KR20210065056A - A Composition for semen cryoprotectant of animal including amniotic membrane derived stem cell-conditioned media and method of making thereof - Google Patents

Abstract

The present application relates to a composition for cryoprotection of semen comprising a cryoprotectant and an animal amnion-derived stem cell-conditioned medium. By including the amnion-derived stem cell-conditioned medium contained in the composition provided by the present application in an optimal amount, it is possible to provide an effect of improving sperm viability, motility, and cell membrane integrity.

Description

A composition for semen cryoprotectant of animal including amniotic membrane derived stem cell-conditioned media and method of making thereof

The present application relates to a composition for freezing animal semen comprising amniotic membrane derived stem cell-conditioned media (AMS-CM) and a cryoprotectant.

The present application relates to a method for preparing the composition.

Cryoprotection (or cryopreservation) technology is a technology used for improvement, propagation, maintenance of excellent individuals, conservation of endangered species, and artificial insemination (AI).

In particular, cryoprotection of sperm is useful for breeding livestock and preserving breeds.

Materials used for cryopreservation of sperm so far are DMSO (dimethyl sulfoxide), glycerol, sucrose, methanol, glucose, proline, galactose, lactose ( lactose), betaine, and fructose. These materials have various problems such as strong toxicity, high viscosity, and insufficient effect of preventing cell damage during freezing-thawing.

Furthermore, sperms die during the freezing and thawing process, or their motility decreases, and the quality of sperm after thawing is lower than that of fresh semen has not been solved. Therefore, the importance of research on developing semen freezing technology has been constantly raised.

Therefore, it is necessary to develop a semen freezing technique that can improve sperm motility and viability.

On the other hand, Korean Patent No. 10-2058338 discloses 'a composition for cryopreservation of canine semen containing mesenchymal stem cells as an active ingredient', and Korean Patent No. 10-0320588 discloses 'for freezing dog semen'. Composition, dog semen freezing method using the same, and artificial insemination method using the frozen semen are disclosed, but the composition for cryopreservation of animal semen comprising the amnion-derived stem cell-conditioned medium and cryopreservative of the present invention is disclosed. there is no bar

1. Korean Patent No. 10-2058338 2. Korean Patent No. 10-0320588

An object of the present application is to provide a composition for cryoprotection of animal semen, comprising a cryoprotectant and an amnion-derived stem cell-conditioned medium.

Another object of the present application is to provide a method for preparing a composition for freezing animal semen, which can improve motility, viability, membrane integrity, and mitochondrial activity of thawed sperm after freezing of animal semen.

In order to solve the problems of the present application described above, according to an aspect of the present application, a composition for freezing semen including a cryoprotectant and amniotic membrane derived stem cell-conditioned media (AMS-CM) is provided. is provided

The composition is

at least one cryoprotectant; and

Amniotic membrane derived Stem Cell-conditioned media (ASC-CM), including apolipoprotein, fibronectin, thioredoxin, and albumin;

including,

The ASC-CM is a culture medium in which amnion-derived stem cells are cultured,

In this case, the ASC-CM is provided with a composition that does not contain amnion-derived stem cells.

In order to solve the problems of the present application described above, according to another aspect of the present application, there is provided a method for preparing the composition for freezing semen.

The method is

culturing amnion-derived stem cells;

obtaining an amnion-derived stem cell-conditioned medium from the culture solution of the cultured amnion-derived stem cells; and

mixing the amnion-derived stem cell-conditioned medium and a cryoprotectant;

including,

In this case, there is provided a method for preparing a composition for freezing semen in which the amnion-derived stem cell-conditioned medium is contained in an amount of 5% to 15% based on the final weight of the composition.

According to the present application, the following effects are generated.

First, according to the present application, it is possible to provide a composition capable of freezing animal semen. In particular, it is possible to provide a composition comprising an amnion-derived stem cell-conditioned medium and a cryoprotectant.

Second, by including the amnion-derived stem cell-conditioned medium contained in the composition provided by the present application in an optimal content, it is possible to provide the effect of improving sperm viability, motility, and cell membrane integrity.

Third, it is possible to provide a method for freezing animal semen using the composition provided by the present application.

Fourth, the semen freezing method provided by the present application can help to maintain excellent individuals of animals and to preserve endangered species.

1 is a diagram of main proteins of amniotic fluid-derived stem cells (AFSCs) and amniotic stem cells (ASCs).
2 is a view showing sperm observed under a microscope after hypo-osmotic swelling test for cell membrane integrity analysis.
3 is a diagram showing a schematic diagram of parameters for analyzing sperm motility using a computer assisted sperm analyzer (CASA).
4 is a view showing the results of flow cytometry analysis of canine amniotic membrane membrane derived mesenchymal stem cells (cAMSC) of canine animals.
5 is a view showing the results of analyzing the expression of the pluripotency gene of cAMSC by qPCR.
6 is a diagram showing the results of analyzing the ratio of migratory and non-migrating sperm in the control group and the 10% cAMSC-CM treated group.
7 is a view showing the results of analyzing the mitochondrial activity of sperm in the control group and the 10% cAMSC-CM treatment group.

Hereinafter, with reference to the accompanying drawings, the content of the present invention will be described in more detail through specific embodiments and examples. It should be noted that the accompanying drawings include some, but not all, embodiments of the invention. The content of the invention disclosed by this specification may be embodied in various forms, and is not limited to the specific embodiments described herein. These embodiments are considered to be provided in order to satisfy the statutory requirements applicable herein.

Many modifications and other embodiments of the subject matter disclosed herein will occur to those skilled in the art to which the invention disclosed herein pertains. Accordingly, it is to be understood that the subject matter disclosed herein is not limited to the specific embodiments described herein, and that modifications and other embodiments thereof are also included within the scope of the claims.

0. Definitions

Definitions of representative terms used in the present invention are as follows.

basal media

As used herein, the term “basal media” refers to a medium used for culturing cells necessary for obtaining an conditioned medium. So, the basic medium means a medium containing sugars, amino acids, various nutrients, minerals, lipids, minerals, growth factors, serum, antibiotics, etc. necessary for cell growth and proliferation. At this time, each component may be selectively added or subtracted according to the type of cell. In addition, only commercially available media (media or medium) or a medium to which serum or antibiotics are added should be interpreted as a basic medium.

conditioned media (CM)

As used herein, the term “conditioned media” refers to a culture medium excluding cells by culturing cells in the basal medium for a certain period of time and then using a method such as centrifugation or filter. In this case, the conditioned medium contains not only sugars, amino acids, various nutrients, minerals, lipids, and minerals necessary for cell growth and proliferation, but also growth factors, extracellular matrix components, antioxidants, metabolites, etc. secreted by cells during the culture process. This is included. The term conditioned medium is also referred to herein by the abbreviation CM.

semen

As used herein, the term "semen" is a body fluid secreted from the gonad or other genital organs of an animal, which is a male or hermaphrodite, and refers to a liquid containing sperm. Semen contains testes, seminal vesicles, and prostate glands in the body, and sperm is produced in the testicles.

Cryopreservation

As used herein, the term “cryopreservation” refers to the long-term preservation of cells in a state in which they slow down or block the rate of all physiological and biochemical reactions in the cells. The cryopreserved cells can be thawed and used if necessary. The term cryopreservative refers to a substance used for cryopreservation. The term cryopreservation should be interpreted with the same meaning as cryoprotection, freezing, and cryopreservation.

about

As used herein, the term "about" does not have to be accurate or necessary to characterize, as to reference amounts, levels, values, numbers, frequencies, percentages, dimensions, sizes, amounts, weights, lengths and other amounts, and to case may be approximate and/or may be greater or lesser than tolerances, conversion factors, roundings, measurement errors, etc., and other factors known to those skilled in the art.

include

As used herein, the term “comprising” means including at least one other feature or number, step, action, material, or element within the disclosed feature, number, step, action, material, or element. The term inclusion is to be interpreted as having the same meaning as containing.

Abbreviation

The terms used in the present application may be used as abbreviations as follows.

conditioned media: CM

Amniotic membrane derived stem cell: ASC

Amniotic membrane derived mesenchymal stem cell: AMSC

Amnion-derived stem cell-conditioned medium: ASC-CM

Amnion-derived mesenchymal stem cells-conditioned medium: AMSC-CM

Limitations of conventional animal semen cryopreservation technology

In general, during cryopreservation, ultra-freezing is mainly used, and DMSO, glycerol, sucrose, etc. are used as cryoprotectants, but they have the following limitations.

i) Due to the strong toxicity and high viscosity of the cryoprotectant, there is a problem in that the effect of preventing damage to cells is insufficient.

Cryoprotectants such as glycerol, dimethyl sulfoxide (DMSO), prophandiol, and polyethylene glycol (PEG) that are conventionally used are physiologically toxic. Such toxicity has a problem of causing cell damage by worsening cell viability and/or function, including damage such as genomic mutation after thawed cells are cultured or injected into a recipient body.

ii) During freezing-thawing, there is a problem in that motility, viability, cell membrane integrity, and fertility are reduced compared to fresh sperm.

When the semen of animals is frozen and then thawed using the cryoprotectant used in the prior art, sperm are not only damaged by the difference in osmotic pressure and low temperature stress, but also have motility, viability, and cell membrane integrity compared to fresh sperm. , there is a problem in that the fertility and the like decrease.

The present application uses an amnion-derived stem cell-conditioned medium to solve the above problems. In particular, it was attempted to solve the problem of decreasing sperm motility, viability, and cell membrane integrity during freezing-thawing of animal semen by using amnion-derived stem cell-conditioned medium.

Technical features of the present application

i) Because amnion-derived stem cells are used, it can help sperm fertility during cryopreservation of semen.

Korean Patent No. 10-2058338 discloses 'a composition for cryopreservation of canine semen comprising mesenchymal stem cells as an active ingredient'. While the patent uses stem cells derived from fat, this application uses stem cells derived from the amniotic membrane. Among various stem cells, when using the stem cells in the amniotic membrane obtained from the placenta as in the present application, there is an advantage that can help the fertility of sperm relative to stem cells derived from fat.

ii) Since the amnion-derived stem cell-conditioned medium is used, various products secreted by stem cells are further included.

When an amnion-derived stem cell-conditioned medium is used, it is characterized by including various substances secreted by stem cells during stem cell culture. Therefore, during cryopreservation of animal semen, it has the advantage of preventing a decrease in sperm motility, viability, and cell membrane integrity.

Hereinafter, the present applicant's amnion-derived stem cell-conditioned medium having the above characteristics and a method for preparing a composition for cryoprotection of semen comprising a cryoprotectant and a composition thereof will be described in more detail.

One aspect of the present application is characterized in that the "amnion"-derived stem cell culture medium is used.

Characteristics of amniotic membrane derived stem cell (ASC)

The amniotic membrane is the membrane that is in contact with the innermost part of the placenta. The amniotic membrane consists of amniotic epithelial cells, a cell-free intermediate basement membrane layer, and a mesenchymal cell layer that is rich in mesenchymal stem cells and is in contact with the chorion. The amniotic membrane is a tissue rich in various growth factors and anti-inflammatory substances.

Stem cells are undifferentiated cells, and refer to cells having the ability to self-replicate and differentiate.

Since the amnion-derived stem cells of the present application can be obtained from the amniotic membrane, which is a tissue discarded after childbirth, there is an advantage in that there is no need to perform an invasive procedure to obtain stem cells while avoiding ethical problems.

In addition, according to the transcriptomics analysis, there is a study result that the expression of genes, transcription factors, and metabolic enzymes involved in the regulation of maternal placental immune adaptation in amnion-derived stem cells were higher than in amniotic stem cells and bone marrow stem cells (Roubelakis). et al., 2012; FIG. 1).

The amnion-derived stem cells have a characteristic of expressing or not expressing specific markers.

The specific marker may be a surface marker or a differentiation marker.

The surface markers are CD29, CD44, CD73, CD90, CD105, CD34, CD45, CD31, CD14, CD117, and the like. In this case, CD is an abbreviation for cluster of differentiation.

The CD29, CD44 and CD90 are known to be expressed in adipose, bone marrow, and umbilical cord blood-derived mesenchymal stem cells (Stem Cells 2006, 24, 1294-1301;, Mol. Cell Biochem. 2011, 357, 331-341).

The CD34 and CD45 are known to be related to hematopoietic stem cells (Cell Biol. Int. 2005, 29, 654-661;, Mol. Cells 2011, 32, 181-188).

In the amnion-derived stem cells, CD34 and CD45 may be expressed low, and CD29, CD44 and CD90 may be expressed high.

The differentiation marker is octamer-binding transcription factor 3/4 (octamer-binding transcription factor 3/4, Oct3/4), octamer-binding transcription factor 4 (octamer-binding transcription factor 4, Oct-4), nanog (Nanog) ), sex determining region Y-box 2 (Sox2), Stage-specific embryonic antigen 3 (SSEA-3), Stage-specific embryonic antigen 4 (Stage-specific) embryonic antigen 4, SSEA-4), T cell receptor alpha locus 1-60 (TRA-1-60), T cell receptor alpha locus 1-81 (T cell receptor alpha locus 1 - 60, TRA-1-81), beta-3 tubulin, forkhead box protein A2 (FOXA2), smooth-α-sarcomeric actin (ASMA), etc. .

