KR20220035575A - Composition for controlling expression of GDF11 gene comprising PCBP2 and microRNA - Google Patents

Abstract

The present invention relates to a composition for controlling expression of the GDF11 gene, comprising PCBP2 and microRNA. The PCBP2 protein and microRNA-93-5p of the present invention can interact to each other to control the expression of GDF11, an anticancer gene, so that it is expected to be usefully used for prevention, improvement or treatment of cancer.

Description

A composition containing PCBP2 and microRNA that regulates the expression of the GDF11 gene {Composition for controlling expression of GDF11 gene comprising PCBP2 and microRNA}

The present invention relates to a composition containing PCBP2 (poly(rC) binding protein) and microRNA that regulates the expression of the GDF11 (Growth differentiation factor 11) gene.

Despite decades of effort, cancer still ranks first or second among modern causes of death due to disease. Such cancer is caused by genetic mutations in normal cells caused by carcinogens or viruses. Anticancer drugs are developed and treated by targeting genes or proteins that are not expressed in normal cells but are specifically expressed only in cancer cells. come. Anticancer drugs are the most common and efficient treatment method for treating cancer, either alone or in combination with other treatments such as radiotherapy. Treatment of cancer with these anticancer drugs is due to their ability to kill cancer cells. They kill not only cancer cells but also normal cells, frequently causing side effects such as hair loss, loss of appetite, nausea, vomiting, difficulty breathing, stomatitis, and neutropenic fever. causes Depending on the patient's general health condition, these side effects may make anticancer drug treatment impossible or at least cause extreme discomfort and discomfort to the patient, and may seriously damage the cancer patient's quality of life.

MicroRNA (microRNA) is a short non-coding RNA consisting of about 18 to 25 nucleotides and is produced by hairpin-shaped transcripts present in cells. Micro RNA binds complementary to target mRNA (messenger RNA) and acts as a post-transcriptional gene repressor. It is known to suppress gene expression by inhibiting mRNA translation or induce destabilization by catalyzing mRNA cleavage. These micro RNAs are involved in various roles in the body, including apoptosis, cell cycle, and gene regulation, and interact with target genes to play a role in the overall functioning of organisms, including cancer differentiation, growth, metastasis, angiogenesis, and apoptosis. The process can be regulated, and the role and function of microRNA in cancer can depend on the target gene.

Meanwhile, Korean Patent No. 1042052 discloses a 'composition for preventing or treating solid cancer containing anti-microRNA' of miR-199a, the production of which is specifically increased in cervical cancer, and Korean Patent No. 2110454 discloses ' A 'composition for preventing or treating cancer diseases containing microRNA-550a-3-5p and an anticancer agent as active ingredients' is disclosed, but there is no description of a composition containing PCBP2 and microRNA that regulates the expression of the GDF11 gene of the present invention. .

The present invention was derived from the above needs, and the present inventors confirmed that the expression of the anti-cancer gene GDF11 increases when the activity of microRNA-93-5p is suppressed, and the RNA pull-down technique (RNA pull-down assay) ), it was confirmed that the adjacent sequence of the microRNA-93-5p target sequence in GDF11 mRNA and the PCBP2 (poly(rC) binding protein) protein can bind and interact with each other. In addition, inhibiting the expression of PCBP2 protein reduced the inhibition of GDF11 expression when treated with microRNA-93-5p, and when PCBP2 protein was present, the expression of GDF11 was suppressed by microRNA-93-5p, thereby inhibiting microRNA-93-5p. The present invention was completed by confirming that the phenomenon of regulating the expression of the GDF11 gene occurs in the presence of the PCBP2 protein.

In order to solve the above problem, the present invention provides GDF11 (GDF11), which contains PCBP2 (poly(rC) binding protein) protein consisting of the amino acid sequence of SEQ ID NO: 2 and microRNA-93-5p consisting of the nucleotide sequence of SEQ ID NO: 3 as active ingredients. A composition for inhibiting the expression of growth differentiation factor 11) gene is provided.

