MXPA00001449A - Genetic control of plant growth and development - Google Patents

Abstract

The wheat i(Rht) gene and homologues from other species including rice and maize (the i(D8) gene), useful for modification of growth and/or development characteristics of plants. Transgenic plants and methods and means for their production.

Description

GENETIC CONTROL OF PLANT GROWTH AND DEVELOPMENT DESCRIPTION OF THE INVENTION This invention relates to the genetic control of the growth and / or development of plants and the cloning and expression of genes involved in them. More particularly, the invention relates to the cloning and expression of the Rh t gene of Tri ti cum aes ti vum, and homologs from other species, and use of the genes in plants. An understanding of the genetic mechanisms that influence the development and growth of plants, including flowering, provides a means to alter the characteristics of a target plant. The species for which manipulation of growth and / or development characteristics may be advantageous include all crops, with important examples being cereals, rice and corn, probably the most agronomically important in hot climatic zones, and wheat , barley, oats and rye in more temperate climates. The important crops for seed products are oily seed rapeseed REF .: 32701 and the cañola, corn, sunflower, soybean and sorghum. Many harvests that are harvested by their roots, are, of course, developed annually from the seed and the production of the seed of any kind is very dependent on the ability of the plant to flower, to be pollinated and to give seeds. In horticulture, the control of the timing of growth and development, including flowering, is important. Horticultural plants whose flowering can be controlled include lettuce, endives and Brassica vegetables including cabbage, broccoli, cauliflower, and carnations and geraniums. Dwarf plants on the one hand and higher plants of greater size on the other hand, can be advantageous and / or desirable in various horticultural and agricultural contexts, including also trees, plantation crops and pastures. Recent decades have seen large increases in grain yields such as wheat due to the incorporation of Rh-homeoalloys of semi-shrinkage within production or breeding programs. These increases have made it possible for wheat productivity to keep pace with the demands of the growing world population. Previously, the cloning of the alleles of Arabi dopsi s gai was described (International Patent Application PCT / GB97 / 00390 filed on February 12, 1997 and published as 097/29123 on August 14, 1998, John Innes Center Innovations Limited, the complete content of which is incorporated by reference herein) which, like Rh mutant alleles in wheat (a monocot), confers a semi-dominant dwarf phenotype on Arabi dopsi s (a dicotyledonous) and a reduction in ability to respond to the plant growth hormone gibberellin (GA). gai codes for a mutant protein (gai) which lacks a segment of 17 amino acid residues found near the N-terminus of the wild-type protein (GAI). The sequence of this segment is highly conserved in a rice cDNA sequence (EST). Here, we show that this cDNA corresponds to a short section of the cereal genome maps, overlaps, that are known to contain the Rh t loci, and that we have used the cDNA to isolate the Rh t wheat genes. Those genomes with divergence as wide as those of Arabi dopsi and Tri ti cum must possess a conserved sequence which, when mutated, affects the responsiveness of GA, indicating a role for that sequence in GA signaling that is conserved at all long of the vegetable kingdom. In addition, the cloning of Rh t allows its transfer to many different crop species, with the aim of improving the yield as high as that previously obtained with wheat. The introduction of Rh-homeoaleels of semi-shrinkage (cloning) (originally known as the Norin 10 genes, derived from a Japanese variety, Norin 10) in select wheat bread production lines was one of the most significant contributors to the so-called 'green revolution' (Gale et al, 1985. Dwarfing genes in wheat.) In: Progress in Plant Breeding, GE Russell ( ed) Butterworths, London pp. 1-35) Wheat containing these homeoallels consistently produces wheat that lacks them, and now comprises about 80% of the wheat crops around the world.The biological basis of this improvement of the First, the semi-dwarf phenotype conferred by the Rh t alleles causes an increased resistance to fall (crushing of the plants by wind / rain with the consequent loss of yield.) Second, these alleles they cause a redistribution of photoassimilated, with more that is directed towards the grain, and less toward the stem (Gale et al, 1985). This is demonstrated by the fact that wheat yields in the United Kingdom increased by more than 20% during the years in which the lines containing .Rht were collected by farmers. Rh t mutants are dwarfed or dwarf because they contain a genetically dominant Rh t mutant allele which compromises their responses to gibberellin (GA, an endogenous plant growth regulator) (Gale et al., 1976. Heredity 37; 283-289). Thus, coleoptiles of rh t mutants, contrary to those of wild-type wheat plants, do not respond to GA applications. In addition, rh t mutants accumulate biologically active GAs at higher levels than those found in wild-type controls (Lenton et al., 1987). Insensitivity to gibberellin and depletion in wheat - consequences for development. In: Hormonal Action in Plant Development - a critical approach. GV Haod, JR Lenton, MB Jackson and RK Atkin (eds) Butterworths, London pp. 145-160). These properties (genetic dominance, reduced GA responses, and high levels of endogenous GA) are common to phenotypes conferred by mutations in other species (D8 / D9 in maize, gai in Arabidopsi s), indicating that these mutant alleles define genes orthologs in these different species, further supported by the observation that D8 / D9 and Rh t are synthetic loci in the corn and wheat genomes. According to a first aspect of the present invention, there is provided a nucleic acid molecule comprising a nucleotide sequence that codes for a polypeptide with Rh t function. The term 'Rht function' indicates the ability to influence the phenotype of a plant such as the Rh t gene of Tri ti cum. 'Rh function' can be observed phenotypically in a plant such as inhibition, suppression, suppression or reduction of the growth of the plant, whose inhibition, suppression, repression or reduction is antagonized by GA. The expression of Rh t tends to confer a dwarf phenotype on a plant, which is antagonized by GA. Overexpression in a plant from a nucleotide sequence encoding a Rh-t-function polypeptide can be used to confer a dwarf phenotype on a plant that is correctable by treatment with GA. Also, according to one aspect of the present invention, there is provided a nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide with the ability to confer a rh t mutant phenotype on expression. The rh t mutant plants are dwarfed compared to the wild-type ones, the shrinkage being insensitive to GA. In the present, 'Rht' (with capital letters) is used to refer to the wild type function, while 'rht' (with lowercase letters) is used to refer to the mutant function. Many plant growth and development processes are regulated by specific members of a family of tetracyclic diterpenoid growth factors known as gibberellins (GA) (Hooley, Pl an t Mol. Bi ol. 2 6, 1529-1555 (1994)). By gibberellin or GA is meant a diterpenoid molecule with the basic carbon ring structure shown in Figure 5 and having biological activity, for example, we refer to biologically active gibberellins. The biological activity can be defined by one or more of the stimulation of cell elongation, leaf senescence or promotion of the aleurone α-amylase response of cereals. There are many standard assays available in the art, a positive result in one or more of whose signals a test gibberellin is considered to be biologically active (Hoad et al., Phyt och emi s try 20, 703-713 (1981); Serebryakov et al. , Phyt och emi s try 23, 1847-1854 (1984), Smith et al., Phytochemis try 33, 17-20 (1993)). The assays available in the art include the lettuce hypocotyl assay, the cucumber hypocotyl assay, and the oat first leaf assay, all of which determine biological activity based on the ability of a gibberellin applied to elongate the elongation respective tissue. Preferred tests are those in which the test composition is applied to a plant deficient in gibberellin. Such preferred assays include GA deficient Arabidopsi s treatment, to determine the growth, the dwarf pea test, in which the internodular elongation is determined, the Tan-ginbozu dwarf rice test, in which the elongation of the leaf sheath is determined, and the maize d5 test , also in which the elongation of the leaf sheath is determined. Elongation bioassays measure the effects of the general elongation of cells on the respective organs, and are not restricted to particular cell types. In addition, the available assays include the romaza leaf senescence test (Jumex) and the aleurone cereal a-amylase assay. The aleurone cells that surround the endosperm in the grain secrete a-amylase upon germination, which digests the starch to produce sugars that are used by the developing plant. The production of enzymes is controlled by GA. Isolated aleurone cells which are administered biologically active GA, secrete α-amylase whose activity can then be evaluated, for example, by measurement of starch degradation. The structural features important for the high biological activity (shown by GAi, GA3, GA4 and GA7) are a carboxyl group on carbon 6 of the B ring; lactone on carbon 19 and on carbon 10; and β-hydroxylation at carbon 3. The β-hydroxylation at carbon 2 causes inactivity (shown by GA8, GA29, GA3 and GA51). The rh t mutants do not respond to treatment with GA, for example, treatment with GAi, GA3 or GA4. Treatment with GA is preferably by spraying with an aqueous solution, for example sprinkling with GA or 10 4 M GA4 in aqueous solution, perhaps weekly or more frequently, and may be by placing droplets on plants instead of spray. It can be applied dissolved in an organic solvent such as ethanol or acetone, because it is more soluble in them than in water, but this is not preferred because these solvents have a tendency to damage the plants. When using an organic solvent, suitable formulations include 24 nanoliters of GA3 or GA 0.6, 4.0 or 300 mM, dissolved in 80% ethanol.The plants, for example Arabi dopsi, can be grown on a medium containing GA, such as the tissue culture medium (GM) solidified with agar and containing supplemental GA.