The Oct3/4, Nanog and Sox2 are known as factors regulating pluripotency.

The amnion-derived stem cells may express Oct3/4, Nanog and Sox2.

1. Amnion-derived stem cell-conditioning medium manufacturing method

One aspect of the present application relates to a method for preparing amniotic membrane derived stem cell-conditioned media (ASC-CM), which is a culture medium in which the amniotic membrane-derived stem cells are cultured.

The method for preparing the amnion-derived stem cell-conditioned medium,

culturing amnion-derived stem cells; and

obtaining an amnion-derived stem cell-conditioned medium from the culture solution of the cultured amnion-derived stem cells;

includes

The step of culturing the amnion-derived stem cells is to allow the amnion-derived stem cells to proliferate.

Culturing the amnion-derived stem cells; culturing the amniotic membrane-derived stem cells in a basal medium; and sub-culturing the amnion-derived stem cells cultured in the basal medium.

The amnion-derived stem cells may be obtained from commercially available products, or the experimenter may obtain amnion-derived stem cells from an animal by obtaining the amniotic membrane, but is not limited thereto.

The amniotic membrane of the amnion-derived stem cells may be the amniotic membrane of mammals including humans.

For example, the mammal may be a dog, horse, cow, rabbit, raccoon, fox, deer, sheep, donkey, pig, chimpanzee, monkey, etc., but is not limited thereto.

In one embodiment, the amniotic membrane-derived stem cells of the present application may be canine amniotic membrane-derived stem cells.

In one embodiment, the amniotic membrane-derived stem cells of the present application may be canine amnion-derived stem cells.

The amniotic membrane-derived stem cells may be amnion-derived epithelial stem cells or amniotic membrane derived mesenchymal stem cells (AMSC), but are not limited thereto.

In one embodiment, the amnion-derived stem cells of the present application may be amnion-derived mesenchymal stem cells.

The amnion-derived stem cells can be obtained by thawing a commercially available product.

The thawing may be performed by thawing using a constant temperature water bath, but is not limited thereto.

In this case, optionally, the method may further include centrifuging after thawing in a constant temperature water bath to remove the cryopreservative contained in the frozen cell vial.

As another example, the amnion-derived stem cells can be obtained from a placenta obtained from a pregnant animal or from a placenta discarded during euthanasia by an experimenter to obtain amnion-derived stem cells.

The step of culturing the amnion-derived stem cells in the basal medium; is to culture the amnion-derived stem cells in the basal medium in order to grow and proliferate the cells necessary to obtain the conditioned medium.

The basal medium may be determined according to the type of the amnion-derived stem cells.

The basic medium may contain sugars, amino acids, various nutrients, minerals, lipids, minerals, antibiotics, etc. necessary for the growth and proliferation of the amnion-derived stem cells.

The sugar is necessary for cell growth, and may be, for example, any one or more selected from glucose, maltose, and fructose, but is not limited thereto.

The amino acids are necessary for cell growth, for example, glycine (Glycine), arginine (Arginine), cystine (Cystine), glutamine (Glutamine), histidine (Histidine), leucine (Leucine), isoleucine (Isoleucine), lysine ( Lysine), methionine, phenylalanine, serine, threonine, tryptophan, tyrosine, may be any one or more selected from valine, but is not limited thereto .

The vitamin is necessary for the growth of cells, for example, Choline chloride, folic acid, D- calcium pantothenate, niacinamide (Niacinamide), pyridoxine hydrochloride (Pyridoxine hydrochloride), Riboflavin (Riboflavin), thiamine hydrochloride (Thiamine hydrochloride), may be any one or more selected from i- inositol (i-Inositol), but is not limited thereto.

The minerals are necessary for cell growth, for example, calcium chloride (Calcium Chloride, CaCl2), iron nitrate (Ferric Nitrate), magnesium sulfate (Magnesium Sulfate, MgSO4), potassium chloride (Potassium Chloride, KCl), sodium bicarbonate ( Sodium Bicarbonate, NaHCO3), sodium chloride (Sodium Chloride, NaCl), and monosodium phosphate (Sodium Phosphate monobasic, NaH2PO4-H2O) may be any one or more selected from, but is not limited thereto.

The antibiotic prevents contamination by bacteria, fungi, mycoplasma, yeasts, etc. during cell culture, for example, streptomycin, penicillin, ampicillin, any one selected from kanamycin It may be one or more, but is not limited thereto.

The basic medium may be a commercially available product.

For example, commercially available products may be BME (Basal medium Eagle's), DMEM (Dulbecco's modified Eagle's medium), RPMI (Rosewell Park Menorial Institute), MEM (Minimum essential medium), RCMEP, etc., but is not limited thereto.

In one embodiment, the step of culturing the amnion-derived stem cells of the present application in a basal medium; may be culturing the amnion-derived stem cells with RCMEP.

The basic medium may further include serum, antibiotics, etc. in commercially available products.

For example, the serum may be Fetal bovine serum (FBS), Bovine calf serum (BSC), or the like, but is not limited thereto.

For example, the antibiotic may be Penicillin, Streptomycin, kanamycin, etc., but is not limited thereto.

The step of culturing the amnion-derived stem cells in a basal medium; the amnion-derived stem cells proliferate to about 70%, 75%, 80%, 85%, 90%, 95% or 100% concentration (confluency, Confluency) may be in the state, but is not limited thereto.

The culture period (ie, cell proliferation period) of the amnion-derived stem cells may be 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or 10 days, It is not limited thereto.

The step of sub-culturing the amnion-derived stem cells cultured in the basal medium is about 70%, 75%, 80%, 85%, 90% of the total cell culture vessel cell density of the amnion-derived stem cells cultured in the basal medium. , when it becomes 95% or 100%, it is periodically replaced by using a new cell culture vessel and a new basic medium. This is to prevent apoptosis due to cell overgrowth and to continue the passage.

The step of subculturing the amnion-derived stem cells; may be performed periodically about every 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 days, It is not limited thereto.

During the subculture, the same or different from the basal medium may be used periodically.

For example, a basal medium containing serum and antibiotics may be used for the first subculture, and a basal medium containing no serum may be used for the second subculture.

As a specific example, amnion stem cells may be passaged 1 to 2 times in RPMI medium containing antibiotics and serum, and then passaged in RPMI medium containing no serum for the third time.

For another specific example, after the first subculture of the amniotic stem cells in RPMI medium, the DMEM medium may be used during the second subculture.

In addition, the subculture may be performed by a conventional subculture method using trypsin, a buffer, etc., but is not limited thereto.

Additionally, analyzing the characteristics of the amnion-derived stem cells; may further include. This may be performed in the middle or/and at the end of the above process, if necessary, by analyzing the characteristics of the amnion-derived stem cells, and confirming whether the finally obtained stem cells are the desired stem cells.

The characteristics may be stem cell origin, stem cell type, stem cell pluripotent (pluripotent), undifferentiated, and the like, but is not limited thereto.

The step of analyzing the characteristics of the amnion-derived stem cells; may be performed by checking whether a marker is expressed.

For example, the origin of stem cells can be confirmed by the expression of surface markers such as CD29, CD44, CD73, CD90, CD105, CD34, CD45, CD31, CD14, CD117, but is not limited thereto.

For another example, stem cell pluripotency is a marker associated with differentiation, such as Oct3/4, Oct-4, Nanog, Sox2, SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, Beta-3. It can be confirmed by the expression of tubulin, FOXA2, ASMA, etc., but is not limited thereto.

The expression of the marker may be performed by a FACS method using a flow cytometer, a column method using an antibody specifically recognizing a target stem cell, etc., but is not limited thereto.

In the present application, as an example, the phenotype characteristics of canine amnion-derived mesenchymal stem cells, that is, the origin of stem cells, were confirmed using FACS (FIG. 4).

4, the amnion-derived mesenchymal stem cells of the canine animal of the present application showed low expression of CD34 and CD45 related to hematopoietic stem cells, and CD29, CD44 and CD29 related to mesenchymal stem cells derived from adipose, bone marrow and umbilical cord blood. It can be seen that CD90 is highly expressed.

In addition, according to another embodiment of the present application, pluripotency gene expression in canine amnion-derived mesenchymal stem cells was confirmed using qPCR (FIG. 5).

Through the results of FIG. 5, the amnion-derived mesenchymal stem cells of the canine animal of the present application express Oct3/4, Nanog and Sox2, which are essential factors for self-renewal of mesenchymal stem cells, determination of pluripotency and maintenance of undifferentiated state of cells. it can be seen that

Through the results of Figures 4 and 5, it can be confirmed that the stem cells of the present application are derived from the amniotic membrane, in particular, mesenchymal stem cells.

culturing the amnion-derived stem cells in a basal medium; Or/and sub-culturing the amniotic membrane-derived stem cells cultured in the basal medium; if performed, the amnion-derived stem cells proliferated in the culture medium can be obtained.

The step of obtaining an amnion-derived stem cell-conditioned medium from the culture solution of the cultured amnion-derived stem cells; is a conditioned medium containing various substances secreted by the amnion-derived stem cells during the culturing of the amnion-derived stem cells. is to obtain At this time, the amnion-derived stem cell-conditioned medium refers to a culture medium excluding cells.

In other words, to obtain only a culture solution in which the amnion-derived stem cells of the amnion-derived stem cells cultured in the basal medium are removed. Therefore, while amnion-derived stem cells are proliferating in the basal medium, etc., the cell proliferation process occurs while secreting metabolites, extracellular matrix components, growth factors, etc. to obtain only a culture medium containing these various substances in the basal medium.

Before obtaining the amnion-derived stem cell-conditioned medium, the step of starvating the amnion-derived stem cells cultured in the basal medium; may be additionally performed.

The malnutrition can be carried out for the purpose of cell cycle arrest or for the purpose of exclusion of serum factors.

The step of starvation of the cultured amnion-derived stem cells; may be performed by replacing the culture medium of the amnion-derived stem cells grown in a cell culture vessel with a serum-free medium and culturing.

At this time, the amnion-derived stem cells may be cultured in the serum-free medium for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, but limited thereto I never do that.

In order to obtain the amnion-derived stem cell-conditioned medium, the culture solution of the amnion-derived stem cells cultured in the basal medium may be obtained by centrifugation or filter, but is not limited thereto.

The centrifugation or filter may be repeatedly performed once, twice, three times, four times, five times, etc., but is not limited thereto.

When the culture solution of the amnion-derived stem cells cultured in the basal medium is centrifuged or filtered, an amnion-derived stem cell-conditioned medium excluding the amnion-derived stem cells can be obtained.

When the culture solution of the amnion-derived stem cells cultured in the basal medium is centrifuged or filtered, not only the amnion-derived stem cells but also debris can be removed. At this time, the debris may be dead cells, debris, etc.

In one embodiment, the step of obtaining an amnion-derived stem cell-conditioned medium from the culture medium of the cultured amnion-derived stem cells of the present application; centrifuging and filtering the culture medium to obtain an amnion-derived stem cell-conditioned medium can

When the culture medium in which the amnion-derived stem cells are cultured, which is the result of the step of culturing the amnion-derived stem cells, is centrifuged or filtered, the amnion-derived stem cells containing various substances secreted by the amnion-derived stem cells during cell proliferation-conditioned medium can be obtained.

The amnion-derived stem cell-conditioned medium obtained above further includes a cryoprotectant, and can be used for cryopreservation of semen.

2. Composition for semen cryoprotection

Another aspect of the present application relates to a composition for cryoprotection of semen comprising the amnion-derived stem cell-conditioned medium and a cryoprotectant.

The amnion-derived stem cells used to obtain the amnion-derived stem cell-conditioned medium can be obtained from various animals, and cryoprotection of semen of an allogeneic animal (the same animal from which the amnion-derived stem cells were obtained) or a heterogeneous animal could be used to

In particular, since mesenchymal stem cells have low immunogenicity, as described above, it is possible to cryopreserve semen of allogeneic or heterogeneous animals.

That is, the composition for cryoprotection of semen of the present application can be used as a composition for cryoprotection of semen in dogs using, for example, amnion-derived stem cell-conditioned medium in dogs. In addition, in another example, a bovine amnion-derived stem cell-conditioned medium can be used as a composition for cryoprotection of dog semen.

The semen may be the semen of mammals including humans.

For example, the mammal may be a dog, horse, cow, rabbit, raccoon, fox, deer, sheep, donkey, pig, chimpanzee, monkey, etc., but is not limited thereto.

In one embodiment, the composition for cryoprotection of semen of the present application may be a composition for cryoprotection of semen of canine animals.

Amnion-derived stem cell-conditioned medium

The amnion-derived stem cell-conditioned medium contains sugars, amino acids, various nutrients, minerals, lipids, minerals, and antibiotics necessary for cell growth and proliferation, as well as growth factors and extracellular matrix components secreted during the process of culturing amnion-derived stem cells. , antioxidants, metabolites, and the like.

The description of the substances necessary for the growth and proliferation of the cells is the same as described above.