In addition, the present invention provides a GDF11 (Growth differentiation factor 11) gene containing as an active ingredient an expression inhibitor of the gene encoding the PCBP2 protein consisting of the amino acid sequence of SEQ ID NO: 2 and microRNA-93-5p consisting of the nucleotide sequence of SEQ ID NO: 3. Provides a composition for enhancing expression.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer comprising an expression inhibitor of the gene encoding the PCBP2 protein consisting of the amino acid sequence of SEQ ID NO: 2 and microRNA-93-5p consisting of the nucleotide sequence of SEQ ID NO: 3 as an active ingredient. provides.

Since the PCBP2 protein and microRNA-93-5p of the present invention can interact with each other to regulate the expression of GDF11 , an anticancer gene, it is expected to be useful for preventing, improving, or treating cancer.

Figure 1 confirms the effect of regulating the expression of the GDF11 gene by microRNA-93-5p, and Figure 1A shows a Western blot confirming the expression level of GDF11 protein in the human liver cancer cell line Huh7 transformed with the microRNA-93-5p expression vector. blot) results, and Figure 1B is the result of a luciferase reporter assay to prove that the specific sequence of microRNA-93-5p targeting the GDF11 gene can regulate the expression of the GDF11 gene. , and Figure 1C is the result of a luciferase reporter assay confirming the expression level of the GDF11 gene in Huh7 cells treated with microRNA-93-5p inhibitor (anti-miR-93). WT: Mock (Huh7 cells untreated), miR-124: Negative control (cells transfected with an expression vector for hsa-miR-124, a microRNA that does not target the GDF11 gene), miRNA target site Mutant: In the GDF11 gene. Anti-miR-93, a mutant with a sequence that randomly changes the target sequence of microRNA-93-5p (sequence complementary to the 2nd to 7th nucleotide sequence of microRNA): microRNA-93-5p activity inhibitor (microRNA-93-5p A complementary sequence that can target, including a sequence in which the hydroxyl group at position 2 of all nucleotides is modified to 2'-O-methyl), anti-siGFP: negative control (RNA that is not expected to have any effect on cells) (including sequences in which the hydroxyl group at position 2 of all nucleotides has been modified to 2'-O-methyl).
Figure 2 shows RNA pull-down assay (A) and electrophoretic mobility change to confirm the interaction relationship between PCBP2 (poly(rC) binding protein) protein, an RNA binding protein, and microRNA-93-5p. This is the result of analysis (Electrophoretic mobility shift assay; B). miR-93 flanking; The adjacent sequence of the microRNA-93-5p target sequence in the 3'-UTR region of GDF11 prepared by in vitro transcription, miR-93 antisense; Negative control (complementary sequence of miR-93 flanking), IGF2BP1; Insulin Like Growth Factor 2 mRNA Binding Protein 1, RNA:RBP Complex; RNA:RNA binding protein complex (miR-93 flanking sequence-PCBP2 complex).
Figure 3 shows the role of PCBP2 protein in regulating GDF11 gene expression by microRNA-93-5p, after knocking out (KO) or re-expressing (PCBP2 ^rescue ) PCPB2 protein in Huh7 cells, GDF11 This is the result of confirming the effect of suppressing gene expression.

In order to solve the above problem, the present invention provides GDF11 (GDF11), which contains PCBP2 (poly(rC) binding protein) protein consisting of the amino acid sequence of SEQ ID NO: 2 and microRNA-93-5p consisting of the nucleotide sequence of SEQ ID NO: 3 as active ingredients. A composition for inhibiting the expression of growth differentiation factor 11) gene is provided.

In the composition for inhibiting expression of the GDF11 gene of the present invention, the microRNA-93-5p may be composed of the base sequence of SEQ ID NO: 3, but is not limited thereto. In addition, the PCBP2 protein consisting of the amino acid sequence of SEQ ID NO: 2 may be encoded by the base sequence of SEQ ID NO: 1, but is not limited thereto.

The present invention also provides a GDF11 (Growth differentiation factor 11) gene containing, as an active ingredient, an expression inhibitor of the gene encoding the PCBP2 protein consisting of the amino acid sequence of SEQ ID NO: 2 and microRNA-93-5p consisting of the nucleotide sequence of SEQ ID NO: 3. Provides a composition for enhancing expression.

