400> 44 agcctgcttt cttgtacaaa gttgg 25 <210> 45 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attL3 recognition sequence <400> 45 acccagcttt cttgtacaaa gttgg 25 <210> 46 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attPl recognition sequence <400> 46 gttcagcttt tttgtacaaa gttgg 25 <210> 47 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attP2,P3 recognition sequence <400> 47 gttcagcttt cttgtacaaa gttgg 25 <210> 48 <211> 282 <212> DNA <213> Artificial Sequence <220> <223> attP recognition sequence <400> 48 ccttgcgcta atgctctgtt acaggtcact aataccatct aagtagttga ttcatagtga 60 WO 20(12/096923 PCT/US2002/017451 -39- ctgcatatgt tgtattttac agtattatgt agtctgtttt ttatgcaaaa tctaatttaa 120 tatattgata tttatatcat tttacgtttc tcgttcagct tttttatact aagttggcat 180 tataaaaaag cattgcttat csatttgttg caacgaacag gtcactatca gtcaaaataa 240 aatcattatt tgatttcaat tttgtcccac tccctgcctc tg 282 <210> 49 <211> 1071 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence encoding Integrase E174R <221> CDS <222> (1)...(1071) <223> Integrase E174R <400> 49 atg gga aga agg cga agt cat gag cgc egg gat tta ccc cct aac ctt 48 Met Gly Arg Arg Arg Ser His Glu Arg Arg Asp Leu Pro Pro Asn Leu 15 10 15 tat ata aga aac aat gga tat tac tgc tac agg gac cca agg acg ggt 96 Tyr lie Arg Asn Asn Gly Tyr Tyr Cys Tyr Arg Asp Pro Arg Thr Gly 20 25 30 aaa gag ttt gga tta ggc aga gac agg cga atc gca atc act gaa get 144 Lys Glu Phe Gly Leu Gly Arg Asp Arg Arg lie Ala lie Thr Glu Ala 35 40 45 ata cag gcc aac att gag tta ttt tea gga cac aaa cac aag cct ctg 192 lie Gin Ala Asn lie Glu Leu Phe Ser Gly His Lys His Lys Pro Leu 50 55 60 aca gcg aga atc aac agt gat aat tcc gtt acg tta cat tea tgg ctt 240 Thr Ala Arg lie Asn Ser Asp A.sn Ser Val Thr Leu His Ser Trp Leu 65 70 75 80 gat cgc tac gaa aaa atc ctg gcc age aga gga atc aag cag aag aca 288 Asp Arg Tyr Glu Lys lie Leu Ala Ser Arg Gly lie Lys Gin Lys Thr 85 90 95 ctc ata aat tac atg age aaa att aaa gca ata agg agg ggt ctg cct 336 Leu lie Asn Tyr Met Ser Lys lie Lys Ala lie Arg Arg Gly Leu Pro 100 105 110 gat get cca ctt gaa gac atc acc aca aaa gaa att gcg gca atg ctc 384 Asp Ala Pro Leu Glu Asp lie Thr Thr Lys Glu lie Ala Ala Met Leu 115 120 125 aat gga tac ata gac gag ggc aag gcg gcg tea gcc aag tta atc aga 432 Asn Gly Tyr lie Asp Glu Gly Lys Ala Ala Ser Ala Lys Leu lie Arg 130 135 140 tea aca ctg age gat gca ttc cga gag gca ata get gaa ggc cat ata 480 Ser Thr Leu Ser Asp Ala Phe Arg Glu Ala lie Ala Glu Gly His lie 145 150 155 160 aca aca aac cat gtc get gcc act cgc gca gca aaa tct aga gta agg 528 Thr Thr Asn His Val Ala Ala Thr Arg Ala Ala Lys Ser Arg Val Arg 165 170 175 aga tea aga ctt acg get gac gaa tac ctg aaa att tat caa gca gca 576 Arg Ser Arg Leu Thr Ala Asp Glu Tyr Leu Lys lie Tyr Gin Ala Ala 180 185 190 caa tea tea cca tgt tgg ctc aga ctt gca atg gaa ctg get gtt gtt 624 WO 2002/096923 PCT/US2002/017451 -40- Glu Ser Ser Pro Cys Trp Leu Arg Leu Ala Met Glu Leu Ala Val Val 195 200 205 acc ggg caa cga gtt ggt gat tta tgc gaa atg aag tgg tct gat atc 672 Thr Gly Gin Arg Val Gly Asp Leu Cys Glu Met Lys Trp Ser Asp lie 210 215 220 gta gat gga tat ctt tat