The growth factor is osteonectin (Secreted protein acidic and cysteine rich/Osteonectin, SPARC), serum albumin (Serum albumin), metalloproteinase inhibitor 1 (Metalloproteinase inhibitor 1, TIMP1), insulin-like growth factor binding protein 7 (Insulin) like growth factor binding protein 7, IGFBP7), Alpha 2-HS glycoprotein (AHSG), fibronectin, Fetuin B, Cellular communication network factor 2 , CCN2), Fms related tyrosine kinase 1 (Fms related tyrosine kinase 1, FLT1), etc. may be, but is not limited thereto.

The extracellular matrix component is osteonectin (Secreted protein acidic and cysteine rich/Osteonectin, SPARC), Lumican, follistatin like 1 (FSTL1), collagen type 3 alpha 1 chain (Collagen type III) alpha 1 chain, Collagen alpha-1(I) chain, COL3A1), LGALS3BP, Dermatopontin, Collagen alpha-2(I) chain, COL1A2), Trom Thrombospondin 1, Biglycan, Collagen type V alpha 2 chain, Collagen type V alpha 1 chain, COL5A2, Collagen type V alpha 1 chain 1 chain, COL5A1), laminin subunit alpha 3, etc., but is not limited thereto.

The antioxidant material may be serum albumin, apolipoprotein E, thioredoxin, LOC102154317 (LOC102154317), ferritin, decorin, A2M, etc. do not limit

Substances related to the cell metabolism include Apolipoprotein E, Actin, cytoplasmic 1, ACTB, vitamin D binding protein, GC, Plasminogen activator, urokinase receptor, PLAUR), alpha-fetoprotein (AFP), YWHAZ, apolipoprotein AI, LOC477072 (LOC477072), hemoglobin subunit beta, ribonucleoprotein SAP domain containing ribonucleoprotein (SARNP), Proteasome subunit beta (PSMB6), LOC475521 (LOC475521), Growth arrest specific 2 (GAS2), Olfactory receptor), Lysosomal protein transmembrane 4 beta (LAPTM4B), Tropomyosin 1, Annexin A2, Serpin family A member 7, Serpin Serpin family F member 1, Nerve growth factor receptor (NGFR), Mitogen-activated protein kinase associated protein 1 (MAPKAP1), Serpin family C Member 1 (Serpin family C member 1), ZNF385C (ZNF385C), Fragile X mental retardation 1 (FMR1), potassium calcium activated channel subfamily N member 2 (Potassium calcium-activated channel subfamily N member 2, KCNN2), Otoancorin Dyslexia-associated protein (KIAA0319), Rho guanine nucleotide exchange factor 40 (Rho guanine nucleotide exchange factor 40, ARHGEF40) ), adenylate cyclase 10 (ADCY10), fibronectin type III domain containing 3B (FNDC3B), coiled coil domain and uveal self-antigen having ankyrin repeats ( Uveal autoantigen with coiled-coil domains and ankyrin repeats, UACA), zinc finger protein 142, (Ryanodine receptor 1, RYR1), etc., but is not limited thereto.

The intermediate fiber-related substances are keratin 10 (Keratin 10, Keratin, type I cytoskeletal 10), keratin 1 (Keratin 1, Keratin, type II cytoskeletal 1), keratin 14 (Keratin 14), vimentin, keratin 75 ( Keratin 75), Keratin 5 (Keratin 5), Keratin 6A (Keratin 6A), Keratin 42 (Keratin 42), Keratin 4 (Keratin 4), Keratin 9 (Keratin 9), Keratin 24 (Keratin 24), Keratin 2 2, Keratin, type II cytoskeletal 2 epidermal), keratin 78 (Keratin 78), keratin 72 (Keratin 72), etc., but is not limited thereto.

The enzyme-related substance is malate dehydrogenase (MDH1), triosephosphate isomerase (TPI1), purine nucleoside phosphorylase (PNP), ATP synthase subunit d (ATP synthase subunit d, mitochondrial, ATP5PD), Nicotinate-nucleotide pyrophosphorylase [carboxylating], QPRT), L-lactate dehydrogenase, dihydropyrimidinase Like 3 (Dihydropyrimidinase like 3, DPYSL3), TBK1 binding protein 1 (TBKBP1), Protein phosphatase 1 regulatory subunit (PPP1R12C), Adenylate cyclase 10 (Adenylate cyclase 10, ADCY10), citron rho-interacting serine/threonine kinase (CIT), DNA-dependent protein kinase catalytic subunit (PRKDC), etc., but are limited thereto. I never do that.

Amnion-derived stem cell-conditioned medium of the present application contains apolipoprotein, fibronectin, thioredoxin, and albumin as essential components.

In this case, the apolipoprotein may be apolipoprotein E and/or apolipoprotein A1. Also, the albumin may be serum albumin.

The amnion-derived stem cell-conditioned medium is further metalloproteinase inhibitor 1 (Metalloproteinase inhibitor 1, TIMP1), actin (Actin, cytoplasmic 1, ACTB), coiled coil domain and uveal self-antigen having ankyrin repeats (Uveal) autoantigen with coiled-coil domains and ankyrin repeats, UACA) may further include any one or more.

Among the apolipoproteins, in particular, apolipoprotein AI is involved in sperm capacitation and motility, and apolipoprotein E is known to have antioxidant activity (Mol). Vis. 2007 Sep 18;13: 1711-21).

The thioredoxin is known as an important substance for antioxidant action and fertility (Eur J Biochem. 2000 Oct;267(20):6102-9;, Cell Growth Differ. 1995 Dec;6(12):1643) -50;, Fertil Steril. 1996 Dec;66(6):1012-7).

The serum albumin is also known to play an important role in improving fertility (Cryobiology. Aug; 30(4): 423-31). In addition, upon thawing after cryopreservation, it is known to enhance motility, protect sperm morphology, and protect plasma membrane, acrosome and DNA integrity (Acta Vet. Brno 2007, 76, 383-390;, Cryobiology. 2013 Aug;67 (1):1-6).

The metalloproteinase inhibitor 1 (Metalloproteinase inhibitor 1, TIMP1) inhibits metalloproteinase, which is known to promote cell proliferation of various cells. It is also known to function to prevent apoptosis.

The actin (cytoplasmic 1, ACTB) produces filaments that form cross-linked networks in the cytoplasm of cells. Actin is involved in cell motility and contraction. In addition, actin is known to regulate gene transcription and damaged DNA repair.

Uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA) having the coiled-coil domain and ankyrin repeats to regulate the expression of APAF1, stress-induced (stress-induced) apoptosis control known to play an important role. The UACA promotes apoptosis by regulating three pathways, apoptosome up-regulation, LGALS3/galectin-3 down-regulation, and NF-kappa-B inactivation. In addition, it modulates isoactin dynamics to control morphological changes required for cell growth and motility. In addition, UACA interacts with ARF6 to control cell morphology and motility after injury.

In particular, when the amnion-derived stem cells are amnion-derived mesenchymal stem cells, the exosomes may be further secreted due to the characteristics of the mesenchymal stem cells.

The exosome is a kind of endoplasmic reticulum and contains various kinds of substances such as proteins, lipids, and nucleic acids therein, and thus plays an important role in information transfer between cells.

Therefore, the amnion-derived mesenchymal stem cell-conditioned medium may further contain exosomes as well as growth factors, extracellular matrix components, antioxidants, and metabolites secreted by the amnion-derived mesenchymal stem cells.

In addition, it may further include various growth factors, proteins, lipids, nucleic acids, etc. secreted by the exosomes or the exosomes.

The amnion-derived stem cell-conditioned medium may be obtained from stem cells derived from the amniotic membrane of mammals including humans.

For example, the mammal may be a dog, horse, cow, rabbit, raccoon, fox, deer, sheep, donkey, pig, chimpanzee, monkey, etc., but is not limited thereto.

In one embodiment, the amnion-derived stem cell-conditioned medium of the present application may be a canine amnion-derived stem cell-conditioned medium.

For example, canine amnion-derived stem cell-conditioned medium may include apolipoprotein, fibronectin, thioredoxin, and albumin.

For another example, canine amnion-derived stem cell-conditioned medium contains metalloproteinase inhibitor 1 (TIMP1), actin (Actin, cytoplasmic 1, ACTB), coiled-coil domains and ankyrin repeats. Uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA) may be included.

For another example, canine amnion-derived stem cell-conditioned medium is keratin 10 (Keratin, type I cytoskeletal 10, Keratin10) Keratin 1 (Keratin, type II cytoskeletal 1, Keratin 1), vimentin (Vimentin), collagen type 3 alpha 1 chain (Collagen type III alpha 1 chain, COL3A1), Thioredoxin, Malate dehydrogenase, Triosephosphate isomerase (TPI1), YWHAZ, LOC477072 , Purine nucleoside phosphorylase (PNP), Collagen alpha-1(I) chain (COL1A1), Proteasome subunit beta (PSMB6), Keratin 78 (Keratin 78, KRT78), LOC475521, Keratin 72 (Keratin 72, KRT72), L-lactate dehydrogenase, Annexin A2 (Annexin A2, ANXA2), Dihydropyrimidinase like 3 (Dihydropyrimidinase) like 3, DPYSL3), and collagen type V alpha 1 chain (COL5A1).

For another example, canine amnion-derived stem cell-conditioned medium is keratin 10 (Keratin, type I cytoskeletal 10, Keratin10) Keratin 1 (Keratin, type II cytoskeletal 1, Keratin 1), vimentin, collagen Collagen type III alpha 1 chain (COL3A1), Thioredoxin, Malate dehydrogenase, Triosephosphate isomerase (TPI1), YWHAZ, LOC477072, Purine nucleoside phosphorylase (PNP), Collagen alpha-1(I) chain (COL1A1), Proteasome subunit beta (PSMB6), Keratin 78 (Keratin 78, KRT78), LOC475521, Keratin 72 (Keratin 72, KRT72), L-lactate dehydrogenase, Annexin A2 (Annexin A2, ANXA2), dihydropyrimidinase like 3 ( Dihydropyrimidinase like 3, DPYSL3), Collagen type V alpha 1 chain (COL5A1), apolipoprotein, fibronectin, albumin, may contain thioredoxin have.

For another example, the canine amnion-derived stem cell-conditioned medium is the canine amnion-derived stem cell-conditioned medium is keratin 10 (Keratin, type I cytoskeletal 10, Keratin10), keratin 1 (Keratin, type II cytoskeletal 1, Keratin 1), Vimentin, Collagen type III alpha 1 chain (COL3A1), Thioredoxin, Malate dehydrogenase, Triosephosphate isomerase, TPI1), IWHAZ, LOC477072, purine nucleoside phosphorylase (PNP), collagen alpha-1 (I) chain (COL1A1), proteasome sub Proteasome subunit beta (PSMB6), Keratin 78 (Keratin 78, KRT78), LOC475521, Keratin 72 (Keratin 72, KRT72), L-lactate dehydrogenase, Annexin A2 (Annexin A2, ANXA2) ), dihydropyrimidinase like 3 (DPYSL3), collagen type V alpha 1 chain (COL5A1), apolipoprotein, fibronectin, albumin , thioredoxin, metalloproteinase inhibitor 1 (TIMP1), actin (Actin, cytoplasmic 1, ACTB), uveal autoantigen with coiled coiled domain and ankyrin repeat -coil domains and ankyri n repeats, UACA).

ASC-CM included in the composition for semen cryoprotection can improve various properties of sperm.

The various characteristics may be sperm motility, viability, cell membrane integrity, mitochondrial activity, and the like, but are not limited thereto.

The reason why the ASC-CM can improve the various characteristics of sperm may be because the ASC-CM contains various substances secreted by amnion-derived stem cells.

In an example of the present application, the results of protein analysis of canine amnion-derived mesenchymal stem cells-conditioned medium are shown in [Table 2].

Through Table 2 of Examples 1-3, apo E lipoprotein (Apolipoprotein E), apolipoprotein A1 (Apolipoprotein AI), fibronectin, thioredoxin ( thioredoxin), serum albumin, metalloproteinase inhibitor 1 (TIMP1), actin (actin, cytoplasmic 1, ACTB), uveal autoantigen with coiled coil domain and ankyrin repeat It can be seen that with coiled-coil domains and ankyrin repeats, UACA) are included.

Through this, apolipoprotein E, apolipoprotein involved in sperm motility, viability, membrane integrity, etc., in the canine amnion-derived stem cell-conditioned medium contained in the composition for cryoprotection of canine semen of the present application A1 (Apolipoprotein AI), fibronectin, thioredoxin, serum albumin, metalloproteinase inhibitor 1 (TIMP1), actin (Actin, cytoplasmic 1, ACTB), nasal By including the uveal autoantigen with coiled-coil domains and ankyrin repeats, UACA, etc. having a yield coil domain and ankyrin repeats,

It can be seen that freezing of canine semen can affect sperm motility, viability, membrane integrity, and mitochondrial activity.

cryoprotectant

The cryoprotectant is a material capable of protecting cells while maintaining their intrinsic shape and characteristics, and is used during cryoprotection.

The principle of cryopreservation is to gradually remove internal moisture using the osmotic principle of a cryoprotectant while maintaining the cell's unique shape and characteristics, thereby minimizing ice crystals to protect cells.