In the composition for enhancing the expression of the GDF11 gene of the present invention, the microRNA-93-5p is formed immediately after UAA, a stop codon, in the CDS (coding sequence) of GDF11 mRNA (GenBank accession No: NM_005811.5) (3'-UTR) ) is 1 bp, it is possible to control the expression of the GDF11 gene by targeting the 1,626-1,632 bp region and the 3,639-3,645 bp region of the GDF11 3'-UTR, and the microRNA-93-5p target sequence in the GDF11 mRNA It has the characteristic of interacting with the adjacent sequence (a total of 107 nucleotides, including 50 nucleotides in the 5' direction and 50 nucleotides in the 3' direction from the target sequence position) and the PCBP2 protein.

When the PCBP2 protein is present in the cell, the expression of the GDF11 gene is inhibited by microRNA-93-5p. However, if the expression of the PCBP2 protein is suppressed, the inhibition of the expression of the GDF11 gene is reduced upon treatment with microRNA-93-5p. It can be seen that the phenomenon of decreased expression of the GDF11 gene caused by microRNA-93-5p occurs in the presence of PCBP2 protein.

The present invention also provides a pharmaceutical composition for the prevention or treatment of cancer comprising an expression inhibitor of the gene encoding the PCBP2 protein consisting of the amino acid sequence of SEQ ID NO: 2 and microRNA-93-5p consisting of the nucleotide sequence of SEQ ID NO: 3 as an active ingredient. provides.

In the present invention, it was confirmed that when the PCBP2 protein is present in the cell, the expression of the GDF11 gene is reduced by microRNA-93-5p, and when the expression of the PCBP2 protein is suppressed, the inhibition of the expression of the GDF11 gene by microRNA-93-5p is reduced. Therefore, treating cancer cells with an expression inhibitor of the PCBP2 coding gene and microRNA-93-5p can reduce the proliferation of cancer cells because the expression of GDF11 , an anti-cancer gene, is not inhibited in cancer cells.

In the pharmaceutical composition for preventing or treating cancer of the present invention, the expression inhibitor of the PCBP2 coding gene is any one selected from the group consisting of antisense oligonucleotides, siRNA, shRNA, microRNA, and ribozyme that specifically bind to the PCPB2 gene. It may include the above, but any agent that can inhibit gene expression may be included without limitation.

As used herein, the term “cancer” refers to general cancer diseases including solid tumors and blood born tumors, preferably liver cancer, lung cancer, stomach cancer, colon cancer, breast cancer, and non-small cell lung cancer. , bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, colon cancer, small intestine cancer, rectal cancer, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulva. Carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, lymph node cancer, bladder cancer, gallbladder cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, may be lymphocytic lymphoma, bladder cancer, renal or ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, pituitary adenoma, or fibrosarcoma cancer; Preferably, it may be liver cancer, but is not limited thereto.

The pharmaceutical dosage form of the composition according to the present invention can be used alone or in combination with other pharmaceutically active compounds, as well as in appropriate combinations.

The pharmaceutical composition according to the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injection solutions according to conventional methods. It may be possible, but it is not limited to this. Carriers, excipients, and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, and methyl. Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations include the extract with at least one excipient, such as starch, calcium carbonate, and sucrose. ) or prepared by mixing lactose, gelatin, etc. Additionally, in addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. there is.

Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, Witepsol, Macrogol, Tween 61, cacao, laurin, glycerol, geratin, etc. can be used.

The pharmaceutical composition of the present invention can be administered orally or parenterally, and when administered parenterally, it is preferable to select an injection method for external application to the skin or intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine dura, or intracerebrovascular injection, but is limited thereto. I never do that.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, a pharmaceutically effective amount refers to an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type of patient's disease, severity, activity of the drug, and It can be determined based on factors including sensitivity, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.

The dosage of the composition of the present invention may vary depending on the patient's weight, age, gender, health condition, diet, administration time, administration method, excretion rate, and severity of the disease, but may vary depending on the route of administration and severity of obesity. , the dosage may increase or decrease depending on gender, weight, age, etc., so the above dosage does not limit the scope of the present invention in any way.