gtc gag caa age aaa aca ggc gta aaa att 720 Val A.sp Gly Tyr Leu Tyr Val Glu Gin Ser Lys Thr Gly Val Lys lie 225 230 235 240 gcc atc cca aca gca ttg cat att gat get ctc gga ata tea atg aag 768 Ala lie Pro Thr Ala Leu His lie Asp Ala Leu Gly lie Ser Met Lys 245 250 255 gaa aca ctt gat aaa tgc aaa gag att ctt ggc gga gaa acc ata att 816 Glu Thr Leu Asp Lys Cys Lys Glu lie Leu Gly Gly Glu Thr lie lie 260 265 270 gca tct act cgt cgc gaa ccg ctt tea tcc ggc aca gta tea agg tat 864 Ala Ser Thr Arg Arg Glu Pro Leu Ser Ser Gly Thr Val Ser Arg Tyr 275 280 285 ttt atg cgc gca cga aaa gca tea ggt ctt tcc ttc gaa ggg gat ccg 912 Phe Met Arg Ala Arg Lys Ala Ser Gly Leu Ser Phe Glu Gly Asp Pro 290 295 300 cct acc ttt cac gag ttg cgc agt ttg tct gca aga ctc tat gag aag 960 Pro Thr Phe His Glu Leu Arg Ser Leu Ser Ala Arg Leu Tyr Glu Lys 305 310 315 320 cag ata age gat aag ttt get caa cat ctt ctc ggg cat aag teg gac 1008 Gin lie Ser A.sp Lys Phe Ala Gin His Leu Leu Gly His Lys Ser Asp 325 330 335 acc atg gca tea cag tat cgt gat gac aga age agg gag tgg gac aaa 1056 Thr Met Ala Ser Gin Tyr Arg Asp Asp Arg Gly Arg Glu Trp Asp Lys 340 345 350 att gaa atc aaa taa 1071 lie Glu lie Lys * 355 <210> 50 <211> 356 <212> PRT <213> Artificial Sequence <220> <223> Integrase E174R <400> 50 Met Gly Arg Arg Arg Ser His Glu Arg Arg Asp Leu Pro Pro Asn Leu 15 10 15 Tyr lie Arg Asn A.sn Gly Tyr Tyr Cys Tyr Arg Asp Pro Arg Thr Gly 20 25 30 Lys Glu Phe Gly Leu Gly Arg Asp Arg Arg lie Ala lie Thr Glu Ala 35 40 45 lie Gin Ala Asn lie Glu Leu Phe Ser Gly His Lys His Lys Pro Leu 50 55 60 Thr Ala Arg lie Asn Ser A.sp Asn Ser Val Thr Leu His Ser Trp Leu 65 70 75 80 Asp Arg Tyr Glu Lys lie Leu Ala Ser Arg Gly lie Lys Gin Lys Thr 85 90 95 Leu lie Asn Tyr Met Ser Lys lie Lys Ala lie Arg Arg Gly Leu Pro 100 105 110 Asp Ala Pro Leu Glu Asp lie Thr Thr Lys Glu lie Ala Ala Met Leu WO 2002/096923 PCT/US2O02/017451 -41- 115 120 125 Asn Gly Tyr lie Asp Glu Gly Lys Ala Ala Ser Ala Lys Leu lie Arg 130 135 140 Ser Thr Leu Ser Asp Ala Phe Arg Glu Ala lie Ala Glu Gly His lie 145 150 155 160 Thr Thr Asn His Val Ala Ala Thr A.rg Ala Ala Lys Ser Arg Val Arg 165 170 175 Arg Ser Arg Leu Thr Ala Asp Glu Tyr Leu Lys lie Tyr Gin Ala Ala 180 185 190 Glu Ser Ser Pro Cys Trp Leu Arg Leu Ala Met Glu Leu Ala Val Val 195 200 205 Thr Gly Gin Arg Val Gly Asp Leu Cys Glu Met Lys Trp Ser Asp lie 210 215 220 Val Asp Gly Tyr Leu Tyr Val Glu Gin Ser Lys Thr Gly Val Lys lie 225 230 235 240 Ala lie Pro Thr Ala Leu His lie Asp Ala Leu Gly lie Ser Met Lys 245 250 255 Glu Thr Leu A.sp Lys Cys Lys Glu lie Leu Gly Gly Glu Thr lie lie 260 265 270 Ala Ser Thr Arg Arg Glu Pro Leu Ser Ser Gly Thr Val Ser Arg Tyr 275 280 285 Phe Met Arg Ala Arg Lys Ala Ser Gly Leu Ser Phe Glu Gly Asp Pro 290 295 300 Pro Thr Phe His Glu Leu Arg Ser Leu Ser Ala Arg Leu Tyr Glu Lys 305 310 315 320 Gin lie Ser Asp Lys Phe Ala Gin His Leu Leu Gly His Lys Ser Asp 325 330 335 Thr Met Ala Ser Gin Tyr A.rg Asp Asp Arg Gly Arg Glu Trp Asp Lys 340 345 350 lie Glu lie Lys 355 <210> 51 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Lox P Site <400> 51 ataacttcgt ataatgtatg ctatacgaag ttat 34