The cryoprotectant may include a diluent solution (undiluted stock solution), an antioxidant, and the like, but is not limited thereto.

The diluent means a substance capable of diluting the crude solution.

The diluent is a buffer containing egg yolk, glycerol, glucose, fructose, sucrose, dextran, citric acid, acetic acid, butyric acid, palmitic acid, oxalic acid, tartaric acid, streptomycin, penicillin, ampicillin, kanamycin, distilled water, etc. may be, but is not limited thereto. In addition, each of these components can be used in combination by those skilled in the art as needed.

The antioxidant refers to a substance capable of adsorbing and removing reactive oxygen species (ROS) generated in cells. In order to cryopreserve sperm, when working outside the body, they are exposed to a higher concentration of oxygen than in the body, so an excess of active oxygen is generated, and the generated active oxygen induces oxidative stress, suppressing mitochondrial respiration and reducing cell membranes. It is known to exhibit side effects such as reduced fluidity, inactivation of various enzymes, and damage to DNA and RNA.

The antioxidant is beta-mercaptoethanol (β-mercaptoethanol, β-ME), glutathione (Glutathione, GSH), ascorbic acid (ascorbic acid), vitamin E, beta-carotene, lycopene, coenzyme Q-10 (coenzyme Q-10) ), selenium, chromium, magnesium taurine, hypotaurine, trehalose, etc., but is not limited thereto.

For example, the cryoprotectant is distilled water, tris (hydroxymethyl) aminomethane, citric acid, fructose, kanamycin sulfate, It may include egg yolk and glycerol.

In one embodiment, the cryoprotectant is 54% Tris-extender 1:1 (v / v) - distilled water, tris (hydroxymethyl) aminomethane (tris (hydroxymethyl) aminomethane) 24 g / L, citric acid 14 g/L, fructose 8 g/L, kanamycin sulfate 0.15 g/L; pH 6.6, 290 mOsm - 40% (v/v) egg yolk, 6% (v/v) glycerol may be further included.

In one embodiment, the composition for freezing semen of the present application,

at least one cryoprotectant; and

Amniotic membrane derived Stem Cell-conditioned media (ASC-CM), including apolipoprotein, fibronectin, thioredoxin, and albumin;

including,

The ASC-CM is a culture medium in which amnion-derived stem cells are cultured,

In this case, the ASC-CM may be a composition characterized in that it does not contain amnion-derived stem cells.

The composition for cryoprotection of semen of the present application may include, in one embodiment, apolipoprotein, fibronectin, thioredoxin, albumin, egg yolk, and glycerol. have.

At this time, the composition for semen cryoprotection is in another embodiment, keratin 10 (Keratin, type I cytoskeletal 10, Keratin10) Keratin 1 (Keratin, type II cytoskeletal 1, Keratin 1), vimentin (Vimentin), collagen type 3 alpha 1 Collagen type III alpha 1 chain (COL3A1), thioredoxin, malate dehydrogenase, triosephosphate isomerase (TPI1), YWHAZ, LOC477072, purine nuclease Purine nucleoside phosphorylase (PNP), Collagen alpha-1(I) chain (COL1A1), Proteasome subunit beta (PSMB6), Keratin 78 (Keratin 78) , KRT78), LOC475521, Keratin 72 (Keratin 72, KRT72), L-lactate dehydrogenase, Annexin A2 (Annexin A2, ANXA2), Dihydropyrimidinase like 3 (Dihydropyrimidinase like 3, DPYSL3), and may further include a collagen type V alpha 1 chain (COL5A1).

In addition, the composition for semen cryoprotection is in another embodiment, distilled water, tris (hydroxymethyl) aminomethane (tris (hydroxymethyl) aminomethane), citric acid (citric acid), fructose (fructose), kanamycin sulfate (kanamycin sulfate), egg yolk, and glycerol may be further included.

The composition for cryoprotection of semen minimizes damage to sperm due to osmotic pressure difference, low temperature stress, etc. in semen freezing, and/or motility, viability, cell membrane integrity, and fertilization compared to fresh sperm during freezing-thawing of semen. Amnion-derived stem cell-conditioned medium and/or cryoprotectant may be included in an appropriate concentration, ratio, etc. so that the ability does not decrease.

The composition, concentration, and ratio of the composition for semen cryoprotection during semen freezing may play an important role in maintaining sperm characteristics (eg, motility, viability, etc.).

For example, the amnion-derived stem cell-conditioned medium (ASC-CM) is 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% of the final weight of the composition for semen cryoprotection. %, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% , 100% may be included, but is not limited thereto.

In one embodiment, the ASC-CM of the present application may be included in 5%, 10%, 15%, 25%, 50%, 75%, or 100% of the final weight of the composition for semen cryoprotection.

In a specific embodiment, the ASC-CM of the present application may be included in 5% to 15% based on the final weight of the composition for semen cryoprotection.

In a more specific embodiment, the ASC-CM of the present application may be included in 10% of the final weight of the composition for semen cryoprotection.

For another example, the amnion-derived stem cell-conditioned medium and cryoprotectant are 5:95, 10:90, 15:75, 20:80, 25:75, 30:70, 35:65, 40:60, 45 It may be included in a ratio of :55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5, but this do not limit

In one embodiment, the results of confirming how much weight of canine ASC-CM can be included in the composition for semen cryoprotection to improve the properties of sperm is described in Example 2.

Through Example 2, compared to the composition for semen cryoprotection comprising ASC-CM of high concentration (25%, 50%, 75%, 100%), low concentration (5%, 10%, 15%) of ASC-CM It can be seen that sperm motility and viability are improved in the composition for cryopreservation of semen, including the composition.

In particular, it can be seen that the semen cryoprotection composition containing 10% ASC-CM among the low concentration group is most effective for sperm motility and viability.

In addition, sperms thawed (or frozen) of canine semen using the composition containing 10% ASC-CM have higher motility, viability, and cell membrane integrity than sperms thawed after freezing the semen. It can be seen from Example 3 that the effect of improving mitochondrial activity and the like can occur.

The improvement effect is that the amnion-derived stem cell-conditioned medium in the composition contains a substance secreted by the amnion-derived stem cells to affect sperm motility, viability, cell membrane integrity, mitochondrial activity, etc. It may be that melting does not reduce the various properties of the sperm.

Therefore, in Examples 2 and 3 of the present application, when 10% of the amnion-derived stem cell-conditioned medium was included with respect to the final weight of the composition, the motility and survival of frozen-thawed or refrigerated canine sperm as a canine sperm cryoprotectant It can be seen that the performance and cell membrane integrity are improved.

Specifically, among various proteins in the amnion-derived stem cell-conditioned medium described above, apolipoprotein, fibronectin, thioredoxin, which are involved in sperm motility, fertility, acrosome integrity, and membrane integrity, etc. ), albumin, etc. may be improved by affecting sperm motility, viability, cell membrane integrity, and mitochondrial activity.

The semen cryopreservation composition may be provided as a kit for semen freezing further comprising a cryoprotection container.

The cryoprotection container may be a cryoprotection tube, a vial, or the like, but is not limited thereto.

The composition for semen cryoprotection may be used in a semen freezing method.

The semen freezing method may include the step of freezing the semen with the composition for cryoprotection of the semen.

The semen may be obtained by a penile hydraulic method, a resin friction method, etc., but is not limited thereto.

The freezing may be performed by using liquid nitrogen, but is not limited thereto.

3. Method for preparing a composition for semen cryoprotection

Another aspect of the present application relates to a method for preparing a composition for cryoprotection of semen comprising the amnion-derived stem cell-conditioned medium and a cryoprotectant.

The method of preparing the composition for semen cryoprotection,

culturing amnion-derived stem cells;

obtaining an amnion-derived stem cell-conditioned medium from the culture solution of the cultured amnion-derived stem cells; and

mixing the amnion-derived stem cell-conditioned medium and a cryoprotectant;

includes

culturing the amnion-derived stem cells; and

obtaining an amnion-derived stem cell-conditioned medium from the culture solution of the cultured amnion-derived stem cells;

The description is the same as described above (see 1. Amnion-derived stem cell-conditioning medium preparation method).

The step of mixing the amnion-derived stem cell-conditioned medium (ASC-CM) and a cryoprotectant is to minimize damage to sperm due to toxicity, etc., when using only the cryoprotectant during semen cryoprotection, and furthermore, After freeze-thaw, it is a process of mixing properly to prevent a decrease in sperm motility, viability, and cell membrane integrity compared to fresh sperm.

In the mixing, the order of mixing the cryoprotectant and the ASC-CM is not limited.

In addition, in the mixing step; a material that helps the cryoprotectant and the ASC-CM to be well mixed, or a material capable of improving various characteristics of sperm may be further included.

The mixing step; may be mixed using a device that helps the cryoprotectant and the ASC-CM to be mixed well.

When mixing, the cryoprotectant and/or the ASC-CM may be mixed in a specific ratio, concentration, and the like.

Descriptions of the specific ratio, concentration, etc. are the same as described above (see 2. Composition for semen cryoprotection).

For example, the amnion-derived stem cell-conditioned medium may be included in an amount of 5% to 15% based on the final weight of the composition.

Compared to the prior art using only a cryoprotectant, the composition for freezing semen provided in the present application is for freezing semen in which i) a cryoprotectant and an amnion-derived stem cell-conditioned medium containing a material secreted by amnion-derived stem cells are mixed. As a composition, it has relatively little toxicity, and ii) is different from the prior art in that sperm motility, viability, cell membrane integrity, and mitochondrial activity are improved upon freezing-thawing of sperm.

[Mode for Implementation of the Invention]

Hereinafter, the invention provided by the present specification will be described in more detail through experimental examples and examples. These examples are only for illustrating the content disclosed by the present specification, and it is to those of ordinary skill in the art that the scope of the content disclosed by the present specification is not to be construed as being limited by these examples. it will be self-evident

Unless otherwise specified, all chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA).

experimental design

Experiment 1: Characterization of cAMSCs

Through flow cytometry and confirmation of pluripotent gene expression, cAMSCs were characterized.

Experiment 2: Evaluation of sperm motility parameters and viability according to the concentration change of cAMSC-CM

CM was prepared from cAMSC analyzed in Experiment 1, and the optimal concentration of cAMSC-CM was searched by evaluating sperm motility parameters and viability according to the concentration change.

Experiment 3: Evaluation of dog semen cryopreservation effect using optimal concentration of cAMSC-CM

Using the optimal concentration of cAMSC-CM analyzed in Experiment 2, the effect of cryopreservation of dog semen was confirmed.

Experimental materials and methods

cell culture

Canine amnion-derived mesenchymal stem cells (cAMSC) and their culture medium were purchased from Naturecell Co., Ltd., Seoul, Korea. Briefly, cAMSCs were tissue cultured using RCMEP medium containing serum and antibiotics (Stem Cell Research Center, Biostar, Seoul, Korea). Cells were cultured at 37°C in an environment with 5% CO2. Cells used for characterization of cAMSCs were cultured at 90% confluency until passage 2, and cells used to make canine amnion-derived mesenchymal stem cell-conditioned medium (cAMSC-CM) were cultured until passage 3.

Thaw frozen canine amnion-derived mesenchymal stem cells

로 유지되는 항온수조에서 녹인 후 15 ml 튜브에서 RPMI 배지(양막줄기세포 조정 배지; ㈜네이처셀) 9 ml과 혼합하였다. 튜브를 원심분리기에 넣고 1000 rpm에서 3 분간 원심분리하였다.Canine amnion-derived mesenchymal stem cells were taken out of liquid nitrogen tank and

After dissolving in a constant temperature water bath maintained as a 15 ml tube was mixed with 9 ml of RPMI medium (amnion stem cell conditioned medium; Nature Cell Co., Ltd.). The tube was placed in a centrifuge and centrifuged at 1000 rpm for 3 minutes.

The supernatant of the centrifuged tube was discarded, 5 ml of RPMI medium was added, and mixed with a micropipette. The tube was placed in a centrifuge and centrifuged at 1500 rpm for 2 minutes. The supernatant of the centrifuged tube was discarded, and RPMI medium was added and mixed.

All chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise specified.

Canine Amnion-derived Mesenchymal Stem Cell Culture

₂ 배양기에서 배양하였다. 배지교환은 약 24시간 간격으로 이루어졌다. 배지교환을 위하여 PBS(phosphate buffered saline; Gibco) 용액으로 dish를 세척하였고, 다시 RPMI 배지를 넣어주었다.Amnion stem cells were adhered and cultured on a culture dish, 39

₂ was cultured in an incubator. Medium exchange was performed at about 24 hour intervals. For medium exchange, the dish was washed with PBS (phosphate buffered saline; Gibco) solution, and RPMI medium was added thereto.