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Cell culture and plasmid production

The human liver cancer cell line Huh7 was cultured using DMEM (Dulbecco's modified eagle's medium) containing 9% fetal bovine serum. For the cultured Huh7 cells, miR-124 duplex (SEQ ID NO: 4: 5'-cguguucacagcggaccuugau-3'), miR-93 duplex, and miR-93 flanking (SEQ ID NO: 5'-ATGACAGCACCCGCCACAGCCAAGAGATGAATTCTGAGCACTTACCACGGGCACTTTATGGACATAAAATACCTCTCGCTGTGGGACAGATAACCAGGGCACCAGAG-3' ),miR -93-antisense (SEQ ID NO: 6: 5'-CTCTGGTGCCCTGGTTATCTGTCCCACAGCGAGAGGTATTTTATGTCCATAAAGTGCCCGTGGTAAGTGCTCAGAATTCATCTCTTGGCTGTGGCGGGTGCTGTCAT-3'), using anti-siGFP or anti-miR-93 (Bioneer) according to the manufacturer's method of Lipofectamine 2000 transfection reagent (Thermofisher scientific) converted . The anti-miR-93 is a single-stranded synthetic inhibitor with a complementary sequence to target microRNA-93-5p, and the hydroxyl group at position 2 of all nucleotides is modified to 2'-O-methyl to target microRNA-93-5p. It plays a role in suppressing the activity of anti-miR-93, and anti-siGFP is modified by modifying the hydroxyl group at number 2 of all nucleotides of RNA to 2'-O-methyl, which is not expected to have any effect on cells. It was used as a negative control.

In addition, for a luciferase reporter assay experiment using GDF11 3'-UTR, GDF11 3'-UTR (1,296~3,152 bp) was amplified and cloned into the psichek-2 vector, and the corresponding GDF11 3'-UTR was amplified and cloned into the psichek-2 vector. Site-specific mutagenesis of the -UTR sequence was performed through inverse PCR. PCBP2 ^rescue experiments were conducted in PCBP2 knock out cells. It was transformed again with the pcDNA3.1 PCBP2 ORF vector. All cloning processes used the Overlap cloner DNA cloning kit (Elpis Biotech.).

2. Western blot

The transfected Huh7 cells were treated with RIPA (Radioimmunoprecipitation assay) buffer and centrifuged at 12,000 rpm after repeated vortexing to obtain cell lysates. Afterwards, a total of 30 μg of protein was loaded and separated on a polyacrylamide gel and transferred to a PVDF membrane. For GDF11 detection, rabbit anti-GDF11 polyclonal antibody (Abcam, ab71347) was used as the primary antibody, for GAPDH detection, rabbit anti-GAPDH monoclonal antibody (Cell Signaling Technology, #2118) was used as the primary antibody, and for PCBP2 detection, rabbit anti-GAPDH monoclonal antibody was used. Rabbit anti-IGF2BP1 antibody (MBL Life Science) was used to detect PCBP2 (MBL Life Science, RN025P) and IGF2BP1. Goat anti-rabbit IgG (H+L) HRP-conjugated antibody was used as the secondary antibody. The antibody-treated membrane was reacted with ECL reagent (Elpis biotech.) and then exposed to X-ray film for analysis.

3. Luciferase reporter assay

Luciferase reporter assay was performed using the Dual-luciferase ^® reporter assay system (Promega). Specifically, Huh7 cells were inoculated into a 24-well plate at 1 × 10 ⁴ cells per well, and 48 hours later, the transformed cells were lysed by treatment with passive lysis buffer (Promega), and the eluate was added with luciferase assay reagent Ⅱ ( After treatment with LAR II) to measure firefly luciferase activity, Renilla luciferase activity was measured by treatment again with Stop & Glo ^® Buffer. Renilla luciferase and firefly luciferase activities were measured separately using a Glomax ^® 96 microplate luminometer (Promega), and then Renilla luciferase activity was measured using each firefly luciferase. The analysis was normalized to activity.

4. RNA pull-down assay

The adjacent RNA sequence of the miRNA target sequence was synthesized from the 3'-UTR of GDF11 produced by in vitro transcription using T7 RNA polymerase, and the RNA sequence was synthesized using sodium periodate (sodium m-periodate). (bead). Beads linked to RNA were reacted with Huh7 eluate and then separated on an acrylamide gel. To observe the separated proteins, silver staining was performed using the SiverQuest™ staining kit (Invitrogen).

5. Recombinant protein production

To produce GST and GST-rPCBP2, pET28b plasmid containing GST or GST-rPCBP2 ORF sequence was transformed into Rosetta™ 2 competent cells and then cultured. The cultured bacteria were collected by centrifugation and then sonicated to obtain an eluate. GST and GST-rPCBP2 were purified by reacting the eluate with glutathione-agarose beads, and the proteins were quantified using the Bradford assay, separated on an acrylamide gel, and then analyzed using Coomassie. Purification was confirmed through Coomassie blue staining.

