KR20220091885A - Biomarkers for predicting the response of liver cancer targeting agent and their uses - Google Patents

Abstract

The present invention relates to a marker for predicting the therapeutic response to a targeted therapy agent for liver cancer, and more specifically, to a marker composition for predicting the therapeutic response to a targeted therapy agent for liver cancer containing an Etoposide-induced protein 2.4 homolog (EI24) gene or a protein encoded by the gene, a composition for predicting therapeutic response to a targeted therapy agent for liver cancer including the agent for measuring the level of the gene or protein, and a method for providing information for predicting therapeutic response to a targeted therapy agent for liver cancer. The therapeutic response prediction technology for a targeted therapy agent for liver cancer, according to the present invention, measures the expression level of the EI24 gene or the protein encoding the same, and thus, it is expected that The therapeutic response prediction technology can be usefully used to increase the therapeutic effect of chemotherapy for liver cancer, as the therapeutic response prediction technology can effectively predict the therapeutic response to anticancer drugs and suggest the possibility of concurrent treatment with other targeted therapies.

Description

Biomarkers for predicting the response of liver cancer targeting agent and their uses {Biomarkers for predicting the response of liver cancer targeting agent and their uses}

The present invention relates to a marker for predicting therapeutic responsiveness to a liver cancer targeted therapeutic agent, and more specifically, EI24 (Etoposide-induced protein 2.4 homolog) gene or a marker composition for predicting therapeutic responsiveness to a liver cancer targeted therapeutic agent comprising a protein encoded by the gene , It relates to a composition for predicting treatment responsiveness to a targeted liver cancer treatment agent, including an agent for measuring the gene or protein level, and a method for providing information for predicting treatment reactivity to a targeted liver cancer treatment agent.

According to the 2020 data of the National Cancer Information Center, liver cancer is one of the 6 major cancers with the highest incidence in Korea. Internationally, East Asia, to which Korea belongs, is known as the region with the highest mortality rate from liver cancer, and as a result of a study on socioeconomic impact, liver cancer is known as a cancer with a high burden to the extent that it is similar to pancreatic cancer.

Sorafenib is the first target anticancer drug developed for liver cancer and is known to mainly inhibit Raf/VEGFR/PDGFR, is prescribed as the 1st line for all advanced liver cancers, and is known to improve the average survival rate by 2-3 months. High tolerance is an issue with sorafenib treatment. A number of studies have been conducted to find and solve the cause of sorafenib resistance. In particular, it has received great attention that autophagy regulates the reactivity to sorafenib, but the effect of autophagy on the treatment of sorafenib has not yet been fully defined. For example, there was a report that inhibiting autophagy could enhance the anticancer activity of sorafenib (Shi et al. 2011), but there were also conflicting reports that autophagy should be activated because apoptosis by sorafenib is autophagy-dependent apoptosis (Shi et al. 2011). Tai et al. 2013). Also, there are reports that autophagy is positive or negative for sorafenib treatment effect depending on the condition (Zhai et al. 2014).

Therefore, a more clear study on the correlation between autophagy and the therapeutic response of sorafenib is needed.

In order to improve the above problems, the present inventors analyzed the effect of autophagy genes on sorafenib sensitivity, and discovered a marker that can predict the sensitivity to sorafenib in liver cancer cell lines based on the genetic interaction between the genes. completed.

Accordingly, the present invention includes EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene or a protein encoded by the gene, An object of the present invention is to provide a marker composition for predicting the reactivity of a liver cancer target therapy.

In addition, the present invention relates to the expression of mRNA of EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene or a protein encoded by the gene. It is another object to provide a composition for predicting liver cancer target therapeutic agent responsiveness, including an agent for measuring the level.

In addition, it is another object of the present invention to provide a kit for predicting treatment responsiveness to a liver cancer-targeted therapeutic agent comprising the composition for predicting reactivity.

In addition, the present invention relates to a biological sample derived from a human subject, EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene Another object of the present invention is to provide an information providing method for predicting therapeutic responsiveness to a liver cancer-targeted therapeutic agent, including measuring the expression level of mRNA or a protein encoded by the gene.

In addition, the present invention comprises the steps of (1) treating cells with a candidate substance in vitro; and (2) EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene mRNA or protein expression level in the cells. Another object of the present invention is to provide a method for screening a resistance inhibitor of a liver cancer-targeted therapeutic agent, comprising the step of measuring.

In addition, the present invention includes sorafenib (sorafenib) as an active ingredient, EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) Another object of the present invention is to provide a pharmaceutical composition for the treatment of a gene-deficient liver cancer patient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the above object, the present invention provides an EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene or the gene It provides a marker composition for predicting liver cancer-targeted drug responsiveness, including the encoding protein.

In one embodiment of the present invention, the marker composition is ATG5 (Autophagy related 5, NCBI accession number: NM_001286106.2; NM_001286107.2; NM_001286108.2; NM_001286111.2; NM_004849.4; XM_024446590.1) and Becn1 (Beclin) -1, NCBI accession number: NM_001313998.2; NM_001313999.1; NM_001314000.2; NM_003766.5; XM_017025262.2; XM_005257760.4; XM_011525421.2; XM_017025263.2; XM_017025264.2; XM_005257759.3). It may further include one or more genes selected from or a protein encoded by the gene.

In another embodiment of the present invention, the liver cancer targeted therapeutic agent may be sorafenib (sorafenib).