Canine Amnion-derived Mesenchymal Stem Cell Subculture

배양기에 넣었다. 배양기에서 꺼낸 후 현미경으로 세포가 dish에서 떨어졌는지를 확인하였다. dish에 trypsin과 동량의 RPMI 배지를 넣어주었다. dish 내용물을 모두 튜브로 옮기고 1500 rpm으로 2 분간 원심분리 하였다. 상층액을 제거하고 RPMI 배지를 넣어 펠렛을 풀어준 뒤 1500 rpm으로 2 분간 원심분리 하였다. 상층액을 제거하고 RPMI 배지를 넣어 펠렛을 풀어준 뒤 dish에 적정량의 혼합물을 옮긴 뒤 배양기에서 배양하였다.In order to subculture the cultured dog amniotic stem cells, the culture dish was taken out of the incubator and the supernatant was removed. The dish was washed with PBS (phosphate buffered saline; Gibco) solution. Put trypsin (Gibco) in the dish and cook for 2 minutes and 30 seconds 37

placed in an incubator. After taking out from the incubator, it was checked whether the cells had fallen from the dish under a microscope. The same amount of trypsin and RPMI medium was added to the dish. All the contents of the dish were transferred to a tube and centrifuged at 1500 rpm for 2 minutes. The supernatant was removed, and RPMI medium was added to release the pellet, followed by centrifugation at 1500 rpm for 2 minutes. After removing the supernatant and adding RPMI medium to release the pellet, an appropriate amount of the mixture was transferred to a dish and cultured in an incubator.

Flow Cytometric Analysis

To determine the immunophenotype of cAMSCs, Fluorescence-activated cell sorting (FACS) was used.

Cells were washed twice with phosphate-containing buffer (PBS; Thermo Fisher Scientific, Waltham, MA, USA). Thereafter, the adherent cells were detached using TrypLE-Express (Gibco, Grand Island, NY, USA). Cells were washed twice with PBS (Thermo Fisher Scientific), cell counting ^{, and divided into 96-well plates (1Х10 5} cells/100 μL per well).

5 μL of fluorochrome-conjugated antibody or isotype control antibody with fluorescein isothiocyanate (FITC) or phycoerythrin (PE) in each well

-CD29 monoclonal antibody-PE (Invitrogen, CA, Carlsbad, USA), CD44 monoclonal antibody -FITC, CD90 (Thy-1) monoclonal antibody-PE, CD34 monoclonal antibody-PE, CD45 monoclonal antibody Raw antibody-FITC, Rat IgG2a kappa Isotype Control-FITC, Rat IgG2b kappa Isotype Control-PE, Mouse IgG1 kappa Isotype Control-PE, Rat IgG2b kappa Isotype Control-FITC (eBioscience, CA, San Diego, USA)-

was added to the cell suspension in aliquots.

After incubation at 4° C. for 30 minutes, the cells were centrifuged (1500 rpm / 3 minutes) and washed twice with PBS. Cells were transferred to round tubes with 5 mL of PBS and analyzed using FACSCalibur®. Cluster of Dierentiation (CD) marker percentages were calculated using Cell Quest software (BD Biosciences, CA, San Jose, USA). 10,000 cells were used for each antibody.

Quantitative Polymerase Chain Reaction (qPCR)

Pluripoten gene expression was confirmed by quantitative polymerase chain reaction (qPCR).

Briefly, RNA was extracted at passage 2 of cAMSCs using the RNeasy Mini kit (Qiagen, Hilden, Germany).

Then, cDNA was synthesized by reverse transcription of RNA using DiaStar 2X RT Pre-Mix (Solgent, Daejeon, Korea) and Random Hexamers (Invitrogen, Carlsbad, CA, USA).

The synthesized cDNA was amplified by PCR and real-time PCR was performed using Agilent ariaMX Real-Time PCR (Agilent, Santa Clara, CA, USA).

The primers used for qPCR are as follows (Table 1).

Gene Primer Sequence
(5'-3') Product size(bp) Temperature
(℃) NCBI Accession
No. β-ACT Forward GCTACGTCGCCCTGGACTTC
(SEQ ID No. 1) 86 60 AF021873.2 Reverse GCCCGTCGGGTAGTTCGTAG
(SEQ ID No. 2) Oct3/4 Forward CGAGTGAGAGGCAACCTGGAGA
(SEQ ID No. 3) 114 60 XM_538830 Reverse CCACACTCGGACCACATCCTTC
(SEQ ID No. 4) Sox2 Forward CAGACCTACATGAACGGCTCGC
(SEQ ID No. 5) 147 60 XM_005639752 Reverse CCTGGAGTGGGAGGAGGAGGTA
(SEQ ID No. 6) Nanog Forward GAATAACCCGAATTGGAGCA
(SEQ ID No. 7) 125 60 XM_022411387 Reverse AGTTGTGGAGCGGATTGTTC
(SEQ ID No. 8)

β-ACT was used as an endogenous control. For gel electrophoresis, 10 μL of each real-time PCR product was put into the well and subjected to 1% agarose gel electrophoresis for 20 minutes.

Conditioned Medium Preparation

cAMSCs were maintained in culture medium until reaching 80% confluency at passage 3. Cell starvation was made by replacing the culture medium with serum-free Dulbecco's Modified Eagle Medium.

After 48 hours, the CM was recovered and the recovered supernatant was centrifuged (2000 g / 30 min) to remove debris in the conditioned medium, such as dead cells, and filtered through a 0.22 m filter. The obtained CM was divided and stored at -80°C. It was used after thawing in a constant temperature water bath at 37°C immediately before use.

Animal Use for Semen Collection

All dogs used in the study were housed in individual cages. Dogs were fed commercial adult dry food and provided ad libitum water.

All experiments and studies were performed in accordance with the recommendations of the "Guide to the Care and Use of Laboratory Animals" (approval numbers: SNU-180731-2-1 and SNU-200409-3) published by the Institutional Animal Care Committee (IACUC) of Seoul National University. . Semen was obtained from beagle dogs using digital manipulation twice a week, and only the second part of ejaculation was collected and used.

Only those with a motility of 80% or more and a mass mobility of at least 4/5 (on a 0-5 scale) were selected, and samples were obtained at the ^{appropriate concentration (>300 Х 10 6 sperm/mL).}

One ejaculation per male was obtained from 5 males, and 4 independent replicates were performed with pooled semen.

Semen Cryopreservation

The collected semen was diluted with Tris-extender, washed and centrifuged.

First, collected semen was diluted with Tris-extender 1:1 (v/v)-distilled water, tris(hydroxymethyl)aminomethane 24 g/L, citric acid 14 g/L, fructose 8 g/L, and kanamycin sulfate 0.15 g/L. ; Centrifugation was performed at pH 6.6, 290 mOsm-700g for 1 min.

Tris-extender 1:1 (v/v) the collected semen

— distilled water, tris (hydroxymethyl) aminomethane 24 g/L, citric acid 14 g/L, fructose 8 g/L, kanamycin sulfate 0.15 g/L; pH 6.6, 290 mOsm—

, and centrifuged (700Х g, 1 min). The supernatant was collected and centrifuged (500 g / 5 min), and only the pellet was resuspended in Tris-extender to a ^{concentration of 200 Х 10 6} sperm cells/mL.

Various concentrations of CM (0 %, 5 %, 10 % and 15 %) and freezing buffer were mixed - composition of freezing buffer: 54% (v/v) Tris-extender, 40% (v/v) egg yolk and 6% (v/v) glycerol -.

The samples were then chilled at 4° C. for 4-6 hours.

Samples were placed in 0.5 μL straws (Minitube, Tiefenbach, Germany) and stored at 4° C. for 1 hour for equilibration. Then, after freezing for 15 minutes at 5 cm of liquid nitrogen (LN2), it was transferred to the LN2 tank.

Semen Thawing

Straws were removed from liquid nitrogen. As soon as possible, it was placed in a 37°C water bath for 30 seconds. The end of the straw was cut off and the contents were placed in a tube. 2.5 ml of buffer 1 was added little by little and shaken for 30 seconds. Sperm analysis was performed when all 2.5 ml of Buffer 1 was added.

Proteomic Analysis of CM Composition

To identify and quantify the protein composition of cAMSC-CM, a Q Exactive Plus mass spectrometer (Thermo Scientific, Waltham, MA, USA) was used.

Briefly, cAMSC-CM was obtained and protein purification was performed using ammonium sulfate (AS) saturated with 80%. For precipitation, CM was centrifuged (18,000 rpm / 1 hour), dissolved using 20 mM tris-HCl pH 8.0, and AS was removed using Viva spin (50 kD). After in-gel digestion with trypsin, the protein lysate was separated using 12 % sodium dodecyl-sulfate polyacrylamide gel electrophoresis (12 % SDS-PAGE).

MASCOT software (Matrix Science Inc., MA, Boston, USA) was used to identify proteins and generate exponentially modified proteins. Mole % was calculated according to abundance index (emPAI) and emPAI values.

The obtained data were analyzed using UniProtKB (UniProt Knowledgebase) database (Canis_lupus). The identified proteins were grouped according to function, and percentages were calculated for each protein group present in cAMSC-CM.

Sperm Kinetic Parameters Analysis

Sperm motility, curvilinear velocity (VCL), straight-line velocity (VSL), mean path using a sperm analysis imaging system (FSA2011 premium edition version 2011; Medical Supply, Gangwon, Korea) Average path velocity (VAP), linearity (LIN), straightness (or VSL/VAP) (STR), amplitude of lateral head (ALH), and survival parameters were assessed. .

Sperm motility parameters were analyzed using a computer-assisted sperm analyzer (CASA; Sperm Class Analyzer® System version 6.4.0.93, Microptic, Barcelona, Spain). The system includes a Nikon Eclipse ci-L microscope (Nikon, Tokyo, Japan) with a 10x phase contrast objective and a heating stage at 37°C.

For analysis, Leja 20 μm chamber slides (Leja, Gynotec Malden, Nieuw Vennep, The Netherlands) were used and the frame rate was set to 25 frames/s. Various parameters such as sperm motility, progressive motility, VCL, VSL, VAP, LIN, STR, ALH, and the proportion of rapid and immobile sperm were analyzed.

Eosin-Nigrosin Staining

Eosin-nigrosine staining was used to detect the proportion of live sperm cells and tail morphology defects in each group.

Briefly, freeze-thawed samples were washed and smeared on a warm glass slide by mixing equal amounts of eosin and nigrosine in 10 μL of sperm pellet. The slides were then air dried to analyze sperm.

For each stained smear, 200 sperm were examined under an optical microscope (Eclipse Ts 2, Nikon, Tokyo, Japan) using an oil immersion objective (1000 magnification). Unstained sperm were counted as live, and stained sperm were counted as dead cells. Results were expressed as a percentage of live sperm cells. Sperms with a twisted tail were counted as cells with a twisted tail, and sperm with a twisted tail or the middle part were counted as cells with a curved tail.

Aniline Blue Staining

Wash the freeze-thawed sample, spread 20 μL of sperm pellet on a glass slide, air-dry, and 3% glutaraldehyde in 0.2 M phosphate buffer (pH 7.2). The solution was fixed for 30 minutes.

Then, the slides were stained with a solution of 4% acetic acid (pH 3.5) and 5% aniline blue aqueous solution for 5 minutes.

200 sperm cells from each group were evaluated with an oil immersion objective (1000 magnification) of an optical microscope (Eclipse Ts 2, Nikon, Tokyo, Japan).

Cells with unstained nuclei were considered as mature chromatin, and cells with blue-stained nuclei were considered as immature chromatin.

The results were expressed as a percentage of aniline blue positive sperm (abnormal).

Hypo-Osmotic Swelling Test

A hypo-osmotic swelling test (HOST) was performed to evaluate the proportion of sperm cells with intact plasma membrane.

Briefly, 100 μL of sperm was added to 900 μL of hypotonic solution (150-155 mOsm) and incubated at 37° C. for 30 minutes.

A drop of HOST solution with sperm was then placed on a warm slide, covered, and a minimum of 100 sperm was counted using a phase contrast microscope (Eclipse Ts 2, Nikon, Tokyo, Japan). Twisted-tailed cells were counted as HOST-positive sperm.

Acrosome Assessment Test

The sperm acrosome membrane was analyzed using fluorescein isothiocyanate-conjugated peanut (FITC-PNA).

Briefly, semen was embedded on glass slides, air dried, fixed with methanol, stained, and mounted with an anti-fade mounting medium (VECTASHIELD®, Vector Laboratories, Burlingame, CA, USA).

The integrity of sperm acrosome membranes was analyzed using epifluorescence phase-contrast microscopy (Eclipse Ts 2, Nikon, Tokyo, Japan) and analyzed with strong green fluorescence or partial or no fluorescence. classified.

Mitochondria Activity Assessment

The proportion of viable sperm cells with functional mitochondria was assessed using fluorescent staining Rhodamine 123 (Molecular Probes, OR, Eugene, USA) and propidium iodide (PI).

Briefly, 200 sperms were examined under an epifluorescence phase-contrast microscope (Eclipse) equipped with a 490/515 nm excitation/barrier filter for R123 (blue excitation) and a 545/590 nm excitation/barrier filter for PI (green excitation). Ts 2, Nikon, Tokyo, Japan) evaluated at 600x magnification.

Sperm cells with green fluorescence in the middle region and no red fluorescence in the head were considered viable in functional mitochondria, whereas cells exhibiting red fluorescence in the head were considered dead.

Statistical Analysis

Prior to analysis, D'Agostino and Pearson omnibus tests were performed. Optimal concentration data were analyzed by one-way analysis of variance according to Tukey's multiple test.

