KR20210048110A - Method for preparing fermented rice bran by using weissella koreensis and fermented rice bran prepared thereby - Google Patents

Method for preparing fermented rice bran by using weissella koreensis and fermented rice bran prepared thereby Download PDF

Info

Publication number
KR20210048110A
KR20210048110A KR1020190131979A KR20190131979A KR20210048110A KR 20210048110 A KR20210048110 A KR 20210048110A KR 1020190131979 A KR1020190131979 A KR 1020190131979A KR 20190131979 A KR20190131979 A KR 20190131979A KR 20210048110 A KR20210048110 A KR 20210048110A
Authority
KR
South Korea
Prior art keywords
rice bran
strain
fermentation
ornithine
fermented
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
KR1020190131979A
Other languages
Korean (ko)
Other versions
KR102414355B1 (en
Inventor
장해춘
문송희
문소영
이재준
Original Assignee
조선대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 조선대학교산학협력단 filed Critical 조선대학교산학협력단
Priority to KR1020190131979A priority Critical patent/KR102414355B1/en
Publication of KR20210048110A publication Critical patent/KR20210048110A/en
Application granted granted Critical
Publication of KR102414355B1 publication Critical patent/KR102414355B1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23BPRESERVATION OF FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES; CHEMICAL RIPENING OF FRUIT OR VEGETABLES
    • A23B7/00Preservation of fruit or vegetables; Chemical ripening of fruit or vegetables
    • A23B7/10Preserving with acids; Acid fermentation
    • A23B7/105Leaf vegetables, e.g. sauerkraut
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135Bacteria or derivatives thereof, e.g. probiotics
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/30Dietetic or nutritional methods, e.g. for losing weight
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L7/00Cereal-derived products; Malt products; Preparation or treatment thereof
    • A23L7/10Cereal-derived products
    • A23L7/104Fermentation of farinaceous cereal or cereal material; Addition of enzymes or microorganisms
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L7/00Cereal-derived products; Malt products; Preparation or treatment thereof
    • A23L7/10Cereal-derived products
    • A23L7/115Cereal fibre products, e.g. bran, husk
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2400/00Lactic or propionic acid bacteria
    • A23V2400/11Lactobacillus
    • A23Y2220/00
    • C12R1/01
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Mycology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

The present invention relates to a method for producing fermented rice bran and fermented rice bran produced by the method for producing fermented rice bran. More specifically, a strain used for producing fermented rice bran of the present invention is isolated from kimchi and not only has excellent production ability to produce citrulline and ornithine from arginine but also can grow in a high-concentration rice bran mixture and has excellent fermentation efficiency as a Weissella koreensis DB1 (KCTC 13653BP) strain with citrulline and ornithine production ability. Therefore, the strain can produce high concentrations of citrulline and ornithine during the fermentation process of rice bran so that fermented rice bran with enhanced functionality can be produced by containing high concentrations of citrulline and ornithine. In this aspect, the method for producing fermented rice bran of the present invention may include a step of adding a Weissella koreensis DB1 (KCTC 13653BP) stain isolated from kimchi and having citrulline and ornithine production ability. In addition, the fermented rice bran produced by the method for producing fermented rice bran contains high content of citrulline and ornithine in the fermented rice bran and has excellent functionality. In this aspect, the fermented rice bran may be utilized as a functional food, and the functional food may be a food composition for preventing obesity or a health functional food containing the fermented rice bran as an active ingredient.

Description

김치로부터 분리된 유산균을 이용한 미강 발효물 제조방법 및 그로부터 제조된 미강 발효물{METHOD FOR PREPARING FERMENTED RICE BRAN BY USING WEISSELLA KOREENSIS AND FERMENTED RICE BRAN PREPARED THEREBY}Manufacturing method of fermented rice bran using lactic acid bacteria isolated from kimchi and fermented rice bran produced therefrom {METHOD FOR PREPARING FERMENTED RICE BRAN BY USING WEISSELLA KOREENSIS AND FERMENTED RICE BRAN PREPARED THEREBY}

본 발명은 유산균을 이용한 발효 미강 제조방법 및 상기 제조방법으로 제조된 발효 미강에 관한 것이다.The present invention relates to a fermented rice bran production method using lactic acid bacteria and a fermented rice bran produced by the above production method.

경제수준 향상에 의한 영양과잉, 환경오염, 운동부족, 스트레스 증가 등에 따른 각종 생활습관병 및 만성퇴행성질환의 만연이 우리 사회의 큰 문제로 대두되고 있다. 이 중, 최근에 가장 관심이 집중되고 있는 질병이 비만이다. 상기 비만은 일반적으로 음식물로 섭취한 에너지(energy intake)가 신체활동 등으로 소비한 에너지(energy expenditure)와 균형을 이루지 못하여, 잉여의 에너지가 체내에 지방세포(adipocyte)의 양적, 수적 증가를 일으켜 지방조직이 과다하게 축적된 상태를 의미하며, 유전적 요인, 환경적 요인, 정신적 요인 또는 식사습관 및 운동부족 등의 생활습관 등에 의하여 신체 내 에너지 밸런스가 무너져 생기는 질환을 의미한다.The prevalence of various lifestyle-related diseases and chronic degenerative diseases, such as overnutrition, environmental pollution, lack of exercise, and increased stress due to the improvement of the economic level, has emerged as a major problem in our society. Among them, obesity is the disease that has attracted the most attention recently. The obesity generally causes an increase in the quantity and number of adipocytes in the body because the energy intake cannot be balanced with the energy expenditure consumed by physical activity, etc. It refers to a state in which adipose tissue is accumulated excessively, and refers to a disease caused by the loss of energy balance in the body due to genetic factors, environmental factors, mental factors, or lifestyle habits such as diet and lack of exercise.

국민건강영양조사에 따르면 우리나라 비만 유병률은 점점 증가하는 추세를 나타내고 있으며, 보건복지부는 우리나라 인구의 38%가 권장섭취 기준 이상의 칼로리를 섭취하고 있으며, 이로 인한 심혈관 질환의 위험 또한 증가하고 있다고 보고하였다. 이러한 식습관의 변화로 인해 신체는 여러 위험요소에 노출되고 있으며, 특히 포화지방산이 다량 함유된 식품은 혈중 지질 농도를 증가시켜 고콜레스테롤혈증을 유발하며, 나아가 고지혈증, 심근경색 등 순환기 계통의 질환 발병률을 증가시킨다. According to the National Health and Nutrition Survey, the prevalence of obesity in Korea is showing an increasing trend, and the Ministry of Health and Welfare reported that 38% of the Korean population consumes more than the recommended intake standard, and that the risk of cardiovascular disease is also increasing. Due to this change in diet, the body is exposed to various risk factors. In particular, foods containing a large amount of saturated fatty acids increase blood lipid levels, causing hypercholesterolemia, and further reduce the incidence of diseases of the circulatory system such as hyperlipidemia and myocardial infarction. Increase.

상기 비만과 관련하여, 지방화(Adipogensis)에 대한 연구가 진행되고 있다. 상기 지방화란 지방전구세포로부터 지방세포가 분화되어 지방을 축적하게 되는 과정을 말하며, 상기 지방화는 비만, 당뇨병, 지방간 및 관상 심장질환 등 대사성질환의 원인이 되는 것으로 알려져 있다.In relation to the obesity, studies on adipogensis are being conducted. The localization refers to a process in which fat cells are differentiated from adipocytes to accumulate fat, and the localization is known to cause metabolic diseases such as obesity, diabetes, fatty liver and coronary heart disease.

상기 지방세포에서는 지방분해(lipolysis)와 지방합성(lipogenesis)을 통하여 지질대사가 일어나고, 상기 지방 합성 시, 상기 지방전구세포(preadipocyte)가 증식과 분화과정을 거쳐 성숙한 지방세포로 분화되어 궁극적으로 지질 방울들이 세포질로 나타나게 되고, 시간이 지남에 따라 커지고 또 합쳐지면서 하나 혹은 몇 개의 큰 지방 방울(lipid droplet)이 된다.In the adipocytes, lipid metabolism occurs through lipolysis and lipolysis, and when the adipocytes are synthesized, the predipocytes are differentiated into mature adipocytes through proliferation and differentiation processes. The droplets appear in the cytoplasm, and over time they grow and merge into one or several large lipid droplets.

상기 비만을 해소하고 적정한 체중을 유지하기 위한 비만치료기전으로는 식욕의 조절, 지방의 소화 및 흡수 방해, 에너지 소비의 증가, 지질대사의 조절 등이 있다. 현재 보편적으로 사용되는 비만 치료제로는 세로토닌(serotonin)과 지방분해효소의 활성을 억제하여 콜레스테롤(cholesterol) 및 중성지방(triglyceride)의 가수분해를 방해하며 산화되지 않은 지방을 변으로 배설시키도록 돕는 약물인 올리스타트(orlistat, XenicalR)등이 있다.Obesity treatment mechanisms for relieving obesity and maintaining an appropriate weight include controlling appetite, obstructing digestion and absorption of fat, increasing energy consumption, and regulating lipid metabolism. Currently, a commonly used obesity treatment is a drug that inhibits the activity of serotonin and lipolytic enzymes, inhibits the hydrolysis of cholesterol and triglyceride, and helps to excrete unoxidized fat into the stool. Orlistat (XenicalR).

그러나, 세르토닌의 경우 혈압을 높여 심혈관계 질환을 가진 환자에게 주의하여 사용해야 하고, 올리스타트의 경우 소화기 장애, 지방변, 배변실금, 지용성 비타민 흡수 방해 등을 유도한다고 보고되고 있는 등 기존의 비만 치료제의 경우에는 상당한 부작용을 가지고 있는 것으로 보고되고 있다.However, sertonin increases blood pressure and should be used with caution in patients with cardiovascular disease, and Olistat has been reported to induce digestive disorders, fat stool, bowel incontinence, and obstruction of fat-soluble vitamin absorption. In some cases, it has been reported to have significant side effects.

따라서, 상대적으로 안전성에 대한 문제가 발생할 가능성을 최소화 할 수 있을 것으로 기대되는 천연물로부터 비만세포의 성장 및 분화를 억제하여, 지방조직의 과다나 지방대사 이상으로 유발되는 비만에 대한 항비만 효과는 높고 부작용은 미약한 비만 치료, 예방 또는 개선을 위한 물질의 개발이 요구되고 있다.Therefore, by suppressing the growth and differentiation of mast cells from natural products that are expected to relatively minimize the possibility of safety problems, the anti-obesity effect against obesity caused by excessive adipose tissue or abnormal fat metabolism is high. There is a demand for the development of substances for the treatment, prevention or improvement of obesity, which is a weak side effect.

한편, 인류의 식량자원으로서 오랜 역사가 있는 벼는 왕겨층, 쌀겨층, 눈 및 배유로 구성되어 있다. 상기 벼는 도정하는 정도에 따라 왕겨층을 제거한 현미와 현미를 도정하여, 쌀눈, 과피, 종피, 호분층 등 쌀겨를 제거한 백미의 형태로 얻게 되며, 상기 현미나 백미를 제외하고 남게 되는 벼의 겉껍질인 왕겨층이나 쌀눈과 호분층, 싸라기 등을 포함하는 쌀겨층 등의 부산물을 미강이라고 한다.On the other hand, rice, which has a long history as a food resource for mankind, is composed of rice husk layer, rice husk layer, snow and endosperm. The rice is obtained in the form of white rice from which the rice hull layer has been removed by grinding the brown rice and brown rice with the rice hull layer removed according to the degree of milling, and is obtained in the form of white rice from which rice bran is removed, such as rice buds, peel, seed skin, and algae layer, and the outer shell of the rice remaining except for the brown rice and white rice. By-products such as rice hull layer, rice hull layer, rice hull layer, and salagi are called rice bran.

기존에 부산물로 취급되던 미강은 최근 연구 결과에 따라 감마 아미노부티르산(GABA), 레시친, 옥타코사놀, 오리자놀, 토코페롤, 페룰산 등 벼에 포함된 생리활성물질의 약 95%가 분포되어 있다고 보고되고 있다. 상기 미강에는 많은 생리활성 물질이 존재하기 때문에 항비만 활성, 항콜레스테롤 활성, 항고혈압 활성, 숙취해소 활성, 중금속 해독 활성 및 항변비 활성 등의 다양한 생리활성 효과가 있는 것으로 알려져 있음에도 불구하고, 현재 미강은 대부분 가축사료로 이용되고 있는 실정이다.Rice bran, previously treated as a by-product, has been reported to contain about 95% of the physiologically active substances contained in rice such as gamma aminobutyric acid (GABA), lecithin, octacosanol, orizanol, tocopherol, and ferulic acid. Since many physiologically active substances exist in the rice bran, it is known that it has various physiological effects such as anti-obesity activity, anti-cholesterol activity, anti-hypertensive activity, hangover relief activity, heavy metal detoxification activity and anti-constipation activity. Is mostly used for livestock feed.

이와 관련, 공개된 선행 특허는 유산균 발효를 통해 소화촉진 효과나 풍미 개선 효과와 관련된 내용이 주를 이룰 뿐, 미강에 포함된 유효성분으로부터 특정 기능성 강화를 위한 유효물질 함량 개선에 대한 선행연구는 극히 제한된 면이 있다. 따라서, 다양한 성분을 가지고 있으면서도 사료 등으로 제한적으로 이용되거나 폐기되는 미강의 활용을 통해 농가의 수익개선과 자연 활용을 통한 환경 개선을 가능하게 할 수 있도록 기존 방법과 구분되는 연구의 필요성이 점차 증가하고 있다.In this regard, the prior patents disclosed are mainly related to the effect of promoting digestion or improving flavor through fermentation of lactic acid bacteria, but prior research on improving the content of active substances for enhancing specific functionality from the active ingredients contained in rice bran has been extremely limited. There are limited aspects. Therefore, there is a growing need for research that is differentiated from the existing methods so that it is possible to improve the profits of farmers and improve the environment through the use of nature through the use of rice bran that is limitedly used or discarded as feed, even though it has various ingredients. have.

10-1733967B10-1733967B 10-1618953B10-1618953B 10-1523139B10-1523139B 10-1357663B10-1357663B 10-1177245B10-1177245B 10-0880382B10-0880382B 10-2018-0133372A10-2018-0133372A 10-2017-0086196A10-2017-0086196A 10-2012-0021788A10-2012-0021788A

상기 문제점을 해결하기 위하여, 본 발명자들은 미강의 기능성 개선을 위해 보편적으로 안전성이 확보된 미생물(GRAS)인 유산균 특히, 우리나라 고유의 발효식품으로 다양한 기능성을 갖는 유산균의 보고인 김치로부터 유래된 유산균 중, 발효 미강 제조에 적합한 유산균을 선택하여 이를 이용하여 발효 미강을 제조하기 위해 적합한 제조방법 즉, 유산균을 이용한 미강 발효물 제조방법을 제공하는 것을 목적으로 한다.In order to solve the above problem, the present inventors have developed lactic acid bacteria, which are microorganisms (GRAS) that are universally secured to improve the functionality of rice bran, in particular, among lactic acid bacteria derived from kimchi, which is a report of lactic acid bacteria having various functions as a fermented food unique to Korea. An object of the present invention is to provide a suitable manufacturing method for manufacturing fermented rice bran, that is, a method for producing fermented rice bran using lactic acid bacteria, by selecting the lactic acid bacteria suitable for fermented rice bran production.

또한, 상기 미강 발효물 제조방법에 의해 제조된 미강 발효물과 이를 이용한 기능성 식품을 제공하는 것을 목적으로 한다.In addition, it is an object of the present invention to provide a fermented rice bran produced by the method for producing fermented rice bran and a functional food using the same.

본 발명이 이루고자 하는 기술적 과제들은 이상에서 언급한 기술적 과제들로 제한되지 않으며, 언급되지 않은 또 다른 기술적 과제들은 본 발명의 기재로부터 당해 분야에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.The technical problems to be achieved by the present invention are not limited to the technical problems mentioned above, and other technical problems that are not mentioned will be clearly understood by those of ordinary skill in the art from the description of the present invention. .

상기 목적을 달성하기 위하여, 본 발명은 일 측면에서, 미강 발효에 최적인 유산균, 구체적으로 미강으로부터 항비만 효과를 갖는 물질인 시트룰린(Citrulline) 및 오르니틴(Ornithine)을 효과적으로 생산할 수 있는 미생물을 제공한다.In order to achieve the above object, the present invention provides, in one aspect, a microorganism capable of effectively producing lactic acid bacteria optimal for rice bran fermentation, specifically, citrulline and ornithine, which are substances having an anti-obesity effect from rice bran do.

더욱 구체적으로, 본 발명은 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 제공한다.More specifically, the present invention provides a Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) strain isolated from kimchi and capable of producing citrulline and ornithine.

상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주는 바람직하게는 아르기닌(Arginine)이 첨가된 배지에서 최적 생육 pH가 pH 5.0인 것일 수 있다.The Weissella koreensis DB1 (KCTC 13653BP) strain may preferably have an optimal growth pH of 5.0 in a medium to which arginine is added.

본 발명은 상기 목적을 달성하기 위하여, 다른 측면에서, 상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 이용하여 기능성이 강화된 미강 발효물, 구체적으로, 시트룰린(Citrulline, C6H13N303) 및 오르니틴(Ornithine, C5H12N202) 함량이 증가된 미강 발효물을 제조하는 방법을 제공한다.The present invention, in order to achieve the above object, in another aspect, by using the Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) strain, the rice bran fermentation product with enhanced functionality, specifically, citrulline (C 6 H 13 N 3 0 3 ) And ornithine (Ornithine, C 5 H 12 N 2 0 2 ) It provides a method of preparing a rice bran fermented product with increased content.

더욱 구체적으로, 본 발명은 미강 발효물 제조방법에 있어서, 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하여 발효하는 단계를 포함하는 것을 특징으로 하는 미강 발효물 제조방법을 제공한다.More specifically, in the method for producing fermented rice bran, the present invention comprises the step of fermenting by adding a strain of Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) isolated from the kimchi and having citrulline and ornithine production capacity. It provides a method for producing fermented rice bran, characterized in that it comprises.

또한, 본 발명은 미강, 아르기닌(Arginine) 및 물을 혼합하여 혼합물을 제조하는 발효원물 제조단계; 상기 혼합물을 가열하여 미강을 호화시켜 호화 미강 혼합물을 제조하는 호화 미강 제조단계; 상기 호화 미강 혼합물에 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하는 균주 첨가 단계; 및 상기 균주가 첨가된 호화 미강 혼합물을 발효하여 미강 발효물을 제조하는 발효 단계를 포함하는 것을 특징으로 하는 미강 발효물 제조방법을 제공한다.In addition, the present invention is a fermentation raw material production step of mixing rice bran, arginine and water to prepare a mixture; Gelatinized rice bran manufacturing step of preparing a gelatinized rice bran mixture by heating the mixture to gelatinize the rice bran; A strain addition step of adding a Weissella koreensis DB1 (KCTC 13653BP) strain isolated from the kimchi and having citrulline and ornithine producing ability to the gelatinized rice bran mixture; And a fermentation step of fermenting the gelatinized rice bran mixture to which the strain is added to prepare a rice bran fermentation product.

상기 발효원물 제조단계는 상기 혼합물에 미강을 10%(w/v) 내지 80%(w/v)의 농도로 첨가하고, 아르기닌(Arginine)을 0.1%(w/v) 내지 5%(w/v)의 농도로 첨가하는 방법으로 수행할 수 있다. 더욱 구체적으로, 상기 발효원물 제조단계는 물, 미강 및 아르기닌을 혼합하여 제조된 상기 혼합물 전체 부피를 기준으로 미강을 10%(w/v) 내지 80%(w/v)의 농도로 첨가하고, 아르기닌(Arginine)을 0.1%(w/v) 내지 2%(w/v)의 농도로 첨가하는 방법으로 수행할 수 있다.In the fermentation raw material manufacturing step, rice bran is added to the mixture at a concentration of 10% (w/v) to 80% (w/v), and arginine is added to 0.1% (w/v) to 5% (w/v). It can be carried out by adding at a concentration of v). More specifically, in the step of preparing the fermentation raw material, rice bran is added at a concentration of 10% (w/v) to 80% (w/v) based on the total volume of the mixture prepared by mixing water, rice bran and arginine, It can be carried out by adding arginine at a concentration of 0.1% (w/v) to 2% (w/v).

상기 호화 미강 제조단계는 상기 혼합물을 100℃ 내지 140℃의 온도 조건 및 0.9 기압 내지 1.5 기압의 압력 조건에서 10분 내지 20분 동안 가열하여 미강을 호화시키는 방법으로 수행할 수 있다.The step of preparing the gelatinized rice bran may be performed by heating the mixture under a temperature condition of 100°C to 140°C and a pressure condition of 0.9 to 1.5 atm for 10 to 20 minutes to gelatinize the rice bran.

상기 발효 단계는 상기 균주가 첨가된 호화 미강 혼합물의 초기 pH가 pH 6.0 내지 pH 6.5이고, 발효 온도가 25℃ 내지 30℃인 조건에서 발효시키는 방법으로 수행할 수 있다.The fermentation step may be carried out by fermenting under the condition that the initial pH of the gelatinized rice bran mixture to which the strain is added is pH 6.0 to pH 6.5 and the fermentation temperature is 25°C to 30°C.

또한, 상기 미강 발효물 제조방법은 상기 미강 발효물을 건조하는 미강 발효물 건조 단계를 더욱 포함할 수 있다.In addition, the method for manufacturing the fermented rice bran may further include a step of drying the fermented rice bran of drying the fermented rice bran.