In addition, the present invention relates to the expression of mRNA of EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene or a protein encoded by the gene. It provides a composition for predicting liver cancer target therapeutic agent responsiveness, including an agent for measuring the level.

In one embodiment of the present invention, the composition is ATG5 (Autophagy related 5, NCBI accession number: NM_001286106.2; NM_001286107.2; NM_001286108.2; NM_001286111.2; NM_004849.4; XM_024446590.1) and Becn1 (Beclin- 1, NCBI accession number: NM_001313998.2; NM_001313999.1; NM_001314000.2; NM_003766.5; XM_017025262.2; XM_005257760.4; XM_011525421.2; XM_017025263.2; XM_017025264.2; XM_005257759.3) It may further include an agent for measuring the mRNA level of one or more selected genes or a protein encoded by the gene.

In another embodiment of the present invention, the agent for measuring the level of mRNA of the gene may be sense and antisense primers or probes complementary to the mRNA of the gene.

In another embodiment of the present invention, the agent for measuring the level of the protein may be an antibody that specifically binds to the protein.

In addition, the present invention provides a kit for predicting treatment responsiveness to a liver cancer target therapeutic agent comprising the composition for predicting reactivity.

In addition, the present invention relates to a biological sample derived from a human subject, EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene It provides an information providing method for predicting therapeutic responsiveness to a liver cancer target therapeutic agent, comprising measuring the expression level of mRNA or a protein encoded by the gene.

In one embodiment of the present invention, the method is ATG5 (Autophagy related 5, NCBI accession number: NM_001286106.2; NM_001286107.2; NM_001286108.2; NM_001286111.2; NM_004849.4; XM_024446590.1) and Becn1 (Beclin- 1, NCBI accession number: NM_001313998.2; NM_001313999.1; NM_001314000.2; NM_003766.5; XM_017025262.2; XM_005257760.4; XM_011525421.2; XM_017025263.2; XM_017025264.2; XM_005257759.3) The method may further include measuring the expression level of the mRNA of one or more selected genes or a protein encoded by the gene.

In another embodiment of the present invention, the mRNA level can be measured by a method of polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR) or real-time PCR. .

In another embodiment of the present invention, the protein expression level is determined by western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation. Alternatively, it may be measured by flow cytometry or immunofluorescence.

In addition, the present invention comprises the steps of (1) treating cells with a candidate substance in vitro; and

(2) EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) in the cell mRNA or protein expression level measurement It provides a method for screening a resistance inhibitor of a liver cancer-targeted therapeutic agent, comprising the step of:

In one embodiment of the present invention, the screening method may further include selecting a substance that reduces the expression level of the mRNA of the EI24 gene or its protein as an inhibitor of resistance to a liver cancer-targeted therapeutic agent compared to the non-treated group with the candidate substance. have.

In another embodiment of the present invention, the candidate material may be selected from the group consisting of nucleic acids, compounds, microbial cultures or extracts, natural product extracts, peptides, substrate analogues, aptamers and antibodies.

In addition, the present invention includes sorafenib (sorafenib) as an active ingredient, EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) Provided is a pharmaceutical composition for the treatment of a gene-deficient liver cancer patient.

By measuring the expression level of the EI24 gene or a protein encoding the liver cancer target therapy according to the present invention, the technology for predicting the responsiveness of the liver cancer target therapy can effectively predict the therapeutic response of the anticancer agent, as well as suggest the possibility of concurrent treatment with other target therapeutic agents. As such, it is expected to be usefully used to enhance the therapeutic effect of chemotherapy for liver cancer.

1 shows major autophagy genes at each stage of the autophagy pathway.
Figure 2 is an Autophagy gene knockout isogenic SNU475 hepatocarcinoma cell line established and the sensitivity to sorafenib treatment in the cell line was confirmed. Figure 2a shows the structure of a crRNA array (4CR) specific for Becn1, ATG5 and EI24 genes, The results of the T7E1 assays are shown, and FIG. 2c is a Western blot analysis result, showing a sample obtained after 24 hours treatment with a control group and 10 μM sorafenib, and FIG. The results are shown, and Fig. 2e is a representative flow cytometry result of measuring apoptosis through Annexin V-FITC and propidium iodide (PI) staining, and Fig. 2f is a graph showing the result of repeating the experiment of Fig. 2e 3 times (WT, wild-type; Pa, parental cell line; EV, empty vector).
3 is an autophagy gene knockout isogenic HepG2 liver cancer cell line established and sorafenib sensitivity is confirmed. FIG. 3a shows the structure of a crRNA array (4CR) specific for Becn1, ATG5 and EI24 genes. It was confirmed that it came out different from that used in SNU475, Figure 3b shows the T7E1 assay result, Figure 3c shows the Western blot analysis result of the sample obtained after 24 hours treatment with the control and 10 μM sorafenib, and Figure 3d shows the results of various concentrations Shows the results of ATP assay after sorafenib was treated for 72 hours (WT, wild-type; Pa, parental cell line; EV, empty vector).
Figure 4 relates to the effect of simultaneous knockout of Autophagy genes ATG5 and Becn1 on the sorafenib sensitivity of the SNU475 hepatocarcinoma cell line. It is the result of analysis of T7E1 assays after using lentivirus (BlastR), and FIG. 4b shows the results of Western blot analysis based on the control group and samples obtained after 24 hours of treatment with 10 μM sorafenib, and FIG. 4c shows the results of various concentrations. Shows the results of ATP assay after treatment with sorafenib for 72 hours.
Figure 5 relates to the effect of simultaneous knockout of Autophagy genes ATG5 and EI24 on the sorafenib sensitivity of the SNU475 hepatocarcinoma cell line. Shows the results of analysis of T7E1 assays after using lentivirus (BlastR), FIG. 5b shows the results of Western blot analysis of the control group and samples obtained after 24 hours treatment with 10 μM sorafenib, and FIG. 5c shows the results of sorafenib at various concentrations. The results of the ATP assay after 72 hours of treatment are shown.
6 is a comprehensive view of the prediction results of sorafenib reactivity according to the state of the Autophagy gene according to the present invention.