Each experiment was repeated 4 times, and statistical analysis was performed using GraphPad Prism 5.0 (GraphPad, CA, San Diego, USA). Values were expressed as mean±standard deviation (SEM), and values less than p <0.05 were considered statistically significant.

Example 1: cAMSC and cAMSC-CM Characterization

Example 1-1: Confirmation of the Surface Markers

Flow cytometry analysis of cAMSC showed high expression of CD29, CD44 and CD90 markers (93.73%, 94.28% and 90.10%, respectively) and low expression of CD34 and CD45 markers (0.39% and 0.35%, respectively) (Figure 4).

Therefore, it can be seen that cAMSC cells are mesenchymal stem cells (MSCs) based on the expression of these surface markers.

Example 1-2: Confirmation of Pluripotency Genes Expression

qPCR analysis was performed to analyze the expression of pluripotency genes in cAMSCs.

As a result of qPCR, it was confirmed that the pluripotent genes Oct3/4, Sox2 and Nanog were expressed in cAMSC ( FIG. 5 ), indicating that cAMSC exhibits pluripotency.

Example 1-3: cAMSC-CM Proteome (cAMSC-CM Proteome)

Proteomic analysis showed the presence and expression levels of 86 proteins (Table 2), which were classified into categories/functions and displayed as molar percentages in Table 3.

In particular, 19 proteins - Keratin, type I cytoskeletal 10, Keratin, type II cytoskeletal 1, Vimentin, Collagen type III alpha 1 chain, Thioredoxin, Malate dehydrogenase, Triosephosphate isomerase, YWHAZ, LOC477072, Purine nucleoside phosphorylase, Collagen alpha-1 ( I) chain, Proteasome subunit beta, Keratin 78, LOC475521, Keratin 72, L-lactate dehydrogenase, Annexin A2, Dihydropyrimidinase like 3, Collagen type V alpha 1 chain - not only in tubal cell-conditioned medium exosomes but also in amnion-derived stem cells It was confirmed that the protein was expressed (Table 3)

cAMSC-CM contains 26% Intermediate filaments, 21% other types of proteins involved in cell metabolism, 18% Growth factors, and Extra-cellular matrix components) 15%, antioxidants 13%, and enzymes 7% (Table 4)

Protein name Gene expression Category / Function Secreted protein acidic and cysteine rich/Osteonectin SPARC 6.696 Extracellular matrix component, growth factor, anti-apoptosis
●One of the major non-structural proteins of the extracellular matrix (ECM).
●Combines with calcium. Serum albumin ALB 5.292 Main proteins of plasma
●Good binding to water, Ca2 +, Na +, K +, fatty acids, hormones, bilirubin and drugs.
● Bovine serum albumin (BSA) is commonly used in sperm to improve motility parameters and antioxidant activity. Keratin, type I cytoskeletal 10 KRT10 4.536 Intermediate filament
Member of the type I (acidic) cytokeratin family, belonging to the superfamily of intermediate filament (IF) proteins Lumican LUM 4.212 Extra-cellular matrix component, cell proliferation
●Distributed in most mesenchymal tissues throughout the body.
●Collagen fibrillar tissue, corneal transparency, and involved in epithelial cells and tissue repair. Keratin, type II cytoskeletal 1 KRT1 3.996 Intermediate filament
Interstitial filaments of the intracellular cytoskeleton (IF)
Binding to integrin beta-1 (ITB1) and activated protein kinase C receptors (RACK1/GNB2L1) to regulate the activity of kinases such as PKC and SRC. Metalloproteinase inhibitor 1 TIMP1 3.834 Growth factor, glycoprotein, steroidogenesis stimulation, - May have an anti-apoptotic function.
Can promote cell proliferation in various cell types
Anti-cell death function Insulin-like growth factor binding protein 7 IGFBP7 3.780 growth factor
Regulates the availability of insulin-like growth factor (IGF) in tissues and modulates IGF binding to receptors Apolipoprotein E APOE 3.618 Apolipoprotein, cholesterol metabolism, anti-oxidant
Proteins that bind to lipid particles
Long-term lipoprotein-mediated lipid transport function mainly through plasma Keratin 14 KRT14 3.402 Intermediate filament
Belongs to the type I keratin family of intermediate filament proteins Actin, cytoplasmic 1 ACTB 3.078 Cell metabolism
Produces filaments that polymerize to form a cross-linked network in the cytoplasm of cells
●Main function in cell motility and contraction.
Regulate gene transcription and motility and repair damaged DNA Vimentin VIM 2.808 Intermediate filament
Found in various epithelial cells, especially mesenchymal cells.
●Attached laterally or terminally to the nucleus, endoplasmic reticulum and mitochondria. Keratin 75 KRT75 2.484 Intermediate filament
Formation of medium-sized filaments in the cytoplasm of epithelial cells Follistatin like 1 FSTL1 2.268 Extra-cellular matrix component
Can modulate the action of some growth factors on cell proliferation and differentiation
Binds to heparin Uncharacterized protein KRT5 Intermediate filament Collagen type III alpha 1 chain COL3A1 2.214 Extra-cellular matrix component
Involved in regulating cortical development
Binding to ADGRG1 and the main ligand of ADGRG1 in the developing brain
Binding of ADGRG1 to GNA13 and possibly GNA12, inhibiting neuronal migration and activating the RhoA pathway. Uncharacterized protein KRT6A 1.998 Intermediate filament
Epidermal specific type I keratin involved in wound healing
Involved in follicular keratinocyte activation after injury Thioredoxin TXN 1.620 Anti-oxidant
It reversibly oxidizes the active center dithiol to disulfide to participate in various redox reactions and catalyze the dithiol-disulfide exchange reaction.
Role of reversible S-nitrosylation of cysteine residues in target proteins
Contributes to intracellular nitric oxide reaction
Nitrosylation of the active site Cys of CASP3 in response to nitric oxide (NO)
Inhibition of caspase-3 activity
Inducing FOS/JUN AP-1 DNA binding activity and stimulating AP-1 transcriptional activity in ionizing radiation (IR) cells through oxidation/reduction states. Uncharacterized protein KRT42 1.566 Intermediate filament
●Belongs to the intermediate filament family. Malate dehydrogenase MDH1 1.512 Enzyme
Participate in the Krebs cycle
●Catalyzes the reversible transformation of malate to oxaloacetate. Alpha 2-HS glycoprotein AHSG 1.458 growth factor
Promote endocytosis
Possesses opsonic properties
Affinity for calcium and barium ions GC, vitamin D binding protein GC 1.404 Cell metabolism
Involved in vitamin D transport and storage
Extracellular G-actin clearance
●Enhancement of the chemotactic activity of C5 alpha on neutrophils in inflammation and macrophage activation. Plasminogen activator, urokinase receptor PLAUR 1.404 Cell metabolism
urokinase plasminogen activator receptor Alpha-fetoprotein AFP 1.404 Cell metabolism
Binds to copper, nickel and fatty acids, bilirubin, and serum albumin Uncharacterized protein YWHAZ 1.350 Cell metabolism
Adapter proteins involved in broad-spectrum regulation of general and specialized signal pathways
Binds to multiple partners, typically by recognizing phosphoserine or phospholeonine motifs
Binding normally modulates the activity of the binding partner.
Inducing ARHGEF7 activity on RAC1, lamellar lipodia and membrane wrinkle formation. Apolipoprotein A-I APOA1 1.242 Apolipoprotein, sperm motility, cholesterol metabolism
Promotes cholesterol efflux from tissues and acts as a cofactor for lecithin cholesterol acyl transferase (LCAT), participating in the reverse transport of cholesterol from tissues to the liver for excretion
●Activation of sperm motility as part of the SPAP complex. Uncharacterized protein KRT4 Intermediate filament Keratin, type I cytoskeletal 9 KRT9 Intermediate filament Uncharacterized protein LOC477072 1.188 Cell metabolism
Belongs to the transferrin family Triosephosphate isomerase TPI1 1.188 Enzyme
Highly efficient metabolic enzymes
Catalyzes the interconversion between dihydroxyacetone phosphate (DHAP) and D-glyceraldehyde-3-phosphate (G3P) in glycolysis and gluconeogenesis.
Responsible for the production of methylglyoxal, a reactive cytotoxic byproduct that can modify and alter proteins, DNA and lipids. Purine nucleoside phosphorylase PNP 1.134 Enzyme
Catalyzes the phosphorylation of N-glycosidic bonds in beta-(deoxy)ribonucleoside molecules Hemoglobin subunit beta HBB 1.134 Cell metabolism
Involved in oxygen transport from the lungs to various peripheral tissues Fibronectin FN1 1.134 growth factor
Binding to cell surface with various compounds including collagen, fibrin, heparin, DNA and actin
Involved in cell adhesion, cell motility, opsonization, wound healing and maintenance of cell shape Collagen alpha-1(I) chain COL1A1 0.972 Extra-cellular matrix component
Acts as a cross-bridge between fibrin and other extracellular matrix molecules Keratin 24 KRT24 0.972 Intermediate filament
High expression in keratinocytes, placenta, colon and spleen
Expression at low levels in the thymus and testes ATP synthase subunit d, mitochondrial ATP5PD 0.972 Enzyme
Produces ATP from ADP in the presence of a proton gradient across the membrane produced by the electron transport complex of the respiratory chain Ferritin LOC102154317 0.918 Anti-oxidant
●Storing iron in a soluble, non-toxic, readily available form. Decor DCN 0.918 Anti-oxidant
●May affect the rate of fibrillar formation. Uncharacterized protein LGALS3BP 0.864 Extra-cellular matrix component
Promotes integrin-mediated cell adhesion
●May stimulate host defenses against viruses and tumor cells. Keratin, type II cytoskeletal 2 epidermal KRT2 0.864 Intermediate filament
●It plays a role in forming an epidermal barrier on the skin of the soles of the feet. SAP domain containing ribonucleoprotein SARNP 0.756 Cell metabolism
Binds single-stranded and double-stranded DNA with higher affinity for single-stranded conformations.
Specific binding to scaffold/matrix attachment site DNA
Single-stranded RNA binding
Enhanced RNA unwinding activity of DDX39A
Participate in important transcriptional or translational control of cell growth, metabolism and carcinogenesis. Dermatopontin DPT 0.756 Extra-cellular matrix component
●Mediate adhesion by cell surface integrin binding.
Serve as a communication link between dermal fibroblast cell surface and the extracellular matrix environment and enhance TGFB1 activity
Inhibition of cell proliferation
●Accelerates collagen fibrils formation and stabilizes collagen fibrils against low-temperature dissociation. Proteasome subunit beta PSMB6 0.702 Cell metabolism
A component of the 20S core proteasome complex involved in proteolysis of most intracellular proteins
Integral role in cells by binding to various regulatory particles
Combines with two 19S regulatory particles to form a 26S proteasome and participates in ATP-dependent degradation of ubiquitinated proteins Keratin 78 KRT78 0.648 Intermediate filament
●Two types of cytoskeletal and microfibrous keratin, I (acidic) and II (neutral to basic). Uncharacterized protein LOC475521 0.648 Cell metabolism
Named as Peptidase S1 domain-containing protein Keratin 72 KRT72 0.648 Intermediate filament
●Belongs to the intermediate filament family. Nicotinate-nucleotide pyrophosphorylase [carboxylating] QPRT 0.594 Enzyme
Involved in the catabolism of quinoline acid (QA) Growth arrest specific 2 GAS2 0.486 Cell metabolism
Can play a role in apoptosis by acting as a cell death substrate for caspase
The cleaved and cleaved morphology during apoptosis induces dramatic rearrangements of the actin cytoskeleton and powerful changes in the shape of the affected cells.
●Involved in the membrane ruffling process. Olfactory receptor OR6K6 0.486 Cell metabolism
● Olfactory receptors. Olfactory receptor LOC100687010 0.486 Cell metabolism Lysosomal protein transmembrane 4 beta LAPTM4B 0.486 Cell metabolism
Required for optimal lysosomal function. Blocks EGF-stimulated EGFR in vitro sorting and degradation.
Conversely, it binds with phosphatidylinositol 4,5-bisphosphate to regulate PIP5K1C interaction, inhibit HGS ubiquitination, and alleviate LAPTM4B inhibition of EGFR degradation.
It binds ceramides to control the apoptosis pathway and promotes exit from late endosomes. Fetuin B FETUB 0.486 growth factor
Protease inhibitors required for egg fertilization
Necessary to prevent zona pellucida hardening before fertilization by inhibiting the protease activity of ASTL, a protease that mediates cleavage of ZP2 and causes zona pellucida hardening. L-lactate dehydrogenase LDHA 0.432 Enzyme
Involved in step 1 of the sub-pathway synthesizing (S)-lactate from pyruvate. L-lactate dehydrogenase LDHB Enzyme Tropomyosin 1 TPM1 0.486 Cell metabolism Annexin A2 ANXA2 0.432 Cell metabolism
Calcium-regulated membrane-bound protein with greatly enhanced calcium affinity by anionic phospholipids
Combines two calcium ions with high affinity
● May be involved in coping with heat stress.
●PCSK9-enhanced Can inhibit LDLR degradation and reduce PCSK9 protein levels through translational mechanisms, but compete with LDLR for binding to PCSK9. Collagen alpha-2(I) chain COL1A2 0.432 Extra-cellular matrix component
●Member of group I collagen (fibrillar-forming collagen). Cellular communication network factor 2 CCN2 0.432 growth factor
Major connective tissue mitoattractant secreted by vascular endothelial cells
●Enhance fibroblast growth factor-induced DNA synthesis. Thrombospondin 1 THBS1 0.432 Extra-cellular matrix component
Adhesive glycoproteins mediating intercellular and intercellular interactions
Binding to heparin
Plays a role in the ER stress response through interaction with activating transcription factor 6 alpha (ATF6), which produces an adaptive ER stress response factor Biglycan BGN 0.432 Extra-cellular matrix component
●Involved in the assembly of collagen fibers. Serpin family A member 7 SERPINA7 Cell metabolism Serpin family F member 1 SERPINF1 0.378 Cell metabolism
Belongs to the serpin family Nerve growth factor receptor NGFR 0.378 Cell metabolism
●Mediate cell survival and apoptosis of nerve cells.
RHOA deactivation role
●Plays a role in regulating the translocation of GLUT4 to the cell surface in adipocytes and skeletal muscle cells in response to insulin. Mitogen-activated protein kinase associated protein 1 MAPKAP1 0.342 Cell metabolism
A subunit of mTORC2 that regulates cell growth and survival in response to hormonal signals
●MAPKAP1 inhibits MAP3K2 by preventing dimerization and autophosphorylation.
Suppression of HRAS and KRAS signals
Enhancement of osmotic stress-induced phosphorylation of ATF2 and ATF2-mediated transcription
●Involved in cilia formation and regulates cilia length through interaction with CCDC28B independently of the mTORC2 complex. Serpin family C member 1 SERPINC1 0.324 Cell metabolism Uncharacterized protein ZNF385C 0.324 Cell metabolism Collagen type V alpha 2 chain COL5A2 0.270 Extra-cellular matrix component
Components of small connective tissue of mostly ubiquitous distribution
Binds to DNA, heparan sulfate, thrombospondin, heparin and insulin
● Key determinants of tissue-specific matrix assembly. Dihydropyrimidinase like 3 DPYSL3 0.270 Enzyme
Required for signal transduction by class 3 semaphorins and subsequent cytoskeletal remodeling Fragile X mental retardation 1 FMR1 0.270 Cell metabolism
Involved in the control of DNA damage response (DDR) mechanisms through regulation of ATR-dependent signaling pathways such as histone H2AFX/H2A.x and BRCA1 phosphorylation. TBK1 binding protein 1 TBKBP1 0.270 Enzyme
●Adapter protein that constitutively binds TBK1 and IKBKE, which play a role in antiviral innate immunity. Protein phosphatase 1 regulatory subunit PPP1R12C 0.216 Enzyme
● Regulates myosin phosphatase activity. Uncharacterized protein A2M 0.216 Anti-oxidant Potassium calcium-activated channel subfamily N member 2 KCNN2 0.162 Cell metabolism
●Formation of voltage-independent potassium channels activated by intracellular calcium. Activation following membrane hyperpolarization.
It is thought to modulate neuronal excitability by contributing to a slower component of the post-hyperpolarization synapse. The channel is blocked by apamin. Otoancorin OTOA 0.162 Cell metabolism
● Acts as an adhesion molecule. KIAA0319 KIAA0319L 0.162 Cell metabolism
A possible role in axon induction through interaction with RTN4R. Latent transforming growth factor beta binding protein1 LTBP1 0.108 Other, binding protein
A key regulator of transforming growth factor beta (TGFB1, TGFB2, TGFB3) that regulates TGF-beta activation by keeping TGF-beta in a latent state when stored in extracellular space.
●In particular, it binds to delay-associated peptide (LAP), a regulatory chain of TGF-beta, via disulfide bonds, and regulates integrin-dependent activation of TGF-beta. Rho guanine nucleotide exchange factor 40 ARHGEF40 0.108 ell metabolism
● Acts as a guanine nucleotide exchange factor (GEF). Adenylate cyclase 10 ADCY10 0.108 Enzyme, energy metabolism
It catalyzes the formation of the signaling molecule cAMP
●Can act as a sensor mediating response to changes in cellular bicarbonate and CO2 levels.
It plays an important role in mammalian spermatogenesis by producing cAMP that regulates cAMP-responsive nuclear factors essential for sperm maturation in the epididymis.
Induction of capacity, the maturation process that sperm undergoes before fertilization
●Involved in regulating ciliary pulsation. Collagen type V alpha 1 chain COL5A1 0.108 Extra-cellular matrix component
●Member of group I collagen (fibrillar-forming collagen). Fibronectin type III domain containing 3B FNDC3B 0.108 Cell metabolism
Positive regulator of adipogenesis Uveal autoantigen with coiled-coil domains and ankyrin repeats UACA 0.108 Cell metabolism
●APAF1 expression regulation
An important role in the regulation of stress-induced apoptosis
●Promoting apoptosis by regulating three pathways, apoptosome up-regulation, LGALS3/galectin-3 down-regulation, and NF-kappa-B inactivation.
Regulate the redistribution of APAF1 to the nucleus after proapoptotic stress
Downregulation of LGALS3 expression by inhibiting NFKB1
● Regulates the morphological changes required for cell growth and motility by regulating isoactin dynamics.
Interaction with ARF6 can regulate cell shape and motility after injury. Fms related tyrosine kinase 1 FLT1 0.108 growth factor
Tyrosine protein kinase that acts as a cell surface receptor for VEGFA, VEGFB and PGF
It plays an essential role in the development of the embryonic vasculature, regulation of angiogenesis, cell survival, cell migration, macrophage function, chemotaxis and cancer cell invasion. Zinc finger protein 142 ZNF142 0.108 Cell metabolism
Involvement in transcriptional regulation Ryanodine receptor 1 RYR1 0.054 Cell metabolism
Calcium channels mediating the release of Ca2+ from the sarcoplasmic reticulum to the cytoplasm
An important role in inducing muscle contraction following depolarization of T-tubules
Repetition of very high levels of exercise increases the likelihood of channel opening and Ca2+ leakage into the cytoplasm. Citron rho-interacting serine/threonine kinase CIT 0.054 Enzyme
Role in cytoplasmic division
Required for localization of KIF14 on the central spindle and mid body
Putative RHO/RAC effectors that bind to RHO and RAC in GTP binding form
Serine/threonine protein kinase activity indication
Important role in cytokinesis regulation and central nervous system development
●Phosphorylation of MYL9/MLC2. Laminin subunit alpha 3 LAMA3 0.054 Extra-cellular matrix component
Laminin, which binds to cells through high-affinity receptors, is thought to interact with other extracellular matrix components to mediate adhesion, migration, and tissue of cells to tissues during embryonic development. DNA-dependent protein kinase catalytic subunit PRKDC 0.054 Enzyme
Serine/threonine protein kinase that acts as a molecular sensor for DNA damage.