상기 건조 단계는 30℃ 내지 60℃의 온도 조건에서 1시간 내지 40시간 동안 열풍 건조법으로 수행하거나 - 50℃ 내지 - 80℃의 온도 조건에서 20시간 내지 100시간 동안 동결 건조법으로 수행할 수 있다.The drying step may be performed by a hot air drying method for 1 hour to 40 hours at a temperature condition of 30°C to 60°C, or a freeze drying method for 20 hours to 100 hours at a temperature condition of -50°C to -80°C.

본 발명은 상기 목적을 달성하기 위하여, 또 다른 측면에서, 상기 미강 발효물 제조방법으로 제조된 미강 발효물을 제공한다.In order to achieve the above object, the present invention provides, in another aspect, a rice bran fermented product prepared by the method for producing a rice bran fermented product.

상기 미강 발효물은 바람직하게는 미강 발효물 내에 시트룰린 함량이 2,500 mg/kg 내지 3,500 mg/kg이고, 오르니틴 함량이 5,500 mg/kg 내지 10,500 mg/kg인 것일 수 있다.The fermented rice bran may preferably have a citrulline content of 2,500 mg/kg to 3,500 mg/kg and an ornithine content of 5,500 mg/kg to 10,500 mg/kg in the fermented rice bran.

본 발명은 상기 목적을 달성하기 위하여, 또 다른 측면에서, 상기 미강 발효물을 유효성분으로 포함하는 비만 예방용 식품 조성물을 제공한다.In order to achieve the above object, the present invention provides, in another aspect, a food composition for preventing obesity comprising the fermented rice bran as an active ingredient.

상기 비만 예방용 식품 조성물은 바람직하게는 건강기능성 식품일 수 있다.The food composition for preventing obesity may preferably be a health functional food.

이상 살펴본 바와 같이, 본 발명에 따른 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주로 발효시킨 미강은 미강 내에 시트룰린 및 오르니틴의 함량이 현저하게 개선되므로, 미강 자체가 가지고 있는 여러 기능성에 추가로 항비만 활성을 더욱 개선시킬 수 있으므로, 기존 미강 또는 미강 발효물에 비해 항비만 활성을 현저하게 개선시킬 뿐만 아니라, 상기 발효 과정에 사용된 균주인 유산균은 GRAS 미생물이어서 안전성도 확보되고, 기존에 사료 또는 폐기물로 그 사용이 한정되는 미강을 고부가가치 식품으로 제조할 수 있어, 벼 재배농가는 물론 관련 산업계의 수익 향상에 이바지할 수 있으므로, 경제적인 효과가 매우 크고, 오래 식품으로 안전성이 확보된 미강과 GRAS 미생물인 유산균을 이용한 것이어서, 건강기능성 식품 소재 등으로 다양한 용도로 활용가능하여서, 그 산업적 효과가 매우 크다 할 것이다. As described above, rice bran fermented with the Weissella koreensis DB1 (KCTC 13653BP) strain according to the present invention significantly improves the content of citrulline and ornithine in the rice bran, so that the rice bran itself has various functions. In addition, since the anti-obesity activity can be further improved, it not only significantly improves the anti-obesity activity compared to existing rice bran or rice bran fermentation products, but also the lactic acid bacteria, which are strains used in the fermentation process, are GRAS microorganisms, so safety is also secured. Rice bran, whose use is limited as feed or waste, can be manufactured as a high value-added food, contributing to the improvement of profits not only for rice cultivation farmers but also for related industries, so the economic effect is very large, and safety is secured as a food for a long time. Since rice bran and lactic acid bacteria, which are GRAS microorganisms, are used, it can be used for various purposes as a health functional food material, and the industrial effect will be very great.

도 1은 본 발명의 일 실시예에 따른, 김치 유산균 확보를 위해 우리나라의 다양한 지역에서 수득한 김치의 산지를 표시한 지도이다.
도 2는 본 발명의 일 실시예에 따른, 다양한 지역에서 수득한 김치로부터분리한 유산균의 오르니틴(Ornithine) 생성능을 확인한 결과로, 사진의 아래는 균주 번호를 나타낸 것이고, 사진의 윗 부분의 영문약자는 균주 명칭을 나타낸 것이며, Arginine 및 Ornithine은 아르기닌 및 오르니틴의 위치를 나타낸 것이다.
도 3은 본 발명의 일 실시예에 따른, 웨이셀라 코리엔시스 DB1 균주의 16S rRNA의 염기서열을 나타낸 도면이다.
도 4는 본 발명의 일 실시예에 따른, 웨이셀라 코리엔시스 DB1 균주의 온도에 따른 생육활성도를 나타낸 그래프로, 상기 그래프의 가로축은 배양 시간(hr)을 나타내고, 상기 그래프의 세로축은 미생물 생육 정도(흡광도, A600)를 나타내며, 상기 그래프 상단의 숫자는 배양 온도를 나타낸다.
도 5는 본 발명의 일 실시예에 따른, 웨이셀라 코리엔시스 DB1 균주의 pH에 따른 생육활성도를 나타낸 그래프로, 상기 그래프의 가로축은 배양 배지의 pH 조건을 나타내고, 상기 그래프의 세로축은 미생물 생육 정도(log CFU/mL)를 나타낸다.
도 6은 본 발명의 일 실시예에 따른, 웨이셀라 코리엔시스 DB1 균주의 1%(w/v) 아르기닌이 첨가된 배지에서 pH에 따른 생육활성도를 나타낸 그래프로, 상기 그래프의 가로축은 배양 배지의 pH 조건을 나타내고, 상기 그래프의 세로축은 미생물 생육 정도(흡광도, A600)를 나타낸다. 상기 그래프에서 Control은 MRS 배지에 1%(w/v) 아르기닌이 첨가하고 별도로 pH를 조절하지 않은 대조군을 의미한다.
도 7은 본 발명의 일 실시예에 따른, 웨이셀라 코리엔시스 DB1 균주의 안전성을 확인하기 위하여, 용혈반응을 확인한 사진이다.
도 8은 본 발명의 일 실시예에 따른, 웨이셀라 코리엔시스 DB1 균주의 안전성을 확인하기 위하여, 생체아민 생성여부를 확인한 결과로, 도 8a는 양성대조군인 엔테로코커스 파에칼리스 균주(Enterococcus faecalis ATCC 29212)와 비교하여, 탈탄산효소능 확인 실험(Decarboxylase plate method, Bover-Cid)을 수행한 것으로, ATCC 29212는 엔테로코커스 파에칼리스 균주(Enterococcus faecalis ATCC 29212)를 의미하고, DB1은 웨이셀라 코리엔시스 DB1 균주를 의미하며, 도 8b는 웨이셀라 코리엔시스 DB1 균주의 배양액을 HPLC로 분석하여 생체아민 생성 여부를 확인한 그래프로, Standard는 생체아민 표준액의 HPLC 수행결과를 의미하고, DB1은 웨이셀라 코리엔시스 DB1 균주 배양액의 HPLC 수행결과를 의미한다.
도 9는 본 발명의 일 실시예에 따른, 1%(w/v) 아르기닌 및 20%(w/v) 미강이 혼합된 미강 혼합물에서 pH에 따른 웨이셀라 코리엔시스 DB1 균주의 생육활성도를 나타낸 그래프로, 상기 그래프의 가로축은 배양 배지의 pH 조건을 나타내고, 상기 그래프의 세로축은 미생물 생육 정도(log CFU/mL)를 나타내며, 보라색(24 h)은 24시간 배양한 결과를 나타내고, 파란색(48 h)은 48시간 배양한 결과를 나타낸다.
도 10은 본 발명의 일 실시예에 따른, 1%(w/v) 아르기닌 및 20%(w/v) 미강이 혼합된 미강 혼합물에서 발효 온도에 따른 웨이셀라 코리엔시스 DB1 균주의 생육활성도를 나타낸 그래프로, 상기 그래프의 가로축은 배양 온도 조건을 나타내고, 상기 그래프의 세로축은 미생물 생육 정도(log CFU/mL)를 나타내며, 보라색(24 h)은 24시간 배양한 결과를 나타내고, 파란색(48 h)은 48시간 배양한 결과를 나타낸다.
도 11은 본 발명의 일 실시예에 따른, 건조법에 따른 최종 미강 발효물의 결과를 나타낸 사진으로, 도 11a는 동결건조법으로 건조한 미강 발효물을 촬영한 사진이고, 도 11b는 열풍건조법으로 건조한 미강 발효물을 촬영한 사진이다.
도 12는 본 발명의 일 실시예에 따른, 부고환 조직의 지방세포를 Hematoxylin과 Eosin(H&E)으로 염색하여 관찰한 결과를 나타낸 사진으로, ND는 정상식이군을 의미하고, HFCD는 고지방고콜레스테롤식이군을 의미하며, HFCD-RB는 미강원물 첨가 고지방고콜레스테롤식이군을 의미하고, HFCD-FRB는 미강 발효 열풍 건조물 첨가 고지방고콜레스테롤식이군을 의미한다.
도 13은 본 발명의 일 실시예에 따른, 부고환 조직의 지방세포를 Hematoxylin과 Eosin(H&E)으로 염색하여 지방세포의 크기를 측정한 결과를 나타낸 그래프로, 상기 그래프의 세로축은 지방세포의 평균 크기(Adipocyte size)를 의미하고, 상기 그래프의 가로축은 각각의 실험군을 의미하며, ND는 정상식이군을 의미하고, HFCD는 고지방고콜레스테롤식이군을 의미하며, HFCD-RB는 미강원물 첨가 고지방고콜레스테롤식이군을 의미하고, HFCD-FRB는 미강 발효 열풍 건조물 첨가 고지방고콜레스테롤식이군을 의미한다.
도 14는 본 발명의 일 실시예에 따른, 간 조직을 Oil-Red O 용액으로 염색하여 간 조직의 지방침착도를 확인한 결과를 나타낸 사진으로, ND는 정상식이군을 의미하고, HFCD는 고지방고콜레스테롤식이군을 의미하며, HFCD-RB는 미강원물 첨가 고지방고콜레스테롤식이군을 의미하고, HFCD-FRB는 미강 발효 열풍 건조물 첨가 고지방고콜레스테롤식이군을 의미한다.
1 is a map showing the producing areas of kimchi obtained in various regions of Korea to secure kimchi lactic acid bacteria according to an embodiment of the present invention.
2 is a result of confirming the ornithine production ability of lactic acid bacteria isolated from kimchi obtained in various regions according to an embodiment of the present invention, the lower part of the photo shows the strain number, and the upper part of the photo The abbreviation indicates the strain name, and Arginine and Ornithine indicate the positions of arginine and ornithine.
3 is a diagram showing the nucleotide sequence of 16S rRNA of Weisella coriensis DB1 strain according to an embodiment of the present invention.
Figure 4 is a graph showing the growth activity according to the temperature of the Weissella coriensis DB1 strain according to an embodiment of the present invention, the horizontal axis of the graph represents the incubation time (hr), the vertical axis of the graph is the degree of microbial growth (Absorbance, A 600 ), and the number at the top of the graph indicates the culture temperature.
Figure 5 is a graph showing the growth activity according to the pH of the Weissella coriensis DB1 strain according to an embodiment of the present invention, the horizontal axis of the graph represents the pH condition of the culture medium, the vertical axis of the graph is the degree of microbial growth It represents (log CFU/mL).
6 is a graph showing the growth activity according to pH in a medium to which 1% (w/v) arginine of Weissella coriensis DB1 strain according to an embodiment of the present invention is added, and the horizontal axis of the graph is of the culture medium. It represents the pH condition, and the vertical axis of the graph represents the degree of microbial growth (absorbance, A 600 ). In the graph, Control refers to a control group in which 1% (w/v) arginine is added to the MRS medium and pH is not separately adjusted.
7 is a photograph confirming the hemolysis reaction in order to confirm the safety of the Weisella coriensis DB1 strain according to an embodiment of the present invention.
Figure 8 is a result of confirming whether or not bioamine is produced in order to confirm the safety of the Weisella coriensis DB1 strain according to an embodiment of the present invention, and Figure 8a is a positive control Enterococcus faecalis strain (Enterococcus faecalis ATCC 29212). ), and the decarboxylase ability check experiment (Decarboxylase plate method, Bover-Cid) was performed, ATCC 29212 means Enterococcus faecalis strain (Enterococcus faecalis ATCC 29212), DB1 is Weissella coriensis DB1 Means a strain, Figure 8b is a graph confirming the production of bioamine by analyzing the culture medium of Weisella coriensis DB1 strain by HPLC, Standard means the result of HPLC performance of the bioamine standard solution, DB1 is Weisella coriensis DB1 It means the result of HPLC performance of the strain culture solution.
FIG. 9 is a graph showing the growth activity of Weicella coriensis DB1 strain according to pH in a rice bran mixture in which 1% (w/v) arginine and 20% (w/v) rice bran are mixed according to an embodiment of the present invention. As, the horizontal axis of the graph represents the pH condition of the culture medium, the vertical axis of the graph represents the degree of microbial growth (log CFU/mL), purple (24 h) represents the result of culturing for 24 hours, and blue (48 h ) Represents the result of incubation for 48 hours.
FIG. 10 shows the growth activity of Weisella coriensis DB1 strain according to fermentation temperature in a rice bran mixture in which 1% (w/v) arginine and 20% (w/v) rice bran are mixed according to an embodiment of the present invention. As a graph, the horizontal axis of the graph represents the culture temperature condition, the vertical axis of the graph represents the degree of microbial growth (log CFU/mL), purple (24 h) represents the result of culturing for 24 hours, and blue (48 h) Represents the result of incubation for 48 hours.
Figure 11 is a photograph showing the result of the final rice bran fermentation according to the drying method according to an embodiment of the present invention, Figure 11a is a photograph taken of the rice bran fermentation dried by the freeze drying method, Figure 11b is a rice bran fermentation dried by the hot air drying method This is a picture of water.
12 is a photograph showing the results of observation by staining adipocytes of epididymis tissue with Hematoxylin and Eosin (H&E) according to an embodiment of the present invention, where ND means a normal diet group, and HFCD is a high fat high cholesterol diet group. Means, and HFCD-RB refers to a high fat high cholesterol diet group with rice bran added, and HFCD-FRB refers to a high fat high cholesterol diet group with rice bran fermentation hot air dried product.
13 is a graph showing the results of measuring the size of adipocytes by staining adipocytes of epididymis tissue with Hematoxylin and Eosin (H&E) according to an embodiment of the present invention, and the vertical axis of the graph is an average size of adipocytes. (Adipocyte size), the horizontal axis of the graph refers to each experimental group, ND refers to the normal diet group, HFCD refers to the high fat high cholesterol diet group, and HFCD-RB refers to the high fat high cholesterol supplemented with rice bran It means a diet group, and HFCD-FRB means a high fat high cholesterol diet group added with hot air dried rice fermented rice.
FIG. 14 is a photograph showing the results of confirming the adherence of liver tissue by staining liver tissue with Oil-Red O solution according to an embodiment of the present invention, where ND means a normal diet group, and HFCD is high fat high cholesterol. It means a diet group, HFCD-RB means a high fat high cholesterol diet group with rice bran added, and HFCD-FRB means a high fat high cholesterol diet group with rice bran fermentation hot air dried product.

본 명세서 전체에 걸쳐 다수의 인용문헌이 참조되고 그 인용이 표시되어 있다. 인용문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.Throughout this specification, a number of citations are referenced and the citations are indicated. The disclosure contents of the cited documents are incorporated by reference in this specification as a whole, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly described.

본 발명은 항비만 활성이 개선된 발효 미강 즉, 시트룰린(Citrulline) 및 오르니틴(Ornithine) 함량이 증가된 미강 발효물의 제조 및 활용에 관한 것이다.The present invention relates to the production and utilization of fermented rice bran with improved anti-obesity activity, that is, rice bran fermented product with increased content of citrulline and ornithine.

구체적으로, 본 발명은 미강 발효에 최적인 유산균, 구체적으로 미강으로부터 항비만 효과를 갖는 물질인 시트룰린(Citrulline) 및 오르니틴(Ornithine)을 효과적으로 생산할 수 있는 미생물에 관한 것이다.Specifically, the present invention relates to a microorganism capable of effectively producing lactic acid bacteria that are optimal for fermentation of rice bran, specifically citrulline and ornithine, which are substances having an anti-obesity effect from rice bran.

더욱 구체적으로, 본 발명은 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주에 관한 것이다. More specifically, the present invention relates to a Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) strain isolated from kimchi and having citrulline and ornithine-producing ability.

상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주는 바람직하게는 아르기닌(Arginine)이 첨가된 배지에서 최적 생육 pH가 pH 5.0인 것일 수 있다.The Weissella koreensis DB1 (KCTC 13653BP) strain may preferably have an optimal growth pH of 5.0 in a medium to which arginine is added.

또한, 본 발명은 상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 이용하여 기능성이 강화된 미강 발효물, 구체적으로, 시트룰린(Citrulline) 및 오르니틴(Ornithine) 함량이 증가된 미강 발효물을 제조하는 방법에 관한 것이다.In addition, the present invention is a rice bran fermentation product with enhanced functionality using the Weissella koreensis DB1 (KCTC 13653BP) strain, specifically, rice bran fermentation with increased citrulline and ornithine content. It relates to a method of making water.

더욱 구체적으로, 본 발명은 미강 발효물 제조방법에 있어서, 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하는 단계를 포함하는 것을 특징으로 하는 미강 발효물 제조방법에 관한 것이다. More specifically, the present invention comprises the step of adding a Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) strain isolated from the kimchi and having citrulline and ornithine production ability in the method for producing fermented rice bran in the present invention. It relates to a method for producing fermented rice bran, characterized in that.

또한, 본 발명은 미강, 아르기닌(Arginine) 및 물을 혼합하여 혼합물을 제조하는 발효원물 제조단계; 상기 혼합물을 가열하여 미강을 호화시켜 호화 미강 혼합물을 제조하는 호화 미강 제조단계; 상기 호화 미강 혼합물에 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하는 균주 첨가 단계; 및 상기 균주가 첨가된 호화 미강 혼합물을 발효하여 미강 발효물을 제조하는 발효 단계를 포함하는 것을 특징으로 하는 미강 발효물 제조방법에 관한 것이다.In addition, the present invention is a fermentation raw material production step of mixing rice bran, arginine and water to prepare a mixture; Gelatinized rice bran manufacturing step of preparing a gelatinized rice bran mixture by heating the mixture to gelatinize the rice bran; A strain addition step of adding a Weissella koreensis DB1 (KCTC 13653BP) strain isolated from the kimchi and having citrulline and ornithine producing ability to the gelatinized rice bran mixture; And a fermentation step of fermenting the gelatinized rice bran mixture to which the strain is added to prepare a rice bran fermentation product.

상기 발효원물 제조단계는 상기 혼합물에 미강을 10%(w/v) 내지 80%(w/v)의 농도로 첨가하고, 아르기닌(Arginine)을 0.1%(w/v) 내지 5%(w/v)의 농도로 첨가하는 방법으로 수행할 수 있다. 더욱 구체적으로, 상기 발효원물 제조단계는 물, 미강 및 아르기닌을 혼합하여 제조된 상기 혼합물 전체 부피를 기준으로 미강을 10%(w/v) 내지 80%(w/v)의 농도로 첨가하고, 아르기닌(Arginine)을 0.1%(w/v) 내지 5%(w/v)의 농도로 첨가하는 방법으로 수행할 수 있다.In the fermentation raw material manufacturing step, rice bran is added to the mixture at a concentration of 10% (w/v) to 80% (w/v), and arginine is added to 0.1% (w/v) to 5% (w/v). It can be carried out by adding at a concentration of v). More specifically, in the step of preparing the fermentation raw material, rice bran is added at a concentration of 10% (w/v) to 80% (w/v) based on the total volume of the mixture prepared by mixing water, rice bran and arginine, It can be carried out by adding arginine at a concentration of 0.1% (w/v) to 5% (w/v).

상기 호화 미강 제조단계는 상기 혼합물을 100℃ 내지 140℃의 온도 조건 및 0.9 기압 내지 1.5 기압의 압력 조건에서 10분 내지 20분 동안 가열하여 미강을 호화시키는 방법으로 수행할 수 있다.The step of preparing the gelatinized rice bran may be performed by heating the mixture under a temperature condition of 100°C to 140°C and a pressure condition of 0.9 to 1.5 atm for 10 to 20 minutes to gelatinize the rice bran.

상기 발효 단계는 상기 균주가 첨가된 호화 미강 혼합물의 초기 pH가 pH 6.0 내지 pH 6.5이고, 발효 온도가 25℃ 내지 30℃인 조건에서 발효시키는 방법으로 수행할 수 있다.The fermentation step may be carried out by fermenting under the condition that the initial pH of the gelatinized rice bran mixture to which the strain is added is pH 6.0 to pH 6.5 and the fermentation temperature is 25°C to 30°C.

또한, 상기 미강 발효물 제조방법은 상기 미강 발효물을 건조하는 미강 발효물 건조 단계를 더욱 포함할 수 있다.In addition, the method for manufacturing the fermented rice bran may further include a step of drying the fermented rice bran of drying the fermented rice bran.

상기 건조 단계는 30℃ 내지 60℃의 온도 조건에서 1시간 내지 40시간 동안 열풍 건조법으로 수행하거나 - 50℃ 내지 - 80℃의 온도 조건에서 20시간 내지 100시간 동안 동결 건조법으로 수행할 수 있다.The drying step may be performed by a hot air drying method for 1 hour to 40 hours at a temperature condition of 30°C to 60°C, or a freeze drying method for 20 hours to 100 hours at a temperature condition of -50°C to -80°C.

또한, 본 발명은 상기 미강 발효물 제조방법으로 제조된 미강 발효물에 관한 것이다.In addition, the present invention relates to a rice bran fermented product produced by the method for producing the rice bran fermented product.