The nucleic acid according to the present invention may have the sequence of a wild-type Rh t gene of Tri ti c um or be a mutant, derivative, variant or allele of the sequence provided. Preferred mutants, derivatives, variants and alleles are those that code for a protein that retains a functional characteristic of the protein encoded by the wild-type gene, especially the ability to inhibit the growth of the plant, whose inhibition is antagonized by GA , or the ability to confer on the plant one or more other characteristics that respond to the GA treatment of the plant. Other preferred mutants, derivatives, variants and alleles encode a protein that confers a rh t mutant phenotype, ie the reduced plant development whose reduction is insensitive to GA, for example, not overcome by GA treatment. Changes to a sequence, to produce a mutant, variant or derivative, can be by one or more of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution of one or more amino acids in the encoded polypeptide. Of course, changes to the nucleic acid that make no difference to the encoded amino acid sequence are also included. A preferred nucleotide sequence for a Rh t gene is one that codes for the RHT amino acid sequence shown in Figure 3b, especially a sequence encoding Rh t shown in Figure 3a. A preferred rh t mutant lacks part or all of the 17 amino acid sequence underlined in Figure 3b, and / or part of the DVAQKLEQLE sequence, which immediately follows the 17 amino acid sequence underlined in Figure 3b. Additional preferred nucleotide sequences encode the amino acid sequence shown in any other figure herein, especially a coding sequence shown in a Figure. The additional embodiments of the present invention, in all respects, employ a nucleotide sequence encoding the amino acid sequence shown in Figures 6b, 7b, 8b, 9b, 11b, lid or 12b. Such a coding sequence may be as shown in Figures 6a, 7a, 8a, 9a, lia, 11c or 12a. The present invention also provides a nucleic acid construct or vector comprising the nucleic acid with any of the sequences provided, preferably a construct or vector from which the polypeptide encoded by the nucleic acid sequence can be expressed. The construction or vector is preferably suitable for transformation within a plant cell. The invention further encompasses a host cell transformed with such a construct or vector, especially a plant cell. Thus, a host cell, such as a plant cell, comprising nucleic acid according to the present invention, is also provided. Within the cell, the nucleic acid can be incorporated into the chromosome. There may be more than one heterologous nucleotide sequence per haploid genome. This, for example, makes possible the increased expression of the gene product compared to the endogenous levels, as discussed below. A construct or vector comprising the nucleic acid according to the present invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into the cells for recombination within the genome.

However, in one aspect the present invention provides a nucleic acid construct comprising a Rh to rh t coding sequence (which includes homologs from plants other than Tri ti c um) attached to a regulatory sequence for control of the expression, the regulatory sequences being different from those naturally fused to the coding sequence and preferably from or derived from another gene. The nucleic acid molecules and the vectors according to the present invention can be as an isolated, with the proviso that the isolate comes from its natural environment, in substantially pure or homogeneous form, or is free or substantially free of nucleic acid or of genes of the species of interest or origin other than the sequence encoding a polypeptide capable of of influencing development and / or growth, which may include flowering, for example in the nucleic acid of Tri ti cum aesti vum different from the Rh t coding sequence. The term 'Nucleic acid isolate' encompasses the complete or partially synthetic nucleic acid.

The nucleic acid can of course be double-stranded or single-stranded, cDNA or genomic DNA, RNA, totally or partially synthetic, as appropriate. Of course, where the nucleic acid according to the invention includes RNA, the reference to the sequence shown can be considered to encompass the RNA equivalent, with U substituted by T. The present invention also encompasses the expression product of any of the nucleic acid sequences described, and methods of making the expression product by expression from the nucleic acid coding therefor, under suitable conditions in appropriate host cells. Those skilled in the art are very capable of constructing vectors and designing protocols for the expression and recovery of recombinant gene expression products. Suitable vectors can be chosen or constructed, containing the appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For additional details see, for example, Mol ecul ar Cl oning: a Labora t ory Manual: 2nd Edition, Sambrook et al., 1989, Cold Spring Harbor Laboratory Press. The transformation procedures depend on the host used, but they are well known. Many known techniques and protocols for the manipulation of nucleic acid, for example in the preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and protein analysis, are described in detail in s in Mol ecul ar Bi olgy, Second Edition, Ausubel et al., eds. , John Wiley & Sons, 1992. The specific procedures and vectors previously used with great success on plants are described by Bevan, Nucí. Acids Res. (1984) 12, 8711-8721), and Guerineau and Mullineaux, (1993) Transformation and expression vectors in plants. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148. The descriptions of Sambrook et al. And Ausubel et al. And all other documents mentioned herein are incorporated by reference herein. Expression as a fusion with a polyhistidine tag allows the purification of Rht or rht to be achieved using the Ni-NTA resin available from QIAGEN Inc. (USA) and DIAGEN Gmbh (Germany). See Janknecht et al., Proc. Na ti. Acad. Sci. USA 88, 8972-8976 (1991) and EP-A-0253303 and EP-A-0282042. The Ni-NTA resin having high affinity for the proteins with the consecutive histidines next to the N-terminus or the C-terminus of the protein, can thus be used to purify Rht or rht proteins labeled with histidine from plants, parts or extracts. of plants or from recombinant organisms such as yeasts or bacteria, for example E. coli, which express the protein. The purified Rht protein, for example recombinantly produced by expression from the nucleic acid encoding it, can be used to produce antibodies using techniques that are standard in the art. Antibodies and polypeptides comprising antigen-binding fragments of the antibodies can be used in the identification of homologs from other species, as discussed below. Methods for producing antibodies include immunizing a mammal (eg, human, mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof. The antibodies can be obtained from animals immunized using any of a variety of techniques known in the art, and can be selected, preferably by using the antibody binding to the antigen of interest. For example, Western blotting or transfer techniques or immunoprecipitation can be used (Armitage et al., 1992, Nature 347: 80-82). The antibodies can be polyclonal or monoclonal. As an alternative or supplement to the immunization of a mammal, antibodies with appropriate binding specificity can be obtained from a recombinantly produced library of the immunoglobulin variable domains, expressed, for example using the bacteriophage lambda or the filamentous bacteriophage shown functional immunoglobulin binding domains on their surfaces; for example, see WO92 / 01047. The antibodies produced for a Rht polypeptide, or rht, can be used in the identification and / or isolation of homologous polypeptides, and then the coding genes. Thus, the present invention provides a method for identifying or isolating a Rht function polypeptide or the ability to confer a rh t mutant phenotype, comprising the selection of candidate polypeptides with a polypeptide comprising the antigen binding domain of the polypeptide. an antibody (e.g., the entire antibody or a fragment thereof) which is capable of binding to a Rht or rht polypeptide of Tri ti cum a is ti vum, or preferably has binding specificity for such polypeptide, such as the one having the amino acid sequence shown in Figure 3b. The candidate polypeptides for selection may be for example the products of an expression library created using the nucleic acid derived from a plant of interest, or they may be the product of a purification process from a natural source. A polypeptide that was found to bind to the antibody can be isolated and then subject to amino acid sequencing. Any suitable technique for sequencing the polypeptide can be used, either completely or partially (for example a fragment of the polypeptide can be sequenced). The amino acid sequence information can be used to obtain the nucleic acid encoding the polypeptide, for example by designing one or more oligonucleotides (eg, a degenerate pool of oligonucleotides) for use as probes or primers in hybridization to the candidate nucleic acid, as discussed below in the present. A further aspect of the present invention provides a method for identifying and cloning Rh t homologs from plant species other than Tri ti cum, which method employs a nucleotide sequence derived from any shown in Figure 2 or Figure 3a, or another figure in the present. Sequences derived from these can be used as such in the identification and cloning of other sequences. The information of the nucleotide sequence provided herein, or any part thereof, can be used in a database search to find homologous sequences, the expression products of which can be tested for Rh t function. Alternatively, nucleic acid libraries can be selected using techniques well known to those of ordinary skill in the art, and the homologous sequences identified by them, and then tested. For example, the present invention also provides a method for identifying and / or isolating a Rh to rh t homologous gene, comprising probing the candidate nucleic acid (or "Target") with the nucleic acid encoding a Rh-function polypeptide. To a fragment or mutant, derivative or allele thereof, the candidate nucleic acid (which may be for example cDNA or genomic DNA) may be derived from any cell or organism that may contain or is suspected to contain the nucleic acid encoding Such a homologue In a preferred embodiment of this aspect of the present invention, the nucleic acid used to probe the candidate nucleic acid encodes an amino acid sequence shown in Figure 3b, a sequence complementary to a coding sequence, or a fragment of any of these, more preferably comprising a nucleotide sequence shown in Figure 3a.Alternatively, as discussed, pu A probe can be designed using the amino acid sequence information obtained by sequencing a polynucleotide identified as being capable of being linked by an antigen binding domain of an antibody, which is capable of binding to a Rht or rht polypeptide such as one with the amino acid sequence of Rht shown in Figure 3b. The preferred conditions forThe probes are those that are strict enough for there to be a simple pattern with a small number of hybridizations identified as positive, which can be investigated further. It is well known in the art to increase the requirement for hybridization gradually until only a few positive clones remain. As an alternative to probing, although still employing nucleic acid hybridization, oligonucleotides designed to amplify the DNA sequences of the Rh t genes can be used in PCR or other methods involving the amplification of nucleic acid, using routine procedures. See for example 'PCR protocols; A Guide to Methods and Applications ", Eds. Innis et al., 1990, Academic Press, New York.