The present inventors have completed the present invention by analyzing the effect of autophagy genes on sorafenib sensitivity, and by discovering a marker that can predict the sensitivity to sorafenib in liver cancer cell lines based on the genetic interaction between the genes.

Accordingly, the present invention includes EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene or a protein encoded by the gene, Provided is a marker composition for predicting the reactivity of a liver cancer target therapy.

In addition, the present invention relates to the expression of mRNA of EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene or a protein encoded by the gene. It provides a composition for predicting liver cancer-targeted therapeutic agent responsiveness, including an agent for measuring the level, and a kit for predicting liver cancer-targeted therapeutic agent responsiveness comprising the same.

In the present invention, ATG5 (Autophagy related 5, NCBI accession number: NM_001286106.2; NM_001286107.2; NM_001286108.2; NM_001286111.2; NM_004849.4; XM_024446590.1; (Beclin-1, NCBI accession number: NM_001313998.2; NM_001313999.1; NM_001314000.2; NM_003766.5; XM_017025262.2; XM_005257760.4; XM_011525421.2; XM_017025263.2; XM_017025264.2; XM_005257759.3) It may further include one or more genes selected from the group consisting of or a protein encoded by the gene.

The disease "liver cancer" targeted by the present invention includes all cancers that can occur in the liver.

As used herein, the term “targeted therapy” is a form of therapeutic agent that specifically inhibits the activity of a protein expressed by a gene that causes a disease, and in the present invention, refers to the treatment of liver cancer, , The liver cancer targeted therapeutic agent of the present invention may be sorafenib (sorafenib), but is not limited thereto.

In the present invention, “prediction of reactivity” means predicting whether a patient will respond favorably or unfavorably to a target therapeutic agent, or predicting the risk of resistance to a therapeutic agent, the prognosis of the patient after treatment, It means predicting recurrence, metastasis, survival, or disease-free survival. The biomarker for predicting treatment responsiveness according to the present invention can provide information for selecting the most appropriate immunotherapy modality for liver cancer patients.

The present inventors found that the expression level of the EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene is closely related to the sensitivity of the liver cancer target therapy. It was determined that there is, and the signaling pathway for the association was investigated.

In one embodiment of the present invention, the SNU475 liver cancer cell line knocked out the Becn1, ATG5 and EI24 genes and analyzed whether the sensitivity to sorafenib was changed. was confirmed (see Example 2).

In addition, in another embodiment of the present invention, in order to determine whether enhancement of sorafenib sensitivity due to knockout of Becn1 and EI24 genes in liver cancer cell lines is a phenomenon that occurs dependent on the autophagy pathway, a cell line in which ATG5 and Becn1 are simultaneously knocked out and ATG5 and EI24 As a result of confirming the sorafenib sensitivity in the cell line in which Knockout was simultaneously knocked out, the regulation of sorafenib sensitivity by Becn1 knockout was not dependent on ATG5 function and autophagy pathway, but sorafenib sensitivity regulation by EI24 knockout was dependent on ATG5 function and autophagy pathway. It was confirmed (see Example 4).

From the above results, it can be seen that the EI24 gene or the protein encoded by the gene can be usefully used as a marker for predicting the therapeutic response of a target therapeutic agent in liver cancer.

In the present invention, the agent for measuring the mRNA level of the EI24 gene may be sense and antisense primers or probes complementary to the mRNA of the gene, but is not limited thereto.

As used herein, the term “primer” refers to an oligonucleotide synthesized for use in diagnosis, DNA sequencing, etc. as a short gene sequence serving as a starting point of DNA synthesis. The primers may be synthesized and used with a length of typically 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, etc. by a known method.

As used herein, the term “probe” refers to a nucleic acid capable of specifically binding to mRNA having a length of several bases to several hundreds of bases produced through enzymatic, chemical separation, purification or synthesis. The presence or absence of mRNA can be checked by labeling a radioactive isotope, an enzyme, or a fluorescent substance, and it can be designed and modified by a known method.

The agent for measuring the level of the protein may be an antibody that specifically binds to the protein, but is not limited thereto.

As used herein, the term “antibody” includes immunoglobulin molecules having immunological reactivity with a specific antigen, and includes both monoclonal and polyclonal antibodies. The antibody also includes forms produced by genetic engineering such as chimeric antibodies (eg, humanized murine antibodies) and heterologous antibodies (eg, bispecific antibodies).

The kit for predicting therapeutic responsiveness to a liver cancer target therapy of the present invention may be composed of one or more other component compositions, solutions, or devices suitable for the analysis method.