상기 미강 발효물은 바람직하게는 미강 발효물 내에 시트룰린 함량이 2,500 mg/kg 내지 3,500 mg/kg이고, 오르니틴 함량이 5,500 mg/kg 내지 10,500 mg/kg인 것일 수 있다.The fermented rice bran may preferably have a citrulline content of 2,500 mg/kg to 3,500 mg/kg and an ornithine content of 5,500 mg/kg to 10,500 mg/kg in the fermented rice bran.

또한, 본 발명은 상기 미강 발효물을 유효성분으로 포함하는 비만 예방용 식품 조성물에 관한 것이다.In addition, the present invention relates to a food composition for preventing obesity comprising the fermented rice bran as an active ingredient.

상기 비만 예방용 식품 조성물은 바람직하게는 건강기능성 식품일 수 있다.The food composition for preventing obesity may preferably be a health functional food.

본 명세서에서 특별한 언급이 없는 한, 배양물이란 특정 미생물을 배양배지 또는 배양액에서 배양한 것을 의미한다. 상기 배양물 또는 배양물의 농축물은 그 제형이 한정되지 아니하고, 일 예로 상기 제형은 액체 또는 고체일 수 있다.Unless otherwise specified in the specification, a culture means that a specific microorganism is cultured in a culture medium or a culture medium. The formulation of the culture or the concentrate of the culture is not limited, and for example, the formulation may be liquid or solid.

본 명세서에서 특별한 언급이 없는 한, 배지(culture medium)란 특정 미생물이나 동식물의 조직을 배양하기 위하여, 배양대상 즉, 배양체가 되는 미생물이나 동식물의 조직이 필요로 하는 영양물질을 포함하는 것으로 특수한 목적을 위한 물질이 추가로 첨가되어 혼합된 것일 수 있다. 상기 배지는 천연배지, 합성배지 또는 선택배지를 모두 포함하는 개념이고, 성상에 따라 고체배지 또는 액체배지를 포함하는 개념이다.Unless otherwise specified in the specification, a culture medium is a special purpose to contain nutrients required by a culture target, that is, a microorganism or a tissue of an animal or plant to be cultured in order to cultivate a specific microorganism or tissue of an animal or plant. A material for may be added and mixed. The medium is a concept including all of a natural medium, a synthetic medium or a selective medium, and a concept including a solid medium or a liquid medium depending on the properties.

본 명세서에서 특별한 언급이 없는 한, 배양액이란 액체배지에 균주를 접종하여 배양하는 것을 의미한다. 또한, 배양액의 농축액이란 상기 배양액을 농축한 것을 말하고, 배양액의 건조물이란 상기 배양액의 물기를 없앤 것을 의미한다.Unless otherwise specified in the specification, the culture medium means inoculating and culturing the strain in a liquid medium. In addition, the concentrated solution of the culture solution means that the culture solution is concentrated, and the dried product of the culture solution means that the culture solution has been drained of water.

본 명세서에서 특별한 언급이 없는 한, 발효용 스타터(stater)란 발효에 관여하는 유산균 또는 세균 등을 포함하는 미생물, 이의 배양물, 상기 배양물의 농축물 및 상기 배양물의 건조물로 이루어진 군 중에서 선택된 어느 하나를 포함하는 제제 또는 조성물을 의미한다. 상기 발효용 스타터는 발효식품 등의 생산 시 첨가하여 발효식품에서 생장할 수 있는 미생물 또는 우점종으로 생장할 수 있는 미생물을 제공하기 위하여 사용된다.Unless otherwise specified in the specification, a fermentation starter is any one selected from the group consisting of microorganisms including lactic acid bacteria or bacteria involved in fermentation, a culture thereof, a concentrate of the culture, and a dried product of the culture. It means a formulation or composition containing. The fermentation starter is added to the production of fermented foods and the like and is used to provide microorganisms that can grow in fermented foods or as dominant species.

상기 발효용 스타터를 사용하여 발효식품을 제조하는 경우, 상기 발효용 스타터에 포함된 미생물에 의하여 발효식품의 품질을 일정하게 조절하거나, 발효의 속도 또는 단계를 조절할 수 있으며, 특정한 목적을 달성한 발효 식품을 제조할 수 있다.In the case of manufacturing fermented food using the fermentation starter, the quality of the fermented food can be regulated by microorganisms included in the fermentation starter, or the speed or stage of fermentation can be controlled, and fermentation that achieves a specific purpose You can make food.

본 명세서에서 특별한 언급이 없는 한, 종균이란 발효에 이용되는 미생물로서, 발효를 위하여 기질 또는 식품에 접종되는 미생물을 의미하고, 종균 조성물이란 발효를 개시하는데 필요한 하나 이상의 접종균체를 유효성분으로 포함하는 조성물을 의미한다.Unless otherwise specified in the specification, a seed is a microorganism used for fermentation, and refers to a microorganism inoculated into a substrate or food for fermentation, and the seed composition includes as an active ingredient one or more inoculum required to initiate fermentation. Means composition.

본 명세서에서 특별한 언급이 없는 한, 호화(gelatinization)란 전분 등을 수중에서 가열하거나 알칼리 용액과 같은 용매로 처리하는 경우, 열과 수분에 의해 팽창되어 그 물리 화학적 성질이나 구조가 변하여 점도 증가, 수용성 증가나 부피 증가 등의 성질을 가지는 쪽으로 변화되는 과정 또는 전체가 반투명인 거의 균일한 콜로이드 물질이 되는 현상을 의미하며, 젤라틴화라고도 불리운다.Unless otherwise specified in the specification, gelatinization refers to an increase in viscosity and water solubility due to changes in physicochemical properties or structure due to expansion by heat and moisture in the case of heating starch or the like in water or treating with a solvent such as an alkali solution. It refers to a process that changes toward having properties such as an increase in volume, or a phenomenon in which the whole becomes a semi-transparent, almost uniform colloidal material, and is also called gelatinization.

본 명세서에서 특별한 언급이 없는 한, 식품이란 영양소를 한 가지 또는 그 이상 함유하고 있는 천연물 또는 가공품을 의미하고, 바람직하게는 어느 정도의 가공 공정을 거쳐 직접 먹을 수 있는 상태가 된 것을 의미하며, 그 예로는 과일, 야채, 과일이나 야채의 건조제품이나 절단제품, 과일쥬스, 야채쥬스, 이들의 혼합쥬스이거나 칩류, 면류, 축산가공식품, 수산가공식품, 유가공식품, 발효식품, 두류식품, 곡류식품, 미생물발효식품, 제과제빵, 양념류, 육가공류, 산성음료수, 감초류, 허브류 등이 있으며 본 발명에서 발효식품, 기능성 식품 및 가공식품을 포함하는 것을 의미하나 이에 한정되는 것은 아니다.Unless otherwise specified in the specification, food refers to a natural product or processed product containing one or more nutrients, and preferably refers to a state that can be eaten directly through a certain degree of processing, and the Examples are fruits, vegetables, dried or cut products of fruits or vegetables, fruit juice, vegetable juice, mixed juices or chips, noodles, processed livestock food, processed seafood, dairy processed food, fermented food, bean food, grain food , Microbial fermented food, bakery, seasonings, processed meats, acidic beverages, licorice, herbs, and the like. In the present invention, it means including fermented foods, functional foods and processed foods, but is not limited thereto.

본 명세서에서 특별한 언급이 없는 한, 발효식품이란 유산균이나 효소 등 미생물을 한가지 또는 둘 이상 첨가하고 상기 미생물의 발효 작용을 이용하여 만든 식품을 의미하며, 상세하게는 식품 기재에 발효식품용 종균을 첨가하고 숙성시켜 제조하는 식품을 의미한다. 상기 발효식품으로는 주류, 빵류, 김치, 젓갈, 된장, 간장, 치즈, 버터, 요구르트 등 발효식품 모두가 포함된다.Unless otherwise specified in the specification, fermented food refers to food made by adding one or more microorganisms such as lactic acid bacteria or enzymes and using the fermentation action of the microorganisms, and in detail, fermented food seeds are added to the food substrate. It refers to food produced by aging and aging. The fermented food includes all fermented foods such as liquor, bread, kimchi, salted fish, miso, soy sauce, cheese, butter, and yogurt.

본 발명자들은 미강의 활용도를 높이기 위하여 다양한 연구를 수행하던 중, 미강의 항비만 효과, 배변 촉진 즉, 항변비 효과의 기능성에 착안하여 미강의 항비만 효과를 개선하는 것을 선택하여, 식품에 사용할 수 있는 GRAS 미생물인 유산균을 이용하여 항비만 효과 개선을 위해 시트룰린(Citrulline) 및 오르니틴(Ornithine)의 함량을 증가시키는 방법을 연구하였으며, 대한민국 전 지역에서 수집된 김치로부터 분리된 다양한 미생물을 대상으로 실험을 수행한 결과, 신규한 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1) 균주가 물에 아르기닌(Arginine) 및 미강을 첨가하여 제조된 아르기닌이 첨가된 미강 혼합물에서 효과적으로 시트룰린(Citrulline) 및 오르니틴(Ornithine) 함량을 증가시킬 수 있음을 확인하였고, 이에 추가로 연구를 진행하여 웨이셀라 코리엔시스 DB1 균주의 아르기닌이 첨가된 미강 혼합물 배지에서 최적 배양 pH 및 최적 배양 온도를 확인하였으며, 최종 제품 생산과 관련하여 최적 건조 조건을 확인하여 이를 기초로 본 발명을 완성하였다.The inventors of the present invention selected to improve the anti-obesity effect of rice bran by focusing on the anti-obesity effect of rice bran, facilitating bowel movement, that is, the function of anti-constipation effect, while conducting various studies to increase the utilization of rice bran, and can be used in food. A method of increasing the content of citrulline and ornithine was studied to improve the anti-obesity effect using lactic acid bacteria, which are GRAS microorganisms, and various microorganisms isolated from kimchi collected in all regions of Korea were studied. As a result of performing, the novel Weissella koreensis DB1 strain effectively produced citrulline and ornithine in an arginine-added rice bran mixture prepared by adding arginine and rice bran to water. It was confirmed that the content could be increased, and further research was conducted to confirm the optimum culture pH and optimum culture temperature in the arginine-added rice bran mixture medium of Weicella coriensis DB1 strain. By checking the drying conditions, the present invention was completed based on this.

이하, 본 발명을 보다 상세하게 설명한다.Hereinafter, the present invention will be described in more detail.

본 발명은 미강 발효에 최적인 유산균, 구체적으로 미강으로부터 항비만 효과를 갖는 물질인 시트룰린(Citrulline) 및 오르니틴(Ornithine)을 효과적으로 생산할 수 있는 미생물에 관한 것이다.The present invention relates to a microorganism capable of effectively producing lactic acid bacteria that are optimal for fermentation of rice bran, specifically citrulline and ornithine, which are substances having an anti-obesity effect from rice bran.

상기 미생물은 구체적으로 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주일 수 있다.The microorganism is specifically isolated from kimchi, and may be a Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) strain having citrulline and ornithine-producing ability.

상기 DB1 균주는 본 발명자에 의해 분리 및 동정되어 최초로 보고된 균주로, 김치로부터 분리된 유산균이며, 그람 양성의 단간균으로 확인되었다. 상기 DB1 균주는 D-글루코스(D-Glucose), D-프룩토오스(D-Fructose), D-만노스(D-Mannose), L-아라비노스(L-Arabinose), 리보스(Ribose), D-자일로스(D-Xylose) 및 N-아세틸 글루코사민(N-Acetyl glucosamine)에 대한 당대사능이 있는 것으로 확인되었다. 또한, 16S rRNA 염기서열이 웨이셀라 코리엔시스 S-5623T와 99.86%의 상동성을 가져 웨이셀라 코리엔시스로 동정되었다. 상기 웨이셀라 코리엔시스 DB1 균주는 한국생명공학연구원 생물자원센터에 2018년 10월 2일자로 기탁하여 수탁번호 KCTC 13653BP를 부여 받았다.The DB1 strain was isolated and identified by the present inventors and is the first reported strain, lactic acid bacteria isolated from kimchi, and was identified as a Gram-positive monobacterial. The DB1 strain is D-Glucose, D-Fructose, D-Mannose, L-Arabinose, Ribose, D- It was found to have glucose metabolism for xylose (D-Xylose) and N-acetyl glucosamine (N-Acetyl glucosamine). In addition, the 16S rRNA nucleotide sequence was identified as Weisella coriensis with 99.86% homology with Weisella coriensis S-5623 T. The Weisella coriensis DB1 strain was deposited with the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center on October 2, 2018, and was given the accession number KCTC 13653BP.

상기 웨이셀라 코리엔시스 DB1 균주는 통상의 유산균 배지에서 생육 가능하며, 일 예로 MRS 액체배지 또는 MRS 고체배지나 상기 MRS 액체배지 또는 MRS 고체배지에 아르기닌(Arginine)이 첨가된 배지에서 배양할 수 있다.The Weisella coriensis DB1 strain can be grown in a conventional lactic acid bacteria medium, for example, MRS liquid medium or MRS solid medium, or the MRS liquid medium or MRS solid medium can be cultured in a medium to which arginine is added.

상기 웨이셀라 코리엔시스 DB1 균주는 아르기닌(Arginine) 또는 미강으로부터 항비만 활성이 우수한 물질인 시트룰린 및 오르니틴을 생산할 수 있을 뿐만 아니라, 다른 균주 및 웨이셀라 속의 다른 균주에 비해 시트룰린 생산능 및 오르니틴 생산능이 현저하게 우수하다. 또한, 상기 웨이셀라 코리엔시스 DB1 균주의 생육 활성은 pH 6.0 내지 pH 8.0의 pH 범위에서 최적인 반면, 아르기닌이 첨가된 배지에서는 pH 5.0에서 최적이고, 아르기닌이 첨가된 미강 혼합물에서는 pH 6.0 내지 pH 6.5의 pH 범위에서 최적인 것으로 확인되었으며, 용혈성 시험, 항생제 내성 및 바이오제닉아민(Biogenic amine) 생성능을 통해 확인한 결과 안전성이 매우 우수한 것으로 확인되었다.The Weisella coriensis DB1 strain can produce citrulline and ornithine, which are substances having excellent anti-obesity activity from arginine or rice bran, as well as citrulline production ability and ornithine production compared to other strains and other strains of the genus Weisella. The ability is remarkably excellent. In addition, the growth activity of the Weisella coriensis DB1 strain is optimal in the pH range of pH 6.0 to pH 8.0, whereas it is optimal at pH 5.0 in the medium to which arginine is added, and pH 6.0 to pH 6.5 in the rice bran mixture to which arginine is added. It was found to be optimal in the pH range of, and as a result of the hemolytic test, antibiotic resistance, and biogenic amine production ability, the safety was confirmed to be very excellent.

구체적으로, 상기 웨이셀라 코리엔시스 DB1 균주는 MRS 배지에서의 생육 최적 pH가 pH 6.0 내지 pH 8.0인 반면, 아르기닌이 첨가된 MRS 배지, 구체적으로 아르기닌이 배지 전체 부피를 기준으로 1%(w/w) 첨가된 MRS 배지에서 최적 pH는 pH 5.0이며, 아르기닌이 첨가된 미강 혼합물, 구체적으로 아르기닌이 전체 혼합물 부피를 기준으로 1%(w/v) 첨가되고, 미강이 전체 혼합물 부피를 기준으로 20%(w/v) 첨가된 미강 혼합물 에서 생육 최적 pH가 pH 6.0 내지 pH 6.5인 균주일 수 있다.Specifically, the Weisella coriensis DB1 strain has an optimum pH of growth in the MRS medium of pH 6.0 to pH 8.0, whereas the MRS medium containing arginine, specifically arginine is 1% (w/w) based on the total volume of the medium. ) In the added MRS medium, the optimum pH is pH 5.0, and arginine is added to the rice bran mixture, specifically, arginine is added by 1% (w/v) based on the total volume of the mixture, and rice bran is 20% based on the total volume of the mixture. (w/v) It may be a strain having an optimum pH of pH 6.0 to pH 6.5 grown in the added rice bran mixture.

상기 오르니틴(Ornithine, C5H12N202)은 단백질을 구성하는 아미노산은 아니나, 식품에 통상 함유돠어 있는 아미노산으로, 일 예로 담수성 쌍각류조개나 재첩 등에 다량으로 포함되어 있다. 상기 오르니틴은 항비만 활성, 근육합성 유도, 성장호르몬(Growth Hormone, GH) 분비, 기초대사 촉진, 간기능 개선 및 피부미용 개선 효과가 있는 것으로 알려져 있다. 일 예로, 상기 상기 오르니틴은 성장호르몬을 분비시켜 근육의 합성을 증가시키며, 기초대사를 촉진시켜 비만을 예방하는 식품소재로서 미국이나 유럽 국가를 중심으로 식이보조제나 의약품으로 많이 이용되고 있으며, 최근에는 주름살 개선과 같은 피부미용 효과 등 새로운 기능성을 갖는 것으로 밝혀졌다. 또한, 일본에서는 L-오르니틴 염산염의 형태로 식품소재로서 사용가능한 현실이나, 국내에서는 아직 식약청에 식품첨가물로 등재되어 있지 않아 사용이 곤란한 실정이다. 따라서, 국내에서는 오르니틴을 첨가물로 첨가하는 것이 아닌, 발효과정에서 오르니틴의 함량을 증가시켜 오르니틴의 함량이 증가된 발효식품 형태로 사용될 수 있다. The ornithine (Ornithine, C 5 H 12 N 2 0 2 ) is not an amino acid constituting a protein, but is an amino acid that is usually contained in food, and is included in a large amount, for example, in freshwater bivalve clams or rapeseeds. The ornithine is known to have anti-obesity activity, induction of muscle synthesis, secretion of growth hormone (GH), promotion of basic metabolism, improvement of liver function, and improvement of skin beauty. For example, the ornithine is a food material that increases muscle synthesis by secreting growth hormone and promotes basal metabolism to prevent obesity, and has been widely used as a dietary supplement or medicine in the United States and European countries. It was found to have new functionalities such as skin care effects such as wrinkle improvement. In addition, in Japan, it can be used as a food material in the form of L-ornithine hydrochloride, but in Korea, it is difficult to use because it is not yet registered as a food additive by the KFDA. Therefore, in Korea, ornithine is not added as an additive, but may be used in the form of a fermented food in which the ornithine content is increased by increasing the content of ornithine during the fermentation process.

현재까지 발효과정에서 오르니틴을 생성하여 발효식품의 오르니틴 함량을 증가시키는 연구는 서구의 대표적 발효식품인 치즈와 같은 유제품 관련하여 진행되어 있으며, 우리 전통 발효식품인 김치, 장류 또는 젖갈과 관련해서는 그 연구가 매우 제한적인 실정이다. 현재까지 발표된 연구 결과도 한국등록특허 제096258호나 한국공개특허 제2017-0073839호 또는 한국공개특허 제2012-0021788호와 같이 오르니틴을 생성할 수 있는 유산균에 대한 것으로, 오르니틴 생성능이 산업적으로 이용되기에는 제한적인 연구만이 진행된 실정이다.Until now, studies to increase the content of ornithine in fermented foods by producing ornithine during the fermentation process have been conducted in relation to dairy products such as cheese, a representative fermented food in the West. The research is very limited. Research results published so far are also on lactic acid bacteria capable of producing ornithine, such as Korean Patent No. 096258, Korean Patent Publication No. 2017-0073839, or Korean Patent Publication No. 2012-0021788. Only limited research has been conducted to be used.

상기 시트룰린(Citrulline, C6H13N303)은 박과 식물의 씨 속에 존재하는 아미노산으로, 유리 아미노산으로서 자연계에 존재하는 것이 밝혀져 있을 뿐, 단백질을 구성하는 아미노산 성분으로 존재하는지는 여부는 분명하지 않은 것으로 알려져 있다. 상기 시트룰린은 항비만 활성, 근육합성 유도, 이뇨작용 및 혈행 개선 효과가 있는 것으로 알려져 있다. 일 예로, 상기 시트룰린은 체내에서 산화물질 즉, 활성산소 제거능 혈관 확장에 의한 혈류 개선능을 갖고 있어 고혈압에 효과가 있는 것으로 알려져 있고, 신장병 및 변비에도 효과가 있는 것으로 알려져 있으며, 근육합성을 유도하고, 근육을 이완하여, 신체 기능을 개선하는 효과가 있는 것으로 알려져 있다. 따라서, 미국이나 유럽 등 서구 국가에서는 시트룰린을 의약품이나 기능성 식품 등의 형태로 섭취하고 있다.The citrulline (Citrulline, C 6 H 13 N 3 0 3 ) is an amino acid present in the seeds of the gourd family, and it has been found that it exists in nature as a free amino acid. It is not known to be clear. The citrulline is known to have anti-obesity activity, induction of muscle synthesis, diuretic and blood circulation improvement. For example, the citrulline is known to be effective in hypertension because it has the ability to improve blood flow by dilation of blood vessels, that is, the ability to remove free radicals in the body, and it is known to be effective in kidney disease and constipation, and induces muscle synthesis. , It is known to have the effect of relaxing muscles and improving body functions. Therefore, in western countries such as the United States and Europe, citrulline is consumed in the form of pharmaceuticals or functional foods.

다만, 우리나라에서는 한국등록특허 제1754227호나 한국공개특허 제2017-0033101호와 같이 시트룰린의 기능성을 확인하거나, 한국등록특허 제1038433호과 같이 수박 과피로부터 시트룰린을 추출하는 등 식물 특히, 박과 식물 소재로부터 시트룰린을 추출하는 연구만이 제한적으로 진행될 뿐, 발효균주 특히 우리 전통 발효식품 유래 유산균을 이용하여 시트룰린을 생산하는 연구는 전혀 진행되지 않은 것으로 조사되었다.However, in Korea, such as confirming the functionality of citrulline as in Korean Patent No. 1754227 or Korean Patent Publication No. 2017-0033101, or extracting citrulline from watermelon peels as in Korean Patent No. 1038433, etc. It has been investigated that only studies on extracting citrulline are limited, and studies on producing citrulline using lactic acid bacteria derived from fermented strains, especially Korean traditional fermented foods, have not been conducted at all.