Preferred amino acid sequences suitable for use in the design of PCR probes or primers are conserved sequences (complete, substantial or partially) between the Rh t genes. Based on the amino acid sequence information, the oligonucleotide probes or primers can be designed, taking into account the degeneracy of the genetic code and, where appropriate, the use of the codon of the organism from which the candidate nucleic acid is derived. . In particular, the primers and probes can be designed using information on the apparent conserved sequences for example, of Figure 3 and / or Figure 4, and also Figure 10. Where a coding nucleic acid molecule, full length does not has been obtained, a smaller molecule that represents part of the complete molecule, can be used to obtain full-length clones. Inserts can be prepared for example from partial cDNA clones and used to select cDNA libraries. Full-length, isolated clones can be subcloned into vectors such as expression vectors or vectors suitable for transformation into plants. Overlapping clones can be used to provide a full length sequence. The present invention also extends to the nucleic acid encoding Rh to a homolog obtainable using a nucleotide sequence derived from Figure 2 or Figure 3a, and such nucleic acid obtainable using one or more, eg, a pair, of primers including a sequence shown in Table 1. Also included within the scope of the present invention are the nucleic acid molecules that code for the amino acid sequences that are homologous to the polypeptide encoded by Rh t of Tri ti cum. A homolog may be from a different species of Tri ti cum. The homology may be at the level of the nucleotide sequence and / or the amino acid sequence. Preferably, the nucleic acid sequence and / or amino acid sequence shares homology with the sequence encoded by the nucleotide sequence of Figure 3a, preferably at least about 50%, or 60%, or 70%, or 80%, or 85% of homology, more preferably at least 90%, 92%, 95% or 97% homology. The nucleic acid encoding such a polypeptide may preferably share with the Rh t gene of Tri ti cum the ability to confer a particular phenotype on expression in a plant, preferably a phenotype that is one that responds to GA (eg there is a change in a characteristic of the plant on GA treatment), such as the ability to inhibit the development of plants where the inhibition is antagonized by GA. As noted, the expression of Rh t in a plant can affect one or more other characteristics of the plant. A preferred feature that can be shared with the Rh t gene of Tri ti cum is the ability to complement a null mutant phenotype in Rh t, in a plant such as Tri ti cum, such phenotype being the resistance to the diminution effect of paclobutrazol. The slender mutant of barley corresponds to a location in the genome of barley equivalent to that of Rh t in the wheat genome. Such mutant plants are strongly resistant to paclobutrazol. The present inventors believe that the strand barley mutant is a null mutant allele of the orthologous gene for wheat Rh, allowing the complementation of the barley mutant with the wheat gene. The ability to complement a strand mutant in barley may be a feature of the embodiments of the present invention. Some preferred embodiments of the polypeptides according to the present invention (encoded by the nucleic acid modalities according to the present invention) include the 17 amino acid sequence which is underlined in Figure 3b, or a contiguous sequence of amino acid residues with at least approximately 10 residues with similarity or identity with the corresponding waste, respective (in terms of position) in 17 amino acids that are underlined in Figure 3b, more preferably 11, 12, 13, 14, 15, 16 or 17 of such residues, and / or the DVAQKLEQLE sequence, or a contiguous sequence of amino acids with at least about 5 residues with similarity or identity with the respective corresponding residue (in terms of position) within DVAQKLEQLE, more preferably 6, 7, 8 or 9 of such residues. Additional embodiments include the 27 amino acid sequence DELLAALGYKVRASDMADVAQKLEQLE, or a contiguous sequence of amino acid residues with at least about 15 residues with similarity or identity to the respective corresponding residue (in terms of position) within this sequence, more preferably 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25 or 26 of such residues. As is well understood, the homology of the amino acid level is generally in terms of amino acid similarity or identity. The similarity allows for 'conservative variation', for example the substitution of a hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic acid for acid Asparagine, or glutamine by asparagine The similarity can be as defined and determined by the TBLASTN program, by Altschul et al. (1990) J. Mol. Biol. 215: 403-10, which is in standard use in the art. , or more preferably GAP (Wisconsin Manual Package Program, version 8, September 1994, Genetics Computer Group, 575 Science Drive, Madison, USA), which uses the Needleman and Wunsch algorithm to align sequences. GAP include the default parameters, a gap creation penalty = 12 and a gap extension penalty = 4, or a gap creation penalty of 3.00 and a gap extension penalty of 0.1. the full length of the Rh t sequence of Figure 3b, or may be more preferably on a contiguous sequence of 10 amino acids compared to DVAQKLEQLE, and / or a contiguous sequence of 17 amino acids, compared to the 17 amino acids underlined in Figure 3b , and / or a contiguous sequence of 27 amino acids compared to DELLAALGYKVRASDMADVAQKLEQLE, or a longer sequence, for example of about 30, 40, 50 or more amino acids, compared to the amino acid sequence of Figure 3b and preferably including all 17 amino acids underlined and / or DVAQKLEQLE. At the level of the nucleic acid, the homology may be over the entire length or more preferably by comparison with the coding sequence of 30 nucleotides within the sequence of Figure 3a and coding for the sequence DVAQKLEQLE and / or the coding sequence of 51 nucleotides within the sequence of Figure 3a and coding for the 17 amino acid sequence underlined in Figure 3b, or a longer sequence, for example of about 60, 70, 80, 90, 100, 120, 150 or more nucleotides, and preferably including nucleotide 51 of Figure 3, which codes for the underlined sequence of 17 amino acids of Figure 3b. As noted, the similarity can be as defined and determined by the TBLASTN program, by Altschul et al. (1990) J. Mol. Bi ol. 215: 403-10, which is in standard use in the art, or the standard BestFit program, which is part of the Wisconsin Package, Version 8, September 1994, (Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA, Wisconsin 53711). BestFit performs an optimal alignment of the best segment of similarity between two sequences. Optimal alignments are found by inserting clearances to maximize the number of couplings using Smith and Waterman's local homology algorithm (Adv. Appl. Ma th. (1981) 2: 482-489). Other algorithms include GAP, which uses the Needleman and Wunsch algorithm to align two complete sequences that maximizes the number of couplings and minimizes the number of free spaces. As with any algorithm, default parameters are generally used, which for gap are a penalty of creation of free space = 12 and the penalty of expression of free space 4. The algorithm FASTA (which uses the method of Pearson and Lipman) (1988) PNAS USA 85: 2444-2448) is an additional alternative. The use of any of the terms 'homology' and 'homologous' herein does not imply any necessary evolutionary reaction between the compared sequences, in accordance for example with the standard use of terms such as 'homologous recombination' which merely requires that two The nucleotide sequences are sufficiently similar to recombine under the appropriate conditions The further description of the polypeptides according to the present invention, which can be encoded by the nucleic acid according to the present invention, is set forth below. extends the nucleic acid that hybridizes with one or more of the specific sequences described herein, under stringent conditions.Hybridization can be determined by nucleic acid probing and identifying positive hybridization under suitably stringent conditions (according to the techniques known.) For the survey, l The preferred conditions are those that are strict enough so that there is a simple pattern with a small number of hybridizations identified as positive which can be investigated later. It is well known in the art to increase the requirement for hybridization gradually until only a few positive clones remain. The binding of a probe to the target nucleic acid (eg, DNA) can be measured using any of a variety of techniques available to those skilled in the art. For example, the probes can be radioactive, fluorescent or enzymatically labeled. Other methods that do not employ probe labeling include examination of restriction fragment length polymorphisms, amplification using PCR, RNAse cleavage, and allele-specific oligonucleotide probing. The sounding may employ the standard stain or Southern blot technique. For example, DNA can be extracted from cells and digested with different restriction enzymes. The restriction fragments can then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. The labeled probe can be hybridized to the DNA fragments on the filter and the binding is determined. DNA for probing can be prepared from RNA preparations from cells, by techniques such as reverse transcriptase PCR. Preliminary experiments can be performed by hybridization under conditions of low requirement of various probes to blots or Southern blots of DNA digested with restriction enzymes. For the survey, the preferred conditions are those that are strict enough so that there is a simple pattern with a small number of hybridizations identified as positive, which can be investigated later. It is well known in the art to increase the requirement for hybridization gradually, until only a few positive clones remain. Appropriate conditions could be achieved when a large number of hybridization fragments were obtained, while the background hybridization was low. Using these conditions can be investigated nucleic acid libraries, for example cDNA libraries representative of the expressed sequences.