For example, the kit of the present invention contains genomic DNA derived from a sample to be analyzed, a primer set specific for the marker gene of the present invention, an appropriate amount of a DNA polymerase, a dNTP mixture, a PCR buffer, and water to perform PCR. It may be a kit comprising The PCR buffer solution may contain KCl, Tris-HCl and MgCl ₂ . In addition, components necessary for performing electrophoresis that can confirm whether or not the PCR product is amplified may be additionally included in the kit of the present invention.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing RT-PCR. In addition to each primer pair specific for a marker gene, the RT-PCR kit includes a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC -Water (DEPC-water), sterile water, etc. may be included. In addition, a primer pair specific for a gene used as a quantitative control may be included.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, and the substrate may include cDNA corresponding to a quantitative structural gene or fragment thereof. In addition, the kit of the present invention may be in the form of a microarray having a substrate on which the marker gene of the present invention is immobilized.

In another aspect of the present invention, the present invention relates to a biological sample derived from a human subject, EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069) .2) provides an information providing method for predicting therapeutic responsiveness to a liver cancer-targeted therapeutic agent, including measuring the expression level of the mRNA of the gene or the protein encoded by the gene.

The mRNA level can be measured through a method of polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR) or real-time PCR according to a conventional method known in the art. However, the present invention is not limited thereto.

The protein expression level is determined by western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation according to a conventional method known in the art. ), flow cytometry, or immunofluorescence, but is not limited thereto.

The biological sample may be a tissue derived from a liver cancer patient, but is not limited thereto.

In the information providing method according to the present invention, the mRNA of the EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene or the gene is encoded When the expression level of the protein is low, the reactivity of the liver cancer-targeted therapeutic agent may be excellent.

In another aspect of the present invention, the present invention comprises the steps of (1) treating cells with a candidate substance in vitro; and (2) measuring the expression level of the mRNA or protein thereof of the EI24 gene in the cell.

In one embodiment of the present invention, the screening method may further include selecting a substance that reduces the expression level of the mRNA of the EI24 gene or its protein as an inhibitor of resistance to a liver cancer-targeted therapeutic agent compared to the non-treated group with the candidate substance. have.

In another embodiment of the present invention, the candidate material may be selected from the group consisting of nucleic acids, compounds, microbial cultures or extracts, natural product extracts, peptides, substrate analogues, aptamers and antibodies.

In addition, as another aspect of the present invention, the present invention includes sorafenib as an active ingredient, EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070 .1;XM_011543069.2) To provide a pharmaceutical composition for the treatment of a liver cancer patient with a gene deficiency.

As used herein, the term “deficiency” refers to a state that is insufficient compared to the normal level, and in the present invention, the expression level of the EI24 gene is low compared to the normal control.

As used in the present invention, the term “use for treatment of liver cancer patients” refers to any action in which symptoms for liver cancer patients are improved or beneficially changed by administration of the composition according to the present invention.

The pharmaceutical composition according to the present invention may include a pharmaceutically effective amount of sorafenib alone or may include one or more pharmaceutically acceptable carriers. In this case, pharmaceutically acceptable carriers are those commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose. , polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. may be additionally included in addition to the above components.

The pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intravenously, subcutaneously, intraperitoneally or locally applied) according to a desired method, and the dosage may vary depending on the condition and weight of the patient, and the disease. Although it varies depending on the degree, drug form, administration route and time, it may be appropriately selected by those skilled in the art.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level depends on the type of disease, severity, drug activity, and drug. It can be determined according to factors including sensitivity, administration time, administration route and excretion rate, duration of treatment, concomitant drugs, and other factors well known in the medical field. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Taking all of the above factors into consideration, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, weight, absorption of the active ingredient into the body, inactivation rate and excretion rate, disease type, and drugs used in combination, in general 1 to 500 mg per 1 kg of body weight may be administered daily or every other day, or divided into 1 to 3 times a day. However, since it may increase or decrease depending on the route of administration, sex, weight, age, etc., the dosage is not intended to limit the scope of the present invention in any way.

As another aspect of the present invention, there is provided a method of treating a liver cancer patient deficient in the EI24 gene using the pharmaceutical composition.

As another aspect of the present invention, the present invention provides a use for the treatment of a liver cancer patient deficient in the EI24 gene using the pharmaceutical composition.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

[Example]

Example 　 1. Materials and methods

1-1. crRNA cloning and analysis

CrRNA analysis using pY108 (Addgene #84739), a puromycin-resistant lentivirus vector, 4CR production, and a gene knockout polyclonal isogenic cell line using this were established. crRNA analysis was performed using web-based software (benchling.com), and genomic DNA sequences were obtained through Genebank and then analyzed using Snapgene software (GSL Biotech LLC). Information on each crRNA is shown in [Table 1] below.

target gene crRNA name Exon no. Position Strand Sequence PAM Specificity Score SEQ ID NO: Becn1 CR11 Exon 2 9480 One CACGGCCTCAGGGATGGAAG TTTC 48.8690132 One CR12 Exon 2 9586 One AAGATCCTGGACCGTGTCAC TTTC 49.8272856 2 CR13 Exon 7 14951 One GCAGACGCTGTTTGGAGATC TTTG 97.8029914 3 CR15 Exon 8 17302 -One AATTCACTGTATTCTCTCTG TTTA 76.6095376 4 CR17 Exon 8 17444 One ATGCAACCTTCCACATCTGG TTTA 94.3446589 5 ATG5 CR1 Exon 2 9721 -One CCACAATCAATGTACTTACA TTTG 47.2120767 6 CR2 Exon 4 46024 One CAGAAAAAGACCTTCTGCAC TTTC 47.5823641 7 CR4 Exon 4 46135 -One CAATCCCATCCAGAGTTGCT TTTG 48.8049857 8 CR6 Exon 6 77669 -One AAATGTTATTTCCTACCTGA TTTA 43.4200818 9 EI24 CR1 Exon 2 125,572,536 One GTGGTGAAGAGATGGCTGAC TTTG 62.1326572 10 CR2 Exon 3 125,575,277 One TATAGGGAATCAAAGACTCC TTTC 91.112129 11 CR4 Exon 4 125,576,271 One CAGTGAGCCACGTATTGTTA TTTC 96.0479678 12 CR7 Exon 6 125,578,148 One TTAGGTGACCCATCACTACA TTTC 96.3414665 13 CR8 Exon 6 125,578,180 One GTCGTGGCTGGAATTCTTCC TTTG 64.7972393 14 CR9 Exon 7 125,578,958 One TCTGTTACAGGATATAGCTG TTTC 93.4369992 15 CR10 Exon 7 125,578,990 One AGGTATCAGGGAGGAAGCCT TTTG 64.1555408 16