또한, 본 발명은 상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 이용하여 기능성이 강화된 미강 발효물, 구체적으로, 시트룰린(Citrulline) 및 오르니틴(Ornithine) 함량이 증가된 미강 발효물을 제조하는 방법에 관한 것이다.In addition, the present invention is a rice bran fermentation product with enhanced functionality using the Weissella koreensis DB1 (KCTC 13653BP) strain, specifically, rice bran fermentation with increased citrulline and ornithine content. It relates to a method of making water.

상기 미강 발효물을 제조하는 방법은 미강 발효물 제조방법에 있어서, 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하는 단계 즉, 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하여 발효하는 즉, 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하여 미강을 발효시키는 단계를 포함하는 것일 수 있다.The method for preparing the fermented rice bran is a step of adding a strain of Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP), which is separated from the kimchi and has citrulline and ornithine production capacity, in the rice bran ferment production method. , Separated from the kimchi, and fermented by adding the Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) strain having citrulline and ornithine producing ability, that is, isolated from the kimchi, and having citrulline and ornithine production ability Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) may include the step of fermenting rice bran by adding a strain.

보다 구체적으로, 상기 미강 발효물을 제조하는 방법은 미강을 세척한 후, 미강, 아르기닌(Arginine) 및 물을 혼합하여 혼합물을 제조하는 발효원물 제조단계; 상기 혼합물을 가열하여 미강을 호화시켜 호화 미강 혼합물을 제조하는 호화 미강 제조단계; 상기 호화 미강 혼합물에 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하는 균주 첨가 단계; 및 상기 균주가 첨가된 호화 미강 혼합물을 발효하여 미강 발효물을 제조하는 발효 단계를 포함하는 것일 수 있다.More specifically, the method of preparing the fermented rice bran includes a fermentation raw material manufacturing step of preparing a mixture by washing rice bran, and then mixing rice bran, arginine, and water; Gelatinized rice bran manufacturing step of preparing a gelatinized rice bran mixture by heating the mixture to gelatinize the rice bran; A strain addition step of adding a Weissella koreensis DB1 (KCTC 13653BP) strain isolated from the kimchi and having citrulline and ornithine producing ability to the gelatinized rice bran mixture; And a fermentation step of fermenting the rice bran mixture to which the strain is added to prepare a rice bran fermentation product.

상기 발효란 효소 작용에 의해 복잡한 유기물이 간단한 화합물로 변화해 자유 에너지를 내놓는 현상으로, 일반적으로 미생물이 유기물을 분해해서 대사산물을 축적하는 현상을 의미한다. 상기 발효는 필수 아미노산을 생합성하거나 단백질 함량과 섬유질의 소화가능성을 개선함으로써, 식품의 영양학적 가치를 증가시키며, 칼슘이나 인 또는 다양한 비타민과 같은 미량영양소(micronutrient)의 생물학적 이용가능성(bioavailability )도 개선시킨다.The fermentation refers to a phenomenon in which a complex organic substance is converted into a simple compound by an enzyme action to release free energy, and generally refers to a phenomenon in which a microorganism decomposes an organic substance and accumulates metabolites. The fermentation increases the nutritional value of food by biosynthesizing essential amino acids or improving the digestibility of protein content and fiber, and also improves the bioavailability of micronutrients such as calcium, phosphorus or various vitamins. Let it.

이러한 발효과정에 사용되는 대표적인 미생물로, 유산균, 효모, 아세트산균 등이 있으며, 이 중 오랜 시간 동안 발효식품의 제조에 관여하여 안전성이 확보된 균주인 유산균(Lactic acid bacteria, LAB)이 주로 사용된다. 상기 유산균은 전 세계적으로 오랜 기간에 걸쳐 발효 식품 등 널리 식품으로 섭취되거나 식품의 발효 균주로 사용되어 안전성을 인정받은 미생물(GRAS, Generally Recognized As Safe)이다.Representative microorganisms used in this fermentation process include lactic acid bacteria, yeast, and acetic acid bacteria. Among them, lactic acid bacteria (LAB), a strain that has secured safety due to long-term fermented food manufacturing, is mainly used. . The lactic acid bacteria is a microorganism (GRAS, Generally Recognized As Safe) that has been widely ingested as food, such as fermented foods over a long period of time around the world, or has been used as a fermentation strain of foods and has been recognized for safety.

상기 발효원물 제조단계는 상기 혼합물에 미강을 10%(w/v) 내지 80%(w/v) 또는 12%(w/v) 내지 70%(w/v), 바람직하게는 15%(w/v) 내지 60%(w/v), 더 바람직하게는 17%(w/v) 내지 50%(w/v) 또는 20%(w/v) 내지 50%(w/v) 또는 19%(w/v) 내지 30%(w/v)의 농도로 첨가하고, 아르기닌(Arginine)을 0.1%(w/w) 내지 5%(w/w), 바람직하게는 0.1%(w/v) 내지 2%(w/v), 더 바람직하게는 0.2%(w/v) 내지 1.7%(w/v), 더더욱 바람직하게는 0.5%(w/v) 내지 1.5%(w/v)의 농도로 첨가하는 방법으로 수행할 수 있다. 더욱 구체적으로, 상기 발효원물 제조단계는 물, 미강 및 아르기닌을 혼합하여 제조된 상기 혼합물 전체 부피를 기준으로 미강을 10%(w/v) 내지 80%(w/v)의 농도로 첨가하고, 아르기닌(Arginine)을 0.1%(w/v) 내지 5%(w/v)의 농도로 첨가하는 방법으로 수행할 수 있다. 일 예로, 상기 발효원물 제조단계는 물에 미강, 구체적으로 세척 후 건조한 미강을 물, 미강 및 아르기닌을 혼합하여 제조된 상기 혼합물 전체 부피를 기준으로 10%(w/v) 내지 80%(w/v)의 농도로 첨가하고, 아르기닌(Arginine)을 물, 미강 및 아르기닌을 혼합하여 제조된 상기 혼합물 전체 부피를 기준으로 0.1%(w/v) 내지 5%(w/v)의 농도로 첨가한 후, 잘 섞일 수 있도록 교반하는 방법으로 수행할 수 있다.In the step of preparing the fermentation raw material, rice bran in the mixture is 10% (w/v) to 80% (w/v) or 12% (w/v) to 70% (w/v), preferably 15% (w /v) to 60% (w/v), more preferably 17% (w/v) to 50% (w/v) or 20% (w/v) to 50% (w/v) or 19% (w/v) to 30% (w/v), and arginine is added at a concentration of 0.1% (w/w) to 5% (w/w), preferably 0.1% (w/v) To 2% (w/v), more preferably 0.2% (w/v) to 1.7% (w/v), even more preferably 0.5% (w/v) to 1.5% (w/v) It can be carried out by a method of adding to. More specifically, in the step of preparing the fermentation raw material, rice bran is added at a concentration of 10% (w/v) to 80% (w/v) based on the total volume of the mixture prepared by mixing water, rice bran and arginine, It can be carried out by adding arginine at a concentration of 0.1% (w/v) to 5% (w/v). For example, the fermentation raw material manufacturing step is 10% (w/v) to 80% (w/v) based on the total volume of the mixture prepared by mixing rice bran, specifically washed and dried rice bran with water, rice bran, and arginine in water. v), and arginine was added at a concentration of 0.1% (w/v) to 5% (w/v) based on the total volume of the mixture prepared by mixing water, rice bran and arginine. After, it can be carried out by a method of stirring so that it can be well mixed.

상기 호화 미강 제조단계는 상기 혼합물을 80℃ 내지 160℃ 또는 100℃ 내지 140℃, 바람직하게는 110℃ 내지 130℃의 온도 조건 및 0.7 기압 내지 2.0 기압 또는 0.9 기압 내지 1.5 기압, 바람직하게는 1.0 기압 내지 1.25 기압의 압력 조건에서 1분 내지 60분, 바람직하게는 5분 내지 40분, 더 바람직하게는 10분 내지 20분 동안 가열하여 미강을 호화시키는 방법으로 수행할 수 있다. 상기 호화 미강 제조단계는 고온의 열을 가하는 것이므로, 미강을 호화시켜 발효 효율성을 증가시킬 뿐만 아니라, 상기 혼합물 즉, 미강 혼합물을 살균하여 발효 과정에서 본 발명의 균주가 아닌 다른 미생물에 의한 발효 효율의 저하나 부산물의 발생을 제어할 수 있다. 상기 호화 미강 제조단계는 가열 후, 상온, 일 예로 10℃ 내지 25℃ 또는 15℃ 내지 20℃까지 가열하여 호화시킨 미강 혼합물을 냉각하는 과정을 더 포함할 수 있다.The step of preparing the gelatinized rice bran is a temperature condition of 80°C to 160°C or 100°C to 140°C, preferably 110°C to 130°C, and 0.7 to 2.0 atm or 0.9 to 1.5 atm, preferably 1.0 atm It can be carried out by a method of gelatinizing the rice bran by heating for 1 minute to 60 minutes, preferably 5 minutes to 40 minutes, more preferably 10 minutes to 20 minutes under pressure conditions of to 1.25 atm. Since the step of preparing the gelatinized rice bran is to apply high temperature heat, not only the rice bran is gelatinized to increase fermentation efficiency, but also the mixture, that is, the rice bran mixture, is sterilized to increase the fermentation efficiency by microorganisms other than the strain of the present invention in the fermentation process. Deterioration or generation of by-products can be controlled. The step of preparing the gelatinized rice bran may further include a process of cooling the gelatinized rice bran mixture by heating to room temperature, for example, 10 ℃ to 25 ℃ or 15 ℃ to 20 ℃ after heating.

상기 균주 첨가 단계는 상기 호화 미강 혼합물에 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하는 방법으로 수행할 수 있다. 보다 구체적으로, 상기 균주 첨가 단계는 상기 균주 현탁액 또는 배양액을 상기 호화 미강 혼합물에 부피비를 기준으로 0.1%(v/v) 내지 10%(v/v) 또는 0.2%(v/v) 내지 5.0%(v/v) 또는 0.5%(v/v) 내지 2.0%(v/v)로 첨가할 수 있으며, 상기 균주 현탁액 또는 배양액의 균주 농도는 4 log CFU/mL 내지 9 log CFU/mL 또는 5 log CFU/mL 내지 8 log CFU/mL 또는 6 log CFU/mL 내지 7 log CFU/mL일 수 있다.The strain addition step may be performed by adding a Weissella koreensis DB1 (KCTC 13653BP) strain isolated from the kimchi to the gelatinized rice bran mixture and having citrulline and ornithine producing ability. More specifically, the step of adding the strain includes 0.1% (v/v) to 10% (v/v) or 0.2% (v/v) to 5.0% based on the volume ratio of the strain suspension or culture solution to the gelatinous rice bran mixture. (v/v) or 0.5% (v/v) to 2.0% (v/v) can be added, and the strain concentration of the strain suspension or culture is 4 log CFU/mL to 9 log CFU/mL or 5 log CFU/mL to 8 log CFU/mL or 6 log CFU/mL to 7 log CFU/mL.

상기 발효 단계는 상기 균주가 첨가된 호화 미강 혼합물의 초기 pH가 pH 5.0 내지 pH 8.0, 바람직하게는 pH 5.5 내지 pH 7.0, 가장 바람직하게는 pH 6.0 내지 pH 6.5인 pH 조건 및 발효 온도가 20℃ 내지 35℃, 바람직하게는 25℃ 내지 30℃인 온도 조건에서 발효시키는 방법으로 수행할 수 있다. In the fermentation step, the initial pH of the gelatinized rice bran mixture to which the strain is added is pH 5.0 to pH 8.0, preferably pH 5.5 to pH 7.0, most preferably pH 6.0 to pH 6.5, and the fermentation temperature is 20° C. It can be carried out by fermenting at a temperature condition of 35°C, preferably 25°C to 30°C.

상기 발효 단계는 상기 균주의 생육 최적 pH 또는 상기 균주의 아르기닌이 첨가된 배지에서의 생육 최적 pH와 달리 미강 발효에서의 최적 생육 pH로 발효를 수행함으로써, 발효 효율을 개선시킬 수 있다. 통상의 유산균이 배지 조성이 다른 경우에도 생육 최적 pH가 동일하거나 유사한 범위를 가지는 반면, 상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주는 미강 발효에 있어서 통사의 유산균 또는 웨이셀라 코리엔시스 균주의 최적 생육 pH와 다른 조건의 pH에서 최적 생육 활성을 갖는 것으로 확인되었고(도 7), 이러한 최적 pH에서 오르니틴 생성량도 최적인 것으로 확인되었으므로, 이러한 웨이셀라 코리엔시스 DB1 균주의 특성을 활용하여 미강 발효의 효율을 현저히 개선시킬 수 있다.The fermentation step may improve fermentation efficiency by performing the fermentation at the optimum growth pH in rice bran fermentation unlike the optimum growth pH in the culture medium to which the strain is added or the arginine of the strain is added. Whereas normal lactic acid bacteria have the same or similar range of growth optimal pH even when the medium composition is different, the Weissella koreensis DB1 (KCTC 13653BP) strain is a lactic acid bacteria or Weissella coriensis in rice bran fermentation. It was confirmed that the strain has optimal growth activity at a pH of a different condition than the optimal growth pH of the strain (Fig. 7), and since it was confirmed that the amount of ornithine production was also optimal at this optimal pH, the characteristics of the Weisella coriensis DB1 strain were utilized. It can significantly improve the efficiency of rice bran fermentation.

또한, 상기 미강 발효물 제조방법은 상기 미강 발효물을 건조하는 미강 발효물 건조 단계를 더욱 포함할 수 있다.In addition, the method for manufacturing the fermented rice bran may further include a step of drying the fermented rice bran of drying the fermented rice bran.

상기 건조 단계는 열풍 건조법으로, 바람직하게는 30℃ 내지 60℃의 온도 조건에서 1시간 내지 40시간 동안 열풍 건조법으로 수행하거나 동결 건조법, 바람직하게는 - 50℃ 내지 - 80℃의 온도 조건에서 20시간 내지 100시간 동안 동결 건조법으로 수행할 수 있다.The drying step is a hot air drying method, preferably performed by a hot air drying method for 1 hour to 40 hours at a temperature condition of 30°C to 60°C, or a freeze drying method, preferably at a temperature condition of -50°C to -80°C for 20 hours It can be carried out by a freeze drying method for up to 100 hours.

상기 열풍 건조는 30℃ 내지 60℃, 바람직하게는 40℃ 내지 50℃의 온도 조건에서 1시간 내지 40시간, 바람직하게는 5시간 내지 30시간, 더욱 바람직하게는 10시간 내지 20시간 동안 수행할 수 있다.The hot air drying can be performed for 1 hour to 40 hours, preferably 5 to 30 hours, more preferably 10 to 20 hours at a temperature condition of 30°C to 60°C, preferably 40°C to 50°C. have.

상기 동결 건조는 - 50℃ 내지 - 80℃, 바람직하게는 - 70℃ 내지 - 80℃의 온도 조건에서 20시간 내지 100시간, 바람직하게는 40시간 내지 80시간, 더욱 바람직하게는 48시간 내지 72시간 동안 수행할 수 있다.The freeze-drying is from -50°C to -80°C, preferably from -70°C to -80°C for 20 to 100 hours, preferably 40 to 80 hours, more preferably 48 to 72 hours While you can do it.

또한, 본 발명은 상기 미강 발효물 제조방법으로 제조된 미강 발효물일 수 있다. In addition, the present invention may be a rice bran fermented product manufactured by the method for producing a rice bran fermented product.

구체적으로, 상기 미강 발효물은 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하여 발효하는 단계를 포함하는 것을 특징으로 하는 미강 발효물 제조방법으로 제조된 미강 발효물 또는 미강, 아르기닌(Arginine) 및 물을 혼합하여 혼합물을 제조하는 발효원물 제조단계; 상기 혼합물을 가열하여 미강을 호화시켜 호화 미강 혼합물을 제조하는 호화 미강 제조단계; 상기 호화 미강 혼합물에 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하는 균주 첨가 단계; 및 상기 균주가 첨가된 호화 미강 혼합물을 발효하여 미강 발효물을 제조하는 발효 단계를 포함하는 것을 특징으로 하는 미강 발효물 제조방법으로 제조된 미강 발효물일 수 있다.Specifically, the fermented rice bran is separated from kimchi, and fermented rice bran fermentation comprising the step of fermenting by adding a strain of Weissella koreensis DB1 (KCTC 13653BP) having citrulline and ornithine producing ability. Rice bran fermented product prepared by a water production method or a fermentation raw material production step of mixing rice bran, arginine and water to prepare a mixture; Gelatinized rice bran manufacturing step of preparing a gelatinized rice bran mixture by heating the mixture to gelatinize the rice bran; A strain addition step of adding a Weissella koreensis DB1 (KCTC 13653BP) strain isolated from the kimchi and having citrulline and ornithine producing ability to the gelatinized rice bran mixture; And it may be a rice bran fermented product prepared by a method for producing a rice bran fermented product comprising a fermentation step of fermenting the gelatinized rice bran mixture to which the strain is added to prepare a rice bran fermented product.

상기 미강 발효물은 미강 발효물 내에 미강 발효물 전체 중량을 기준으로시트룰린 함량이 2,500 mg/kg 이상이고, 오르니틴 함량이 5,500 mg/kg 이상인 것, 바람직하게는 시트룰린 함량이 2,700 mg/kg 이상이고, 오르니틴 함량이 7,000 mg/kg 이상인 것, 더욱 바람직하게는 시트룰린 함량이 2,800 mg/kg 이상이고, 오르니틴 함량이 8,000 mg/kg 이상인 것일 수 있다.The fermented rice bran has a citrulline content of 2,500 mg/kg or more, an ornithine content of 5,500 mg/kg or more, and preferably has a citrulline content of 2,700 mg/kg or more, based on the total weight of the rice bran fermentation in the rice bran fermentation product. , Ornithine content may be 7,000 mg/kg or more, more preferably citrulline content is 2,800 mg/kg or more, and ornithine content may be 8,000 mg/kg or more.

또한, 상기 미강 발효물은 미강 발효물 내에 미강 발효물 전체 중량을 기준으로 시트룰린 함량이 2,500 mg/kg 내지 3,500 mg/kg이고, 오르니틴 함량이 5,500 mg/kg 내지 10,500 mg/kg인 것, 바람직하게는 시트룰린 함량이 2,700 mg/kg 내지 3,200 mg/kg이고, 오르니틴 함량이 7,000 mg/kg 내지 9,500 mg/kg인 것, 더욱 바람직하게는 시트룰린 함량이 2,800 mg/kg 내지 2,900 mg/kg이고, 오르니틴 함량이 8,000 mg/kg 내지 8,800 mg/kg인 인 것일 수 있다.In addition, the fermented rice bran has a citrulline content of 2,500 mg/kg to 3,500 mg/kg and an ornithine content of 5,500 mg/kg to 10,500 mg/kg based on the total weight of the fermented rice bran in the fermented rice bran, preferably Preferably, the citrulline content is 2,700 mg/kg to 3,200 mg/kg, the ornithine content is 7,000 mg/kg to 9,500 mg/kg, more preferably the citrulline content is 2,800 mg/kg to 2,900 mg/kg, The ornithine content may be 8,000 mg/kg to 8,800 mg/kg.

상기 미강 발효물은 시트룰린과 오르니틴이 고 함량으로 포함되어 있으므로, 기존 미강 또는 미강 유산균 발효물이 갖는 기능성 외에 추가로 시트룰린과 오르니틴에 의해 항비만 활성, 혈행 개선능, 간기능 개선능, 이뇨 작용, 신체 기능 개선능이나 주름 개선과 같은 피부미용 개선능이 부가되거나 기존 미강 또는 미강 유산균 발효물이 갖는 기능성이 강화된 것일 수 있다.Since the rice bran fermentation product contains a high content of citrulline and ornithine, in addition to the functionality of the existing rice bran or rice lactic acid bacteria fermentation product, anti-obesity activity, blood circulation improvement ability, liver function improvement ability, diuresis by additional citrulline and ornithine It may be that the function, the ability to improve the body function or improve the skin beauty such as wrinkle improvement is added, or the functionality of the existing rice bran or rice lactic acid bacteria fermentation has been enhanced.

이러한 차원에서 본 발명의 미강 발효물은 기능성 식품 또는 기능성 식품의 원료, 바람직하게는 비만을 예방 또는 개선하기 위한 기능성 식품 또는 기능성 식품의 원료나 고지혈증을 예방 또는 개선하기 위한 기능성 식품 또는 기능성 식품의 원료로 활용될 수 있다.In this dimension, the fermented rice bran of the present invention is a functional food or a raw material of a functional food, preferably a functional food or a raw material of a functional food for preventing or improving obesity, or a functional food or a raw material of a functional food for preventing or improving hyperlipidemia. Can be used as.

이러한 측면에서, 본 발명은 상기 미강 발효물 제조방법으로 제조된 미강 발효물을 유효성분으로 포함하는 비만 개선 또는 예방용 식품 조성물에 관한 것일 수 있다.In this aspect, the present invention may relate to a food composition for improving or preventing obesity comprising the fermented rice bran produced by the method for producing fermented rice bran as an active ingredient.