Those skilled in the art are well able to employ the appropriate conditions of the desired requirement for selective hybridization, taking into account such factors as the length of the oligonucleotide and the composition of the bases, the temperature and so forth. For example, the selection can be initially carried out under conditions, which comprise a temperature of about 37 ° C or more, a formamide concentration of less than about 50%, and a moderate to low salt concentration (for example Saline Citrate). Standard (SS SSC) = 0.15 M sodium chloride, 0.15 M sodium citrate, pH 7). Alternatively, a temperature of about 50 ° C or more and a high salt concentration (for example XSSPE '= 0.180 mM sodium chloride, 9 mM disodium hydrogen phosphate, 9 mM sodium diacid phosphate, 1 mM sodium EDTA, pH 7.4). Preferably, the selection is carried out at about 37 ° C, a formamide concentration of about 20%, and a salt concentration of about 5 X SSC, or a temperature of about 50 ° C and a salt concentration of about 2 ° C. X SSPE. These conditions will allow the identification of sequences that have a substantial degree of homology (similarity, identity) with the probe sequence, without requiring the perfect homology for the identification of a standard hybrid. Suitable conditions include, for example, for the detection of sequences that are approximately 80 to 90% identical, overnight hybridization at 42 ° C in 0.25 M Na2HP04, pH 7.2, 6.5% SDS, 10% dextran sulfate. % and a final wash at 55 ° C in 0.1X SSC, 0.1% SDS. For detection of sequences that are more than about 90% identical, suitable conditions include overnight hybridization at 65 ° C in 0.25 M Na2HP04, pH 7.2, 6.5% SDS, 10% dextran sulfate and a wash final at 60 ° C in 0. IX SSC, 0.1% SDS. The conditions that can be used to differentiate Rh genes and homologs from others can include the following procedure: The first and second DNA molecules are run on an agarose gel, transferred on a membrane filter (Sambrook et al., 1989 ). The filters are incubated in prehybridization solution [6xSSC, 5x Denhart's solution, 20mM Tris-HCl, 0.1% SDS, 2mM EDTA, 20μg / ml salmon sperm DNA] at 65 ° C for 5 hours, with constant agitation. Then, the solution is replaced with 30 ml of the same, containing the second radioactively labeled DNA (prepared according to standard techniques, see Sambrook et al., 1989), and incubated overnight at 65 ° C, with constant agitation. The next morning the filters are rinsed (a rinse with 3xSSC-0.1% SDS solution); and then washed: a wash at 65 ° C, for 25 minutes, with 3x SSC-0.1% SDS solution; and a second wash, at the same temperature and for the same tempo, with 0.1xSSC-0.1% SDS. Then the pattern of radioactivity on the filter is recorded using standard techniques (see Sambrook et al., 1989). If necessary, the requirement can be increased by increasing the temperature of the washings, and / or reducing or even omitting together, the initial SSC wash solution. (SSC is 150 mM NaCl, 15 mM sodium citrate, Denhart 50x solution is 1% (w / v) of ficoll, 1% polyvinylpyrrolidone, 1% (w / v) of bovine serum albumin). Homologs for the rh t mutants are also provided by the present invention.

These may be mutants where the wild type includes the 17 amino acids underlined in Figure 3b, or a contiguous sequence of 17 amino acids with at least about 10 (most preferably 11, 12, 13, 14, 15, 16 or 17) having similarity or identity with the corresponding residue in the sequence of 17 amino acids underlined in Figure 3, but the mutant does not. Similarly, such mutants can be where the wild type includes DVAQKLEQLE or a contiguous sequence of 10 amino acids with at least about 5 (more preferably 6)., 7, 8 or 9) that have similarity or identity with the corresponding residue in the DVAQKLEQLE sequence, but the mutant does not. The nucleic acid encoding such mutant polypeptides can, upon expression in a plant, confer a phenotype that is insensitive or unresponsive to the treatment of the plant with GA, ie a mutant phenotype that is not overcome or there is no reversion to the phenotype. of wild type with the treatment of the plant with GA (although there may be some response in the plant on provision or depletion of GA). A further aspect of the present invention provides a nucleic acid isolate having a nucleotide sequence encoding a polypeptide that includes an amino acid sequence that is a mutant, allele, derivative or variant sequence of the Rh t amino acid sequence of the species Tri ti cum a ti ti vum shown in Figure 3b, or is a homolog of another species or a mutant, allele, derivative or variant thereof, wherein said mutant, allele, derivative or variant or homolog differs from the amino acid sequence shown in Figure 3b as an insertion, deletion, addition and / or substitution of one or more amino acids, as is obtainable by the production of transgenic plants by transformation of plants having a null mutant phenotype of Rh t, whose phenotype is the resistance to the diminution effect of paclobutrazol, with the test nucleic acid, provoking or allowing the expression from the nucleic acid of test, within transgenic plants, selecting the transgenic plants for those that show complementation of the null mutant phenotype in Rh t to identify the test nucleic acid capable of complementing the null mutant in Rh t, suppressing the nucleic acid identified thus, as it is capable of complementing the null mutant in Rh t a nucleotide sequence encoding the 17 amino acid sequence underlined in Figure 3b or a contiguous sequence of 17 amino acids in which at least 10 residues have similarity or identity to the respective amino acid in the corresponding position in the sequence of 17 amino acids underlined in Figure 3b, more preferably 11, 12, 13, 14, 15, 16 or 17, and / or a nucleotide sequence coding for DVAQKLEQLE or a contiguous sequence of 10 amino acids with at least about 5 (more preferably 6, 7, 8 or 9) that have similarity or identity with the corresponding residue in the DVAQK sequence LEQLE A cell containing the nucleic acid of the present invention represents a further aspect of the invention, particularly a plant cell, or a bacterial cell. The cell may contain the nucleic acid encoding the protein by virtue of the introduction, within the cell or an ancestor thereof, of the nucleic acid, for example by transformation using any suitable technique, available to those of experience in the art. matter . Also, according to the invention there is provided a plant cell having nucleic acid incorporated as described in its genome. Where a sequence of full natural origin is employed, the plant cell may be from a plant different from the natural host of the sequence. The present invention also provides a plant comprising such a plant cell. Also, according to the invention there is provided a plant cell having incorporated within its genome a sequence of the nucleotides, as provided by the present invention, under the operative control of a regulatory sequence for the control of expression. A further aspect of the present invention provides a method for making such a plant cell, which involves the introduction of a vector comprising the sequence of the nucleotides within a plant cell and causing or allowing recombination between the vector and the genome of the plant. the plant cell to introduce the sequence of the nucleotides within the genome. A plant according to the present invention may be one that does not truly multiply in one or more properties. Plant varieties can be excluded, particularly the varieties of registered plants according to the Rights of Plant Breeders. It is noted that a plant does not need to be considered a 'plant variety' simply because it contains, stably within its genome, a transgene, introduced into a cell of the plant or an ancestor of the plant. the present invention provides any clone of such plant, seed, progeny own or hybrid and descendants, and any part of any of these, such as cuttings, seeds, etc. The invention provides any plant propagule, ie any part that can be used in reproduction or in propagation, sexual or asexual, including cuttings, seeds, etc. Also encompassed by the invention is a plant that is a sexually propagated or asexually propagated, a clone or a descendant of such a plant, or any part or propagule of said plant, progeny, clone or descendant The invention also provides a method for influencing the characteristics of a plant , which comprises the expression of a heterologous Rh t or rh t gene sequence (or mutant, allele, derivative or homologue thereof, as discussed) within the cells of the plant. The term "heterologous" indicates that the gene / sequence of the nucleotides in question has been introduced into the cells of the plant, or an ancestor thereof, using genetic engineering, ie through human intervention, which may comprise the transformation The gene can be on an extragenomic or incorporated vector, preferably stably, within the genome The heterologous gene can replace an endogenous equivalent gene, for example one that normally performs the same or a similar function in the control of growth and / The development, or the inserted sequence may be additional to an endogenous gene.An advantage of the introduction of a heterologous gene is the ability to place the expression of the gene under the control of a promoter of choice, in order to make possible the influence on the expression of the gene, and therefore on the growth and / or development of the plant according to the preference. and wild-type gene derivatives can be used in place of the endogenous gene. The inserted gene can be foreign or exogenous to the host cell, for example from another plant species.

The main characteristics that can be altered using the present invention is growth. According to the model of the Rh t gene as a growth repressor, the sub-expression of the gene can be used to promote growth, at least in plants that have only an endogenous gene that confers Rh t function (not for example Arabi dopsi s which has endogenous homologs which could be compensated). This may involve the use of antisense or sense regulation. Higher plants can be made by emptying Rh t or the relevant homologous gene in the plant of interest. Plants that are resistant to compounds that inhibit GA biosynthesis, such as paclobutrazol, can be elaborated, for example to allow the use of a GA biosynthesis inhibitor to maintain the dwarf weeds but to leave the plants of the harvest grow tall. Overexpression of a Rh t gene can lead to a dwarf plant that is correctable by treatment with GA, as predicted by the Rh t repression model.

