KR20220108440A - Virus like particle of avian influenza virus and vaccine compositon comprising the same - Google Patents

Abstract

The present invention relates to a recombinant vector, a recombinant baculovirus transformed therefrom, an avian influenza virus-like particle produced therefrom, a vaccine composition including the same, and a method for preventing infection with avian influenza viruses. The virus-like particles obtainable from the novel recombinant vector according to the present invention have an excellent expression rate of H5N1-type HA protein with high pathogenicity and infectiousness in a host. In addition, the virus-like particles express various subtypes of HA proteins such as HA proteins of H5N6-type avian influenza viruses simultaneously and can be mass-produced stably, so that the virus-like particles can be developed as a versatile vaccine for preventing various highly pathogenic subtypes of avian influenza.

Description

Avian influenza virus-like particles and vaccine composition comprising the same

The present invention relates to a recombinant vector, a recombinant baculovirus transformed therewith, avian influenza virus-like particles produced thereby, a vaccine composition comprising the same, and a method for preventing avian influenza virus infection using the same.

Avian influenza (Avian Influenza) is an acute viral disease of chickens and other poultry, which generally spreads rapidly, and its pathogenicity varies greatly from cases with no clinical symptoms to cases with a mortality rate of 100%. Avian influenza is classified into three types: highly pathogenic, weakly pathogenic, and non-pathogenic according to pathogenicity. Among them, Highly Pathogenic Avian Influenza (HPAI) is classified as a List A disease by the International Bureau of Veterinary Services (OIE) and a type 1 livestock infectious disease in Korea.

The causative agent of avian influenza is Infuenza virus type A of Orthomyxoviridae. The serotypes of influenza A are classified according to the types of two proteins, namely, hemagglutinin and neuraminidase, and there are H serotypes and N serotypes. There are 16 types of H serotypes and 9 types of avian influenza viruses, and there are 144 serotypes of influenza viruses that can exist arithmetically. All of the highly pathogenic avian influenza that have occurred so far belong to the H5 and H7 serotypes, and it is known that the high pathogenicity of these viruses is due to the repeating basic protein at the cleavage site of the HA protein.

Highly pathogenic avian influenza (HAPI) was the first in the country to be infected with H5N1, a subtype of influenza A, in Negative, Chungbuk in 2003, followed by various subtypes of H5N1, H5N6, and H5N8. Among them, the HAPI outbreak in 2016 ~ 2017 caused damage to 419 farms, resulting in a loss of about 3 trillion won in the poultry industry.

Various types of vaccines have been devised to prevent damage from such highly pathogenic avian influenza, but most are produced using recombinant viruses and eggs, and there is a limit to preparing for AI emergencies.

Crawford et al, Vaccine 1999, 17(18) 2265-2274

It is an object of the present invention to provide a novel recombinant vector capable of producing virus-like particles that highly express the HA protein of H5N1-type virus through a baculovirus system.

Another object of the present invention is to provide a recombinant baculovirus transformed with the vector.

Another object of the present invention is to provide virus-like particles produced using the recombinant baculovirus.

Another object of the present invention is to provide an avian influenza virus vaccine composition comprising the virus-like particles.

Another object of the present invention is to provide a method for preventing highly pathogenic avian influenza virus infection from poultry using the vaccine composition.

In order to achieve the above purpose,

One aspect of the present invention provides a chimeric HA gene comprising an HA1 region of a hemagglutinin (HA) gene derived from a H5N1 virus and an HA2 region of an HA gene derived from a H5N8 virus; and a matrix protein 1 (M1) gene derived from H1N1 virus.

In this case, the vector may further include an HA gene derived from the H5N6 virus.

Another aspect of the present invention provides a recombinant baculovirus transformed with the recombinant vector.

Another aspect of the present invention provides avian influenza virus-like particles produced using the recombinant baculovirus.

Another aspect of the present invention provides an avian influenza virus vaccine composition comprising the virus-like particle.

Another aspect of the present invention provides a method for preventing avian influenza virus infection comprising administering the vaccine composition to a subject.

The vaccine comprising the novel avian influenza virus-like particles according to the present invention not only has an excellent expression rate of the HA protein of the H5N1 virus, which is highly pathogenic and infectious in the host, but also can simultaneously express the HA protein of the H5N6 virus. A bar containing avian influenza virus-like particles obtained through a recombinant vector has the advantage of excellent defense. In addition, as it is manufactured using a baculovirus expression system, it has excellent stability and can be mass-produced. Therefore, the avian influenza virus-like particles of the present invention can be developed as a universal vaccine capable of preventing various subtypes of highly pathogenic avian influenza viruses.

1 is a construct included in a recombinant vector according to an embodiment of the present invention.
2 is a photograph taken with an electron microscope of virus-like particles expressed by recombinant baculovirus according to an embodiment of the present invention.
3 shows the HI test results using highly immune serum of H5N1 virus (KA435) and H5N6 virus (ES2).

Hereinafter, the present invention will be described in detail.

One aspect of the present invention provides a chimeric HA gene comprising an HA1 region of a hemagglutinin (HA) gene derived from a H5N1 virus and an HA2 region of an HA gene derived from a H5N8 virus; and a matrix protein 1 (M1) gene derived from H1N1 virus may be provided.

As used herein, the term "vector" refers to a gene construct comprising a nucleotide sequence of a gene operably linked to a suitable regulatory sequence so as to express a target gene in a suitable host, wherein the regulatory sequence is capable of initiating transcription. a promoter capable of regulating such transcription, any operator sequence to control such transcription, and sequences to control the termination of transcription and translation.

The hemagglutinin is a glycoprotein present in the envelope of avian influenza virus, and is one of the main causes of causing an immune response in the host when infected. The recombinant vector according to an embodiment of the present invention includes a gene encoding a HA protein of several highly pathogenic avian influenza viruses or a gene encoding a part of the HA protein, so that virus-like particles that can be produced therefrom are used as a vaccine. In particular, it has very good defense against viruses of various subtypes of H5 avian influenza.

The chimeric HA gene is a fusion of a part of the HA gene derived from the H5N1 virus and a partial sequence of the HA gene derived from the H5N8 virus, specifically, the HA1 region of the H5N1 virus and the HA2 region of the H5N8 virus. may include Virus-like particles produced using a recombinant vector containing such a chimeric HA gene have significantly higher antigen production compared to virus-like particles produced using a vector containing the full length of the HA gene of H5N1 virus.