Protein OC-exo
(n=3) AmSC-CM
(n=1) GN Keratin, type I cytoskeletal 10 0.041 ± 0.019 4.536 KRT10 Keratin, type II cytoskeletal 1 0.083 ± 0.022 3.996 KRT1 Vimentin 13.929 ± 1.073 2.808 VIM Collagen type III alpha 1 chain 0.088 ± 0.005 2.214 COL3A1 Thioredoxin 0.086 ± 0.022 1.620 - Malate dehydrogenase 0.055 ± 0.007 1.512 MDH1 Uncharacterized protein 0.492 ± 0.038 1.350 YWHAZ Uncharacterized protein 0.006 ± 0.002 1.188 LOC477072 Triosephosphate isomerase 0.530 ± 0.082 1.188 TPI1 Purine nucleoside phosphorylase 0.053 ± 0.012 1.134 PNP Collagen alpha-1(I) chain 0.255 ± 0.017 0.972 COL1A1 Proteasome subunit beta 0.043 ± 0.001 0.702 PSMB6 Keratin 78 0.047 ± 0.005 0.648 KRT78 Uncharacterized protein 0.033 ± 0.007 0.648 LOC475521 Keratin 72 0.009 ± 0.000 0.648 KRT72 L-lactate dehydrogenase 0.434 ± 0.080 0.432 LDHA Annexin A2 3.579 ± 0.372 0.432 ANXA2 Dihydropyrimidinase like 3 0.179 ± 0.005 0.270 DPYSL3 Collagen type V alpha 1 chain 0.015 ± 0.005 0.108 COL5A1

Type of Proteins Total Mole Percentage by Type of Proteins (%) Intermediate filaments 26 Cell metabolism 21 growth factors 18 Extra-cellular matrix components 15 Anti-oxidants 13 Enzymes 7

Example 2: Determination of cAMSC-CM Optimal Concentration

In order to examine the effect of cAMSC-CM on sperm motility and vitality analysis, the amnion stem cell-conditioned medium was divided into high and low concentrations.

A high concentration of cAMSC-CM was added to the freezing buffer at 0% (control), 25%, 50%, 75% and 100%, respectively.

A low concentration of cAMSC-CM was used by adding 0% (control), 5%, 10%, and 15% to the freezing buffer, respectively.

Example 2-1: cAMSC-CM high concentration group

When 25% and 50% of cAMSC-CM was treated in the freezing buffer, the motility of freeze-thawed sperm was not different from that of the control group, but when a higher concentration was used, the motility was reduced compared to the control group (Table 5).

Group Motility (%) Linearity (%) Vitality (%) ALH (μm) Straightness (%) Control 21.9 ± 3.2 ^a 17.3 ± 2.2 42.7 ± 5.3 1.2 ± 0.2 ^ab 50.2 ± 1.0 25% 20.2 ± 2.3 ^a 19.2 ± 2.9 47.8 ± 6.5 1.1 ± 0.1 ^a 53.8 ± 3.2 50% 18.9 ± 4.7 ^ab 19.4 ± 4.7 43.2 ± 8.6 1.0 ± 0.3 ^a 54.2 ± 2.9 75% 6.9 ± 2.8 ^bc 9.6 ± 1.2 22.3 ± 2.2 0.4 ± 0.1 ^ab 57.5 ± 2.5 100% 5.6 ± 0.6 ^c 27.2 ± 10.7 50.7 ± 18.8 0.6 ± 0.1 ^a 66.1 ± 8.1 ^ac mean significantly different within column (p < 0.05, repeat 3 times); ALH: lateral head displacement.

Example 2-2: Analysis of cell membrane integrity and viability of sperm in the cAMSC-CM high concentration group

Sperm cell membrane integrity analysis was performed using the hypo-osmotic swelling test method.

100 μl of semen was mixed with 1 ml of hypo-osmotic swelling solution (150 mOsmol/kg). The mixture was placed at 37° C. for 30 minutes. 10 μl of semen was placed on a heated slide glass and covered with a glass cover. The tail shape of sperm was analyzed by counting 100 sperm under a microscope.

As shown in FIG. 2 , as a result of the hypo-osmotic swelling test, if the tail of the sperm is curled, it is normal, and if it is straight, it was evaluated as having a damaged cell membrane.

Sperm viability stones were analyzed by eosin-nigrosin staining to evaluate the dyeability of the sperm head.

In order to examine the effect of a high concentration of amnion stem cell-conditioned medium in the analysis of sperm cell membrane integrity, 0%, 25%, 50%, 75%, and 100% of the amnion stem cell-conditioned medium was added to the freezing buffer, respectively. was used, and the experimental results are shown in [Table 6].

Group no. sperm count Intact membrane (%) Abnormal membrane (%) Control 110.0 ± 9.5 43.6 ± 7.0 ^a 56.4 ± 7.0 ^a 25% 117.0 ± 12.3 40.3 ± 6.4 ^ab 59.7 ± 6.4 ^ab 50% 101.3 ± 1.3 39.6 ± 5.4 ^ab 60.4 ± 5.4 ^ab 75% 104.7 ± 4.2 17.6 ± 3.2 ^bc 82.4 ± 3.2 ^bc 100% 97.7 ± 2.3 7.1 ± 2.6 ^c 91.9 ± 1.7 ^{c ac} means significantly different within column (p < 0.05, repeat 3 times)

From the results in Table 6, when the cryoprotectant was treated with 25% and 50% of the amnion stem cell-conditioned medium, the cell membrane integrity was not different from that of the control, but when a higher concentration was used, the cell membrane integrity was reduced than the control.

Example 2-3: cAMSC-CM low concentration group

Sperm viability and VCL were 5%, 10% and 15% cAMSC-CM treated groups (5% CM, 83.9±2.8% and 75.4±6.7%; 10% CM, 90.1±2.8% and 87.2±8.1%; 15% CM, 86.8±3.5% and 75.4±6.7%). In particular, the group treated with 10% CM was significantly higher than the control group (80.8±2.0% and 74.2±4.4%, respectively).

The group treated with 10% CM had significantly higher motility and ALH than other groups (control group, 67.3±2.5% and 4.1±0.1 μm; 5% CM, 72.4±2.5% and 4.2±0.3 μm). (79.2±2.6% and 4.8±0.3 μm, respectively) (Tables 7 and 8).