For lentivirus particles, pY108 empty vector (EV), pY108-single crRNA or pY108-crRNA array was used together with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259), and Lipofectamine Plus Reagent (ThermoFisher Scientific) was used. It was prepared by transfection with 293TA cells according to the manual. SNU475 cells were infected with 4 μg/ml polybrene (Sigma) by incubating for 24 hours with lentivirus. After that, the lentivirus was removed and cultured with 2 μg/ml puromycin (Sigma) until all non-infected SNU475 cells were removed.

After puromycin selection, a genomic DNA sample was prepared from cell culture and the target region of each crRNA was amplified using the PCR primer pair listed in [Table 2] below. After forming a heteroduplex with the PCR product as previously known, it was performed according to the manufacturer's manual to determine whether it was cut when it was developed on an agarose gel after treatment with T7 Endonuclease I (T7E1; NEB).

target gene crRNA name Primer Name Sequence (5'->3') Size (bp) SEQ ID NO: Becn1 CR11, CR12 Becn1-Ex2-F2 TACCATCGTCACCAAGGCAT 416 17 Becn1-Ex2-R2 CGGAAAGCTCTCAGAAGTCCAC 18 CR13 Becn1-Ex7-F1 CCAGGGCTCAGAGCTGTTAC 582 19 Becn1-Ex7-R1 GCCCATTCCCTACAGGACAG 20 CR15, CR17 Becn1-Ex8-F1 TTTGCATTGGGCAGCTGGA 723 21 Becn1-Ex8-R1 CTGTTTTGCTGTTGCCCTCC 22 ATG5 CR1 ATG5-E1-F2 TGTGCTTCGAGATGTGTGGT 319 23 ATG5-E1-R1 GTCCAGAACGCATCATGACA 24 CR2, CR4 ATG5-E4-F2 GGGTTATTTCAGTGCTAAGAGATAG 474 25 ATG5-E4-R2 CAGAGGACACCAAAAGAGCAG 26 CR6 ATG5-E6-F1 CTGTACCTTTGTAGCTCAGCA 590 27 ATG5-E6-R2 AAAGACACAGTTTGGAAAACCCC 28 EI24 CR1 EI24-E2-F1 CAGCTGTACAGGAATAGCTTCACT 526 29 EI24-E2-R1 AGCCAAGATGATTAGGGTCCCA 30 CR2 EI24-E3-F1 AAGATACTCAGTACGTGGGTGG 469 31 EI24-E3-R2 TCCGCTCTATACTCTGGGCT 32 CR4 EI24-E4-F1 TGACTGACATTAGAACATTGGGAGA 534 33 EI24-E4-R1 CCTTCCCGAGTCCCCATAGTT 34 CR7, CR8 EI24-E6-F1 CCTGCAGATAGCGTACTGGT 608 35 EI24-E6-R1 ACCAGACACCTGCCAATGAG 36 CR9, CR10 EI24-E7-F2 GGCGGACTAGTGGCCTTA 333 37 EI24-E7-R1 AAAATCATTACCTCCCACCAGCAT 38

To make pY108-Blast, a blasticidin-resistant lentivirus vector, BamHI and PmeI enzymes were used in the pY108 (Addgene #84739) vector to remove the 3' LTR (ΔU3) portion from Puromycin. Then, the same enzyme was used in the Lenti-Cas9-blast vector. After separating the 3' LTR (ΔU3) portion from blasticidin, subcloning was performed to construct a blasticidin-resistant lentivirus vector.

1-2. Cytotoxicity assays

10 mg of Sorafenib Tosylate (Selleckchem #S1040) was purchased and used as 100 mM Stock using DMSO. The prepared cell line was seeded into 2x10 ³ cells/96 wells, and after 24 hours, the sorafenib treatment concentration was increased from 50 μM to 1/2 serial dilution 0.78125 μM. After 72 hours, CellTiter-Glo ^® Luminescent Cell Viability Assay (promega #G7572) was used. Thus, ATP assay was performed. The above cell line was seeded 3 sheets into 1x10 ⁵ cells/60 mm dish, and 24 hours later, 10 μM Sorafenib, which is the IC ₅₀ of sorafenib for the SNU475 cell line, was treated. After 72 hours, Annexin V/PI staining kit (BD #556547) was applied. was used to confirm the degree of apoptosis.

1-3. Western blot analysis

SDS-sample preparation and Western blot analysis were performed as previously reported using the following antibodies (Sung et al. 2010): ATG5 (Cell Signaling #12994), Becn1 (Cell Signaling #3495), Ei24 (Atlas antibodies) #HPA047165), p62 (abcam #ab56416), LC3B (Cell Signaling #3868), β-actin (novusbio #NB600-501).