상기 비만 개선 또는 예방용 식품 조성물은 바람직하게는 건강기능성 식품일 수 있다.The food composition for improving or preventing obesity may preferably be a health functional food.

또 다른 측면에서, 본 발명은 상기 미강 발효물 제조방법으로 제조된 미강 발효물을 유효성분으로 포함하는 고지혈증 개선 또는 예방용 식품 조성물에 관한 것일 수 있다.In another aspect, the present invention may relate to a food composition for improving or preventing hyperlipidemia comprising the fermented rice bran produced by the method for producing fermented rice bran as an active ingredient.

상기 고지혈증 개선 또는 예방용 식품 조성물은 바람직하게는 건강기능성 식품일 수 있다.The food composition for improving or preventing hyperlipidemia may preferably be a health functional food.

상기 유효성분은 바람직하게는 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하여 발효하는 단계를 포함하는 것을 특징으로 하는 미강 발효물 제조방법으로 제조된 미강 발효물 또는 미강, 아르기닌(Arginine) 및 물을 혼합하여 혼합물을 제조하는 발효원물 제조단계; 상기 혼합물을 가열하여 미강을 호화시켜 호화 미강 혼합물을 제조하는 호화 미강 제조단계; 상기 호화 미강 혼합물에 상기 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하는 균주 첨가 단계; 및 상기 균주가 첨가된 호화 미강 혼합물을 발효하여 미강 발효물을 제조하는 발효 단계를 포함하는 것을 특징으로 하는 미강 발효물 제조방법으로 제조된 미강 발효물일 수 있다.The active ingredient is preferably separated from the kimchi, and fermenting rice bran fermentation comprising the step of fermenting by adding a Weissella koreensis DB1 (KCTC 13653BP) strain having citrulline and ornithine producing ability. Rice bran fermented product prepared by a water production method or a fermentation raw material production step of mixing rice bran, arginine and water to prepare a mixture; Gelatinized rice bran manufacturing step of preparing a gelatinized rice bran mixture by heating the mixture to gelatinize the rice bran; A strain addition step of adding a Weissella koreensis DB1 (KCTC 13653BP) strain isolated from the kimchi and having citrulline and ornithine producing ability to the gelatinized rice bran mixture; And it may be a rice bran fermented product prepared by a method for producing a rice bran fermented product comprising a fermentation step of fermenting the gelatinized rice bran mixture to which the strain is added to prepare a rice bran fermented product.

상기 미강 발효물은 미강 발효물 내에 미강 발효물 전체 중량을 기준으로시트룰린 함량이 2,500 mg/kg 이상이고, 오르니틴 함량이 5,500 mg/kg 이상인 것, 바람직하게는 시트룰린 함량이 2,700 mg/kg 이상이고, 오르니틴 함량이 7,000 mg/kg 이상인 것, 더욱 바람직하게는 시트룰린 함량이 2,800 mg/kg 이상이고, 오르니틴 함량이 8,000 mg/kg 이상인 것일 수 있다.The fermented rice bran has a citrulline content of 2,500 mg/kg or more, an ornithine content of 5,500 mg/kg or more, and preferably has a citrulline content of 2,700 mg/kg or more, based on the total weight of the rice bran fermentation in the rice bran fermentation product. , Ornithine content may be 7,000 mg/kg or more, more preferably citrulline content is 2,800 mg/kg or more, and ornithine content may be 8,000 mg/kg or more.

또한, 상기 미강 발효물은 미강 발효물 내에 미강 발효물 전체 중량을 기준으로 시트룰린 함량이 2,500 mg/kg 내지 3,500 mg/kg이고, 오르니틴 함량이 5,500 mg/kg 내지 10,500 mg/kg인 것, 바람직하게는 시트룰린 함량이 2,700 mg/kg 내지 3,200 mg/kg이고, 오르니틴 함량이 7,000 mg/kg 내지 9,500 mg/kg인 것, 더욱 바람직하게는 시트룰린 함량이 2,800 mg/kg 내지 2,900 mg/kg이고, 오르니틴 함량이 8,000 mg/kg 내지 8,800 mg/kg인 인 것일 수 있다.In addition, the fermented rice bran has a citrulline content of 2,500 mg/kg to 3,500 mg/kg and an ornithine content of 5,500 mg/kg to 10,500 mg/kg based on the total weight of the fermented rice bran in the fermented rice bran, preferably Preferably, the citrulline content is 2,700 mg/kg to 3,200 mg/kg, the ornithine content is 7,000 mg/kg to 9,500 mg/kg, more preferably the citrulline content is 2,800 mg/kg to 2,900 mg/kg, The ornithine content may be 8,000 mg/kg to 8,800 mg/kg.

상기 비만은 체내에 지방세포(adipocyte)가 양적, 수적 증가로 인해 지방조직이 과다하게 축적된 상태를 의미하고, 이러한 지방세포의 양적, 수적 증가는 지방화 즉, 지방세포의 분화와 지방의 축적에 의하여 발생한다.The obesity refers to a state in which adipose tissue is excessively accumulated due to an increase in the quantity and number of adipocytes in the body, and the increase in the quantity and number of these adipocytes causes localization, that is, the differentiation of adipocytes and the accumulation of fat. Occurs by

상기 고지혈증이란 혈액 속의 지방 성분이 높아 질병을 유발할 수 있는 상태 또는 혈중 지방의 높은 함량에 의해 발병되는 질병을 의미한다. 상기 고지혈증은 내인성 고지혈증과 외인성 고지혈증으로 구분되는데, 내인성 고지혈증은 콜레스테롤 대사 이상이 원인인 경우가 많으며, 외인성 고지혈증은 음식의 과잉섭취 등에 의해 발병하는 경우가 많다. 상기 외인성 고지혈증의 발병 원인과 관련하여, 음식물의 섭취에 의한 중성지방의 혈중 농도의 상승이 밀접한 관련이 있는 것으로 보고 되어 있다.The hyperlipidemia refers to a condition that can cause a disease due to a high level of fat in the blood or a disease caused by a high content of fat in the blood. The hyperlipidemia is divided into endogenous hyperlipidemia and exogenous hyperlipidemia, and endogenous hyperlipidemia is often caused by abnormal cholesterol metabolism, and exogenous hyperlipidemia is often caused by excessive intake of food. With regard to the cause of the onset of the exogenous hyperlipidemia, it has been reported that an increase in the blood concentration of triglycerides caused by ingestion of food is closely related.

콜레스테롤 조절이란 체내 콜레스테롤 수준을 적절한 범위로 조절하여 혈장과 조직, 특히 혈관에 콜레스테롤의 축적이 일어나지 않게 함을 의미하는데, 상기 콜레스테롤 조절 기능에 이상이 생겨 즉, 콜레스테롤 대상 이상이 발생되면 체내 또는 혈관에 콜레스테롤이 적정 수준 이상으로 축적되는 질환을 고콜레스테롤증이라고 하며, 장기간 콜레스테롤 조절 기능 이상이 발생하여, 고콜레스테롤증이 일정 기간 이상 유지되는 경우 동맥경화증으로 이어질 수 있다.Cholesterol control means that cholesterol levels in the body are controlled in an appropriate range so that the accumulation of cholesterol in plasma and tissues, especially blood vessels, does not occur. A disease in which cholesterol is accumulated above an appropriate level is called hypercholesterolosis, and abnormal cholesterol control functions occur for a long time, and if the hypercholesterolosis is maintained for a certain period of time or longer, it may lead to atherosclerosis.

상기 비만 개선 또는 예방용 식품조성물 또는 상기 고지혈증 개선 또는 예방용 식품조성물은 비만 또는 고지혈증을 억제하거나 개선 또는 예방하기 위하여 사용될 수 있다. 상기 식품조성물은 기능성 식품조성물, 구체적으로 상기 비만 또는 고지혈증의 예방 또는 개선을 위한 건강기능성 식품 조성물일 수 있다. 상기 건강기능성 식품 조성물은 건강기능성 음료일 수 있다.The food composition for improving or preventing obesity or the food composition for improving or preventing hyperlipidemia may be used to suppress, improve or prevent obesity or hyperlipidemia. The food composition may be a functional food composition, specifically a health functional food composition for preventing or improving the obesity or hyperlipidemia. The health functional food composition may be a health functional beverage.

상기 비만 개선 또는 예방용 식품조성물 또는 상기 고지혈증 개선 또는 예방용 식품조성물은 상기 미강 발효물추출물 제조방법에 의해 제조된 미강 발효물추출물을 전체 식품 중량의 0.0001 중량% 내지 99.999 중량% 또는 0.001 중량% 내지 99.9 중량% 또는 0.01 중량% 내지 99 중량% 또는 0.1 중량% 내지 90 중량% 또는 1 중량% 내지 75 중량% 또는 3 중량% 내지 50 중량% 포함될 수 있다.The food composition for improving or preventing obesity or the food composition for improving or preventing hyperlipidemia is from 0.0001% to 99.999% by weight or 0.001% by weight to the total weight of the rice bran fermented product extract prepared by the method for producing fermented rice bran fermented product. 99.9% by weight or 0.01% by weight to 99% by weight or 0.1% by weight to 90% by weight or 1% by weight to 75% by weight or 3% by weight to 50% by weight may be included.

상기 미강 발효물 제조방법에 의해 제조된 미강 발효물을 유효성분으로 포함하는 상기 비만 개선 또는 예방용 식품 조성물 또는 상기 고지혈증 개선 또는 예방용 식품 조성물은 인간을 포함한 동물에 직접 적용될 수 있다. 상기 동물은 식물에 대응하는 생물군으로 주로 유기물을 영양분으로 섭취하고, 소화기관, 배설기관 및 호흡기관이 분화되어 있는 것을 말하며, 바람직하게는 포유류, 더욱 바람직하게는 인간일 수 있다.The food composition for improving or preventing obesity or the food composition for improving or preventing hyperlipidemia, comprising the fermented rice bran produced by the fermented rice bran produced by the method for producing fermented rice bran can be directly applied to animals, including humans. The animal is a group of organisms corresponding to plants, mainly ingesting organic matter as nutrients, and refers to a differentiated digestive organ, excretory organ, and respiratory organ, and may be preferably a mammal, more preferably a human.

상기 미강 발효물 제조방법에 의해 제조된 미강 발효물은 상기 상기 비만 개선 또는 예방용 식품 조성물 또는 상기 고지혈증 개선 또는 예방용 식품 조성물 내에 단독으로 사용될 수 있으며, 그 외 약리학적으로 허용가능한 담체, 부형제, 희석제 또는 부성분을 추가로 포함할 수 있다The rice bran fermented product prepared by the method for producing fermented rice bran can be used alone in the food composition for improving or preventing obesity or the food composition for improving or preventing hyperlipidemia, and other pharmacologically acceptable carriers, excipients, It may additionally contain a diluent or an accessory ingredient.

상기 식품이란 영양소를 한 가지 또는 그 이상 함유하고 있는 천연물 또는 가공품으로, 어느 정도의 가공 공정을 거쳐 직접 먹을 수 있는 상태가 된 것일 수 있고, 통상적인 의미로서 건강기능성식품, 음료, 식품 첨가제 및 음료 첨가제 등을 모두 포함하는 의도이다.The food is a natural product or processed product containing one or more nutrients, and may be in a state that can be eaten directly through a certain processing process, and as a general meaning, health functional foods, beverages, food additives and beverages It is intended to include all additives and the like.

본 발명의 식품은 예를 들어, 각종 식품류, 음료, 껌, 차, 비타민 복합제, 건강기능성식품 등이 있다. 추가로, 본 발명에서 식품에는 특수영양식품(예, 조제유류, 영유아식 등), 식육가공품, 어육제품, 두부류, 묵류, 면류(예, 라면류, 국수류 등), 건강보조식품, 조미식품(예, 간장, 된장, 고추장, 혼합장 등), 소스류, 과자류(예, 스넥류 등), 유가공품(예, 발효유, 치즈 등), 기타 가공식품, 김치, 절임식품(각종 김치류, 장아찌 등), 음료(예, 과실채소류 음료, 발효음료류, 두유류 등), 천연조미료(예, 라면스프 등)을 포함하나 이에 한정되지 않는다. 상기 식품, 건강기능성 식품, 음료, 식품 첨가제 및 음료 첨가제는 통상의 제조방법으로 제조될 수 있다.Foods of the present invention include, for example, various foods, beverages, gum, tea, vitamin complexes, and health functional foods. In addition, the food in the present invention includes special nutritional foods (e.g., formula, infant food, etc.), processed meat products, fish meat products, tofu, muk, noodles (e.g., ramen, noodles, etc.), health supplements, seasoning foods (e.g. , Soy sauce, soybean paste, red pepper paste, mixed sauce, etc.), sauces, confectionery (e.g., snacks, etc.), dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, pickles (various kimchi, pickles, etc.), beverages ( Examples include, but are not limited to, fruit vegetable beverages, fermented beverages, soy milk, etc.), and natural seasonings (eg, ramen soup, etc.). The foods, health functional foods, beverages, food additives, and beverage additives may be prepared by conventional manufacturing methods.

본 발명에서 건강기능성 식품이란 식품에 물리적, 생화학적, 생물공학적 수법 등을 이용하여 해당 식품의 기능을 특정 목적에 작용, 발현하도록 부가가치를 부여한 식품군이나 식품 조성이 갖는 생체방어리듬조절, 질병방지와 회복 등에 관한 체중조절기능을 생체에 대하여 충분히 발현하도록 설계하여 가공한 식품을 의미한다.In the present invention, the health functional food refers to a food group or food composition that has added value to act and express the function of the food by using physical, biochemical, and biotechnological techniques, etc. It refers to food that is designed and processed to sufficiently express the weight control function related to recovery, etc. to the living body.

상기 건강기능성 식품에는 식품학적으로 허용 가능한 식품 보조 첨가제를 포함할 수 있으며, 건강기능성 식품의 제조에 통상적으로 사용되는 적절한 담체, 부형제 및 희석제를 더욱 포함할 수 있다.The health functional food may include food additives acceptable for food, and may further include suitable carriers, excipients, and diluents commonly used in the manufacture of health functional foods.

본 발명에서 음료란 갈증을 해소하거나 맛을 즐기기 위하여 마시는 것의 총칭을 의미하며 건강기능성 음료를 포함하는 의도이다. 상기 음료는 지시된 비율로 필수 성분으로서 상기 미강 발효물을 유효성분으로 포함하는 것 외에 다른 성분에는 특별한 제한이 없으며, 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.In the present invention, the beverage refers to a generic term for drinking to quench thirst or to enjoy the taste, and is intended to include a health functional beverage. The beverage is an essential component at the indicated ratio, and there is no particular limitation on other components other than containing the fermented rice bran as an active ingredient, and as an ordinary beverage, various flavoring agents or natural carbohydrates can be contained as an additional component. have.

상기의 천연 탄수화물의 예는 모노사카라이드, 예를 들어 포도당, 과당 등 디사카라이드, 예를 들어 말토스, 수크로스 등 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알코올이다. 상기한 것 이외의 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 식품 조성물 100 mL 당 일반적으로 약 1 내지 20 g, 바람직하게는 5 내지 12 g일 수 있다. 그 밖에 본 발명의 조성물은 천연 과일 주스, 과일 쥬스 음료, 야채 음료의 제조를 위한 과육을 추가로 함유할 수 있다.Examples of the above natural carbohydrates include monosaccharides, such as disaccharides such as glucose and fructose, such as maltose, sucrose, and the like, and polysaccharides, such as dextrin, cyclodextrin, and the like, and conventional sugars, and These are sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The ratio of the natural carbohydrate may be generally about 1 to 20 g, preferably 5 to 12 g, per 100 mL of the food composition of the present invention. It may further contain pulp for the manufacture of beverages.

상기 외에 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 이러한 성분을 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하지 않지만, 본 발명의 미강 발효물 100 중량부 당 0 내지 200,000 중량부 범위에서 선택될 수 있다.In addition to the above, the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring and natural flavoring agents, coloring agents and heavy weight agents (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid, and It may contain salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like. These components may be used independently or in combination. The proportion of these additives is not so important, but may be selected in the range of 0 to 200,000 parts by weight per 100 parts by weight of the rice bran fermentation of the present invention.

본 발명에서 건강기능성 음료란 음료에 물리적, 생화학적, 생물공학적 수법 등을 이용하여 해당 음료의 기능을 특정 목적에 작용, 발현하도록 부가가치를 부여한 음료 군이나 음료 조성이 갖는 생체방어리듬조절, 질병방지와 회복 등에 관한 체조절기능을 생체에 대하여 충분히 발현하도록 설계하여 가공한 음료를 의미한다.In the present invention, a health-functional beverage refers to a beverage group or beverage composition that has added value to act and express the function of the beverage for a specific purpose by using physical, biochemical, and biotechnological techniques, etc., to control the biological defense rhythm of the beverage composition, and to prevent diseases. It refers to a beverage that has been designed and processed to fully express the function of gymnastics for and recovery.

상기 건강기능성 음료는 지시된 비율로 필수 성분으로서 본 발명의 미강 발효물을 함유하는 외에는 다른 성분에는 특별한 제한이 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.The health functional beverage is an essential ingredient in the indicated ratio, and there is no particular limitation on other ingredients other than containing the rice bran fermented product of the present invention, and may contain various flavoring agents or natural carbohydrates, etc. as an additional ingredient like a normal beverage. .

상기 천연 탄수화물의 예는 모노사카라이드, 예를 들어 포도당, 과당 등 디사카라이드, 예를 들어 말토스, 수크로스 등 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알코올이다. 상기한 것 이외의 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 mL 당 일반적으로 약 1 g 내지 20 g, 바람직하게는 5 g 내지 12 g일 수 있다.Examples of the natural carbohydrates include monosaccharides, such as disaccharides such as glucose and fructose, such as maltose, sucrose, and the like, and polysaccharides, such as dextrin, cyclodextrin, and the like, and xylitol. , Sugar alcohols such as sorbitol and erythritol. As flavoring agents other than those described above, natural flavoring agents (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The ratio of the natural carbohydrate may be generally about 1 g to 20 g, preferably 5 g to 12 g per 100 mL of the composition of the present invention.

그 밖에 본 발명의 조성물은 천연 과일 주스, 과일 쥬스 음료, 야채 음료의 제조를 위한 과육을 추가로 함유할 수 있다.In addition, the composition of the present invention may further contain flesh for the manufacture of natural fruit juice, fruit juice beverage, and vegetable beverage.

상기 외에 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 이러한 성분을 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하지 않지만, 본 발명의 미강 발효물 100 중량부 당 0 내지 200,000 중량부 범위에서 선택될 수 있다.In addition to the above, the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring and natural flavoring agents, coloring agents and heavy weight agents (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid, and It may contain salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like. These components may be used independently or in combination. The proportion of these additives is not so important, but may be selected in the range of 0 to 200,000 parts by weight per 100 parts by weight of the rice bran fermentation of the present invention.

본 발명에서 건강기능 음료란 음료에 물리적, 생화학적, 생물공학적 수법 등을 이용하여 해당 음료의 기능을 특정 목적에 작용, 발현하도록 부가가치를 부여한 음료 군이나 음료 조성이 갖는 생체방어리듬조절, 질병방지와 회복 등에 관한 체중조절기능을 생체에 대하여 충분히 발현하도록 설계하여 가공한 음료를 의미한다.In the present invention, the health functional beverage refers to a beverage group or a beverage group that has added value to act and express the function of the beverage for a specific purpose by using physical, biochemical, and biotechnological techniques, etc., to control the biological defense rhythm of the beverage composition, and to prevent diseases. It refers to a beverage that is designed and processed to sufficiently express weight control functions related to and recovery to the living body.

상기 건강기능 음료는 지시된 비율로 필수 성분으로서 본 발명의 미강 발효물을 함유하는 외에는 다른 성분에는 특별한 제한이 없으며 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.The health functional beverage is an essential component in the indicated ratio, except for containing the rice bran fermented product of the present invention, there is no particular limitation on other components, and may contain various flavoring agents or natural carbohydrates, etc. as an additional component, like a normal beverage. .

상기의 천연 탄수화물의 예는 포도당이나 과당 등과 같은 모노사카라이드, 말토스, 수크로스 등과 같은 디사카라이드, 덱스트린, 시클로덱스트린 등과 같은 폴리사카라이드 또는 자일리톨, 소르비톨, 에리트리톨 등의 당알코올 등일 수 있다. 상기 향미제는 타우마틴이나 레바우디오시드 A 또는 글리시르히진과 같은 스테비아 추출물과 같은 천연 향미제 또는 사카린, 아스파르탐 등과 같은 합성 향미제일 수 있다.Examples of the natural carbohydrates may be monosaccharides such as glucose or fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, or sugar alcohols such as xylitol, sorbitol, and erythritol. . The flavoring agent may be a natural flavoring agent such as taumatin, rebaudioside A, or a stevia extract such as glycyrrhizin, or a synthetic flavoring agent such as saccharin or aspartame.

상기 천연 탄수화물의 첨가량은 본 발명의 식품 조성물 100 mL 당 일반적으로 약 1 g 내지 20 g, 바람직하게는 5 g 내지 12 g일 수 있다. 그 밖에 본 발명의 조성물은 천연 과일 주스, 과일 쥬스 음료, 야채 음료의 제조를 위한 과육을 추가로 함유할 수 있다.The amount of the natural carbohydrate added may be generally about 1 g to 20 g, preferably 5 g to 12 g per 100 mL of the food composition of the present invention. In addition, the composition of the present invention may further contain flesh for the manufacture of natural fruit juice, fruit juice beverage, and vegetable beverage.