6. Electrophoretic mobility shift assay

The 3'-UTR sequence of GDF11 was prepared by in vitro transcription using [α- ³² P]UTP. The corresponding sequences were reacted with recombinant GST or various concentrations of GST-PCBP2 and then separated on an acrylamide gel. This acrylamide gel was visualized and analyzed through phosphorimaging.

Example 1. microRNA-93-5p GDF11 Gene expression regulation analysis

In the present invention, after confirming that some sequences of microRNA-93-5p (AAAGUGC) can bind to the 1,626-1,632 bp region and 3,639-3,645 bp region of GDF11 3'-UTR using the microRNA target prediction program TargetScan, microRNA In order to analyze the effect of -93-5 on regulating the expression of the GDF11 gene, human liver cancer cell line Huh7 was treated with microRNA-93-5 and Western blot was performed to confirm the level of GDF11 protein expression in the control group (Mock). , untreated Huh7 cells), and a decrease in the expression of GDF11 protein in the miR-93 treatment group was confirmed compared to the miR-124 treatment group (Figure 1A). At this time, miR-124 is a microRNA that does not have a target sequence in the GDF11 gene, and has no effect on GDF11 expression, so it was used as a control for the miR-93 treatment group.

In addition, luciferase reporter was used for the microRNA-93-5p treatment group and mutants with a randomly altered sequence of the target sequence of microRNA-93-5p (sequence complementary to the 2nd to 7th nucleotide sequence of microRNA) in the GDF11 gene. By performing the assay, it was confirmed that the inhibition rate of GDF11 expression in the microRNA-93-5p treatment group (approximately 1.9 fold) was significantly higher than that in the miRNA target site mutant treatment group (approximately 1.0 fold), thereby confirming that the GDF11 gene in the present invention was actually It was found that the specific sequence of the targeted microRNA-93-5p was capable of controlling the expression of the GDF11 gene (Figure 1B).

In addition, to confirm the effect of suppressing the activity of microRNA-93-5 on the expression of the GDF11 gene, Huh7 cells were treated with a microRNA-93-5 inhibitor (Anti-miR-93) and the expression level of the GDF11 gene was analyzed. As a result, as shown in Figure 1C, it was confirmed that the effect of suppressing the expression of the GDF11 gene was reduced in the microRNA-93-5 inhibitor treatment group compared to the control group (anti-siGFP).

Example 2. Analysis of interaction between microRNA-93-5p and PCBP2 protein

The miR-93 flanking sequence adjacent to the microRNA-93-5p target sequence in GDF11 3'UTR and the miR-93 antisense sequence complementary to the miR-93 flanking sequence were synthesized and linked to beads for RNA pull-down technique and Western blot. As a result, IGF2BP1 protein, one of the RNA-binding proteins, was detected in cells containing miR-25 flanking, miR-93 flanking, or miR-93 antisense sequences, but PCBP2 protein was detected in cells containing miR-93 flanking sequences. It was only detected in Through this, it was found that PCBP2 protein can bind to the adjacent sequence (miR-93 flanking) of the microRNA-93-5p target sequence (Figure 2A).

In addition, the GDF11 3'-UTR sequence produced by in vitro transcription was reacted with the recombinant protein GST or GST-PCBP2 and then separated on an acrylamide gel to analyze the change in electrophoretic mobility. As a result, the concentration of GST-PCBP2 protein increased. It was confirmed that the expression level of the RNA-RBP complex increased, and through this, it was confirmed that the adjacent sequence (miR-93 flanking) of the microRNA-93-5p target sequence and PCBP2 protein, an RNA-binding protein, can bind and interact with each other. (Figure 2B).

Example 3. Due to the interaction between PCBP2 protein and microRNA-93-5p GDF11 Analysis of gene expression regulation

To analyze the effect of the PCBP2 protein interacting with microRNA-93-5p on regulating the expression of the GDF11 gene, the expression level of the GDF11 gene was analyzed in Huh7 cells in which the PCBP2 protein was knocked out. As a result, the control group (WT) ), the effect of suppressing the expression of the GDF11 gene was reduced in cells in which the PCBP2 protein was knocked out (KO), but when the PCBP2 protein was re-expressed, the effect of suppressing the expression of the GDF11 gene was confirmed to increase (Figure 3).