Example 2. Confirmation of Sorafenib treatment responsiveness according to Autophagy gene expression in SNU475 cell line

Autophagy is known to proceed through several stages such as membrane nucleation, elongation and closure, autophagosme-lysosome fusion and degradation, and a schematic diagram of autophagy is shown in FIG. 1 . Various genes are involved in the progress of these steps, and it is known that the Becn1 gene is typically involved in the membrane nucleation stage, the ATG5 gene in the elongation and closure stage, and the EI24 gene in the autophagosme-lysosome fusion and degradation stages. Specifically, the Becn1 gene plays an important role in the membrane nucleation stage, the starting stage of autophagy, the ATG5 gene is essential in the elongation and closure stages, and EI24 is essential for the final stage of autophagy, autophagosome-lysosome fusion and content degradation. is known

In order to know the effect of autophagy on the sensitivity of hepatocarcinoma cell lines to sorafenib, a cell line was established based on the method of Example 1 for the production of an isogenic hepatocarcinoma cell line in which these genes were knocked out. Canine CRISPR RNA (crRNA) was ligated to minimize in-frame mutation.

First, a change in sensitivity to sorafenib was investigated after knockout of Becn1, ATG5, and EI24 genes in SNU475 hepatocellular carcinoma cell line, a Korean patient-derived hepatocellular carcinoma cell line that exhibits resistance to sorafenib. At this time, as shown in FIG. 2a, four crRNAs for each gene were ligated (4CR) and delivered to the SNU475 hepatocellular carcinoma cell line together with Cpf1 using a lentivirus vector. As a result of examining the activity of gene scissors through the T7E1 assay, it was confirmed that insertion & deletion mutations (indel mutations) were induced at a very high level as shown in FIG. 2b .

In addition, as a result of performing Western blot analysis before and after sorafenib treatment to prove gene knockout at the protein level, as shown in FIG. 2c , almost no ATG5 protein was detected, and only a very small amount of EI24 protein remained, and Becn1 protein was also found to be significantly reduced. In particular, as a result of examining the levels of p62 and lipidated LC3B (form II) protein, which are representative markers of autophagy, it was found that the effect of the knocked out gene was varied, but it was confirmed that the effect of sorafenib was insignificant under the investigated conditions. .

Furthermore, as a result of measuring the sensitivity of these gene knockout isogenic hepatocarcinoma cell lines by treatment with sorafenib, as shown in FIG. 2d , the ATG5 knockout effect was insignificant. confirmed to be.

To verify the result that the knockouts of Becn1 and EI24 genes show significantly high sensitivity to sorafenib, apoptosis was measured by annexin V-FITC and propidium iodide (PI) staining, which are representative apoptosis investigation methods. As a result, as shown in FIGS. 2e and 2f, it was confirmed that the sensitivity to sorafenib was increased when the Becn1 and EI24 genes were knocked out, as in the result of FIG. 2d.

Example 3. Confirmation of Sorafenib treatment responsiveness according to Autophagy gene expression in HepG2 cell line

In order to verify the results of Example 2, the reactivity of the liver cancer cell line to sorafenib was confirmed according to the expression of the autophagy gene using the HepG2 cell line, which is one of the most widely used cell lines for liver cancer research. As shown in Fig. 3a, multiplex crRNA (4CR) was applied to the HepG2 cell line, ATG5-4CR was the same as that used in SNU475, but Becn1-4CR and EI24-4CR were replaced with some crRNAs. As a result of analysis through T7E1 assay and Western blot analysis, it was confirmed that gene knockout was efficiently achieved as shown in FIGS. 3B and 3C .

As a result of treatment with sorafenib in the established gene knockout isogenic HepG2 cell line, it was confirmed that the sensitivity to sorafenib was significantly increased by the knockout of Becn1 and EI24 genes, as shown in FIG. 3d , as shown in SNU475.

From the above results, it can be inferred that autophagy genes play various roles in regulating the sensitivity of sorafenib.

Example 4. Confirmation of sorafenib treatment responsiveness according to autophagy pathway in liver cancer cell lines

From Examples 2 and 3, it could be inferred that autophagy genes play various roles in regulating the sensitivity of sorafenib. However, even the autophagy gene has the potential to regulate sorafenib sensitivity of hepatocellular carcinoma cell lines through roles other than autophagy, so it needs to be clarified. Bar, whether the increase in sensitivity to sorafenib in liver cancer cell lines caused by knockout of Becn1 or EI24 gene is autophagy-dependent or independent through genetic interaction between autophagy genes by additionally knocking out ATG5 in cells in which the Becn1 or EI24 gene is knocked out was confirmed.

First, a blasticidin-resistant ATG5-4CR expression lentivirus vector was constructed, the Becn1 gene was further knocked out in the Becn1 knockout isogenic SNU475 hepatocarcinoma cell line, and it was confirmed that ATG5 was efficiently knocked out in the existing Becn1 knockout cells as shown in FIG. 4a. and was verified through Western blot analysis as shown in FIG. 4b. As a result of treatment with sorafenib in the prepared cells, as shown in FIG. 4c , the ATG5 gene knockout did not significantly affect the sorafenib sensitivity of the SNU475 liver cancer cell line increased by the Becn1 gene knockout. It was confirmed that the liver cancer cell line showed similar sensitivity to sorafenib.