또한, 미강 발효물을 유효성분으로 포함하는 비만 예방 또는 개선용 식품조성물 또는 미강 발효물을 유효성분으로 포함하는 고지혈증 예방 또는 개선용 식품조성물에 있어서, 상기 유효성분은 전체 식품 중량의 0.01 중량% 내지 15 중량%로 포함될 수 있으며, 음료 조성물은 100 mL를 기준으로 0.02 g 내지 5 g, 바람직하게는 0.3 g 내지 1 g의 비율로 포함될 수 있다.In addition, in a food composition for preventing or improving obesity comprising fermented rice bran as an active ingredient or a food composition for preventing or improving hyperlipidemia comprising fermented rice bran as an active ingredient, the active ingredient is 0.01% by weight to the total weight of the food. It may be included in an amount of 15% by weight, and the beverage composition may be included in an amount of 0.02 g to 5 g, preferably 0.3 g to 1 g, based on 100 mL.

이하, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시 할 수 있도록 본 발명의 실시예에 대하여 상세히 설명한다. 그러나 본 발명은 여러 가지 상이한 형태로 구현될 수 있으며 여기에서 설명하는 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명이 하기 실시예에 한정되는 것은 아니다.Hereinafter, embodiments of the present invention will be described in detail so that those skilled in the art can easily implement the present invention. However, the present invention may be implemented in various different forms, and the examples described herein are for illustrative purposes only, and the present invention is not limited to the following examples.

본 실험은 각각 동일한 실험을 3회 수행하였으며, 각각의 실험결과로 얻어진 자료는 SAS 9.1 version 통계프로그램을 이용하여 평균 및 표준편차(Mean ± SEM)로 표시하였다. 집단간의 유의성 검증 위해, 일원변량분석(one-way ANOVA)을 통해 분석하였고, 사후검증(Post-Hoc test)은 Duncan's multiple range test에 의해 P < 0.05 수준에서 각 실험군 간의 유의성을 검증하였다.In this experiment, the same experiment was performed three times, and the data obtained from each experiment was expressed as mean and standard deviation (Mean ± SEM) using the SAS 9.1 version statistical program. In order to verify the significance between groups, it was analyzed through one-way ANOVA, and the post-hoc test was verified by Duncan's multiple range test at P <0.05 level between each experimental group.

<실시예><Example> 미강 발효물의 제조 및 활용Manufacturing and utilization of fermented rice bran

실시예 1. 균주의 분리 및 동정Example 1. Isolation and identification of strains

서울경기, 강원, 충청, 영남 및 호남 등 5개 권역의 전국의 가정집, 명가, 식당, 사찰 및 회사 등 36 곳에서 수집한 맛이 좋은 최적 숙성기의 김치 시료로부터 분리된 유산균 중 사전에 오르니틴 생산능을 가진 것으로 확인된 하기 표 1의 40종의 김치 유산균을 분리하여 실험 균주로 사용하였다.Ornithine in advance among lactic acid bacteria isolated from kimchi samples in the optimal ripening period collected from 36 homes, famous houses, restaurants, temples, and companies nationwide in five regions including Seoul, Gyeonggi, Gangwon, Chungcheong, Yeongnam and Honam. The 40 types of kimchi lactic acid bacteria in Table 1, which were confirmed to have productive ability, were isolated and used as an experimental strain.

Figure pat00001
Figure pat00001

미강 발효물 제조를 위한 유산균을 선별하기 위하여, 1% 아르기닌(Arginine)이 첨가된 MRS 액체배지에서 상기 표 1의 총 40종의 균주를 30℃에서 48시간 정치 배양한 후, 상기 각 균주를 배양한 배양액에서 오르니틴 생성정도를 TLC(Thin Layer Chromatography)를 이용하여 분석하였다. 구체적으로, 상기 각 균주를 배양한 배양액을 9,950 x g 및 4℃ 조건에서 3분 동안 원심분리 한 후, 상징액을 수득하고, 상기 상징액을 TLC 판(Merck, 독일)에 2 μL 점적한 후, 아세트산(acetic acid, Darjung, 대한민국)과 1-부탄올(1-butanol, Junsei co., 일본) 및 3차 증류수를 부피를 기준으로 3 : 12 : 5(아세트산 : 1-부탄올 : 3차 증류수, v/v)로 조정한 전개용매에서 7 cm 씩 두 번 전개하였다. 상기 전개가 끝난 후, TLC판은 실온에서 건조 후 0.5% 닌하이드린(ninhydrin, Alfa Aesar, USA) 용액에 담가 가열하여 아르기닌과 오르니틴 표준물질에 대비하여 같은 위치에 점(spot)을 보이는지 여부 및 해당 점(spot)이 얼마나 진한지 여부를 비교하여, 각 균주의 오르니틴의 생성 정도를 확인하였다. 상기 TLC판 전개 결과를 하기 도 2에 나타내었다.In order to select the lactic acid bacteria for the production of rice bran fermentation, 1% arginine was added to the MRS liquid medium, and the 40 strains of Table 1 were stationarily cultured at 30° C. for 48 hours, and then each of the strains was cultured. The degree of ornithine production in one culture was analyzed using Thin Layer Chromatography (TLC). Specifically, the culture solution obtained by culturing each strain was centrifuged for 3 minutes at 9,950 xg and 4° C., and then a supernatant was obtained, and 2 μL of the supernatant was dropped on a TLC plate (Merck, Germany), and then acetic acid ( acetic acid, Darjung, Republic of Korea), 1-butanol (1-butanol, Junsei co., Japan) and tertiary distilled water based on volume 3: 12: 5 (acetic acid: 1-butanol: tertiary distilled water, v/v ) Was developed twice in 7 cm increments in the developing solvent. After the development is complete, the TLC plate is dried at room temperature and then immersed in a 0.5% ninhydrin (Alfa Aesar, USA) solution and heated to see whether or not a spot is visible in the same position as compared to the arginine and ornithine standards. And by comparing how dark the corresponding spot (spot), it was confirmed the degree of production of ornithine of each strain. The results of the development of the TLC plate are shown in FIG. 2 below.

상기 도 2에 나타낸 바와 같이, 상기 40종의 균주 중 7종의 균주, 구체적으로 3번 균주(GH), 10번 균주(GL), 12번 균주(DB1), 20번 균주(CM), 23번 균주(IS), 38번 균주(CGM1) 및 40번 균주(HJ)가 오르니틴 생성능이 우수한 것으로 육안으로 확인되었다.As shown in FIG. 2, of the 40 strains, 7 strains, specifically, strain 3 (GH), strain 10 (GL), strain 12 (DB1), strain 20 (CM), 23 Strains No. (IS), No. 38 (CGM1) and No. 40 (HJ) were visually confirmed to have excellent ornithine-producing ability.

상기 도 2의 결과를 기초로 하여, 상기 7종의 균주의 오르니틴 생산능을 확인하기 위해, HPLC를 이용하여 오르니틴 생성 정도를 아미노산 분석법을 통해 확인하였다.Based on the results of FIG. 2, in order to confirm the ornithine production ability of the seven strains, the degree of ornithine production was confirmed by using HPLC through amino acid analysis.

구체적으로, 상기 7종의 균주를 배양한 배양액을 9,950 x g 및 4℃ 조건에서 3분 동안 원심분리 한 후, 상징액을 수득하고, 얻어진 상등액을 0.2 μm의 membrane filter(Sartotius, 독일)로 여과시켜 불순물 등을 제거해 분석에 사용하였다.Specifically, the culture solution obtained by culturing the 7 strains was centrifuged at 9,950 xg and 4°C for 3 minutes, and then a supernatant was obtained, and the resulting supernatant was filtered through a 0.2 μm membrane filter (Sartotius, Germany) to prevent impurities. The etc. were removed and used for analysis.

OPA(O-phthalaldehyde)-FMOC(fluorenylmethyl chloroformate) 유도체화하여 HPLC(Ultimate 3000, Thremo Scientific Dionex, USA)로 분석하였다. 컬럼 오븐 온도는 40℃로 하였으며 컬럼은 Inno C18 column(4.6 x 150 mm, 5 μm, Youngjin Biochrom, 대한민국)을 사용하였다. 이동상은 40 mM sodium phosphate(pH 7.0), water : acetonitrile : methanol = 10 : 45 : 45로 혼합된 용액을 각각 A와 B로 1.5 mL/min의 유속으로 사용하였다. 구배조건은 A용액 : B용액으로서 0 내지 24분에 95 : 5(v/v, %)에서 24 내지 25분에 45 : 55, 23 내지 34.5분에 20 : 80, 34.5분부터 95 : 5로 설정하여 분석을 시행하였다. 아미노산 함량은 표준 아미노산의 HPLC 분석결과를 토대로 작성한 표준곡선을 이용하여 산출하였다.OPA (O-phthalaldehyde)-FMOC (fluorenylmethyl chloroformate) was derivatized and analyzed by HPLC (Ultimate 3000, Thremo Scientific Dionex, USA). The column oven temperature was set to 40°C, and an Inno C18 column (4.6 x 150 mm, 5 μm, Youngjin Biochrom, Korea) was used. The mobile phase was a mixture of 40 mM sodium phosphate (pH 7.0), water: acetonitrile: methanol = 10: 45: 45, A and B, respectively, at a flow rate of 1.5 mL/min. The gradient conditions are: Solution A: Solution B, from 0 to 24 minutes, 95: 5 (v/v, %), 24 to 25 minutes, 45: 55, 23 to 34.5 minutes, 20: 80, 34.5 minutes to 95: 5 It was set up and analyzed. The amino acid content was calculated using a standard curve prepared based on the results of HPLC analysis of standard amino acids.

상기 7종의 균주의 배양액에 포함된 아미노산의 산출 결과를 하기 표 2에 나타내었다. 하기 표 2의 각 아미노산의 단위는 분석시료 1 L를 기준으로 mg의 단위(mg/L)로 나타내었다. 또한, 하기 표 2의 N.D는 해당 아미노산이 발견되지 않았다는 것을 의미한다.The calculation results of amino acids contained in the culture medium of the seven strains are shown in Table 2 below. The units of each amino acid in Table 2 below are expressed in units of mg (mg/L) based on 1 L of the analysis sample. In addition, N.D in Table 2 means that the corresponding amino acid was not found.

Figure pat00002
Figure pat00002

상기 표 2에 나타낸 바와 같이, HPLC 결과에서 오르니틴 생성능이 우수한 것으로 확인된 7종의 균주 중에서도 DB1 균주가 현저하게 우수한 오르니틴 생성능을 가지는 것으로 확인되었다. 7종의 균주 중 DB1 균주를 제외한 균주 대부분이 5,000 mg 내지 6,500 mg, 구체적으로 5,059.53 mg 내지 6,520.55 mg인 반면, DB1 균주는 8,373.59 mg로 오르니틴 생성능이 다른 균주에 비해 더 우수한 것으로 확인되었으며, DB1 균주는 GH 균주와 비교하여 165.5%이고, HJ 균주와 비교해서도 110.1%로 우수한 오르니틴 생성능이 확인되었다. 상기 결과로부터, DB1 균주를 오르니틴 생성능이 가장 우수한 균주로 선정하여 분리하였다. As shown in Table 2, it was confirmed that the DB1 strain had remarkably excellent ornithine-producing ability among the seven strains confirmed to have excellent ornithine-producing ability in HPLC results. Of the seven strains, most strains excluding the DB1 strain were 5,000 mg to 6,500 mg, specifically 5,059.53 mg to 6,520.55 mg, whereas the DB1 strain was 8,373.59 mg, which was found to have better ornithine production ability than other strains. Is 165.5% compared to the GH strain, and 110.1% compared to the HJ strain, showing excellent ornithine-producing ability. From the above results, the DB1 strain was selected and isolated as the strain having the best ornithine-producing ability.

상기 오르니틴 생성능이 가장 우수한 균주로 선택된 DB1 균주를 동정하기 위하여, 형태학적 특성 및 생화학적 특성을 관찰하였다. 상기 형태학적 특성의 조사는 그람 염색 여부와 현미경을 이용하여 균의 형태 등을 관찰하는 방법으로 수행하였으며, 그 결과를 하기 표 3에 나타내었다. In order to identify the DB1 strain selected as the strain having the best ornithine-producing ability, morphological and biochemical properties were observed. The investigation of the morphological characteristics was performed by observing the morphology of bacteria using a microscope and whether or not Gram was stained, and the results are shown in Table 3 below.

특성(Characteristics)Characteristics 균주(DB1)Strain (DB1) 그람 염색(Gram-stain)Gram-stain 양성(+)Positive (+) 세포 형태(Cell morphology)Cell morphology 단간균Monococci

상기 표 3에 나타낸 바와 같이, 상기 분리된 DB1 균주는 그람 양성의 단간균으로, MRS 평판배지를 이용하여 30℃에서 48시간 배양하였을 때 둥글고 매끈하며 아이보리색의 납작한 집락(colony)을 형성하는 것으로 확인되었다. 추가로, 카탈라제 실험(Catalase test) 수행 결과 카탈라제 음성(Catalase-negative)으로 확인되었다.As shown in Table 3, the isolated DB1 strain is a Gram-positive monobacterial bacteria that form round, smooth and ivory-colored flat colonies when cultured at 30°C for 48 hours using MRS plate medium. Confirmed. In addition, as a result of performing a catalase test, it was confirmed as catalase-negative.

상기 분리 균주를 동정하기 위하여 생화학적 조사를 수행하였다. 생화학적 조사는 API 50CHL system(BioMerieux, 프랑스)을 이용하여 당이용성을 조사한 후 균주동정 프로그램(http://apiweb.biomerieux.com)을 이용하여 확인하는 방법으로 수행하였다. 상기 API 50CHL system을 이용한 당 이용성 조사결과는 하기 표 4에 나타내었다.Biochemical investigations were performed to identify the isolated strains. The biochemical investigation was performed by examining the sugar availability using the API 50CHL system (BioMerieux, France) and then confirming using the strain identification program (http://apiweb.biomerieux.com). The results of the investigation of sugar availability using the API 50CHL system are shown in Table 4 below.

Figure pat00003
Figure pat00003

상기 표 4에서, - 또는 +는 당대사능 또는 당이용능을 기준으로 결정한 것으로, 각 당에 대한 당대사능이 없는 경우 - 라고 표시하고, 당대사능이 있는 경우 +라고 표시하였다.In Table 4,-or + is determined on the basis of sugar metabolism or sugar utilization, and is indicated as-when there is no sugar metabolism for each sugar, and + when there is sugar metabolism.

상기 표 4에 나타낸 바와 같이, 상기 DB1 균주는 L-아라비노스(L-Arabinose), 리보스(Ribose), D-자일로스(D-Xylose), D-글루코스(D-Glucose), D-프룩토오스(D-Fructose), D-만노스(D-Mannose) 및 N-아세틸 글루코사민(N-Acetyl glucosamine)에 대해 당대사능을 갖는 것으로 확인되었다.As shown in Table 4, the DB1 strain is L-Arabinose, Ribose, D-Xylose, D-Glucose, D-Fructose It was confirmed to have glucose metabolism against D-Fructose, D-Mannose and N-Acetyl glucosamine.

상기 형태학적 분석 결과 및 당대사능 분석을 통해 수행한 생화학적 분석 결과, DB1 균주는 웨이셀라 코리엔시스(Weissella koreensis)로 추정되었으며, 최종적으로 동정하기 위하여, 16S rRNA 염기서열 분석을 실시하였다. 구체적으로, DB1의 16S rRNA 염기서열을 도 3과 같이 결정하였고, 이를 GenBank에 등록된 다른 균주들의 염기서열과 비교하여 16S rRNA 염기서열 분석을 수행하였다. As a result of the morphological analysis and biochemical analysis performed through the glucose metabolic analysis, the DB1 strain was estimated to be Weissella koreensis , and to finally identify it, 16S rRNA sequence analysis was performed. Specifically, the 16S rRNA nucleotide sequence of DB1 was determined as shown in FIG. 3, and 16S rRNA nucleotide sequence analysis was performed by comparing it with the nucleotide sequence of other strains registered in GenBank.

상기 분리균주의 16S rRNA의 염기서열은 다음과 같은 방법으로 수행하였다. 상기 분리균주의 chromosomal DNA를 Genomic DNA purification kit(Qiagen, 독일)를 이용하여 분리한 후에, 하기 표 5의 서열을 갖는 프라이머를 이용하여 PCR을 수행하였다.The nucleotide sequence of the 16S rRNA of the isolated strain was performed in the following manner. After the chromosomal DNA of the isolate was isolated using a Genomic DNA purification kit (Qiagen, Germany), PCR was performed using primers having the sequence shown in Table 5 below.

PrimersPrimers 서열 (5′→ 3′)Sequence (5′→ 3′) 785F785F GGATTAGATACCCTGGTAGGATTAGATACCCTGGTA 907R907R CCGTCAATTCMTTTRAGTTTCCGTCAATTCMTTTRAGTTT

상기 PCR은 94℃에서 1분간 전변성단계(pre-denaturation)를 수행한 후, 94℃에서 30초, 55℃에서 30초 및 72℃에서 1분의 과정을 30회 반복하고, 72℃에서 10분간 종료단계(termination)를 수행하는 방법으로 진행하였다. 상기 증폭된 PCR 산물은 multiscreen filter plate(Millipore Co., USA)를 이용하여 정제하고, BigDye(R) Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA)을 이용하여 sequencing 반응을 수행하였다. 증폭된 산물을 포함하는 DNA sample은 ABI Prism Prism 3730xl DNA analyzer(Applied Biosystems)를 이용하여 염기서열을 결정하였으며, 상기 결과로부터 도 3에 나타낸 바와 같이, 총 1,460bp의 염기서열을 확인하였다.In the PCR, after performing a pre-denaturation step at 94° C. for 1 minute, the process of 30 seconds at 94° C., 30 seconds at 55° C. and 1 minute at 72° C. was repeated 30 times, and 10 at 72° C. It proceeded by a method of performing a minute termination step (termination). The amplified PCR product was purified using a multiscreen filter plate (Millipore Co., USA), and a sequencing reaction was performed using the BigDye(R) Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA). The DNA sample containing the amplified product was sequenced using an ABI Prism Prism 3730xl DNA analyzer (Applied Biosystems), and as shown in FIG. 3 from the result, a total of 1,460 bp was confirmed.

상기 결정된 염기서열을 BLASTN 프로그램을 이용하여 GenBank에 ribosomal RNA gene sequence로 등록된 염기서열과 비교하였으며, 염기서열간의 상동성은 Clustal X program을 이용하여 비교분석하였다.The determined nucleotide sequence was compared with the nucleotide sequence registered as a ribosomal RNA gene sequence in GenBank using the BLASTN program, and the homology between the nucleotide sequences was compared and analyzed using the Clustal X program.

상기 DB1 균주의 16S rRNA 염기서열은 웨이셀라 코리엔시스 S-5623T 균주(Weissella koreensis S-5623T)와 99.86% 상동성을 나타냄을 확인하였다. 따라서, 최종적으로 상기 DB1 균주는 웨이셀라 코리엔시스(Weissella koreensis)로 동정되었고, 상기 DB1 균주를 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1)으로 명명하였다.The 16S rRNA nucleotide sequence of strain DB1 was determined to represent the way Cellar Corey N-Sys S-5623 T strain (Weissella koreensis S-5623 T) and 99.86% homology. Therefore, finally, the DB1 strain was identified as Weissella koreensis , and the DB1 strain was named Weissella koreensis DB1.

이하, 상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1) 균주를 한국생명공학연구원 생물자원센터에 2018년 10월 2일자로 기탁하여 수탁번호 KCTC 13653BP를 부여받았다.Hereinafter, the Weissella koreensis DB1 strain was deposited with the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center on October 2, 2018, and was given the accession number KCTC 13653BP.

실시예 2. 분리 균주의 생육 특성 및 기능성 확인Example 2. Confirmation of growth characteristics and functionality of isolated strains

2-1. 분리 균주의 최적 생육 pH 조건 및 온도 조건 확인2-1. Confirmation of optimum growth pH and temperature conditions of isolated strains

상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1) 균주의 최적 생육 온도 및 생육 pH 조건을 다음과 같이 확인하였다.The optimal growth temperature and growth pH conditions of the Weissella koreensis DB1 strain were confirmed as follows.

우선, 상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1) 균주를 MRS 배지(Difco, USA)에 1%(v/v), 약 6.70 log CFU/mL로 접종하고, 배양온도를 5℃ 간격으로 5℃ 내지 30℃의 온도 범위에서 배양하며, 시간 별로 600 nm에서 흡광도를 측정하여 균주의 생육 정도를 확인하였다. 상기 생육 정도를 측정한 결과를 도 4에 나타내었다.First, the Weissella koreensis DB1 strain was inoculated in MRS medium (Difco, USA) at 1% (v/v), about 6.70 log CFU/mL, and the culture temperature was 5℃ at intervals of 5℃. The culture was carried out at a temperature range of to 30°C, and the degree of growth of the strain was confirmed by measuring the absorbance at 600 nm for each time. The results of measuring the growth degree are shown in FIG. 4.