In other words, since microRNA-93-5p can regulate the expression of the GDF11 gene in the presence of the PCBP2 protein, an anticancer effect can be expected by regulating the expression of the anticancer gene GDF11 through the interaction between the PCBP2 protein and microRNA-93-5p. It was thought that it was.

<110> Seoul National University R&DB Foundation <120> Composition for controlling expression of GDF11 gene comprising PCBP2 and microRNA <130> PN20216 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 1101 <212> DNA <213> Homo sapiens <400> 1 atggacaccg gtgtgattga aggtggatta aatgtcactc tcaccatccg gctacttatg 60 catggaaagg aagttggcag tatcatcgga aagaaaggag aatcagttaa gaagatgcgc 120 gaggagagtg gtgcacgtat caacatctca gaaggggaatt gtcctgagag aattatcact 180 ttggctggac cccactaatgc catcttcaaa gcctttgcta tgatcattga caaactggaa 240 gaggacataa gcagctctat gaccaatagc acagctgcca gtagaccccc ggtcaccctg 300 aggctggtgg tccctgctag tcagtgtggc tctctcattg gaaaaggtgg atgcaagatc 360 aaggaaatac gagagagtac aggggctcag gtccaggtgg caggggatat gctaccaac 420 tcaactgagc gggccatcac tattgctggc attccacaat ccatcattga gtgtgtcaaa 480 cagatctgcg tggtcatgtt ggagactctc tcccagtccc ccccgaaggg cgtgaccatc 540 ccgtaccggc ccaagccgtc cagctctccg gtcatctttg caggtggtca ggacaggtac 600 agcacaggca gcgacagtgc gagctttccc cacaccaccc cgtccatgtg cctcaaccct 660 gacctggagg gaccacctct agaggcctat accattcaag gacagtatgc cattccacag 720 ccagatttga ccaagctgca ccagttggca atgcaacagt ctcattttcc catgacgcat 780 ggcaacaccg gattcagtgg cattgaatcc agctctccag aggtgaaagg ctattgggca 840 ggtttggatg catctgctca gactacttct catgaactca ccattccaaa cgatttgatt 900 ggctgcataa tcgggcgtca aggcgccaaa atcaatgaga tccgtcagat gtctggggcg 960 cagatcaaaa ttgcgaaccc agtggaagga tctactgata ggcaggttac catcactgga 1020 tctgctgcca gcattagcct ggctcaatat ctaatcaatg tcaggctttc ctcggagacg 1080 ggtggcatgg ggagcagcta g 1101 <210> 2 <211> 366 <212> PRT <213> Homo sapiens <400> 2 Met Asp Thr Gly Val Ile Glu Gly Gly Leu Asn Val Thr Leu Thr Ile 1 5 10 15 Arg Leu Leu Met His Gly Lys Glu Val Gly Ser Ile Ile Gly Lys Lys 20 25 30 Gly Glu Ser Val Lys Lys Met Arg Glu Glu Ser Gly Ala Arg Ile Asn 35 40 45 Ile Ser Glu Gly Asn Cys Pro Glu Arg Ile Ile Thr Leu Ala Gly Pro 50 55 60 Thr Asn Ala Ile Phe Lys Ala Phe Ala Met Ile Ile Asp Lys Leu Glu 65 70 75 80 Glu Asp Ile Ser Ser Ser Met Thr Asn Ser Thr Ala Ala Ser Arg Pro 85 90 95 Pro Val Thr Leu Arg Leu Val Val Pro Ala Ser Gln Cys Gly Ser Leu 100 105 110 Ile Gly Lys Gly Gly Cys Lys Ile Lys Glu Ile Arg Glu Ser Thr Gly 115 120 125 Ala Gln Val Gln Val Ala Gly Asp Met Leu Pro Asn Ser Thr Glu Arg 130 135 140 Ala Ile Thr Ile Ala Gly Ile Pro Gln Ser Ile Ile Glu Cys Val Lys 145 150 155 160 Gln Ile Cys Val Val Met Leu Glu Thr Leu Ser Gln Ser Pro Pro Lys 165 170 175 Gly Val Thr Ile Pro Tyr Arg Pro Lys Pro Ser Ser Ser Pro Val Ile 180 185 190 Phe Ala Gly Gly Gln Asp Arg Tyr Ser Thr Gly Ser Asp Ser Ala Ser 195 200 205 Phe Pro His Thr Thr Pro Ser Met Cys Leu Asn Pro Asp Leu Glu Gly 210 215 220 Pro Pro Leu Glu Ala Tyr Thr Ile Gln Gly Gln Tyr Ala Ile Pro Gln 225 230 235 240 Pro Asp Leu Thr Lys Leu His Gln Leu Ala Met Gln Gln Ser His Phe 245 250 255 Pro Met Thr His Gly Asn Thr Gly Phe Ser Gly Ile Glu Ser Ser Ser 260 265 270 Pro Glu Val Lys Gly Tyr Trp Ala Gly Leu Asp Ala Ser Ala Gln Thr 275 280 285 Thr Ser His Glu Leu Thr Ile Pro Asn Asp Leu Ile Gly Cys Ile Ile 290 295 300 Gly Arg Gln Gly Ala Lys Ile Asn Glu Ile Arg Gln Met Ser Gly Ala 305 310 315 320 Gln Ile Lys Ile Ala Asn Pro Val Glu Gly Ser Thr Asp Arg Gln Val 325 330 335 Thr Ile Thr Gly Ser Ala Ala Ser Ile Ser Leu Ala Gln Tyr Leu Ile 340 345 350 Asn Val Arg Leu Ser Ser Glu Thr Gly Gly Met Gly Ser Ser 355 360 365 <210> 3 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> microRNA-93-5p <400> 3 caaagugcug uucgugcagg uag 23 <210> 4 <211> 22 <212> RNA <213> Artificial Sequence <220> <223>miR-124 duplex <400> 4 cguguucaca gcggaccuug au 22 <210> 5 <211> 107 <212> RNA <213> Artificial Sequence <220> <223>miR-93 flanking <400> 5 atgacagcac ccgccacagc caagagatga attctgagca cttaccacgg gcactttatg 60 gacataaaat acctctcgct gtgggacaga taaccagggc accagag 107 <210> 6 <211> 107 <212> RNA <213> Artificial Sequence <220> <223>miR-93-antisense <400> 6 ctctggtgcc ctggttatct gtcccacagc gagaggtatt ttatgtccat aaagtgcccg 60 tggtaagtgc tcagaattca tctcttggct gtggcgggtg ctgtcat 107