The base sequence of the chimeric HA gene may be defined as, for example, SEQ ID NO: 1. In addition, the chimeric HA gene is not only the base sequence of SEQ ID NO: 1, but also 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, It may include a nucleotide sequence exhibiting 95% or more or 99% or more sequence homology.

In addition, the H5N1-type virus may be A/chicken/Vietnam/KA435/2013, and the H5N8-type virus may be A/environment/Korea/W454/2014, but is not limited thereto.

The 　 matrix 　 protein M1 is a matrix protein of the influenza virus that forms a coating film inside the virus envelope, and may be derived from the H1N1 virus.

The nucleotide sequence of the M1 gene derived from the H1N1 virus may be defined, for example, as SEQ ID NO: 2. In addition, the M1 gene is not only the base sequence of SEQ ID NO: 3, but also 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% It may include a nucleotide sequence showing greater than or greater than 99% sequence homology.

In addition, the H1N1 virus may be A/Puerto Rico/8/1934, but is not limited thereto.

In one embodiment, the vector may further include an HA gene derived from the H5N6 virus. The nucleotide sequence of the HA gene derived from the H5N6 virus may be defined, for example, as SEQ ID NO:3. In addition, the HA gene is not only the base sequence of SEQ ID NO: 2, but also 70% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% It may include a nucleotide sequence showing greater than or greater than 99% sequence homology.

In addition, the H5N6 virus may be A/duck/Korea/ES2/2016, but is not limited thereto.

On the other hand, the recombinant vector is a HA gene derived from H1N1 virus, HA gene derived from H1N2 virus, HA gene derived from H2N2 virus, HA gene derived from H3N2 virus, HA gene derived from H3N8 virus , HA gene derived from H5N2 virus, HA gene derived from H5N3 virus, HA gene derived from H5N8 virus, HA gene derived from H5N9 virus, HA gene derived from H7N1 virus, H7N1 virus HA gene derived from the H7N2 virus, the HA gene derived from the H7N3 virus, the HA gene derived from the H7N4 virus, the HA gene derived from the H7N7 virus, the HA gene derived from the H7N9 virus, It may further include at least one selected from the group consisting of HA gene derived from H9N2 virus and HA gene derived from H10N7 virus. Therefore, when a virus-like particle obtained using a baculovirus system as a vector containing two or more subtypes of viral genes is used as a vaccine, simultaneous immunogenicity against various avian influenza viruses can be imparted to a subject.

Another aspect of the present invention provides a recombinant baculovirus transformed with the recombinant vector. For example, the virus may be a recombinant baculovirus of accession number KCTC18881P.

The recombinant baculovirus refers to a baculovirus in which the chimeric HA gene, the HA gene derived from the H5N6 virus, and the M1 gene derived from the H1N1 virus are operably inserted into the genomic DNA of the baculovirus.

Specifically, a recombinant baculovirus may be prepared using the aforementioned recombinant vector using a baculovirus expression system, and the recombinant baculovirus may be infected with insect cells, and then virus-like particles may be isolated from the insect cells.

The insect cell is not particularly limited, and for example, Sf9 (Spodoptera frugiperda), Spodoptera exiaua, Choristoneura fumiferana, Trichoplusia ni and Spodoptera littoralis and Drosophila may be used, but are not limited thereto.

In the case of producing the virus-like particles of the present application using the recombinant baculovirus, there is an advantage in that the production yield is high and stable mass production is possible compared to other methods for producing virus-like particles.

Another aspect of the present invention provides avian influenza virus-like particles produced by the recombinant baculovirus.

As used herein, the term "Virus Like Particle (VLP)" refers to a type of antigen having a form similar to that of a virus. Virus-like particles are assembled in a form similar to that of an actual virus through the binding of viral structural proteins, but virus genes are not included in the virus-like particles during assembly.

The virus-like particle includes a gene encoding a HA protein of several avian influenza viruses or a gene encoding a part of the HA protein, so that when used as a vaccine, it has very good defense against various subtypes of highly pathogenic avian influenza viruses. . Specifically, the virus-like particle may include an H5N1-type virus-derived HA protein and an H5N6-type virus-derived HA protein.

Another aspect of the present invention may provide an avian influenza virus vaccine composition comprising the aforementioned virus-like particles as an active ingredient. As used herein, the term “vaccine composition” refers to a composition containing at least one immunologically active ingredient that induces an immunological response in an animal. The vaccine composition may be a bivalent vaccine that exhibits immunity to both H5N1 virus and H5N6 virus. In addition, it can exhibit immunogenicity against various subtypes of highly pathogenic avian influenza H5 virus.

The vaccine composition can be administered to all animals, including humans, which are already infected with or capable of being infected with an avian influenza virus, thereby preventing infection with highly pathogenic avian influenza H5N1 serotype and/or H5N6 serotype viruses. For example, A/chicken/Vietnam/KA435/2013, A/chicken/Korea/ES/2003, A/Wild duck/Korea/SNU50-5/2009, A/Environment/Korea/W149/2006 of H5N1 serotype , can prevent infection against A/duck/Korea/ES2/2016 of H5N6 serotype, but is not limited thereto, and may be a universal vaccine that prevents infection of subtype of highly pathogenic H5 serotype.

In addition, the vaccine composition comprises Newcastle disease virus (NDV), infectious bursitis virus (IBDV), infectious laryngitis virus (ILTV), avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowlpox. Virus, avian coronavirus, avian rotavirus, chicken anemia virus, avian astrovirus, avian parvovirus, avian retrovirus, a complex further comprising at least one virus selected from the group consisting of avian picornavirus or antigens thereof It could be a vaccine.

The vaccine composition is preferably administered parenterally, that is, intramuscularly or subcutaneously, but is not limited thereto.

In addition, the vaccine composition comprises an effective amount of avian influenza virus-like particles as an active ingredient, i.e., an amount that immunizes avian influenza virus material that will induce immunity in vaccinated birds or their progeny against attack (antigen administration) by a virulent virus. include as Immunity is defined herein as inducing a significantly higher level of protection in a population of birds after vaccination compared to an unvaccinated group.