상기 도 4에 바타낸 바와 같이, 최적 생육 온도는 30℃인 것으로 확인되었다. 구체적으로, 5℃의 경우, 11일이 경과된 시점에서 생육 정도가 정체기에 접어들었으며, 11일이 경과한 시점에 측정된 흡광도(A600)는 1.787 ± 0.012로 확인되었고, 10℃의 경우, 4일이 경과된 시점에서 생육 정도가 정체기에 접어들었으며, 4일이 경과한 시점에 측정된 흡광도(A600)는 2.535 ± 0.021로 확인되었으고, 15℃의 경우, 4일이 경과된 시점에서 생육 정도가 정체기에 접어들었으며, 4일이 경과한 시점에 측정된 흡광도(A600)는 2.955 ± 0.133으로 확인되었고, 25℃의 경우, 20시간이 경과된 시점에서 생육 정도가 정체기에 접어들었으며, 20시간이 경과한 시점에 측정된 흡광도(A600)는 3.162 ± 0.157로 확인되었으고, 30℃의 경우, 16시간이 경과된 시점에서 가장 급격한 생육 활성이 확인되었고, 16시간이 경과한 시점부터는 세포수가 점진적으로 증가하였으나, 그 정도가 제한적이었고, 16시간이 경과한 시점에 측정된 흡광도(A600)는 3.035 ± 0.174로 확인되어, 가장 최단시간에 흡광도(A600)가 3.000 이상으로 증가한 30℃가 최적 생육 온도인 것으로 확인되었다.As shown in FIG. 4, it was confirmed that the optimum growth temperature was 30°C. Specifically, in the case of 5°C, the degree of growth reached a plateau after 11 days, and the absorbance (A 600 ) measured at the time of 11 days was confirmed to be 1.787 ± 0.012, and in the case of 10°C , After 4 days, the growth level entered a plateau, and the absorbance (A 600 ) measured at 4 days was confirmed to be 2.535 ± 0.021, and in the case of 15°C, after 4 days At the time point, the degree of growth reached a plateau, and the absorbance (A 600 ) measured at the time of 4 days was confirmed to be 2.955 ± 0.133, and in the case of 25°C, the degree of growth at the time of 20 hours had passed. The absorbance (A 600 ) measured at the time of 20 hours elapsed was confirmed to be 3.162 ± 0.157, and in the case of 30°C, the most rapid growth activity was confirmed at the time point 16 hours elapsed, and 16 hours From the time point elapsed, the number of cells gradually increased, but the degree was limited, and the absorbance (A 600 ) measured at the time of 16 hours was found to be 3.035 ± 0.174, and the absorbance (A 600 ) was 3.000 in the shortest time. It was confirmed that 30°C increased above is the optimum growth temperature.

상기 최적 생육 온도로 확인된 30℃에서 pH를 달리하며 상기 웨이셀라 코리엔시스 DB1 균주의 최적 생육 pH를 확인하였다. 구체적으로, 상기 웨이셀라 코리엔시스 DB1 균주를 5 N HCl 또는 5 N NaOH를 사용하여 pH를 pH 4.0, pH 5.0, pH 6.0, pH 7.0 및 pH 8.0으로 조정한 MRS 배지(Difco, USA)에 1%(v/v), 약 6.70 log CFU/mL로 접종하고, 배양 pH를 달리하며 16시간 동안 배양한 후, 600 nm에서 흡광도를 측정하여 균주의 생육 정도를 확인하였다. 상기 생육 정도를 측정한 결과를 도 5에 나타내었다.By varying the pH at 30° C., which was identified as the optimal growth temperature, the optimal growth pH of the Weisella coriensis DB1 strain was confirmed. Specifically, the Weisella coriensis DB1 strain was 1% in MRS medium (Difco, USA) adjusted to pH 4.0, pH 5.0, pH 6.0, pH 7.0 and pH 8.0 using 5 N HCl or 5 N NaOH. (v/v), inoculated at about 6.70 log CFU/mL, cultured for 16 hours while varying the culture pH, and then measured the absorbance at 600 nm to confirm the growth degree of the strain. The results of measuring the growth degree are shown in FIG. 5.

상기 도 5에 바타낸 바와 같이, 최적 생육 pH는 pH 6 내지 pH 8인 것으로 확인되었다. 구체적으로, pH 4에서 pH 6까지는 pH가 증가하여 중성에 가까워질수록 생육 활성이 증가한 반면, pH 6 내지 pH 8에서는 세포 수(Viable cell number)가 8.32 log CFU/mL 내지 8.84 log CFU/mL로 유사한 정도를 나타내어, 생육 pH는 pH 6 내지 pH 8인 것으로 확인되었다.As shown in FIG. 5, it was confirmed that the optimum growth pH was between pH 6 and pH 8. Specifically, from pH 4 to pH 6, the growth activity increases as the pH increases and approaches neutrality, whereas in pH 6 to pH 8, the viable cell number is 8.32 log CFU/mL to 8.84 log CFU/mL. Showing a similar degree, the growth pH was found to be between pH 6 and pH 8.

상기 확인된 결과를 기초로, 상기 웨이셀라 코리엔시스 DB1 균주가 오르니틴을 생성하기 위한 최적 생육 조건 즉, 아르기닌이 첨가된 생육 조건에서의 최적 생육 pH가 상기 확인된 최적 생육 pH 조건인 pH 6 내지 pH 8와 일치하는지 여부를 추가로 확인하였다.Based on the above-identified results, the optimal growth conditions for the Weissella coriensis DB1 strain to produce ornithine, that is, the optimal growth pH in the growth conditions to which arginine is added, is from pH 6 to the identified optimal growth pH condition. It was further checked whether it coincided with pH 8.

구체적으로, 상기 최적 생육 온도로 확인된 30℃에서 1%(w/v) 아르기닌이 첨가된 MRS 배지를 이용하여 pH를 달리하며 상기 웨이셀라 코리엔시스 DB1 균주의 최적 생육 pH를 확인하였다. 구체적으로, 상기 웨이셀라 코리엔시스 DB1 균주를 5 N HCl 또는 5 N NaOH를 사용하여 pH를 pH 4.0, pH 5.0, pH 6.0, pH 6.5 및 pH 7.0으로 조정한 1%(w/v) 아르기닌이 첨가된 MRS 배지에 1%(v/v), 약 6.70 log CFU/mL로 접종하고, 배양 pH를 달리하며 24시간 동안 배양한 후, 600 nm에서 흡광도를 측정하여 균주의 생육 정도를 확인하였다. 상기 생육 정도를 측정한 결과를 도 6에 나타내었다.Specifically, the pH was varied using the MRS medium to which 1% (w/v) arginine was added at 30° C., which was confirmed as the optimum growth temperature, and the optimum growth pH of the Weisella coriensis DB1 strain was confirmed. Specifically, 1% (w/v) arginine adjusted to pH 4.0, pH 5.0, pH 6.0, pH 6.5 and pH 7.0 using 5 N HCl or 5 N NaOH was added to the Weisella coriensis DB1 strain Inoculated with 1% (v/v), about 6.70 log CFU/mL in the MRS medium, cultured for 24 hours with different culture pH, and then measured the absorbance at 600 nm to confirm the growth degree of the strain. The results of measuring the growth degree are shown in FIG. 6.

상기 도 6에 바타낸 바와 같이, 최적 생육 pH는 기존 MRS 배지를 이용하여 측정한 경우 즉, pH 6 내지 pH 8와 달리 pH 5인 것으로 확인되었다. 구체적으로, pH 4에서는 생육활성이 낮은 것으로 확인된 반면, pH 5에서는 흡광도(A600)가 5.000보다 높아(5.08 ± 0.11) 가장 우수한 것으로 확인된 반면, pH 6(A600 4.52 ± 0.20)부터 pH가 증가하여 중성에 가까워질수록 생육 활성이 감소하였으며, MRS 배지에 1%(w/v) 아르기닌을 첨가한 배지 자체로 pH를 조정하지 않은 경우(초기 pH가 pH 7.2 내지 pH 7.5)에서는 pH 7보다 낮은 것으로 확인되어, 아르기닌이 첨가된 생육 조건에서는 최적 생육 pH가 pH 5로 초기 pH를 조정한 것으로 확인되었다.As shown in FIG. 6, it was confirmed that the optimum growth pH was measured using an existing MRS medium, that is, pH 5, unlike pH 6 to pH 8. Specifically, it was confirmed that the growth activity was low at pH 4, whereas the absorbance (A 600 ) at pH 5 was higher than 5.000 (5.08 ± 0.11) and was found to be the best, whereas at pH 6 (A 600 4.52 ± 0.20), the pH The growth activity decreased as it increased and approached neutrality.In the case where the pH was not adjusted with the medium containing 1% (w/v) arginine in the MRS medium (initial pH was pH 7.2 to pH 7.5), the pH was 7 It was found to be lower, and it was confirmed that the initial pH was adjusted to pH 5 in the growing condition to which arginine was added.

2-2. 분리 균주의 최적 오르니틴 생성 조건 확인2-2. Confirmation of optimal ornithine production conditions of isolated strains

상기 2-1에서 확인된 결과를 기초로, 상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1) 균주의 배양 조건에 따른 오르니틴 생산능을 확인하기 위해, 30℃에서 초기 pH를 pH 5로 조절한 1%(w/v) 아르기닌이 첨가된 MRS 배지와 pH를 조절하지 않은 1%(w/v) 아르기닌이 첨가된 MRS 배지(pH 7.2 내지 pH 7.5)에서 48시간 동안 배양하며, 24시간이 경과된 시점과 48시간이 경과된 시점에서의 오르니틴 생성 정도를 확인하였다.Based on the results confirmed in 2-1, in order to confirm the ornithine production capacity according to the culture conditions of the Weissella koreensis DB1 strain, 1 adjusted the initial pH to pH 5 at 30°C. %(w/v) arginine-added MRS medium and 1% (w/v) arginine-added MRS medium (pH 7.2 to pH 7.5) for 48 hours, 24 hours elapsed The degree of ornithine production at the time point and 48 hours elapsed was confirmed.

상기 오르니틴 생산능은 상기와 같은 방법으로 HPLC를 이용한 아미노산 분석법을 통해 확인하였다. The ornithine production ability was confirmed through an amino acid analysis method using HPLC in the same manner as described above.

구체적으로, 상기 각각의 조건에서 상기 웨이셀라 코리엔시스 DB1 균주를 배양한 배양액을 9,950 x g 및 4℃ 조건에서 3분 동안 원심분리 한 후, 상징액을 수득하고, 얻어진 상등액을 0.2 μm의 membrane filter(Sartorius, 독일)로 여과시켜 불순물 등을 제거해 분석에 사용하였다. OPA(O-phthalaldehyde)-FMOC(fluorenylmethyl chloroformate) 유도체화하여 HPLC(Ultimate 3000, Thremo Scientific Dionex, USA)로 분석하였다. 컬럼 오븐 온도는 40℃로 하였으며 컬럼은 Inno C18 column(4.6 × 150 mm, 5 μm, Youngjin Biochrom, 대한민국)을 사용하였다. 이동상은 40 mM sodium phosphate(pH 7.0), water : acetonitrile : methanol = 10 : 45 : 45로 혼합된 용액을 각각 A와 B로 1.5 mL/min의 유속으로 사용하였다. 구배조건은 A용액 : B용액으로서 0 내지 24분에 95 : 5(v/v, %)에서 24 내지 25분에 45 : 55, 23 내지 34.5분에 20 : 80, 34.5분부터 95 : 5로 설정하여 분석을 시행하였다. 아미노산 함량은 표준 아미노산의 HPLC 분석결과를 토대로 작성한 표준곡선을 이용하여 산출하였다.Specifically, the culture solution obtained by culturing the Weicella coriensis DB1 strain in each of the above conditions was centrifuged for 3 minutes at 9,950 xg and 4°C for 3 minutes, and then a supernatant was obtained, and the obtained supernatant was used as a 0.2 μm membrane filter (Sartorius , Germany) to remove impurities, etc., and used for analysis. OPA (O-phthalaldehyde)-FMOC (fluorenylmethyl chloroformate) was derivatized and analyzed by HPLC (Ultimate 3000, Thremo Scientific Dionex, USA). The column oven temperature was set to 40°C, and an Inno C 18 column (4.6 × 150 mm, 5 μm, Youngjin Biochrom, Korea) was used as the column. The mobile phase was a mixture of 40 mM sodium phosphate (pH 7.0), water: acetonitrile: methanol = 10: 45: 45, A and B, respectively, at a flow rate of 1.5 mL/min. The gradient conditions are: Solution A: Solution B, from 0 to 24 minutes, 95: 5 (v/v, %), 24 to 25 minutes, 45: 55, 23 to 34.5 minutes, 20: 80, 34.5 minutes to 95: 5 It was set up and analyzed. The amino acid content was calculated using a standard curve prepared based on the results of HPLC analysis of standard amino acids.

상기 최적 생성 조건인 초기 pH를 pH 5로 조절한 1%(w/v) 아르기닌이 첨가된 MRS 배지에서 배양 후 HPLC를 통해 확인된 각각의 아미노산의 함량을 측정한 결과를 하기 표 6에 나타내었다.Table 6 shows the results of measuring the content of each amino acid identified through HPLC after culturing in MRS medium to which 1% (w/v) arginine was added, in which the initial pH, which is the optimum production condition, was adjusted to pH 5. .

Figure pat00004
Figure pat00004

상기 표 6에 나타낸 바와 같이, 48시간이 경과된 시점에서 초기 pH를 pH 5로 조절한 1%(w/v) 아르기닌이 첨가된 MRS 배지에서 상기 균주를 배양한 오르니틴의 함량이 11,090.80 mg/L으로 확인되어, 오르니틴 생산능이 매우 우수한 것으로 확인되었으며, 오르니틴 외에 항비만 활성을 가진 것으로 알려진 시트룰린도 319.33 mg/L으로 확인되어, 시트룰린 생산능도 있는 것으로 확인되었다.As shown in Table 6, the content of ornithine cultured in MRS medium containing 1% (w/v) arginine in which the initial pH was adjusted to pH 5 after 48 hours elapsed was 11,090.80 mg/ It was confirmed as L, and it was confirmed that ornithine production ability was very excellent, and citrulline, which is known to have anti-obesity activity in addition to ornithine, was also confirmed to be 319.33 mg/L, and it was also confirmed that citrulline production ability was also present.

구체적으로, 초기 pH를 조절하지 않은 경우에 48시간이 경과한 후에 오르니틴의 함량이 8,373.59 mg/L으로 확인되어, 초기 pH를 pH 5로 조절한 1%(w/v) 아르기닌이 첨가된 MRS 배지에서 48시간 배양한 경우(11,090.80 mg/L)가 초기 pH를 조절하지 않은 대조구에 비해 132.4%로 32% 넘게 생산능이 개선되는 것으로 확인되었다.Specifically, when the initial pH was not adjusted, the content of ornithine was confirmed to be 8,373.59 mg/L after 48 hours, and 1% (w/v) arginine was added with the initial pH adjusted to pH 5. It was confirmed that when cultured in the medium for 48 hours (11,090.80 mg/L), the productivity improved by more than 32% to 132.4% compared to the control without adjusting the initial pH.

또한, 기존 연구 결과(The Korean Journal of Microbiology, Vol 45, No. 4, p. 339 - 345)에서 오르니틴을 생산하는 다른 균주와 비교한 경우에도 , 본 발명의 균주는 현저하게 우수한 오르니틴 생성능이 확인되었다. 상기 기존 연구 결과와 비교를 위해, 상기 기존 연구 결과와 같이 초기 pH를 조절하지 않고 48시간 배양한 경우, 시간 당 배양액 1L에서 생산된 오르니틴 함량을 비교하였으며, 그 결과를 하기 표 7에 나타내었다.In addition, even when compared with other strains producing ornithine in the results of previous studies (The Korean Journal of Microbiology, Vol 45, No. 4, p. 339-345), the strain of the present invention has remarkably excellent ornithine producing ability. Was confirmed. For comparison with the previous study results, when cultured for 48 hours without adjusting the initial pH as in the previous study results, the content of ornithine produced in 1 L of the culture medium per hour was compared, and the results are shown in Table 7 below. .

균주 명Strain name 오르니틴 생산능(mg/L/hr)Ornithine production capacity (mg/L/hr) Weissella koreensis OK1-4 Weissella koreensis OK1-4 27.0127.01 Weissella koreensis OK1-6 Weissella koreensis OK1-6 31.4131.41 Weissella koreensis KCCM 41517 Weissella koreensis KCCM 41517 29.2329.23 Lactobacillus hilgardii KCCM 40759 Lactobacillus hilgardii KCCM 40759 21.2721.27 Weissella koreensis DB1 Weissella koreensis DB1 174.45174.45

상기 표 7에 나타낸 바와 같이, 기존 아르기닌으로부터 오르니틴을 생산할 수 있는 유산균의 경우, 오르니틴 생산능이 21 mg/L/hr 내지 31.5 mg/L/hr 정도로 확인된 반면, 본 발명의 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1) 균주는 174.45 mg/L/hr로 기존 균주에 비하여 약 5.6 내지 8.2배 더 우수한 생산능을 갖는 것으로 확인되었다.As shown in Table 7 above, in the case of lactic acid bacteria capable of producing ornithine from existing arginine, the ornithine production ability was confirmed to be about 21 mg/L/hr to 31.5 mg/L/hr, whereas weissella coriensis of the present invention DB1 ( Weissella koreensis DB1) strain was confirmed to have a production capacity of about 5.6 to 8.2 times better than the existing strain at 174.45 mg/L/hr.

뿐만 아니라, 기존 연구에서는 시트룰린을 생산할 수 있는 유산균이 전혀 확인되지 아니한 반면, 본 발명의 웨이셀라 코리엔시스 DB1 균주는 시트룰린도 생산할 수 있는 것으로 확인되었다.In addition, while existing studies have not identified any lactic acid bacteria capable of producing citrulline, it was confirmed that the Weicella coriensis DB1 strain of the present invention can also produce citrulline.

상기 결과롤부터, 본 발명의 웨이셀라 코리엔시스 DB1 균주는 오르니틴 생산능이 매우 우수할 뿐만 아니라, 시트룰린 생산능도 있어서, 항비만 또는 고지혈증 개선을 위한 유효성분 생산을 위한 최적 균주로 확인되었다.From the result roll, the Weissella coriensis DB1 strain of the present invention has not only excellent ornithine production ability, but also citrulline production ability, and thus it was confirmed as an optimal strain for the production of an active ingredient for improving anti-obesity or hyperlipidemia.

2-3. 분리 균주의 안전성 확인2-3. Confirmation of the safety of isolated strains

상기 실시예 2-1 및 2-2에서 확인된 결과를 기초로, 상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1) 균주의 안전성 여부를 확인하였다.Based on the results confirmed in Examples 2-1 and 2-2, the safety of the Weissella koreensis DB1 (Weissella koreensis DB1) strain was confirmed.

우선, 유산균이 식품 제조를 위한 발효균주 또는 생균활성제 또는 프로바이오틱 미생물로 활용되기 위해서는 인체에 대한 용혈성 독성이 없는 안전성이 요구된다. 이와 관련하여, 상기 웨이셀라 코리엔시스 DB1 균주가 적혈구의 파괴 또는 분해를 유도할 수 있는지 여부와 관련하여, 용혈성 여부를 검사하였다. First, in order for lactic acid bacteria to be utilized as a fermentation strain for food production, a probiotic active agent, or a probiotic microorganism, safety without hemolytic toxicity to the human body is required. In this regard, with respect to whether the Weicella coriensis DB1 strain can induce destruction or degradation of red blood cells, hemolytic properties were examined.

구체적으로, 상기 용혈성 확인은 Blood agar base(Oxoid, 영국)를 멸균 후에, 7% horse blood(Oxoid, 영국)를 첨가하여 평판배지를 만든 다음 상기 웨이셀라 코리엔시스 DB1 균주를 도말(streaking)한 후, 30

Figure pat00005
에서 48시간 배양하여 균체주위에 투명환의 생성여부로 용혈성을 판단하였으며, 그 결과를 도 7에 나타내었다.Specifically, the hemolytic confirmation is after sterilization of a blood agar base (Oxoid, UK), after making a plate medium by adding 7% horse blood (Oxoid, UK), and then streaking the Weisella coriensis DB1 strain. , 30
Figure pat00005
The hemolytic properties were determined by incubation for 48 hours in the cells, and the hemolytic properties were determined by the formation of transparent rings around the cells, and the results are shown in FIG.

상기 도 7에 나타낸 바와 같이, 상기 웨이셀라 코리엔시스 DB1은 용혈성 검사에서 어떤 경우(α-hemolysis 및 β-hemolysis)에도 균체주위에 적혈구가 파괴되어 생기는 투명환이 전혀 생성되지 않아, 용혈반응을 유도하지 않는 것으로 확인되었다. 따라서, 상기 웨이셀라 코리엔시스 DB1은 용혈성과 같은 인체에 대한 유해작용은 없는 것으로 확인되어, 발효식품의 종균으로서의 안전성이 있는 것으로 확인되었다.As shown in FIG. 7, the Weicella coriensis DB1 does not induce a hemolytic reaction in any case (α-hemolysis and β-hemolysis) in the hemolytic test because a transparent ring caused by destruction of red blood cells around the cells is not generated at all. It was confirmed that it does not. Therefore, it was confirmed that the Weisella coriensis DB1 had no harmful effects on the human body such as hemolytic properties, and it was confirmed that it has safety as a seed of fermented food.

또한, 식품 또는 의약으로 섭취된 유산균이 자체적으로 생육하기 위해 생성되는 물질로 인해 신체의 면역체계에 변화가 생기는 경우 안전성의 문제가 발생될 수 있으며, 이와 관련 GRAS 미생물인 유산균의 경우, 기본적인 안전성이 보장되므로, 유산균으로 인해 체내에서 항생제 내성 관련 문제가 더 관심을 받고 있다. 이와 관련하여, 상기 웨이셀라 코리엔시스 DB1 균주의 항생제 내성에 대해 검사하였다.In addition, when lactic acid bacteria ingested as food or medicine changes in the body's immune system due to substances that are produced to grow on their own, safety problems may arise. In the case of lactic acid bacteria, which are related GRAS microorganisms, basic safety is not required. As a result, problems related to antibiotic resistance in the body are receiving more attention due to lactic acid bacteria. In this regard, the Weicella coriensis DB1 strain was tested for antibiotic resistance.