Since rh t mutant genes are dominant over the phenotype, they can be used to make GA-insensitive dwarf plants. This can be applied for example to any transformable harvest plant, tree or fruit tree species. This may provide higher yield / reduced fall due to wind or rain, such as Rht wheat. In rice this can provide GA insensitive rice resistant to Bakane disease, which is a problem in Japan and elsewhere. Dwarf ornamental plants can be valuable for horticulture and cut flower markets. The manipulation of the sequence can provide varying degrees of shrinkage severity, the GA-sensitive phenotype, allowing the manipulation or design of the degree of severity to the needs of each harvest plant or the wishes of the manipulator. Overexpression of rh t mutant sequences is potentially the most useful. A second characteristic that can be altered is the development of the plant, for example the flowering. In some plants, and under certain environmental conditions, a GA signal is required for floral induction. For example, Arabi dopsi s mutant plants deficient in GA developed under short day conditions will not flower, unless they are treated with GA. These plants do flower normally when they grow under long day conditions Mutant Arabidopsi s gai plants show delayed flowering under short day conditions. Severe mutants may not flower at all. Thus, for example by expression or overexpression Rh t or rh t, plants can be produced by remaining vegetative until they are given GA treatment to induce flowering. This can be useful in horticultural contexts or for spinach, lettuce and other crops where suppression of fixation is desirable. The nucleic acid according to the invention can be placed under the control of an externally inducible gene promoter to place the Rh t or rh t coding sequence under the control of the user. The term "inducible" as applied to a promoter is well understood by those of skill in the art In essence, expression under the control of an inducible promoter is "on" or increased in response to an applied stimulus. The nature of the stimulus varies among the promoters. Some inducible promoters cause small or undetectable levels of expression (or non-expression) in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus. The preferable situation is where the level of expression increases after the application of the relevant stimulus by an effective amount to alter a phenotypic characteristic. In this way, an inducible (or 'switchable') promoter can be used, which causes a basic level of expression in the absence of the stimulus, whose level is too low to give rise to a desired phenotype (and can in fact be zero). the application of the stimulus, the expression is increased (or turned on) to a level that gives rise to the desired phenotype.The suitable promoters include the gene promoter of the Cauliflower Mosaic Virus 35S (CaMV 35S) that is expressed at a high level in virtually all plant tissues (Benfey et al., 1990a and 1990b); the promoter of the isoform II gene of corn glutathione-S-transferase (GST-II-27) which is activated in response to the application of exogenous insurer (WO93 / 01294, ICI Ltd); the meri 5 promoter of cauliflower that is expressed in the vegetative apical meristem, as well as in several well-localized positions in the body of the plant, for example the internal phloem, the primordium of the flower, the branching points in the root and the outbreak (Medford, 1992; Medford and collaborators, 1991) and the LEAFY promoter of Arabi dopsi s thali ana that is expressed very early in the development of the flower (Weigel et al., 1992). The promoter of the GST-II-27 gene has been shown to be induced by certain chemical compounds which can be applied to developing plants. The promoter is functional in monocotyledons and dicotyledons. This can therefore be used to control the expression of the gene in a variety of genetically modified plants, including field crops such as canola, sunflower, tobacco, sugar beet, cotton; cereals such as wheat, barley, rice, corn, sorghum; fruits such as tomatoes, mangoes, peaches, apples, strawberries, bananas and melons; and vegetables such as carrots, lettuce, cabbage and onions. The GST-II-27 promoter is also suitable for use in a variety of tissues, including roots, leaves, stems and reproductive tissues. Accordingly, the present invention provides in a further aspect a gene construct comprising an inducible promoter operably linked to a nucleotide sequence provided by the present invention, such as the Rht gene of Tri ti cum, a homologue from another plant species or any mutant, derivative or allele thereof. This makes it possible to control the expression of the gene. The invention also provides plants transformed with the gene construct and methods comprising the introduction of such a construct into a plant cell and / or the induction of the expression of a construct within a plant cell, by application of an appropriate stimulus, an effective exogenous inducer. The promoter can be the promoter of the GST-II-27 gene or any other inducible plant promoter. When a chosen gene construct is introduced into a cell, certain considerations, well known to those of experience in the field, must be taken into account. The nucleic acid to be inserted must be assembled into a construct that contains effective regulatory elements which will drive transcription. A method of transportation of the construction within the cells must be available. Once the construction is within the cell membrane, integration within the endogenous chromosomal material will occur or not. Finally, as to whether the plants are related or not, the type of target cell must be such that the cells can be regenerated into whole plants. Selectable genetic markers can be used consisting of chimeric genes that confer selectable phenotypes such as resistance to antibiotics such as kanamycin, hygromycin, phosphinothricin, chlorsulfuron, methotrexate, gentamicin, spectinomycin, imidazolinones and glyphosate. One aspect of the present invention is the use of the nucleic acid according to the invention in the production of a transgenic plant. A further aspect provides a method that includes introducing the nucleic acid into a plant cell and causing or allowing the incorporation of the nucleic acid into the genome of the cell. Any suitable method of plant transformation can be used to generate plant cells comprising the nucleic acid according to the present invention. After the transformation, plants can be regenerated from transformed plant cells and transformed tissues. Cells and / or plants successfully transformed, for example with the construct incorporated within their genome, can be selected after the introduction of nucleic acid into plant cells, optionally followed by regeneration within a plant, for example, using one or more marker genes such as antibiotic resistance (see above). Plants transformed with the DNA segment containing the sequence can be produced by standard techniques that are already known for the genetic manipulation of plants. The DNA can be transformed into plant cells using any suitable technology, such as a vector of disarmed Ti plasmids, carried by Agroba ct erium, exploiting their natural gene transfer ability (European Patent EP-A-270355, EP-A -0116718, NAR 12 (22) 8711-87215 1984), bombardment with particles or microprojectiles (US Patent No. 5100792, European Patent EP-A-444882, EP-A-434616), microinjection (WO92 / 09696, WO 94 / 00583, EP-331083, EP-175966, Green et al. (1987) Plant Ti ssue and Cell Cul t ure, Academic Press), electroporation (EP-290395, WO-8706614 Gelvin Debeyser - see annex) other forms of direct uptake of DNA (DE-4005152, WO-9012096, US-4684611), liposome-mediated DNA uptake (for example Free an et al., Pl ant Cell Physi ol 29: 1353 (1984)), or the vortexing method ( for example Kindle, PNAS U. S. A. 87: '1228 (1990d) .The physical methods for transformation of plant cells are reviewed in Oard, 1991, Biotech. Adv. 9: 1-11. The transformation of Agrobacterium is widely used by those skilled in the art to transform dicotyledonous species. Recently, there has been substantial progress towards the routine production of stable, fertile transgenic plants in almost all economically relevant monocotyledonous plants (Toriyama et al. (1988) Bio / Technology 6, 1072-1074; Zhang et al. (1988) Plant Cell Rep. 1, 379-384; Zhang et al. (1988) Theor Appl Genet 76, 835-840; Shimamoto et al (1989) Nature 338, 274-276; Datta et al. (1990) Bio / 'Technology 8, 736-740; Christou et al. (1991) Bio / Technology 9, 957-962; Peng et al. (1991) International Rice Research Institute, Manila, Philippines 563-574; Cao et al. (1992) Plant Cell Rep. 11, 585-591; Li et al. (1993) Plant Cell Rep. 12, 250-255; Rathore et al. (1993) Plant Molecular Biology 21, 871-884; Fromm et al. (1990) Bio / Technology 8, 833-839; Gordon-Kamm et al. (1990) Plant Cell 2, 603-618; D'Halluin et al. (1992) Plant Cell 4, 1495-1505; Walters et al. (1992) Plant Molecular Biology 18, 189-200; Koziel et al. (1993) Biotechnology 11, 194-200; Vasil, I.K. (1994) Plant Mlecular Biology 25, 925-937; Weeks and collaborators (1993) Plant Physiology 102, 1077-1084; Somers et al. (1992) Bio / Technology 10, 1589-1594; W092 / 14828). In particular, the Agrobacterium-mediated transformation is now also emerging as a highly efficient transformation method in monocotyledons (Hiei et al. (1994) The Plant Journal 6, 271-282). The generation of fertile transgenic plants has been achieved in cereals such as rice, corn, wheat, oats, and barley (reviewed in Shimamoto, K. (1994) Current Opinion in Biotechnology 5, 158-162; Vasil et al. (1992) Bio / Technology 10, 667-674; Vain et al 1995, Biotechnology Advances 13 (4): 653-671; Vasil, 1996, Nature Biotechnology 14, page 702). Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective. Alternatively, a combination of different techniques can be used to improve the efficiency of the transformation process, for example the bombardment with microparticles coated with Agrobacterium (European Patent EP-A-486234) or bombardment with microprojectiles to induce wound or injury, followed by co-cultivation by Agrobacterium (European Patent EP-A-486233). The transformation with Brassica napus is described in Moloney et al. (1989) Plant Cell Report 8: 238-242.