The vaccine composition may contain avian influenza virus-like particles in an effective amount of 2 ⁵ to 2 ¹² hemagglutination units (HAU), for example, 2 ⁷ to 2 ¹¹ HAU, 2 ⁸ to 2 ¹⁰ HAU or about 2 ⁹ HAU. By including virus-like particles within the above range, antibody formation can be more efficiently induced in the subject subject to administration.

In addition, the vaccine composition according to one embodiment of the present invention may additionally include a pharmaceutically acceptable carrier, diluent, adjuvant, immune enhancing agent, and the like.

The pharmaceutically acceptable carrier includes, by way of non-limiting example, a solvent containing water, physiological saline, distilled water, ethanol, polyols (eg, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof, or dispersion medium and the like. In addition, the immunopotentiator may be, for example, aluminum hydroxide or aluminum phosphate as an inorganic immunopotentiator, or an organic immunopotentiator, for example, CpG DNA or poly A or microorganisms and extracts thereof, and an oil immunopotentiator. In addition, the additionally included agents are not limited thereto, and may further include all known substances used in vaccine preparation well known to those of ordinary skill in the art. In addition, stabilizers, inactivating agents, antibiotics, preservatives, and the like may be additionally used in the vaccine composition. Depending on the route of administration of the vaccine, the vaccine antigen may be mixed with a buffer solution and the like.

Another aspect of the present invention may provide a method for preventing avian influenza virus infection comprising administering the vaccine composition to a subject.

As used herein, the term "subject" may be any kind of animal that can be transmitted to an individual, for example, an avian influenza virus other than humans, and specifically, chickens, ducks, geese, turkeys, It can be a quail, a pigeon or a pheasant.

By administering the vaccine composition to such an individual, it is possible to induce a protective immune response or increase the immune response in the individual. The immune response is an antibody, B cells, helper T cells, suppressor T cells, cytotoxic T cells and gamma-delta T cells specifically directed against the antigen or antigens contained in the vaccine composition or vaccine comprising the same. production or activation, exhibiting a therapeutic or protective immunological response in the host, thereby enhancing resistance to new infections or reducing the clinical severity of the disease. Preferably it may be a protective immune response.

Such protection is evidenced by a reduction or absence of clinical signs normally exhibited by an infected host, a faster recovery time or lower duration, or a lower viral titer in the tissues or body fluids or feces of the infected host. In the above, the effective amount means an amount of a vaccine capable of inducing an immune response, for example, reducing the frequency or severity of chicken infectious virus infection in chickens, and those skilled in the art can appropriately select it.

Hereinafter, the present invention will be described in more detail by way of Examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited thereto.

Example 1. Preparation of avian influenza virus-like particles (VLP)

Example 1.1. cell culture

SF9 insect cells were cultured using SF-900II serum-free medium (Gibco, USA), and the same medium was used for recombinant baculovirus production. Virus-like particles were cultured and produced using TNi cells and ESF 921™ (expression system) medium. All cells were cultured in suspension at 27°C.

Example 1.2. Construction of Expression Vector and Preparation of Recombinant Baculovirus

HA gene of A/chicken/Vietnam/KA435/2013 (H5N1) and part of its HA gene (HA1 domain), part of HA gene of A/environment/Korea/W454/2014 (H5N8) (HA2 domain), A/ HA gene of duck/Korea/ES2/2016 (H5N6) and part of HA gene (HA2 domain) of A/Puerto Rico/8/1934 (H1N1), M1 gene and A/Hong Kong/01/1968 (H3N2) A part of the HA gene (HA2 domain) was extracted and used after amplification by PCR.

First, the M1 gene (SEQ ID NO: 2) of the H1N1 virus and the HA gene (SEQ ID NO: 3) of the H5N6 virus were inserted into a dual vector (pFastBac™ dual vector), a Bac-to-Bac® baculovirus expression donor vector. . The dual vector has p10 and PH (polyhedrin) promoters in both directions and has a polyadenylation signal sequence behind the two promoters. It was inserted with SphI restriction enzyme, and the H5N6(ES2) HA gene was inserted into the MCS of the PH promoter using BamH1/HindIII restriction enzymes (pFastBac-M1-ES2). In the same manner as above, the H5N1 (KA435) HA gene (SEQ ID NO: 4) was also inserted (pFastBac-M1-Ka435) into the pFastBac™ Dual vector in which H1N1 (PR8) M1 was inserted into the p10 promoter with SpeI/SalI restriction enzyme (pFastBac-M1-Ka435), but H5N1 (KA435) HA protein expression rate is low, so a part of this HA gene (HA2 domain, SEQ ID NO: 6) was cut and replaced with a part of H5N8 (W454) HA gene (HA2 domain, SEQ ID NO: 7) with KasI / SalI restriction enzyme (pFastBac-M1) -KA435chi) chimeric HA gene was inserted (see Experimental Example 1.1. below). At the AvrII restriction enzyme site located behind the insertion of the H5N6 (ES2) HA gene of pFastBac-M1-ES2, the SV40 polya at the back of the H5N1-HA1-H5-HA2 (KA435chi) gene from the PH promotor of pFastBac-M1-KA435chi The denylation signal sequence was inserted by PCR with a primer containing AvrII restriction enzyme (pFastBac-M1-ES2-KA435chi). The PCR conditions and sequence information of the primers used are shown in Tables 1 and 2 below, respectively.

PCR cycle Temperature Time Initial denaturation 95℃ 5min 35 cycles Denaturation 95℃ 30sec Annealing 56℃ 30sec Extension 72℃ 2min final extension 72℃ 5min

primer sequence (5'->3') SEQ ID NO: PR8 M1 Forward CAATCGA GCATGC TCTCCCTCTTGAGCTTCCTA 10 PR8 M1 Reverse TGCCAGT CCCGGG ATGAGTCTTCTAACCGAGGT 11 ES2 Forward CGTGCG GGATCC ATGGAGAAAATAGTGCTTCT 12 ES2 Reverse AATAGG AAGCTT TTAAATGCAAATTCTGCATT 13 KA435 Forward TGGACT ACTAGT ATGGAGAAGATCGTTCTTCT 14 KA435 Reverse GAGTAC GTCGAC TTAAATGCAAATACGGCACT 15 KA435-chimeric Forward 1 TGGACT ACTAGT ATGGAGAAGATCGTTCTTCT 16 KA435-chimeric Reverse 1 AGGAGT GGCGCC CCAAACAGTCCTCTTTTGCG 17 KA435-chimeric Forward 2 GACGTA GGCGCC ATAGCAGGGTTTATAGAGGG 18 KA435-chimeric Reverse 2 AATCGA GTCGAC TCAGATGCATATTCTGCATT 19 KA435-chimeric insert Forward TGTAAG CCTAGG ATGGAGATAATTAAAATGAT 20 KA435-chimeric insert Reverse AGCGGT CCTAGG ATCAGATCCAGACATGATAA 21

Recombinant baculovirus was produced from the thus-completed vector using the Bac-to-Bac® system (invitrogen, USA).