Claims (5)

For inhibiting the expression of the GDF11 (Growth differentiation factor 11) gene, which contains as active ingredients PCBP2 (poly(rC) binding protein) protein consisting of the amino acid sequence of SEQ ID NO: 2 and microRNA-93-5p consisting of the nucleotide sequence of SEQ ID NO: 3 Composition. GDF11 (Growth differentiation factor) containing as an active ingredient an expression inhibitor of the gene encoding the PCBP2 (poly(rC) binding protein) protein consisting of the amino acid sequence of SEQ ID NO: 2 and microRNA-93-5p consisting of the nucleotide sequence of SEQ ID NO: 3 11) Composition for enhancing gene expression. A pharmaceutical composition for the prevention or treatment of cancer comprising an expression inhibitor of the gene encoding the PCBP2 protein consisting of the amino acid sequence of SEQ ID NO: 2 and microRNA-93-5p consisting of the base sequence of SEQ ID NO: 3 as an active ingredient. The method of claim 3, wherein the expression inhibitor of the PCBP2 encoding gene is at least one selected from the group consisting of antisense oligonucleotides, siRNA, shRNA, microRNA, and ribozyme that specifically bind to the gene encoding the PCBP2 protein. Pharmaceutical composition for preventing or treating cancer. The method of claim 3, wherein the cancer is liver cancer, laryngeal cancer, lung cancer, esophageal cancer, pancreatic cancer, colon cancer, stomach cancer, tongue cancer, skin cancer, brain tumor, uterine cancer, breast cancer, cervical cancer, ovarian cancer, kidney cancer, gallbladder cancer, oral cancer, colon cancer, and liver cancer. , A pharmaceutical composition for preventing or treating cancer, characterized in that it is selected from the group consisting of bladder cancer and colon cancer.

Images