After transformation, a plant can be regenerated, for example from simple cells, from callus tissue or from leaf discs, as is standard in the art. Almost any plant can be completely regenerated from the cells, tissues and organs of plants. The available techniques are reviewed in Vasil et al., Cell Cul t ure and Soma ti c Cel Geneti cs of Plants, Vol. I, II and III, Labora tory Procedures and Th eir Appli ca ti ons, Academic Press, 1984, and Weissbach and Weissbach, Methods for Plant Biological Engineering, Academic Press, 1989. The particular choice of a transformation technology will be determined by its efficiency in transforming certain plant species, as well as the experience and preference of the person who practices the transformation. invention, with a particular methodology of choice. It will be apparent to the skilled person that the particular choice of a transformation system for introducing nucleic acid into plant cells is not essential to or a limitation of the invention, nor is it the choice of technique for regeneration of the plant. In the present invention, overexpression can be carried out by introducing the nucleotide sequence in a sense orientation. Thus, the present invention provides a method for influencing a characteristic of a plant, the method comprising causing or allowing expression of the nucleic acid according to the invention from said nucleic acid within the cells of the plant. Sub-expression of the gene product polypeptide can be achieved using antisense technology or 'sense regulation. "The use of anti-sense genes or partial gene sequences to down-regulate gene expression is now well established. DNA is placed under the control of a promoter such that the transcription of the "antisense" strand of the DNA produces the RNA that is complementary to the normal mRNA transcribed from the "sense" strand of the target gene.For the double-stranded DNA this is achieved by placing a coding sequence or a fragment thereof in a 'reverse orientation' under the control of a promoter. The complementary antisense RNA sequence is thought to bind to the mRNA to form a duplex, inhibiting translation of the endogenous mRNA from the target gene into protein. Whether or not this is the effective mode of action, it is still uncertain. However, it is an established fact that the technique works. See, for example, Rothstein et al., 1987; Smith et al. (1988) Na t ure 334, 724-726; Zhang et al., (1992) Th e Pl ant Cell 4, 1575-1588, English et al., (1996) Th e Pl an t Cell 8, 179-188. Antisense technology is also reviewed in Bourque, (1995), Pl ant Sci ence 105, 125-149, and Flavell, (1994) PNAS USA 91, 3490-3496. The complete sequence corresponding to the coding sequence in the reverse orientation does not need to be used. For example, fragments of sufficient length can be used. It is a routine matter for the person skilled in the art to select fragments of various sizes and from various parts of the coding sequence to optimize the level of antisense inhibition. It may be advantageous to include the start methionine ATG codon, and perhaps one or more nucleotides upstream (5 ') of the start codon. A further possibility is to direct a regulatory sequence of a gene, for example a sequence that is characteristic of one or more genes, into one or more pathogens, against which resistance is desired. A suitable fragment may have at least about 14-23 nucleotides, for example about 15, 16 or 17, or more, at least about 25, at least about 30, at least about 40, at least about 50, or more. Other fragments may be at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least 600 aapprrooxxiimmaaddaammeennttee, at least about 700 nucleotides or more. Such fragments in sense orientation can be used in co-suppression (see below). The total complementarity of the sequence is not essential, although it may be preferred. One or more nucleotides may differ in the antisense construct from the target gene. It may be preferred that there is sufficient homology for the respective antisense and RNA molecules to hybridize, particularly under the conditions in a plant cell. Thus, the present invention also provides a method of influencing a characteristic of a plant, the method comprising causing or allowing antisense transcription from the nucleic acid according to the invention, within the cells of the plant. When additional copies of the target gene are inserted in sense, that is, the same orientation as the target gene, a range of phenotypes is produced that includes individuals where overexpression occurs and some where the protein under expression occurs from target gene. When the inserted gene is only part of the endogenous gene, the number of sub-expression individuals in the transgenic population is increased. The mechanism by which regulation in sense occurs, particularly sub-regulation, is not well understood. However, it is also well reported in scientific and patent literature and is routinely used for gene control.

See for example, van der Krol et al., (1990) Th e Pl an t Cell 2, 291-299; Napoli and collaborators (1990) The Pl an t Cell 2, 279-289; Zhang et al., (1992) Th e Pl an t Cel l 4, 1575-1588, and U.S. Patent No. US-A-5, 231, 020. Thus, the present invention also provides a method for influencing a characteristic of a plant, the method comprising causing or allowing expression from the nucleic acid according to the invention, within the cells of the plant. This can be used to influence growth. The aspects and embodiments of the present invention will now be illustrated, by way of example, with reference to the appended figures. The additional aspects and modalities will be apparent to those with experience in the subject. All the documents mentioned in this text are incorporated by reference in it. The following Figures are included herein. Figure 1: Alignment of the predicted GAI amino acid sequence, N-terminus (Gai), with rice EST D39460 (0830), with a 'region of homology up-regulated in black. Figure 2: DNA sequences from C15-1, 14al and 5al. Figure 2a shows a consensual DNA sequence, C15-1 cDNA (obtained via the one-step sequencing). Figure 2b shows the data from the runs, of original DNA sequencing from 14a (single pass).

Figure 2c shows the data from the original DNA sequencing runs from 5a (single pass). Figure 3: Rht sequences. Figure 3a shows a DNA sequence composed of the Rh t gene of wheat derived from the data of Figure 2, including the coding sequence. Figure 3b shows an alignment of the predicted, complete Rht protein sequence encoded by the coding sequence of Figure 2 (rht) with the sequence of the predicted GAI protein, complete with Arabi dopsi s (Gai). The regions of the sequential identity are highlighted in black. Figure 4: Sequence D39460. Figure 4a shows the DNA sequence. (simple step) of rice D39460 cDNA. This cDNA is a partial, incomplete clone that lacks the 3 'end of the mRNA from which it is derived. Figure 4b shows the alignment of the predicted, complete Rht protein sequence (wheat-encoded by the coding sequence of Figure 2) with that of GAI (Gai) and the rice protein sequence predicted from the DNA sequence in Figure 4a (Rice). The amino acid identity regions are highlighted in black; some conservative substitutions are shaded. Figure 5: Basic structure of the carbon ring of gibberellins. Figure 6: EST sequence of rice. Figure 6a shows the nucleotide sequence of EST rice D39460, as determined by the present inventors. Figure 6b shows the predicted amino acid sequence encoded by the rice EST sequence of Figure 6a. Figure 7: C15-1 wheat cDNA. Figure 7a shows the nucleotide sequence of the C15-1 wheat cDNA. Figure 7b shows the predicted amino acid sequence of the C15-1 wheat cDNA of Figure 7a. Figure 8: Genomic clone of wheat 5al. Figure 8a shows the nucleotide sequence of the wheat genomic clone 5al. Figure 8b shows the predicted amino acid sequence of the genomic clone of wheat 5al of Figure 8a.

Figure 9: Genomic clone of maize lal. Figure 9a shows the nucleotide sequence of the corn genomic clone lal, for example D8. Figure 9b shows the amino acid sequence of the maize genomic clone lal of Figure 9a. Figure 10 shows a PRETTYBOX alignment of the amino acid sequences of the corn D8 polypeptide with, the wheat Rht polypeptide, the rice EST sequence determined by the present inventors and the Gai polypeptide of Arabidopsi s thaliana. Figure 11: Sequences of D8 corn alleles. Figure Ia shows a partial nucleotide sequence of the D8-1 maize allele. Figure 11b shows a partial amino acid sequence of the D8-1 corn allele. Figure 11c shows a partial nucleotide sequence of the corn allele D8-2023. Figure lid shows a partial amino acid sequence of the corn allele D8-2023. Figure 12: rh t-10 wheat allele.

Figure 12a shows a partial nucleotide sequence of the wheat allele rh t-1 0. Figure 12b shows a partial amino acid sequence of the ri? T-10 wheat allele.

Previously, the GAI gene from Arabi dopsi s was cloned (PCT / GB97 / 03390-W097 / 29123 published on August 14, 1997). Comparison of the wild type DNA sequences (GAI) and the mutant alleles (gai) showed that gai codes for a predicted mutant protein product (gai) which lacks a 17 amino acid segment near the N-terminus of the protein . The selection of the DNA sequence databases with the GAI sequence revealed the existence of an EST rice (D39460) which contains a sequence region very closely related to that of the segment that is deleted from GAI in the gai protein. . A comparison of the predicted amino acid sequences from the DELLA region to the EQLE are identical in both sequences. The two differences (V / A; E / D) are conservative substitutions, in which one amino acid residue is replaced by another that has very similar chemical properties. In addition, the identity region extends beyond the limit of the region of suppression in the gai protein. The DVAQKLEQLE sequence is not affected by the deletion in gai, and is still perfectly preserved between the sequences GAI and D39460 (figure 1). A sub-fragment Sal l-No t l of approximately 700 base pairs D39460 was used in low-requirement hybridization experiments to isolate the hybridization clones from the wheat cDNA and the genomic libraries (made from the DNA from the Chínese variety).

Spring) and from a genomic corn library (elaborated from line B73N). Several wheat clones were isolated, including C15-1 and C15-10 (cDNAs), and 5al and 14al (genomic clones). Clone C15-1 has been used in gene map mapping experiments. The nulisomic-tetrasomic analysis showed that the clone C15-1 hybridizes to the genomic DNA fragments derived from the wheat chromosomes 4A, 4B and 4D. This is consistent with the clone C15-1 containing the Rh t sequence, from the map of the Rh t loci to the chromosomes of group 4. In addition, the recombinant analysis using a segregating population for the Rh t -Dlb allele (formerly Rh t 2) identified a fragment of hybridization that showed perfect co-segregation with the mutant allele. This placed the genomic site of the gene encoding the mRNA sequence in the C15-1 cDNA within a 2 cM segment (which was already known to contain Rh t) of the group 4 chromosomes, and provides strong evidence that cDNA and genomic clones do indeed contain the Rh t gene. The DNA sequence of the D8 maize described herein is derived from the contiguous subcloned salt fragments of 1.8 kb and 3.0 kb (cloned in Bluescript ™ SK +) from it. the Rh t wheat sequence described herein is from a 5.7 kb Dral subfragment (cloned within Bluescript ™ SK +) from the 5al clone. Figure 2a gives the complete DNA sequence (one step) of the C15-1 cDNA. The DNA sequence for C15-10 has also been obtained; This is identical to that of C15-1, and therefore is not shown. Figures 2b and 2c show the original data from the individual sequencing runs from clones 14al and 5al. The sequences shown in Figure 2 can be overlapped to make a DNA composite sequence, shown in Figure 3a. This sequence shows strong homology with that of Arabidopsi s GAI, as revealed by a comparison of the amino acid sequence of a predicted translational product of the wheat sequence (Rht) with that of GAI (GAI) shown in Figure 3b. In particular, the predicted amino acid sequence of Rh t presumed reveals a region of close identity with GAI over the region lacking in gai (Figure 4). Figure 4 reveals that the homology that extends beyond the region of suppression of gai in rice EST, is also conserved in Rht (DVAQKLEQLE), indicating in this way that this region, in addition to that found in the suppression of gai, is involved in the transduction of the GA signal. This region is not found in SCR, another protein that is related in sequence to GAI but which is not involved in GA signaling. The primers used in the above sequencing experiments are shown in Table 1. Further confirmation that these sequences are of course the Rh t wheat and D8 maize loci has been obtained by analysis of the gene sequences from the various loci. mutant alleles, as follows.