Example 1.3. Virus-like particle (VLP) production

The recombinant baculovirus prepared in Example 1.2. was transfected into SF9 cells cultured at 27°C. After 3 to 4 days of transfection, the SF9 culture medium was centrifuged at 2,000 g at 4° C. for 30 minutes to obtain a supernatant containing VLP.

In this regard, FIG. 2 is a photograph taken with an electron microscope of the recombinant baculovirus of the present invention, and it can be confirmed that the virus expresses a bivalent VLP.

Experimental Example 1. Immunogenicity analysis of avian influenza virus-like particles

Experimental Example 1.1. Confirmation of expression level of H5N1 virus according to HA gene

The recombinant vector (pFastBac-M1-KA435) containing the HA gene of the H5N1 virus prepared in Example 1.2, the HA1 region of the H5N1 virus (SEQ ID NO: 5) and the HA2 region of the H5N8 virus (SEQ ID NO: 7) A chimeric HA gene comprising a recombinant vector (pFastBac-M1-KA435chi) containing a chimeric HA gene containing A recombinant baculovirus obtained using a recombinant vector comprising HA test (Hemagglutination Test) was performed on the VLPs obtained from (total 4 types).

First, 25 μl of PBS was dispensed into a V-shaped 96-well microplate, and 25 μl of antigen (VLP) was dispensed into the first well. Next, the antigen was diluted 2-fold using a pipette. Then, 25 μl of 1% red blood cell suspension was added to all wells, and the plate was shaken well and left at room temperature for 40 minutes to observe the degree of hemagglutination. When the 96-well plate was tilted, aggregation was determined up to the well where blood cells did not flow, and the results are shown in Table 3.

expression gene SEQ ID NOS OF THE HA2 REGION HA titer (log2) H5N1 (KA435) HA 6 5-6 H5N1-HA1-H1-HA2 (KA435-chimeric) HA 8 1-2 H5N1-HA1-H3-HA2 (KA435-chimeric) HA 9 6-7 H5N1-HA1-H5-HA2 (KA435-chimeric) HA 7 8~9

Referring to Table 3, when the HA chimeric gene according to the present invention is included (H5N1-HA1-H5-HA2 (KA435-chimeric) HA), compared to the HA gene of the H5N1 virus and other chimeric HA genes, H5N1 It can be seen that the expression rate of the type virus is much higher.

Experimental Example 1.2. Identification of antibody titer using highly immune serum of H5N1 virus (KA435) and H5N6 virus (ES2)

The immunogenicity of the VLP expressing the chimeric HA and H5N6-type HA prepared in Example was confirmed through the HI test (Hemagglutination 　 Inhibition Test). First, 25 μl of PBS was dispensed into all wells of a 96-well plate, 25 μl of each serum was dispensed in the first cell, binary diluted, and 25 μl of each antigen was dispensed into the appropriate wells, and then at room temperature for 40 minutes. reacted. Thereafter, 25 μl of 1% chicken blood cells were dispensed into all wells and reacted at room temperature for 40 minutes. After 40 minutes, the HI value was measured based on the well flowing down the plate similarly to the control blood cells.

The results are shown in FIG. 2 . Referring to FIG. 2 , it was confirmed that the VLPs according to an embodiment of the present invention reacted normally with the H5N1 virus immune serum and the H5N6 virus immune serum, so that the VLPs significantly express the proteins for the two viruses. .

Experimental Example 1.3. Identification of antigen titer by inactivation method

The VLPs expressing the chimeric HA and H5N6-type HA prepared in Examples were inactivated according to the method shown in Table 3 below, and then the antigen titer of each VLP was measured by the antigen titer measurement method of Experimental Example 1.1. did.

division HA titer (log2) before inactivation 8 1 mM binary ethylenimine (BEI) 8 0.2% formalin 7

As shown in Table 4, it was confirmed that the use of binary ethyleneimine rather than formalin for VLP according to an embodiment of the present invention is more suitable for preventing protein denaturation.

Experimental Example 1.4. Comparison of antigenicity of H5N1 virus (KA435) and H5N6 virus (ES2) using immune serum

VLPs expressing chimeric HA and H5N6-type HA prepared in Examples, and H5N1-type KA435 (Clade 2.3.2.1C) and H5N6-type ES2 (Clade 2.3.4.4C) vaccine strains of whole virus (agriculture, forestry and livestock) After inactivation of the Quarantine Headquarters AI Research Team) with formalin, immune serum and HI tests were performed against two types of antigen bank (whole virus). The results are shown in Table 5.

Antigen (8 HAU) Antibody (HI titer) H5N1 (KA435) H5N6 (ES2) Virus-like particles of the present invention 16 16 H5N1 type KA435 (Clade 2.3.2.1C) 32 (Homo) - H5N6 Type ES2 (Clade 2.3.4.4C) - 32 (Homo)

Referring to Table 5, it can be seen that the VLPs of the present invention show similar reactivity to the existing vaccine strains with respect to each immune serum.

Experimental Example 2. Immunity verification of vaccines containing avian influenza virus-like particles

Experimental Example 2.1. Preparation of vaccine composition

Virus-like particles containing the chimeric HA and H5N6-type HA prepared in Example 1 were inactivated with binary ethylenimine (BEI), and the inactivated antigen was combined with MONTANIDE™ ISA 70 (SEPIC), a mineral oil supplement, and Recombinant vaccine was prepared by emulsification at 3:7 (antigen: adjuvant).

H5N1 type KA435 (Clade 2.3.2.1C) and H5N6 type ES2 (Clade 2.3.4.4C) vaccine strains (provided by AI Research Team of the Agriculture, Forestry and Livestock Quarantine Headquarters) of whole virus were inactivated with formalin, respectively, and then mineral oil It was emulsified with the adjuvant MONTANIDE™ ISA 70 (SEPIC) and 3:7 (antigen: adjuvant).