In addition, the same experiment was performed on the isogenic SNU475 liver cancer cell line in which the EI24 gene was knocked out, and the successful establishment of the desired cell line was confirmed through FIGS. 5A and 5B. As a result of treating these cells with sorafenib, as shown in FIG. 5c , it was confirmed that the sorafenib sensitivity increased by EI24 knockout disappeared in the ATG5 & EI24 DKO hepatocellular carcinoma cell lines, unlike the ATG5 & Becn1 DKO hepatocellular carcinoma cell lines.

From the above results, it was confirmed that the regulation of sorafenib sensitivity by Becn1 knockout in liver cancer cell lines was not dependent on ATG5 function and autophagy pathway, but sorafenib sensitivity regulation by EI24 knockout was dependent on ATG5 function and autophagy pathway. More specifically, as shown in FIG. 6 , it was confirmed that the sorafenib sensitivity of the liver cancer cell line and the therapeutic effect to sorafenib in liver cancer patients could be predicted according to the expression state and genotype of the ATG5, Becn1 and EI24 genes. ATG5 deficiency will have no effect, but EI24-deficient liver cancer may be sensitive to sorafenib, but this is possible only when the ATG5 gene is functioning normally. In contrast, Becn1 deletion is expected to enhance sorafenib sensitivity regardless of the status of the ATG5 gene.

The effect of ATG5 and EI24 gene knockout to regulate sorafenib sensitivity in hepatocellular carcinoma cell lines has a very important meaning for liver cancer treatment by sorafenib. In addition to clarifying previously unclear areas in detail, it is expected to trigger a number of studies on the regulation of sorafenib sensitivity by autophagy in the future. In particular, it is expected that studies similar to this study will be conducted on the functions of other genes mediating the autophagy pathway. In addition, the fact that EI24 knockout increases sorafenib sensitivity when ATG5 is operating normally suggests that a substance blocking the role of EI24 gene contributing to the autophagy pathway will act as an important sorafenib sensitizer in the treatment of liver cancer. In conclusion, this study showed that ATG5 and EI24 can be used as important companion diagnostic markers for sorafenib-mediated liver cancer treatment. In addition, EI24 is considered to be discovered as an important drug target gene for the development of sorafenib sensitizer.

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> University of Ulsan Foundation For Industry Cooperation THE ASAN FOUNDATION <120> Biomarkers for predicting the response of liver cancer targeting agent and their uses <130> PD20-396 <160> 38 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 crRNA (CR11) <400> 1 cacggcctca gggatggaag 20 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 crRNA (CR12) <400> 2 aagatcctgg accgtgtcac 20 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 crRNA (CR13) <400> 3 gcagacgctg tttggagatc 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 crRNA (CR15) <400> 4 aattcactgt attctctctg 20 <210> 5 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 crRNA (CR17) <400> 5 atgcaacctt ccacatctgg 20 <210> 6 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ATG5 crRNA (CR1) <400> 6 ccacaatcaa tgtacttaca 20 <210> 7 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ATG5 crRNA (CR2) <400> 7 cagaaaaaga ccttctgcac 20 <210> 8 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ATG5 crRNA (CR4) <400> 8 caatcccatc cagagttgct 20 <210> 9 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ATG5 crRNA (CR6) <400> 9 aaatgttatt tcctacctga 20 <210> 10 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 crRNA (CR1) <400> 10 gtggtgaaga gatggctgac 20 <210> 11 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 crRNA (CR2) <400> 11 tatagggaat caaagactcc 20 <210> 12 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 crRNA (CR4) <400> 12 cagtgagcca cgtattgtta 20 <210> 13 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 crRNA (CR7) <400> 13 ttaggtgacc catcactaca 20 <210> 14 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 crRNA (CR8) <400> 14 gtcgtggctg gaattcttcc 20 <210> 15 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 crRNA (CR9) <400> 15 tctgttacag gatatagctg 20 <210> 16 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 crRNA (CR10) <400> 16 aggtatcagg gaggaagcct 20 <210> 17 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 primer (Becn1-Ex2-F2) <400> 17 taccatcgtc accaaggcat 20 <210> 18 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Becn1 primer (Becn1-Ex2-R2) <400> 18 cggaaagctc tcagaagtcc ac 22 <210> 19 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 primer (Becn1-Ex7-F1) <400> 19 ccagggctca gagctgttac 20 <210> 20 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 primer (Becn1-Ex7-R1) <400> 20 gcccattccc tacaggacag 20 <210> 21 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 primer (Becn1-Ex8-F1) <400> 21 tttgcatatg ggcagctgga 20 <210> 22 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Becn1 primer (Becn1-Ex8-R1) <400> 22 ctgttttgct gttgccctcc 20 <210> 23 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ATG5 primer (ATG5-E1-F2) <400> 23 tgtgcttcga gatgtgtggt 20 <210> 24 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> ATG5 primer (ATG5-E1-R1) <400> 24 gtccagaacg catcatgaca 20 <210> 25 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> ATG5 primer (ATG5-E4-F2) <400> 25 gggttatttc agtgctaaga gatag 25 <210> 26 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> ATG5 primer (ATG5-E4-R2) <400> 26 cagaggacac caaaagagca g 21 <210> 27 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> ATG5 primer (ATG5-E6-F1) <400> 27 ctgtaccttt gtagctcagc a 21 <210> 28 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> ATG5 primer (ATG5-E6-R2) <400> 28 aaagacacag tttggaaaac ccc 23 <210> 29 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E2-F1) <400> 29 cagctgtaca ggaatagctt cact 24 <210> 30 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E2-R1) <400> 30 agccaagatg attagggtcc ca 22 <210> 31 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E3-F1) <400> 31 aagatactca gtacgtgggt gg 22 <210> 32 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E3-R2) <400> 32 tccgctctat actctgggct 20 <210> 33 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E4-F1) <400> 33 tgactgacat tagaacattg ggaga 25 <210> 34 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E4-R1) <400> 34 ccttcccgag tccccatagt t 21 <210> 35 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E6-F1) <400> 35 cctgcagata gcgtactggt 20 <210> 36 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E6-R1) <400> 36 accagacacc tgccaatgag 20 <210> 37 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E7-F2) <400> 37 ggcggactag tggcctta 18 <210> 38 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> EI24 primer (EI24-E7-R1) <400> 38 aaaatcatta cctcccacca gcat 24