The present inventors obtained and sequenced the clone identified in the database as the rice EST D39460, and the predicted nucleotide and amino acid sequences resulting from this work are shown in Figure 6a and Figure 6b respectively. Previous work on the GAI gene from Arabi dopsi showed that the GAI protein consists of two sections, an N-terminal half that shows no homology to any protein of known function, and a C-terminal half that shows extensive homology with the factor transcript of the Arabi dopsi SCR candidate (Peng et al. (1997) Genes and Devel opmen t 11: 3194-3205; PCT / GB97 / 00390). As described above, deletion of a portion of the N-terminal half of the protein causes the characteristic of reduced GA responses of the gai mutant allele (Peng et al., 1997; PCT / GB / 00390). The inventors therefore predicted that if D8 and Rh t are respectively functional homologues of maize and wheat (orthologs) of Arabidopsi s GAI, then the dominant mutant alleles of D8 and Rh t should also contain mutations that affect the N-terminal sections of the proteins they encode.

Previous reports describe a number of dominant mutant alleles in D8 and Rht, in particular D8-1, D8-2023 and Rht-Dlc (formerly RhtlO) (Borner et al. (1996) Euphytica 89: 69-75; Harberd and Freeling (1989) Genetics 121: 827-838; Winkler and Freeling (1994) Plant 193: 341-348). The present inventors thus cloned the candidate D8 / Rht genes from these mutants, and examined by DNA sequencing the portion of the gene encoding the N-terminal half of the protein. A fragment of the candidate D8 or Rht genes, which codes for a portion of the N-terminal half of the D8 / Rht protein was amplified via PCR from the genomic DNA of plants containing D8-1, D8-2023 and Rht- Dlc, using the following primers for amplification: for D8-1, the primers ZM-15 and ZM-24; for 8-2023, the primers ZM-9 and ZM-11; for Rht-Dlc, nested PCR was performed using Rht-15 and Rht-26 followed by Rht-16 and Rha-2. The PCR reactions were performed using a Perkin El er geneAmp XL PCR kit, using the following conditions: the reactions were incubated at 94 ° C for 1 minute, then subjected to 13 cycles of 94 ° C, 15 seconds - x ° C for 15 seconds - 69 ° C 5 minutes (where X is reduced by 1 ° C per cycle starting at 64 ° C and ending at 52 ° C), then 25 cycles of 94 ° C, 15 seconds - 53 ° C, 15 seconds - 65 ° C, 5 minutes, then 10 minutes at 70 ° C. These fragments were then cloned into the vector pGEMR-T Easy (Promega, see Technical Manual), and their DNA sequences were determined. Mutations were found in candidate genes D8 and Rh t in each of the above mutants. The D8-1 mutation is a suppression infrastructure! that removes VAQK amino acids (55-59) and add a G (see sequence in Figure a and Figure 11b). This deletion overlaps with the conserved homology block DVAQKLEQLE, described above. D8-2203 is another mutation by infrastructural deletion that removes the amino acids LATDTVHYNPSD (87-98) from the N-terminus of the D8 protein (see Figure 11c and Figure lid). This deletion does not overlap with the deletion in gai or D8-1, but covers another region that is highly conserved between GAI, D8 and Rht (see Figure 10). Finally, Rh t -Dl c contains another small intrastructural deletion that removes the amino acids LNAPPPPPPAPQ (109-121) in the N-terminal region of the mutant Rht protein that it encodes (see Figure 12a and Figure 12b) (LN-P is conserved between GAI, D8 and Rht, see Figure 10). Thus, all of the mutant alleles described above are dominant, and contain dwarfism associated with the reduced response to GA. All three of these alleles contain deletion mutations that remove a portion of the N-terminal half of the protein they encode. These observations demonstrate that the D8 and Rht genes of corn and wheat have been cloned.

TABLE 1 - Primers used in the Rht sequencing Sense Sequence Name -L TTTGCGCCAATTATTGGCCAGAGATAGATAGAGAG Front 16-L GTGGCGGCATGGGTTCGTCCGAGGACAAGATGATG Front 23-L CATGGAGGCGGTGGAGAACTGGGAACGAAGAAGGG Inverse 26-L CCCGGCCAGGCGCCATGCCGAGGTGGCAATCAGGG Inverse 3-L GGTATCTGCTTCACCAGCGCCTCCGCGGCGGAGAG Inverse 9-L ATCGGCCGCAGCGCGTAGATGCTGCTGGAGGAGTC Inverse RHA-1 CTGGTGAAGCAGATACCCTTGC Front RHA-2 CTGGTTGGCGGTGAAGTGCG Inverse RHA-3 GCAAGGGTATCTGCTTCACCAGC Inverse RHA-5 CGCACTTCACCGCCAACCAG Front RHA-6 TTGTGATTTGCCTCCTGTTTCC Front RHA-7 CCGTGCGCCCCCGTGCGGCCCAG Front RHA-8 AGGCTGCCTGACGCTGGGGTTGC Front RHT-9 GATCGGCCGCAGCGCGTAGATGC Inverse RHT-10 GATCCCGCACGGAGTCGGCGGACAG Inverse RHT-12 TCCGACAGCATGCTCTCGACCCAAG Inverse RHT-13 TTCCGTCCGTCTGGCGTGAAGAGG Front RHT-14 AAATCCCGAACCCGCCCCCAGAAC Front RHT-15 GCGCCAATTATTGGCCAGAGATAG Front RHT-16 GGCATGGGTTCGTCCGAGGACAAG Front RHT-18 TTGTCCTCGGACGAACCCATGCCG Inverse RHT-19 GATCCAAATCCCGAACCCGCCC Front RHT-20 GTAGATGCTGCTGGAGGAGTCG Inverse RHT-21 GTCGTCCATCCACCTCTTCACG Inverso RHT-22 GCCAGAGATAGATAGAGAGGCG Front RHT-23 TAGGGCTTAGGAGTTTTACGGG Inverse RHT-24 CGGAGTCGGCGGACACGGTCGGC Inverse RHT-25 CGGAGAGGTTCTCCTGCTGCACGGC Inverse RHT-26 TGTGCAACCCCAGCGTCAGGCAG Inverse RHT-27 GCGGCCTCGTCGCCGCCACGCTC Front RHT-28 TGGCGGCGACGAGGCCGCGGTAC Inverse RHT-29 AAGAATAAGGAAGAGATGGAGATGGTTG Inverse RHT-30 TCTGCAACGTGGTGGCCTGCGAG Front RHT-31 CCCCTCGCAGGCCACCACGTTGC Inverse RHT-32 TTGGGTCGAGAGCATGCTGTCGGAG Front TABLE 2 - Chips used in the sequence of clones D-í Sense Sequence Name ZM-8 GGCGATGACACGGATGACG Front ZM-9 CTTGCGCATGGCACCGCCCTGCGACGAAG Inverse ZM-10 CCAGCTAATAATGGCTTGCGCGCCTCG Inverse ZM-11 TATCCCAGAACCGAAACCGAG Front ZM-12 CGGCGTCTTGGTACTCGCGCTTCATG Inverse ZM-13 TGGGCTCCCGCGCCGAGTCCGTGGAC Inverse ZM-14 CTCCAAGCCTCTTGCGCTGACCGAGATCGAG Front ZM-15 TCCACAGGCTCACCAGTCACCAACATCAATC Front ZM-16 ACGGTACTGGAAGTCCACGCGGATGGTGTG Inverse ZM-17 CGCACACCATCCGCGTGGACTTCCAGTAC Front ZM-18 CTCGGCCGGCAGATCTGCAACGTGGTG Front ZM-1 TTGTGACGGTGGACGATGTGGACGCGAGCCTTG Inverse ZM-20 GGACGCTGCGACAAACCGTCCATCGATCCAAC Front ZM-21 TCCGAAATCATGAAGCGCGAGTACCAAGAC Front ZM-22 TCGGGTACAAGGTGCGTTCGTCGGATATG Front ZM-23 ATGAAGCGCGAGTACCAAGAC Front ZM-24 GTGTGCCTTGATGCGGTCCAGAAG Inverse ZM-25 AACCACCCCTCCCTGATCACGGAG Inverse ZM-27 CACTAGGAGCTCCGTGGTCGAAGCTG Front ZM-28 GCTGCGCAAGAAGCCGGTGCAGCTC Inverse ZM-29 AGTACACTTCCGACATGACTTG Inverse It is noted that in relation to this date, the best method known by the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (54)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. An isolated polynucleotide encoding a polypeptide, characterized in that it comprises the amino acid sequence DELLAALGYKVRASDMA and whose expression in a plant of Tri ti cum aes ti vum provides inhibition of the growth of the plant, whose inhibition is antagonized by gibberellin.