Experimental Example 2.2. Comparison of immunogenicity between recombinant vaccine (HA　VLP) and antigen bank vaccine

Based on antigen amounts of 2 ⁷ HAU, 2 ⁸ HAU and 2 ⁹ HAU, 1 dose was administered to 6-8 week-old SPF chickens by antigen by 0.5 ml (antigen amount 2 ⁷ HAU, 2 ⁸ HAU and 2 ⁹ HAU) into muscle (IM, intramuscular) ) was inoculated at 0.5 ml each. After vaccination, blood was collected weekly for 3 weeks, and blood was collected once a month for 6 months, and then the HI test was performed using the serum. The HI test was performed in the same manner as in Experimental Example 1.2., using antigen-inactivated HPAI H5N1 (KA435) and H5N6 (ES2) viruses (8HA) with sera immunized with the whole virus vaccine for AI antigen bank. compared.

[Table 6]

The HA antigen amount standard of the vaccine strain for AI antigen bank was 2 ⁹ HAU, and it was confirmed that it was 0.5 HI lower than the result of the vaccine strain ES2 for AI antigen bank 3 weeks after vaccination. It was confirmed that the antibody titer was equivalent to this level. In addition, both antibodies of the recombinant vaccine not only exhibit an effective antibody titer as they exceed the antibody standard for antigen bank, 2 ⁷ HI, but also show a similar value to the effective antibody titer ( ²⁷ HI) at the 2nd week of inoculation. It was confirmed that it is more suitable for emergency quarantine than the bank vaccine.

Experimental Example 2.3. Confirmation of Immune Sustainability of Recombinant Vaccines

Through the HI test performed in Experimental Example 2.2., the immunity of the recombinant vaccine was analyzed.

[Table 7]

Referring to Table 7, it was confirmed that the recombinant vaccine exhibited an effective antibody titer (>2 ⁷ HI) for 3 months after inoculation. Specifically, when the virus-like particles of the present invention were used at 512 HAU, 128-fold or more of HI antibody was maintained for at least 3 months, and 32-fold or more of HI antibody was maintained for 6 months ((32-fold death of HI antibody HI antibody can protect against virus shedding 128 times).

That is, it can be seen that the vaccine composition according to an embodiment of the present invention exhibits an effective antibody titer against both types of highly pathogenic avian influenza viruses of H5N1 type and H5N6 type, and exhibits more rapid immunogenicity and lasts for 3 months. Therefore, it is expected to be developed as a universal vaccine that can prevent various highly pathogenic H5 subtypes.