Therefore, the optimal concentration of cAMSC-CM was selected as 10%, and subsequent experiments were also performed with the optimal concentration of 10% cAMSC-CM.

Concentration of CM (%) Motility (%) Viability (%) VCL (μm/s) VSL (μm/s) 0 67.3±2.5 80.8±2.0 74.2±4.4 21.4±1.3 5 72.4±2.5 83.9±2.8 75.4±6.7 20.4±1.0 10 79.2±2.6 90.1±2.8 87.2±8.1 23.8±1.8 15 72.1±3.9 86.8±3.5 75.4±6.7 24.6±3.7 VCL: average curvilinear velocity;, VSL: straight-line velocity

Concentration of CM (%) VAP (μm/s) LIN(%) STR (%) ALH (μm) 0 45.8±2.0 29.0±1.3 47.4±1.7 4.1±0.1 5 46.8±3.1 29.0±1.5 44.1±1.4 4.2±0.3 10 54.0±4.0 31.2±1.6 44.5±1.2 4.8±0.3 15 46.7±4.0 31.6±2.1 46.4±2.3 4.1±0.3 VAP: average path velocity; LIN: linearity (average ratio of VSL/VCL);
STR: straightness (average value of the ratio VSL/VAP); ALH: amplitude of lateral head

Example 2-4: Analysis of cell membrane integrity and viability of sperm in the cAMSC-CM low concentration group

In order to examine the effect of the optimal concentration of amnion stem cell-conditioned medium in the analysis of sperm cell membrane integrity, 0% and 10% of amnion stem cell-conditioned medium was added to the freezing buffer, respectively, and the experimental results were It is shown in [Table 9].

Group Intact membrane (%) Live sperm (%) Control 48.5 ± 5.3 49.5 ± 3.7 ^a 10% 60.0 ± 9.1 52.1 ± 3.4 ^{b Significantly different in columns a and b} (p < 0.05, repeat 4 times)

From the results of [Table 9], it was confirmed that there was no difference from the control group in cell membrane stability when freeze-thawed by adding an amnion stem cell-conditioned medium with an optimal concentration of 10%, but improved viability.

When cAMSC-CM is used at a concentration higher than 15%, it is thought to have a negative effect by affecting sperm homeostasis and changing the osmotic environment.

Therefore, through the results of analysis of sperm motility and viability by cryoprotectants treated with high and low concentrations of cAMSC-CM in the freezing buffer, it was determined that the optimal concentration was 10%.

Example 3: cAMSC-CM Effects on Sperm Cryopreservation

According to the results of analysis of sperm motility and viability by cryoprotectant treated with high and low concentrations of cAMSC-CM in Example 2, the optimal concentration was determined to be 10%.

Therefore, the motility, vitality, VSL, and ALH of freeze-thawed sperm in the experimental group treated with cAMSC-CM at the optimal concentration of 10% were as follows.

Example 3-1: Motility and Velocity Parameters

As a result of the CASA system, motility and LIN were significantly improved in the 10% cAMSC-CM treated group (54.3±1.9% and 50.3±3.1%) compared to the control group (42.1±2.1% and 47.0±3.4%) (Tables 10 and 11) ).

It can be seen that the proportion of immotile spermatozoa was significantly reduced in the 10% cAMSC-CM treated group (45.7 ± 1.9%) as compared to the control group (57.9 ± 2.1%) (Fig. 6).

The remaining parameters showed no significant difference between groups.

Concentration of CM (%) Motility (%) Progressive
Motility (%) VCL (μm/s) VSL (μm/s) 0 42.1±2.1 22.8±3.4 81.5±6.4 49.4±5.6 10 54.3±1.9 26.2±4.2 74.5±7.8 46.3±7.1 VCL: average curvilinear velocity;, VSL: straight-line velocity

Concentration of CM (%) VAP (μm/s) LIN(%) STR (%) ALH (μm) 0 57.2±5.6 47.0±3.4 68.1±2.4 3.1±0.3 10 53.3±7.2 50.3±3.1 70.0±2.2 2.8±0.2 VAP: average path velocity; LIN: linearity (average ratio of VSL/VCL);
STR: straightness (average value of the ratio VSL/VAP); ALH: amplitude of lateral head

Example 3-2: Live/Dead Count and Morphology Assessment

The percentage of viable sperm cells was higher in the 10% CM treatment group (55.2±3.0%) than in the control group (43.9±4.3%). And, the proportion of bent-tailed sperm was lower in the 10% CM treatment group (1.8±0.6%) than in the control group (3.1±0.7%). However, the proportion of coiled tail cells was not significantly different between the control group and the 10% CM treatment group (3.0±1.2% and 3.0±1.8%, respectively) (Table 12).

These results suggest that cAMSC-CM may have an anti-apoptotic effect during sperm cryopreservation.

Concentration of CM (%) Live Sperm Cells (%) Coiled Tail (%) Bent Tail (%) 0 43.9±4.3 3.0±1.2 3.1±0.7 10 55.2±3.0 3.0±1.8 1.8±0.6

Example 3-3: Chromatin Integrity

The proportion of sperm with nuclei stained with abnormal chromatin condensation was not significantly different between the two groups (control group, 34.0±2.9%, 10% CM, 31.0±3.1%) (Table 13). These results suggest that cAMSC-CM has no protective effect on DNA integrity.

Concentration of CM (%) Aniline Blue Positive Spermatozoa (%) 0 34.0±2.9 10 31.0±3.1

Example 3-4: Acrosome and Membrane Integrity Assessment

The proportion of sperm cells with intact plasma membrane was significantly higher in the 10% CM-treated group (66.5±2.3%) than in the control group (54.5±2.9%) (Table 14).

In the FITC-PNA test, there was no significant difference in the proportion of sperm with intact acrosomes between the two groups (control group, 74.0±4.3%; 10% CM, 76.6±4.0%) (Table 14).

Concentration of CM (%) Intact Acrosome (%) Intact Membrane (%) 0 74.0±4.3 54.5±2.9 10 76.6±4.0 66.5±2.3

Example 3-5: Mitochondria Activity Assessment

R123 dye was used to evaluate mitochondrial activity, and PI was used to stain dead sperm cells. Both data were used to calculate the proportion of live sperm with active mitochondria in each group.

Mitochondrial activity was significantly improved in the 10% CM treated group (49.6±0.7%) compared to the control group (36.4±2.5%) ( FIG. 7 ).

Example Conclusion

Through the above embodiments of the present application,

It can be seen that the cAMSC-CM of the present application contains proteins including growth factors, antioxidants, enzymes, extracellular matrix components, intermediate filaments, and the like.

For this reason, it can be seen that during cryopreservation of sperm, motility, viability, membrane integrity, and mitochondrial activity are improved when cAMSC-CM is added to the freezing medium at an optimal content.

<110> INDUSTRY-UNIVERSITY COOPERATION FOUNDATION SEOUL NATIONAL UNIVERSITY <120> A Composition for semen cryoprotectant of animal including amniotic membrane derived stem cell-conditioned media and method of making it <130> CP20-249 <150> KR 10-2019-0152119 <151> 2019-11-25 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Beta-ACT_F <400> 1 gctacgtcgc cctggacttc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Beta-ACT_R <400> 2 gcccgtcggg tagttcgtag 20 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Oct3-4_F <400> 3 cgagtgagag gcaacctgga ga 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Oct3-4_R <400> 4 ccacactcgg accacatcct tc 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sox2_F <400> 5 cagacctaca tgaacggctc gc 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Sox2_R <400> 6 cctggagtgg gaggaggagg ta 22 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nanog_F <400> 7 gaataacccg aattggagca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nanog_R <400> 8 agttgtggag cggattgttc 20

Claims (23)

A composition for freezing semen, comprising:
The composition is
at least one cryoprotectant; and
Amniotic membrane derived Stem Cell-conditioned media (ASC-CM), including apolipoprotein, fibronectin, thioredoxin, and albumin;
including,
The ASC-CM is a culture medium in which amnion-derived stem cells are cultured,
At this time, the ASC-CM composition, characterized in that it does not contain amnion-derived stem cells.
The method of claim 1,
The Apolipoprotein may be any one or more selected from Apolipoprotein Apolipoprotein E and Apolipoprotein AI,
The albumin (albumin) is a composition, characterized in that the serum albumin (serum albumin).
The method of claim 1,
The ASC-CM is a metalloproteinase inhibitor 1 (Metalloproteinase inhibitor 1, TIMP1), actin (Actin, cytoplasmic 1, ACTB), coiled coil domain and uveal autoantigen with coiled-coil domains and ankyrin repeats, UACA), characterized in that it further comprises any one or more.
The method of claim 1,
The ASC-CM is keratin 10 (Keratin, type I cytoskeletal 10, Keratin10) keratin 1 (Keratin, type II cytoskeletal 1, Keratin 1), vimentin, collagen type III alpha 1 chain , COL3A1), thioredoxin, malate dehydrogenase, triosephosphate isomerase (TPI1), Iwatsu (YWHAZ), LOC477072, purine nucleoside phosphorylase (Purine) nucleoside phosphorylase, PNP), Collagen alpha-1(I) chain (COL1A1), Proteasome subunit beta (PSMB6), Keratin 78 (Keratin 78, KRT78), LOC475521, Keratin 72 (Keratin 72, KRT72), L-lactate dehydrogenase, Annexin A2 (Annexin A2, ANXA2), Dihydropyrimidinase like 3 (DPYSL3), Collagen type 5 alpha 1 A composition, characterized in that it may further include a chain (Collagen type V alpha 1 chain, COL5A1).
The method of claim 1,
The cryoprotectant composition, characterized in that it contains any one or more selected from egg yolk (egg yolk) and glycerol (glycerol).
The method of claim 1,
The cryoprotectant further includes distilled water, tris (hydroxymethyl) aminomethane, citric acid, fructose, and kanamycin sulfate. A composition, characterized in that
The method of claim 1,
The composition, characterized in that 5%, 10% or 15% of the ASC-CM is included with respect to the final weight of the composition.
The method of claim 1,
Composition characterized in that 10% of the ASC-CM is included based on the final weight of the composition.
The method of claim 1,
The amniotic membrane-derived stem cells are amniotic membrane derived mesenchymal stem cells (AMSC) composition, characterized in that.
The method of claim 1,
The semen is a composition, characterized in that the semen of a dog, horse, cow, rabbit, raccoon, fox, deer, sheep, donkey, pig, chimpanzee or monkey.
The method of claim 1,
The amnion-derived stem cells are dog, horse, cow, rabbit, raccoon, fox, deer, sheep, donkey, pig, chimpanzee or monkey composition, characterized in that the amnion-derived stem cells.
The method of claim 1,
The composition is characterized in that at least one selected from the group consisting of sperm motility, viability, cell membrane integrity, and mitochondrial activity is improved when the semen is freeze-thawed.
A kit for freezing semen comprising the composition of any one of claims 1 to 12 and a container for cryoprotection.
14. The method of claim 13,
The cryoprotection container is a kit for freezing semen, characterized in that at least one selected from a cryoprotection tube and a vial.
culturing amnion-derived stem cells;
obtaining an amnion-derived stem cell-conditioned medium from the culture solution of the cultured amnion-derived stem cells; and
At this time, the amnion-derived stem cell-conditioned medium is to remove the amnion-derived stem cells from the culture medium,
mixing the amnion-derived stem cell-conditioned medium and a cryoprotectant;
including,
In this case, the method of claim 1, wherein the amnion-derived stem cell-conditioned medium is contained in an amount of 5% to 15% based on the final weight of the composition.
16. The method of claim 15,
The amnion-derived stem cells express high levels of CD29, CD44, and CD90, and low expression of CD34 and CD45.
16. The method of claim 15,
The step of culturing the amnion-derived stem cells; is about 70%, 75%, 80%, 85%, 90%, 95%, or 100% density (Confluency) in the culture vessel as the cells proliferate. A method characterized in that.
16. The method of claim 15,
Culturing the amnion-derived stem cells; culturing the amniotic membrane-derived stem cells in a basal medium; and sub-culturing the amnion-derived stem cells cultured in the basal medium.
19. The method of claim 18,
In the step of culturing the amnion-derived stem cells in a basal medium; the basal medium is selected from BME (Basal medium Eagle's), DMEM (Dulbecco's modified Eagle's medium), RPMI (Rosewell Park Menorial Institute), MEM (Minimum essential medium), RCMEP A method, characterized in that any one or more being.
19. The method of claim 18,
The period of culturing the amnion-derived stem cells is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or 10 days.
16. The method of claim 15,
Before performing the amnion-derived stem cells- obtaining an conditioned medium, the step of starvation of the cultured amnion-derived stem cells; method characterized in that it can be performed.
22. The method of claim 21,
The nutritional deficiency is characterized by culturing by replacing the culture medium of amnion-derived stem cells grown in a cell culture vessel with a serum-free medium.
16. The method of claim 15,
The amnion-derived stem cell-conditioning medium is obtained by performing at least one selected from centrifugation or filter of the culture medium in which the amnion-derived stem cells are cultured to obtain a culture solution from which the amnion-derived stem cells are removed.

Images