2. An isolated polynucleotide according to claim 1, characterized in that the polypeptide includes the amino acid sequence of a Rh t polypeptide obtainable from Tri ti cum aestivum.

3 . An isolated polynucleotide according to claim 2, characterized in that it includes the nucleotide nucleic acid sequence obtainable from Tri ti cum aes ti vum coding for the Rh t polypeptide, the nucleotide sequence includes GACGAGCTGCTGGCGGCGCTCGGGTACAAGGTGCGCGCCTCCGACATGGCG.

4. An isolated polynucleotide encoding a polypeptide, characterized in that it comprises the amino acid sequence shown in Figure 8b.

5. An isolated polynucleotide according to claim 4, characterized in that it has the coding nucleotide sequence shown in Figure 8a.

6. An isolated polynucleotide encoding a polypeptide, which upon expression in a plant provides inhibition of plant growth, which inhibition is antagonized by gibberellin, characterized in that the polypeptide has an amino acid sequence that exhibits at least 80% similarity with the Amino acid sequence of the Rh t Tri ti cum aes ti vum polypeptide encoded by the nucleic acid obtainable from Tri ti cum aestivum including the nucleotide sequence GACGAGCTGCTGGCGGCGCTCGGGTACAAGGTGCGCGCCTCCGACATGGCG.

7. An isolated polynucleotide according to claim 6, characterized in that the polypeptide includes the amino acid sequence DELLAALGYKVRASDMA.

8. An isolated polynucleotide according to claim 6, characterized in that the polynucleotide includes a contiguous sequence of 17 amino acids in which at least 10 residues show similarity or identity of amino acids with the residue in the corresponding position in the amino acid sequence DELLAALGYKVRASDMA.

9. An isolated polynucleotide according to claim 8, characterized in that the polypeptide includes a contiguous sequence of 17 amino acids in which 16 residues show amino acid identity with the residue at the corresponding position in the amino acid sequence DELLAALGYKVRASDMA.

10. An isolated polynucleotide according to claim 9, characterized in that the polypeptide includes the amino acid sequence shown in Figure 9b for the corn D8 polypeptide.

11. An isolated polynucleotide according to claim 10, characterized in that it has the coding nucleotide sequence shown in Figure 9a.

12. An isolated polynucleotide according to claim 9, characterized in that the polypeptide includes the amino acid sequence shown in Figure 6b.

13. An isolated polynucleotide according to claim 12, characterized in that it has the coding nucleotide sequence shown in Figure 6a.

14. An isolated polynucleotide that encodes a polypeptide which when expressed in a plant confers a plant phenotype that is dwarfism that does not respond to gibberellin or which, when expressed in a plant of null mutant phenotype in rh t complements the phenotype rh t null mutant, such a null mutant phenotype rh t being the resistance to the dwarfing effect of paclobutrazol, characterized in that the polypeptide has an amino acid sequence that shows at least 80% similarity to the amino acid sequence of the Rh t of Tri ti polypeptide cum aes ti vum encoded by the nucleic acid obtainable from Tri ti cum a es ti vum, which includes the nucleotide sequence GACGAGCTGCTGGCGGCGCTCGGGTACAAGGTGCGCGCCTCCGACATGGCG.

15. An isolated polynucleotide according to claim 14, characterized in that the polypeptide includes the amino acid sequence of a Rh t polypeptide obtainable from Tri ti cum a ti ti, with one or more suppressed amino acids.

16. An isolated polynucleotide according to claim 15, characterized in that the amino acid sequence DELLAALGYKVRASDMA is deleted.

17. An isolated polynucleotide according to claim 15, characterized in that the amino acid sequence LNAPPPPLPPAPQ is deleted.

18. An isolated polynucleotide according to claim 14, characterized in that the polypeptide includes the amino acid sequence shown in Figure 9b for the corn D8 polypeptide, with one or more amino acids deleted.

19. An isolated polynucleotide according to claim 18, characterized in that the amino acid sequence DELLAALGYKVRSSDMA is deleted.

20. An isolated polynucleotide according to claim 19, having the coding nucleotide sequence shown in Figure 9a, characterized in that the nucleotides encoding the amino acid sequence DELLAALGYKVRSSDMA is deleted.

21. An isolated polynucleotide according to claim 18, characterized in that the VAQK amino acid sequence is deleted.

22. An isolated polynucleotide according to claim 18, characterized in that the amino acid sequence LATDTVHYNPSD is deleted.

23. An isolated polynucleotide according to claim 14, characterized in that the polypeptide includes the amino acid sequence shown in Figure 6b, with one or more amino acids deleted.

24. An isolated polynucleotide according to claim 23, characterized in that the amino acid sequence DELLAALGYKVRSSDMA is deleted.

25. An isolated polynucleotide according to claim 24, having the coding nucleotide sequence shown in Figure 6a, characterized in that the nucleotides encoding the amino acid sequence DELLAALGYKVRSSDMA is deleted.

26. An isolated polynucleotide encoding a polypeptide, characterized in that it comprises the amino acid sequence shown in Figure 8b, with the amino acid sequence DELLAALGYKVRASDMA deleted.

27. An isolated polynucleotide according to claim 26, having the coding nucleotide sequence shown in Figure 8a, characterized in that the nucleotides encoding the amino acid sequence DELLAALGYKVRASDMA are deleted.

28. An isolated polynucleotide, characterized in that a polynucleotide according to any of claims 1 to 27 is operably linked to a regulatory sequence for expression.

29. An isolated polynucleotide according to claim 28, characterized in that the regulatory sequence includes an inducible promoter.

30. An isolated polynucleotide of which the nucleotide sequence is complementary to a sequence of at least 50 contiguous nucleotides of the coding sequence or sequence complementary to the coding sequence of the nucleic acid according to any one of claims 1 to 27, suitable for the use in antisense or sense regulation ('co-suppression') of the expression of the coding sequence and under the control of a regulatory sequence for transcription.

31. A polynucleotide according to claim 30, characterized in that the regulatory sequence includes an inducible promoter.

32. A nucleic acid vector, characterized in that it is suitable for the transformation of a plant cell and that it includes a polynucleotide according to any of the preceding claims.

33. A host cell, characterized in that it contains a heterologous polynucleotide or nucleic acid vector according to any of the preceding claims.

34. A host cell according to claim 33, characterized in that it is microbial.

35. A host cell according to claim 33, characterized in that it is a plant cell.

36. A plant cell according to claim 35, characterized in that it has the heterologous polynucleotide within its chromosome.

37. A plant cell according to claim 36, characterized in that it has more than one polynucleotide per haploid genome.

38. A plant cell according to any of claims 35 to 37, characterized in that it is comprised in a plant, a part of the plant or a propagule of the plant, or an extract or derivative of a plant.

39. A method for producing a cell according to any of claims 33 to 37, characterized in that the method includes the incorporation of the polynucleotide or the nucleic acid vector into the cell, by means of transformation.

40. A method according to claim 39, characterized in that it includes the recombination of the polynucleotide with the nucleic acid of the genome of the cell, such that it is stably incorporated therein.

41. A method according to claim 39 or claim 40, characterized in that it includes the regeneration of a plant from one or more transformed cells.

42. A plant, characterized in that it comprises a plant cell according to any of claims 35 to 37.

43. A part or propagule of a plant, characterized in that it comprises a plant cell according to any of claims 35 to 37.

44. A method for the production of a plant, characterized in that it includes the incorporation of a polynucleotide or a nucleic acid vector according to any of claims 1 to 32, within a plant cell and regenerating a plant from said cell vegetable

45. A method according to claim 44, characterized in that it includes the propagation or sexual or asexual development of the progeny or a descendant of the plant regenerated from the plant cell.

46. A method for influencing a characteristic of a plant, characterized in that the method includes causing or allowing expression from a heterologous polynucleotide according to any of claims 1 to 31 within the cells of the plant.

47. The use of a polynucleotide according to any of claims 1 to 32, in the production of a transgenic plant.

48. A method for the identification or obtaining of a polynucleotide according to claim 6, characterized in that the method includes the selection of the candidate nucleic acid using a nucleic acid molecule that hybridizes specifically with a polynucleotide according to any of claims 1 to the 13th

49. A method according to claim 48, characterized in that the oligonucleotide primers are used in PCR.

50. A method according to claim 49, characterized in that the primers are selected from those shown in Tables 1 and 2.

51. An isolated polypeptide, characterized in that it is encoded by a polynucleotide according to any of claims 1 to 27.

52. An antibody that includes an antigen binding site with binding affinity specific for the polypeptide according to claim 51.

53. A polypeptide, characterized in that it includes the antigen binding site of an antibody according to claim 52.

54. A method for identifying or obtaining a polypeptide according to claim 51, characterized in that the method includes the selection of candidate polypeptides with an antibody or polypeptide according to claim 52 or claim 53.