Korea Institute of Bioscience and Biotechnology KCTC18881P 20201228

<110> Komipharm International Co., Ltd <120> VIRUS LIKE PARTICLE OF AVIAN INFLUENZA H5 VIRUS AND VACCINE COMPOSITON COMPRISING THE SAME <130> P2020 <160> 21 <170> KoPatentIn 3.0 <210> 1 <211> 1704 <212> DNA <213> Artificial Sequence <220> <223> H5N1-HA1-H5-HA2(KA435-chimeric) <400> 1 atggagaaga tcgttcttct ctttgcaacc atcagccttg tcaaaagcga ccacatttgc 60 attggttacc acgcgaacaa ctcgactgag caagttgata caattatgga gaagaacgtt 120 actgttacac acgcccagga catactggaa aagacacaca acgggaagct ctgcgaccta 180 aacggagtga agcctctgat cttaaaagat tgcagtgtgg ccggatggct cctcggtaat 240 ccattgtgtg acgagttcac caatgtcccg gagtggtctt acatagtaga gaaggccaat 300 cctgccaatg acctatgtta ccccgggaac ttcaacgatt acgaggaatt gaagcatttg 360 ttgagccgca taaaccattt tgagaaaata cagatcatcc ccaaagattc ttggtcagat 420 catgaagcct cattgggcgt gtccgctgcc tgctcatacc agggaaactc ctccttcttc 480 aggaatgtgg tgtggcttat caagaaggac aacgcttacc cgacaataaa gaagggctac 540 aacaatacca accgagaaga cctcttgata ctgtggggga tacaccaccc taatgatgag 600 gcagagcaga cacca ctcta ccaaaatcca actacctaca tttccattgg cacctcaaca 660 ctgaaccaga gactggtacc caagatagcc accagatcca aaattaacgg acagagcggc 720 aggatagatt tcttctggac gattctaaag ccgaatgacg caatccattt cgagagcaat 780 ggcaatttca tcgctccaga gtacgcatac aaaatcgtca agaagggaga ctcaacaatc 840 atgagaagtg aagtggaata tggtaactgc aacaccaggt gccagactcc aattggcgcg 900 atcaactcta gtatgccatt ccacaacatc caccctctca ccatcggaga atgccccaaa 960 tatgtgaagt cgaacaagtt agtccttgca actgggttgc gtaattctcc tcaaagagag 1020 cgccgccgca aaagaggact gtttggcgcc atagcagggt ttatagaggg aggatggcag 1080 ggaatggtag acggttggta tgggtaccac catagcaatg agcaggggag tgggtacgcc 1140 gcagacaaag aatccaccca aaaggcaata gatggagtta ccaataaggt caactcaatc 1200 attgacaaaa tgaacactca atttgaggcc gttggaaggg aatttaataa cttagaaagg 1260 agaatagaga atttaaacaa gaaaatggag gacggattcc tagatgtctg gacttataat 1320 gctgaacttt tagttctcat ggaaaatgag agaactctcg atttccatga ctcaaatgtc 1380 aagaaccttt acgacaaagt ccgactacag cttagggata atgcaaaggg gctgggtaat 1440 ggttgtttcg agttctatca caaatg tgat aacgaatgta tggaaagcgt aagaaatggg 1500 acgtatgact accctaagta ttcagaagaa gcaagattaa aaagagaaga aataagcgga 1560 gtgaaattag aatcaatagg aacttaccaa atactgtcaa tttattcaac agtggcgagt 1620 tccctagcac tggcaatcat agtggctggt ctatctttat ggatgtgctc taatgggtcg 1680 ctacaatgca gaatatgcat ctga 1704 <210> 2 <211> 759 <212> DNA <213> Artificial Sequence <220> <223> H1N1-M1(PR8) <400> 2 atgagtcttc taaccgaggt cgaaacgtac gttctctcta tcatcccgtc aggccccctc 60 aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120 gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180 ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tacagcgtag acgctttgtc 240 caaaatgccc ttaatgggaa cggcgatcca aataacatgg acaaagcagt taaactgtat 300 aggaagctca agagggagat aacatttcat ggggccaaag aaatctcact cagttattct 360 gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420 gaagtggcat ttggacac ca ggtggt atgtgacta ca ggtg tattagacta cat acct gatagact ttag tt 540 ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600 gaggctatgg aggttgctag tcaggctagg caaatggtgc aagcgatgag aaccattggg 660 actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcctat 720 cagaaacgaa tgggggtgca gatgcaacgg ttcaagtga 759 <210> 3 <211> 1701 <212> DNA <213> Artificial Sequence <220> <223> H5N6-HA(ES2) <400> 3 atggagaaaa tagtgcttct tcttgcagtg gttagccttg ttaaaagtga tcagatttgc 60 attggttacc atgcaaacaa ctcgacagag caggttgaca cgataatgga aaaaaacgtc 120 actgttacac atgcccaaga catactggaa aagacacaca acgggaggct ctgcgatctg 180 aatggagtga aacctctgat tttgaaggat tgtagtgtag ctggatggct tcttggaaac 240 ccaatgtgcg acgaattcat cagagtgccg gaatggtctt acatagtgga gagggctaac 300 ccagccaatg acctctgtta cccagggaac ctcaatgact atgaagaact gaaacaccta 360 ttgagcagaa taaatcattt tgagaagact ctgatcatcc ccaagagttc ttggcccaat 420 catgaaacat caggggtgag ctcagcatgc ccataccagg gagtgacacctc ctttttgacgactc ctttttgacat gaact gagat gagtggtat gaac 480 aatagatggtat tttgatactg tgggggattc atcattccaa caatgcagca 600 gagcagacaa atctctataa aaacccaacc acctatgttt ccgttgggac atcaacatta 660 aaccagagat tggtgccaaa aatagctact agatcccaag taaacgggca acaaggaaga 720 atggatttct tctggacaat tttaaaaccg aatgatgcaa tccactttga gagtaatgga 780 aattttattg ctccagaata tgcatacaaa atagtcaaga aaggggactc aacaattatg 840 aaaagtgaaa tggaatatgg ccactgcaac accaaatgtc aaactccaat aggggcgata 900 aactctagta tgccattcca caatatacac cctctcacca tcggggagtg ccccaaatac 960 gtgaaatcaa acaaattagt ccttgcgact ggactcagaa atagtccttt aagagaaaga 1020 agaagaaaaa gaggactatt tggagctata gcagggttca tagagggagg atggcaagga 1080 atggtagatg gttggtatgg gtaccaccat agcaatgaac aggggagtgg gtacgctgca 1140 gacagagaat ccacccaaag ggcaatagat ggagttacca ataaggtcaa ctcgataatc 1200 gacaaaatga acactcaatt tgaggccgtt ggaagggagt ttaataactt agaacggaga 1260 atagagaatt taaataagaa aatggaagac ggattcctag atgtctggac ttacaatgct 1320 gaacttttag ttctcatgga aaatgagaga actttagatt ttcacgattc aaatgtaaaa 1380 aacctttatg acaaagtccg actacagctt ag ggataatg caaaggagct aggtaatggt 1440 tgtttcgagt tctatcataa atgtgataat gaatgtatgg aaagtgtaag aaatgggacg 1500 tatgactatc cccagtattc agaagaagca agattaaaaa gggaagaaat aagcggagtg 1560 aaattggaat caataggaac ttaccaaata ctgtcaattt attcaacagt ggcgagttcc 1620 ctaacactgg caatcattgt ggctggtcta tctttatgga tgtgctccaa tgggtcgtta 1680 caatgcagaa tttgcattta a 1701 <210> 4 <211> 1704 <212> DNA <213 > Artificial Sequence <220> <223> H5N1-HA(KA435) <400> 4 atggagaaga tcgttcttct ctttgcaacc atcagccttg tcaaaagcga ccacatttgc 60 attggttacc acgcgaacaa ctcgactgag caagttgata caattatgga gaagaacgtt 120 actgttacac acgcccagga catactggaa aagacacaca acgggaagct ctgcgaccta 180 aacggagtga agcctctgat cttaaaagat tgcagtgtgg ccggatggct cctcggtaat 240 ccattgtgtg acgagttcac caatgtcccg gagtggtctt acatagtaga gaaggccaat 300 cctgccaatg acctatgtta ccccgggaac ttcaacgatt acgaggaatt gaagcatttg 360 ttgagccgca taaaccattt gaggact tgagaaaata cagatcatcc ccaaagtgctt gt c gaatgtgg tgtggcttat caagaaggac aacgcttacc cgacaataaa gaagggctac 540 aacaatacca accgagaaga cctcttgata ctgtggggga tacaccaccc taatgatgag 600 gcagagcaga cacgactcta ccaaaatcca actacctaca tttccattgg cacctcaaca 660 ctgaaccaga gactggtacc caagatagcc accagatcca aaattaacgg acagagcggc 720 aggatagatt tcttctggac gattctaaag ccgaatgacg caatccattt cgagagcaat 780 ggcaatttca tcgctccaga gtacgcatac aaaatcgtca agaagggaga ctcaacaatc 840 atgagaagtg aagtggaata tggtaactgc aacaccaggt gccagactcc aattggcgcg 900 atcaactcta gtatgccatt ccacaacatc caccctctca ccatcggaga atgccccaaa 960 tatgtgaagt cgaacaagtt agtccttgca actgggttgc gtaattctcc tcaaagagag 1020 cgccgccgca aaagaggact gtttggagct atagctggtt tcatagaggg aggatggcag 1080 ggaatggtag atggctggtt cgtttgcctc cgcgaccaag agcaggggtc tggttacgct 1140 gcggacaagg aatccacgca aaaggcgatc gacggagtca ccaacaaggt