Claims (19)

EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene or a protein encoded by the gene, predicting liver cancer target therapy reactivity For marker composition. According to claim 1,
The marker composition is ATG5 (Autophagy related 5, NCBI accession number: NM_001286106.2; NM_001286107.2; NM_001286108.2; NM_001286111.2; NM_004849.4; XM_024446590.1) and Becn1 (Beclin-1, NCBI accession number: NM_001313998) .2; NM_001313999.1; NM_001314000.2; NM_003766.5; XM_017025262.2; XM_005257760.4; XM_011525421.2; XM_017025263.2; XM_017025264.2; XM_005257759.3) or A marker composition, characterized in that it further comprises a protein encoded by the gene. According to claim 1,
The liver cancer target therapeutic agent, characterized in that sorafenib (sorafenib), a marker composition. EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) An agent for measuring the expression level of the gene or the protein encoded by the gene A composition for predicting the reactivity of a target liver cancer treatment agent, comprising a. 5. The method of claim 4,
The composition is ATG5 (Autophagy related 5, NCBI accession number: NM_001286106.2; NM_001286107.2; NM_001286108.2; NM_001286111.2; NM_004849.4; XM_024446590.1) and Becn1 (Beclin-1, NCBI accession number: NM_001313998. 2; NM_001313999.1; NM_001314000.2; NM_003766.5; XM_017025262.2; XM_005257760.4; XM_011525421.2; XM_017025263.2; XM_017025264.2; XM_005257759.3) or The composition for prediction, characterized in that it further comprises an agent for measuring the level of the protein encoded by the gene. 5. The method of claim 4,
The agent for measuring the level of mRNA of the gene is a sense and antisense primer, or a probe that complementarily binds to the mRNA of the gene, the composition for prediction. 5. The method of claim 4,
The agent for measuring the level of the protein is an antibody that specifically binds to the protein, the composition for prediction. 5. The method of claim 4,
The composition for prediction, characterized in that the liver cancer target therapeutic agent is sorafenib (sorafenib). A kit for predicting treatment responsiveness to a liver cancer target therapy comprising the composition of claim 4 . For a biological sample derived from a human subject, the mRNA of the EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene or the gene is An information providing method for predicting therapeutic responsiveness to a liver cancer-targeted therapeutic agent, comprising the step of measuring the expression level of the encoding protein. 11. The method of claim 10,
The method is ATG5 (Autophagy related 5, NCBI accession number: NM_001286106.2; NM_001286107.2; NM_001286108.2; NM_001286111.2; NM_004849.4; XM_024446590.1) and Becn1 (Beclin-1, NCBI accession number: NM_001313998. 2; NM_001313999.1; NM_001314000.2; NM_003766.5; XM_017025262.2; XM_005257760.4; XM_011525421.2; XM_017025263.2; XM_017025264.2; XM_005257759.3) or Information providing method, characterized in that it further comprises the step of measuring the expression level of the protein encoded by the gene. 11. The method of claim 10,
The mRNA level is characterized in that measured through the method of polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR) or real-time polymerase chain reaction (Real-time PCR), information providing method. 11. The method of claim 10,
The protein expression level was determined by Western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation or flow cytometry, Method for providing information, characterized in that measured through immunofluorescence (immunofluorescence). 11. The method of claim 10,
The method for providing information, characterized in that the liver cancer targeted therapeutic agent is sorafenib (sorafenib). (1) treating cells with a candidate substance in vitro; and
(2) EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) in the cell mRNA or protein expression level measurement A method of screening a resistance inhibitor for a liver cancer-targeted therapeutic agent, comprising the step of: 16. The method of claim 15,
The screening method, characterized in that it further comprises the step of selecting a substance that reduces the expression level of the mRNA of the EI24 gene or its protein as an inhibitor of resistance to a liver cancer-targeted therapeutic agent compared to the candidate substance-untreated group. 16. The method of claim 15,
The screening method, characterized in that the liver cancer target therapeutic agent is sorafenib (sorafenib). 16. The method of claim 15,
The candidate material is a screening method, characterized in that it is selected from the group consisting of a nucleic acid, a compound, a microbial culture or extract, a natural product extract, a peptide, a substrate analog, an aptamer and an antibody. Sorafenib (sorafenib) as an active ingredient, EI24 (Etoposide-induced protein 2.4 homolog, NCBI accession number: NM_001290135.2; NM_001330419.2; NM_004879.5; XM_011543070.1; XM_011543069.2) gene-deficient liver cancer A pharmaceutical composition for the treatment of a patient.

Images