caattcgatc 1200 attgacaaaa tgaacaccca atttgaggct gtaggaaggg aatttaacaa cttagagagg 1260 agaatcgaaa atttaaacaa aaagatggaa gacggattcc tagatgtctg gacctataac 1320 gctgaactgc tggtt ctcat ggagaatgaa cgcactctgg acttccacga ctcaaatgtc 1380 aagaaccttt acgataaggt ccgtctgcaa cttaaggata atgctaagga gttgggaaat 1440 ggttgcttcg agttctatca caagtgtaac aacgaatgta tggaaagtgt gcggaacggc 1500 acgtacgact acccacatta cgccgaggaa gcgagactca aaagagaaga aatctcaggt 1560 gtaaagctgg agtcaatagg catctaccaa atactgtcaa tttattcgac tgtggctagt 1620 tccctagtgc tcgcaatcat gatggccggt ctgtctttgt ggatgtgttc caacggctcg 1680 ttacagtgcc gtatttgcat ttaa 1704 <210> 5 < 211> 1044 <212> DNA <213> Artificial Sequence <220> <223> H5N1 HA1(KA435) <400> 5 atggagaaga tcgttcttct ctttgcaacc atcagccttg tcaaaagcga ccacatttgc 60 attggttacc acgcgaacaa ctcgactgag caagttgata caattatgga gaagaacgtt 120 actgttacac acgcccagga catactggaa aagacacaca acgggaagct ctgcgaccta 180 aacggagtga agcctctgat cttaaaagat tgcagtgtgg ccggatggct cctcggtaat 240 ccattgtgtg acgagttcac caatgtcccg gagtggtctt acatagtaga gaaggccaat 300 cctgccaatg acctatgtta ccccggagaac ttcaatta accatagttg ttca tatagat cagatt cca 360 g agattc ttggtcagat 420 catgaagcct cattgggcgt gtccgctgcc tgctcatacc agggaaactc ctccttcttc 480 aggaatgtgg tgtggcttat caagaaggac aacgcttacc cgacaataaa gaagggctac 540 aacaatacca accgagaaga cctcttgata ctgtggggga tacaccaccc taatgatgag 600 gcagagcaga caccactcta ccaaaatcca actacctaca tttccattgg cacctcaaca 660 ctgaaccaga gactggtacc caagatagcc accagatcca aaattaacgg acagagcggc 720 aggatagatt tcttctggac gattctaaag ccgaatgacg caatccattt cgagagcaat 780 ggcaatttca tcgctccaga gtacgcatac aaaatcgtca agaagggaga ctcaacaatc 840 atgagaagtg aagtggaata tggtaactgc aacaccaggt gccagactcc aattggcgcg 900 atcaactcta gtatgccatt ccacaacatc caccctctca ccatcggaga atgccccaaa 960 tatgtgaagt cgaacaagtt agtccttgca actgggttgc gtaattctcc tcaaagagag 1020 cgccgccgca aaagaggact gttt 1044 <210> 6 <211> 660 <212> DNA <213> Artificial Sequence <220> <223> H5N1 HA2(KA435) <400> 6 ggcgccatag ctggttttat agagggagga tggcagggaa tggtagatgg ttggtttgtt 60 tgtctccgcg accaagagca ggggagtggt tacgctgcag acaaagaatc 120 gc accaa taaggtcaat tcgatcattg acaaaatgaa cacccagttt 180 gaggctgtag gaagggaatt taataactta gagaggagaa tagaaaattt aaacaagaag 240 atggaagacg gattcctaga tgtctggact tataatgctg aacttctggt tctcatggag 300 aatgagagaa ctctagactt ccatgattca aatgtcaaga acctttacga taaggtccga 360 ctacagctta aggataatgc aaaagagctg ggaaacggtt gtttcgagtt ctatcacaaa 420 tgtaataatg aatgtatgga aagtgtaaga aacgggacgt atgactaccc gcattatgca 480 gaagaagcaa gattaaaaag agaggaaata agtggagtaa aactggaatc aataggaatc 540 taccaaatac tgtcaattta ttcaacagtg gcgagttccc tagtgctggc aatcatgatg 600 gctggtctat ctttatggat gtgttccaac gggtcgttac agtgcagaat ttgcatttaa 660 660 <210> 7 <211> 660 <212> DNA <213> Artificial Sequence 400N catag 7 agagtac(Wttag45) ttggtatggg 60 taccaccata gcaatgagca ggggagtggg tacgccgcag acaaagaatc cacccaaaag 120 gcaatagatg gagttaccaa taaggtcaac tcaatcattg acaaaact 240aatta gaa cactcaattt 180 gaggtagagatg ga attag aggagattaga ga attag tcctaga tgtctggact tataatgctg aacttttagt tctcatggaa 300 aatgagagaa ctctcgattt ccatgactca aatgtcaaga acctttacga caaagtccga 360 ctacagctta gggataatgc aaaggggctg ggtaatggtt gtttcgagtt ctatcacaaa 420 tgtgataacg aatgtatgga aagcgtaaga aatgggacgt atgactaccc taagtattca 480 gaagaagcaa gattaaaaag agaagaaata agcggagtga aattagaatc aataggaact 540 taccaaatac tgtcaattta ttcaacagtg gcgagttccc tagcactggc aatcatagtg 600 gctggtctat ctttatggat gtgctctaat gggtcgctac aatgcagaat atgcatctga 660 660 < 210> 8 <211> 660 <212> DNA <213> Artificial Sequence <220> <223> H1N1 HA2(PR8) <400> 8 ggcgccattg ccggttttat tgaaggggga tggactggaa tgatagatgg atggtatggt 60 tatcatcatc agaatgaaca gggatcaggc tatgcagcgg atcaaaaaag cacacaaaat 120 gccattaacg ggattacaaa caaggtgaac actgttatcg agaaaatgaa cattcaattc 180 acagctgtgg gtaaagaatt caacaaatta gaaaaaagga tggaaaattt aaataaaaaa 240 gttgatgatg gatttctgga catttggaca tataatgcag aattgttagt tctagaggaa tctagaggaa aggaatta cacca 300 aatgaaagta cta aggaatta atta cta aataatgc caaagaaatc ggaaatggat gttttgagtt ctaccacaag 420 tgtgacaatg aatgcatgga aagtgtaaga aatgggactt atgattatcc caaatattca 480 gaagagtcaa agttgaacag ggaaaaggta gatggagtga aattggaatc aatggggatc 540 tatcagattc tggcgatcta ctcaactgtc gccagttcac tggtgctttt ggtctccctg 600 ggggcaatca gtttctggat gtgttctaat ggatctttgc agtgcagaat atgcatctga 660 660 <210> 9 <211> 657 <212> DNA <213> Artificial Sequence <220> <223> H3N2 HA2(HK01) <400> 9 ggcgccatag caggtttcat agaaaatggt tgggagggaa tgatagacgg ttggtacggt 60 ttcaggcatc aaaattctga gggcacagga caagcagcag atcttaaaag cactcaagca 120 gccatcgacc aaatcaatgg gaaagtgaac aggataatcg agaagacgaa cgagaaattc 180 catcaaatcg aaaaggaatt ctcagaagta gaagggagaa ttcaggacct cgagaaatac 240 gttgaagaca ctaaaataga tctctggtct tacaatgcgg agcttcttgt cgctctggag 300 aatcaacata caattgacct gactgactcg gaaatgaaca agctgtttga aaaaacaagg 360 aggcaactga gggaaaatgc tgaagacatg ggcaatggtt gcttcaaaat gaccacaaa 420 gttgtgacatgaaca gtaccat agaggacttatg cttg taaacaaccg gtttcagatc aaaggtgttg aactgaagtc tggatacaaa 540 gactggatcc tgtggatttc ctttgccata tcatgctttt tgctttgtgt tgttttgctg 600 gggttcatca tgtgggcctg ccagagaggc aacattaggt gcaacatttg catttga 657 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> PR8 M1 forward <400> 10 caatcgagca tgctctccct cttgagcttc cta 33 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> PR8 M1 reverse <400> 11 tgccagtccc gggatgagtc ttctaaccga ggt 33 <210> 12 <211> 32 <212 > DNA <213> Artificial Sequence <220> <223> ES2 forward <400> 12 cgtgcgggat ccatggagaa aatagtgctt ct 32 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ES2 reverse < 400> 13 aataggaagc ttttaaatgc aaattctgca tt 32 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> KA435 forward <400> 14 tggactacta gtatggagaa gatcgttctt ct 32 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> KA435 reverse <400> 15 gagtacgtcg acttaaatgc aaatacggca ct 32 <210> 16 <211> 32 <212> DNA <213> Ar tificial Sequence <220> <223> KA435-chimeric forward1 <400> 16 tggactacta gtatggagaa gatcgttctt ct 32 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> KA435-chimeric reverse1 <400 > 17 aggagtggcg ccccaaacag tcctcttttg cg 32 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> KA435-chimeric forward2 <400> 18 gacgtaggcg ccatagcagg gtttatagag gg 32 <210> 19 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> KA435-chimeric reverse <400> 19 aatcgagtcg actcagatgc atattctgca tt 32 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> < 223> KA435-chimeric insert forward <400> 20 tgtaagccta ggatggagat aattaaaatg at 32 <210> 21 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> H5N1-HA1-H5-HA2(KA435-chimeric )<400> 21 agcggtccta ggatcagatc cagacatgat aa 32

Claims (17)

a chimeric HA gene comprising the HA1 region of a hemagglutinin (HA) gene derived from the H5N1 virus and the HA2 region of the HA gene derived from the H5N8 virus; and
A recombinant vector comprising a matrix protein 1 (M1) gene derived from H1N1 virus.
According to claim 1,
The chimeric HA gene is a recombinant vector comprising the nucleotide sequence of SEQ ID NO: 1.
According to claim 1,
The H5N1-type virus is A/chicken/Vietnam/KA435/2013 (H5N1), the recombinant vector.
According to claim 1,
The M1 gene derived from the H1N1 virus is a recombinant vector comprising the nucleotide sequence of SEQ ID NO: 2. According to claim 1,
The vector further comprises an HA gene derived from the H5N6 virus, recombinant vector.
6. The method of claim 5,
The HA gene derived from the H5N6 virus is a recombinant vector comprising the nucleotide sequence of SEQ ID NO: 3.
6. The method of claim 5,
The H5N6 virus is A / duck / Korea / ES2 / 2016 (H5N6), the recombinant vector.
6. The method of claim 5,
The vector is an HA gene derived from H1N1 virus, HA gene derived from H1N2 virus, HA gene derived from H2N2 virus, HA gene derived from H3N2 virus, HA gene derived from H3N8 virus, H5N2 type HA gene derived from virus, HA gene derived from H5N3 virus, HA gene derived from H5N8 virus, HA gene derived from H5N9 virus, HA gene derived from H7N1 virus, HA derived from H7N1 virus gene, HA gene derived from H7N2 virus, HA gene derived from H7N3 virus, HA gene derived from H7N4 virus, HA gene derived from H7N7 virus, HA gene derived from H7N9 virus, H9N2 virus A recombinant vector further comprising at least one selected from the group consisting of an HA gene derived from and an HA gene derived from a H10N7 virus.
A recombinant baculovirus transformed with the recombinant vector according to any one of claims 1 to 8.
10. The method of claim 9,
The virus is a virus of accession number KCTC18881P, recombinant baculovirus.
10. Avian influenza virus-like particles (Virus-Like Particle, VLP) produced by the recombinant baculovirus according to claim 9.
12. The method of claim 11,
The virus-like particle comprises an H5N1-type virus-derived HA protein and an H5N6-type virus-derived HA protein.
An avian influenza virus vaccine composition comprising the virus-like particle according to claim 11 .
14. The method of claim 13,
The composition further comprises at least one selected from the group consisting of pharmaceutically acceptable carriers, diluents and adjuvants.
14. The method of claim 13,
The composition is a highly pathogenic avian influenza H5N1 serotype virus and H5N6 serotype virus to exhibit a divalent (divalent) immune ability, an avian influenza virus vaccine composition.
14. The method of claim 13,
The composition comprises Newcastle disease virus (NDV) infectious bursitis virus (IBDV), infectious laryngeal tracheitis virus (ILTV), avian encephalomyelitis virus, avian reovirus, avian paramyxovirus, avian metapneumovirus, avian adenovirus, fowlpox virus, Avian influenza further comprising at least one virus or antigen thereof selected from the group consisting of avian coronavirus, avian rotavirus, chicken anemia virus, avian astrovirus, avian parvovirus, avian retrovirus, avian picornavirus Antivirus composition.
A method for preventing avian influenza virus infection, comprising administering the vaccine composition according to claim 13 to a subject.

Images