상기 웨이셀라 코리엔시스 DB1 균주의 안전성을 확인하기 위하여, 기존 주로 사용되는 8종의 항생제에 대한 감수성을 액체 배지 희석법(Broth microdilution method)을 이용하여 측정하였다. 상기 8종의 항생제는 Ampicillin(AMP), Vacomycin(VAC), Gentamycin(GEN), Kanamycin(KAN), Streptomycin(STR), Erythromycin(ERY), Tetracycline(TET), Chloramphenicol(CHL)이었으며, Sigma-Aldrich(USA)에서 구입하여 규정된 용매에 녹인 후 사용하였다. 또한, 상기 항생제 감수성을 측정하기 위한 배지는 0.5% dextrose를 첨가한 Muller-Hinton(MH, BBL Muller Hinton Broth, Becton Dickinson and company, USA) 액체배지에 상기 항생제를 각 농도별로 조정하여 첨가한 것을 사용하였다. In order to confirm the safety of the Weisella coriensis DB1 strain, the sensitivity to 8 kinds of antibiotics that are mainly used in the past was measured using a broth microdilution method. The eight antibiotics were Ampicillin (AMP), Vacomycin (VAC), Gentamycin (GEN), Kanamycin (KAN), Streptomycin (STR), Erythromycin (ERY), Tetracycline (TET), Chloramphenicol (CHL), and Sigma-Aldrich It was purchased from (USA) and used after dissolving in a prescribed solvent. In addition, the medium for measuring the antibiotic sensitivity is a Muller-Hinton (MH, BBL Muller Hinton Broth, Becton Dickinson and Company, USA) liquid medium with 0.5% dextrose added by adjusting the antibiotics for each concentration. I did.

상기 항생제 감수성은 항생제의 최소 생육저해 농도(minimum inhibitory concentration, MIC)를 측정하는 방법으로 수행하였다. 구체적으로, 상기 균주의 항생제에 대한 최소 생육저해 농도는 다음과 같은 방법으로 수행하였다. 우선, MRS 액체배지에 1%(v/v) 접종하여 30℃에서 24시간 배양한 후 배양액을 9,950 x g의 조건에서 4분 동안 원심분리하여 균체를 회수한 후, 상기 0.5% Dextrose가 함유된 MH액체배지(Muller-Hinton broth)에 현탁하여 OD600 값이 0.4 내지 0.5가 되도록 조절한 다음, 상기 현탁액을 MH 액체배지에 1 : 10으로 희석하였다. 항생제를 단계별로 희석하여 준비된 배지에 상기 균주의 현탁액 즉, 희석한 배양액을 넣어준 후 혐기적인 조건하에 30℃에서 24시간 동안 배양하였다. 감수성 여부는 탁도 및 600 nm(Ultrospec 2100 pro, Amersham Biosciences, 스웨덴)에서 흡광도를 측정하여 생육도를 확인하는 방법으로 수행하였다. 탁도 및 생육도의 대조구로는 항생제를 첨가하지 않은 MH 액체배지에서 상기 균주를 배양한 결과를 사용하였다. 상기 균주에 대한 감수성 해석은 European Food Safety Authority(EFSA, 2012)에서 제시한 웨이셀라 코리엔시스(Weissella koreensis)에 대한 제안값(break point)이 없으므로, 웨이셀라 코리엔시스(Weissella koreensis)의 항생제 내성 관련 수행된 타 연구에서 확인된 실험값과 비교하여 항생제 감수성 또는 내성을 결정하였다. 상기 측정 결과와 타 연구에서 확인된 웨이셀라 코리엔의 실험값을 하기 표 8에 나타내었다. 하기 표 8의 단위(Unit)는 MIC(μg / mL)이다. The antibiotic sensitivity was performed by measuring the minimum inhibitory concentration (MIC) of the antibiotic. Specifically, the minimum growth inhibitory concentration for antibiotics of the strain was performed in the following manner. First, after inoculating 1% (v/v) in MRS liquid medium and incubating for 24 hours at 30° C., the culture medium was centrifuged for 4 minutes at 9,950 xg to recover the cells, and then MH containing the 0.5% Dextrose. It was suspended in a liquid medium (Muller-Hinton broth) and adjusted to an OD 600 value of 0.4 to 0.5, and the suspension was diluted 1:10 in MH liquid medium. The suspension of the strain, that is, the diluted culture solution was added to the prepared medium by diluting the antibiotic step by step, and then incubated at 30° C. for 24 hours under anaerobic conditions. Susceptibility was determined by measuring turbidity and absorbance at 600 nm (Ultrospec 2100 pro, Amersham Biosciences, Sweden) to confirm growth. As a control for turbidity and growth, the result of culturing the strain in MH liquid medium to which antibiotics were not added was used. Since there is no break point for Weissella koreensis suggested by the European Food Safety Authority (EFSA, 2012), the sensitivity analysis for the strain is related to antibiotic resistance of Weissella koreensis. Antibiotic susceptibility or resistance was determined by comparison with experimental values confirmed in other studies performed. Table 8 below shows the measurement results and experimental values of Weisella Corrients confirmed in other studies. The unit of Table 8 below is MIC (μg / mL).

Figure pat00006
Figure pat00006

상기 표 8에 나타낸 바와 같이, 본 발명의 균주인 상기 웨이셀라 코리엔시스 DB1 균주 8 종류의 항생제 모두에 대하여 사전 연구 조사한 결과에 비해 낮은 최소생육저해농도를 보여, 상기 8 종의 항생제 모두에 대해 감수성을 갖는 것으로 확인되었다. 상기 결과로부터, 상기 웨이셀라 코리엔시스 DB1 균주는 인간의 건강에 위험을 나타내지 않은 기준정도의 항생제 저항성만을 나타내어, 항생제 내성을 갖지 않는 즉, 생균활성제로 사용이 가능한 안전한 균주임을 확인되었다.As shown in Table 8, the Weissella coriensis DB1 strain, which is the strain of the present invention, showed a lower minimum growth inhibitory concentration compared to the results of a preliminary study on all eight kinds of antibiotics, and was susceptible to all of the eight kinds of antibiotics. Was found to have. From the above results, it was confirmed that the Weisella coriensis DB1 strain exhibits only a standard level of antibiotic resistance, which does not present a risk to human health, and thus does not have antibiotic resistance, that is, it is a safe strain that can be used as a probiotic.

추가로, 최근 서구뿐만 아니라 우리나라에서도 발효식품과 관련 문제가 되는 생체아민 생성 여부를 확인하였다. 상기 생체아민 생성여부는 생체아민 생성능이 있는 것으로 기존에 보고된 균주인 엔테로코커스 파에칼리스 균주(Enterococcus faecalis ATCC 29212)와 비교하여, 탈탄산효소능 확인 실험(Decarboxylase plate method, Bover-Cid)와 생체아민 생성 정도를 HPLC로 확인하는 실험으로 확인하였다.In addition, it was recently confirmed whether bioamines were produced, which is a problem related to fermented foods in Korea as well as in the West. The bio-amine production was compared with the previously reported strain Enterococcus faecalis ATCC 29212 as having bio-amine-producing ability, and the decarboxylase activity confirmation experiment (Decarboxylase plate method, Bover-Cid) and in vivo The degree of amine production was confirmed by an experiment confirming by HPLC.

상기 탈탄산효소능 확인 실험을 위해 우선, 전구체 아미노산으로서 Tyrosine을 0.1% 첨가한 액체 배지 9mL에 균주 배양액 1mL를 첨가하여 24시간 동안 배양한 후, 9.0 log CFU/mL의 농도로 준비하였다. 준비된 배양액을 1% Tyrosine이 첨가된 탈탄산효소 배지(Decarboxylase plate)에 10 μL 점적하여 해당 균주가 형성한 집락(colony)의 주변에 색깔 변화를 확인하는 방법으로 수행하였다. 상기 형성된 콜로니의 주변 색깔 변화를 확인한 결과를 도 8a에 나타내었다.For the decarboxylase activity confirmation experiment, first, 1 mL of the strain culture solution was added to 9 mL of a liquid medium to which 0.1% of Tyrosine was added as a precursor amino acid, followed by incubation for 24 hours, and then prepared at a concentration of 9.0 log CFU/mL. The prepared culture was carried out by dropping 10 μL on a decarboxylase plate to which 1% Tyrosine was added to check the color change around the colony formed by the corresponding strain. The result of confirming the change in the surrounding color of the formed colony is shown in FIG. 8A.

상기 도 8a에 나타낸 바와 같이, 좌측의 ATCC 29212(Enterococcus faecalis ATCC 29212)는 집락(colony) 주변이 선명한 보라색으로 나타내어, 생체아민 생성능이 있음이 확인된 반면, DB1(본 발명의 웨이셀라 코리엔시스 DB1)은 콜로니 주변이 전혀 변화되지 않아, 생체아민 생성능이 없는 것으로 판단되었다.As shown in FIG. 8A, ATCC 29212 ( Enterococcus faecalis ATCC 29212) on the left has a vivid purple color around the colony, confirming that it has bioamine-producing ability, whereas DB1 (Weissella coriensis DB1 of the present invention) ) Did not change at all around the colony, so it was judged that there was no bioamine-producing ability.

추가로, 웨이셀라 코리엔시스 DB1의 생체아민 생성능을 확인하기 위해, 웨이셀라 코리엔시스 DB1 균주의 배양액에 대해 HPLC를 수행하여, 생체아민 생성 여부 및 생성된 생체아민의 양을 정량적으로 검증하였다.In addition, in order to confirm the bioamine-producing ability of Weissella coriensis DB1, HPLC was performed on the culture medium of the Weissella coriensis DB1 strain, and whether or not bioamine was produced and the amount of bioamine produced were quantitatively verified.

상기 HPLC를 이용한 검증은 하기와 같은 방법으로 수행하였다. 우선, HPLC를 이용한 생체아민 생성여부를 검증하기 위해, 생체아민 표준용액(BA standard solution)을 조제하였다. 상기 생체아민 표준용액은 총 9종의 생체아민과 내부표준물질(internal standard, IS)을 이용하여 조제하였다. 상기 9종의 생체아민은 구체적으로 트립타민(tryptamine hydrochloride, TRY, 49.12 mg), 퓨트레신 (putrescine dihydrochloride, PUT, 73.2 mg), 카다베린(cadaverine dihydrochloride, CAD, 68.56 mg), 스퍼 미다인(spermidine trihydrochloride, SPD, 70.16 mg), 페닐에틸아민(2-phenylethylamine hydrochloride, PHE, 52.08 mg), 스퍼민(spermine tetrahydrochloride, SPM, 68.8 mg), 히스타민(histamine dihydrochloride, HIS, 66.24 mg), 티라민(tyramine hydrochloride, TYR, 50.72 mg) 및 아그마틴(agmatine sulfate, AGM, 70.16 mg)이며, 상기 9종의 생체아민과 내부표준물질(1,7-diaminoheptane, IS, 40 mg)을 각각 0.1 N HCl 40 mL에 녹여 최종 1 mg/mL 농도로 준비하였다. 상기 생체아민 표준용액(BA standard solution)은 상기 생체아민과 내부표준물질(IS)을 각각 0.1 mg/mL 농도로 혼합하여 제조하였다.Verification using the HPLC was performed in the following manner. First, in order to verify whether or not bioamine is produced using HPLC, a bioamine standard solution (BA standard solution) was prepared. The bioamine standard solution was prepared using a total of 9 types of bioamine and an internal standard (IS). Specifically, the nine biological amines are tryptamine (tryptamine hydrochloride, TRY, 49.12 mg), putrescine (putrescine dihydrochloride, PUT, 73.2 mg), cadaverine (cadaverine dihydrochloride, CAD, 68.56 mg), and spur midyne (TRY, 49.12 mg). spermidine trihydrochloride, SPD, 70.16 mg), phenylethylamine (2-phenylethylamine hydrochloride, PHE, 52.08 mg), spermine (spermine tetrahydrochloride, SPM, 68.8 mg), histamine (histamine dihydrochloride, HIS, 66.24 mg), tyramine (tyramine hydrochloride) , TYR, 50.72 mg) and agmatine (agmatine sulfate, AGM, 70.16 mg), and the 9 kinds of biological amines and internal standards (1,7-diaminoheptane, IS, 40 mg) were added to each of 0.1 N HCl 40 mL. It was dissolved and prepared at a final concentration of 1 mg/mL. The biological amine standard solution (BA standard solution) was prepared by mixing the biological amine and the internal standard substance (IS) at a concentration of 0.1 mg/mL, respectively.

또한, 상기 HPLC를 수행하기 위한 웨이셀라 코리엔시스 DB1 균주의 배양액으로부터 생체아민을 추출하는 방법은 Hwang 등의 방법(Journal of Chromatography B, Vol 693, pp. 23-30(1997))을 변형하여 사용하였다. 보다 구체적으로, 상기 웨이셀라 코리엔시스 DB1 균주를 각각 30

Figure pat00007
에서 24시간 전배양한 후, MRS broth와 MRSO broth(상기 MRS broth에 0.1% 오르니틴(Ornithine, 전구체)를 첨가한 배지)에 각각 전배양한 균주를 10%씩 접종하여 24시간 동안 배양하였다. 상기 24시간 동안 배양한 후, 4
Figure pat00008
및 9,950 x g의 조건으로 15분간 원심분리한 후, 상등액만을 분리하여 균체를 제거하고 배양 상징액을 회수하였다. 상기 회수한 배양 상징액을 0.2 μm membrane filter로 제균한 후, 동결건조하여 10배 농축하였다. 상기 10배 농축한 농축 배양 상징액 2 mL에 5% trichloroacetic acid(TCA)-0.4 M perchloric acid(HClO4) 10 mL을 가하고, 상기 내부표준물질(IS, 1,7-diaminoheptane)를 0.2 mg/mL첨가하여 추출하였다. 상기 생체아민 및 내부표준물질이 포함된 생체아민 표준용액과 상기 추출된 배양 상징 추출액에 대해 우선 유도 체화를 수행한 후, HPLC를 수행하였다. In addition, the method of extracting a biological amine from the culture medium of Weicella coriensis DB1 strain for performing the HPLC is used by modifying the method of Hwang et al. (Journal of Chromatography B, Vol 693, pp. 23-30 (1997)). I did. More specifically, the Weisella coriensis DB1 strain was each 30
Figure pat00007
After pre-culture in 24 hours, the strains pre-cultured in MRS broth and MRSO broth (a medium in which 0.1% ornithine (precursor) was added to the MRS broth) were each inoculated with 10% of the strains and cultured for 24 hours. After incubation for the above 24 hours, 4
Figure pat00008
And after centrifuging for 15 minutes under the conditions of 9,950 xg, only the supernatant was separated to remove the cells, and the culture supernatant was recovered. The collected culture supernatant was sterilized with a 0.2 μm membrane filter, and then lyophilized and concentrated 10 times. 10 mL of 5% trichloroacetic acid (TCA)-0.4 M perchloric acid (HClO4) was added to 2 mL of the 10-fold concentrated culture supernatant, and 0.2 mg/mL of the internal standard (IS, 1,7-diaminoheptane) was added. And extracted. The bioamine standard solution containing the bioamine and the internal standard and the extracted culture symbol extract were first subjected to derivatization, followed by HPLC.

상기 HPLC를 수행하기 전에 수행된 유도체화 과정 및 상기 추출된 농축 배양 상징 추출액의 유도체와 과정은 다음과 같은 방법으로 수행하였다. 상기 생체아민 표준 물질 혼합용액과 상기 추출된 농축 배양 상징 추출액에 각각 2 M NaOH 1 mL와 benzoyl chloride 10 μL를 가하고 30

Figure pat00009
에서 40분간 반응시켰다(benzoylation). 상기 각각의 반응액에 포화된 NaCl 용액(saturated NaCl) 2 mL를 가하여 반응을 정지시키고, 디에틸 에테르(diethyl ether) 3 mL를 첨가하여 추출한 다음, 상징액 1.5 mL을 분취하여 질소 가스로 농축하였다. 상기 질소가스로 농축한 상징액을 50% 메탄올 수용액(이동상) 500 μL에 용해하여 HPLC 분석 시료로 사용하였다. 또한, 상기 생체아민 및 내부표준물질을 이용하여 정확한 생체아민 분석을 위해 HPLC 분석 조건을 설정하였다. 상기 HPLC를 수행한 기계에 관한 사항 및 수행조건과 최종 분석조건으로 결정된 HPLC의 분석조건을 하기 표 9 및 표 10에 나타내었다.The derivatization process performed before performing the HPLC and the derivative and process of the extracted concentrated culture symbol extract were performed in the following manner. 1 mL of 2 M NaOH and 10 μL of benzoyl chloride were added to the bioamine standard mixture solution and the extracted concentrated culture supernatant extract, respectively, and 30
Figure pat00009
It was reacted for 40 minutes at (benzoylation). The reaction was stopped by adding 2 mL of saturated NaCl solution to each of the reaction solutions, followed by extraction with 3 mL of diethyl ether, and 1.5 mL of the supernatant was aliquoted and concentrated with nitrogen gas. The supernatant concentrated with nitrogen gas was dissolved in 500 μL of a 50% methanol aqueous solution (mobile phase) and used as an HPLC analysis sample. In addition, HPLC analysis conditions were set for accurate bioamine analysis using the bioamine and internal standard material. Tables 9 and 10 show the details of the machine that performed the HPLC and the conditions for the HPLC analysis determined as the final analysis conditions.

InstrumentInstrument Youngin instrumentYoungin instrument DetectorDetector UV-730D(254 nm)UV-730D (254 nm) ColumnColumn SunFire C18(4.6 x 150 nm, 3.5 μm, Waters)SunFire C 18 (4.6 x 150 nm, 3.5 μm, Waters) SolventSolvent A: water : methanol(50 : 50) / B: water : methanol(10 : 90)A: water: methanol (50: 50) / B: water: methanol (10: 90) Oven temperatureOven temperature 40℃40 Injection VolInjection Vol 20 μL20 μL

Time(min)Time(min) Flow rate(mL/min)Flow rate (mL/min) A(%)A(%) B(%)B(%) 00 0.40.4 100100 00 1515 0.40.4 00 100100 2525 0.40.4 00 100100 3030 0.40.4 100100 00 5555 0.40.4 100100 00

상기 표 9 및 표 10의 조건으로 수행한 HPLC 결과를 도 8b에 나타내었다. 상기 도 8b에 나타낸 바와 같이, 웨이셀라 코리엔시스 DB1은 정량적인 실험 결과에서도 생체아민을 생성하지 않는 것으로 확인되었다.The HPLC results performed under the conditions of Table 9 and Table 10 are shown in FIG. 8B. As shown in FIG. 8B, it was confirmed that Weicella coriensis DB1 did not generate bioamine even in quantitative experimental results.

상기 결과로부터, 본 발명의 웨이셀라 코리엔시스 DB1은 GRAS 미생물로 안전성이 보편적으로 확보되어 있을 뿐만 아니라, 용혈성 검사, 항생제 내성 검사 및 생체아민 생성능 검사 결과 모두 음성으로 확인되어, 개별적인 안전성도 확보된 것으로 확인되었다.From the above results, the Weicella Coriansis DB1 of the present invention is not only universally secured as a GRAS microorganism, but also as a result of a hemolytic test, an antibiotic resistance test, and a bioamine-producing ability test, all of which were confirmed negative, and individual safety was also secured. Confirmed.

실시예3. 분리 균주를 이용한 기능성 미강 생산Example 3. Functional rice bran production using isolated strains

3-1. 분리 균주를 이용한 기능성 미강 생산 조건 확인3-1. Confirmation of functional rice bran production conditions using isolated strains

상기 시트룰린 및 오르니틴 생산능을 가지며, 오르니틴 생산능이 다른 균주에 비해 현저하게 우수한 것으로 확인된 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1) 균주를 활용하여, 미강 발효물을 제조하기 위해 최적의 조건을 확인하였다. Using the Weissella koreensis DB1 (Weissella koreensis DB1) strain, which has the citrulline and ornithine production ability, and ornithine production ability is remarkably superior to other strains, the optimum conditions are used to prepare the rice bran fermentation product. Confirmed.

우선, 미강 발효물을 제조하기 위해 발효균주 및 발효원물인 미강은 다음과 같은 방법으로 제조하였다.First, in order to prepare a rice bran fermented product, a fermented strain and rice bran as a fermentation raw material were prepared by the following method.

상기 발효균주는 웨이셀라 코리엔시스 DB1 균주를 MRS 배지에 접종한 후, 30℃에서 24시간 동안 배양한 후, 상기 배양액의 1%를 MRS 배지에 접종하여 30℃에서 24시간 동안 배양하는 계대 배양을 2회 즉, 1차 및 2차로 수행한 후, 2차 계대배양한 배양액을 10,000 x g 및 4℃ 조건에서 15분 동안 원심분리를 수행한 다음 상등액을 제거하고 균체를 회수하였다. 상기 회수한 균체에 멸균수를 가하여 약 6.70 log CFU/mL의 농도로 현탁하여, 미강 발효용 종균으로 사용하였다.The fermentation strain was inoculated with Weissella coriensis DB1 strain in MRS medium, cultured at 30°C for 24 hours, and then 1% of the culture medium was inoculated into MRS medium, followed by passage culture in which cultured at 30°C for 24 hours. Times, that is, after performing the first and second times, the second passage culture was centrifuged at 10,000 xg and 4° C. for 15 minutes, and then the supernatant was removed and the cells were recovered. Sterile water was added to the recovered cells and suspended at a concentration of about 6.70 log CFU/mL, and used as a seed for fermentation of rice bran.

상기 발효원물인 미강은 쌀 도정과정에서 수득한 미강을 3차 증류수에 20%(w/v, 미강 중량/증류수 부피), 45%(w/v, 미강 중량/증류수 부피) 및 50%(w/v, 미강 중량/증류수 부피)의 비율로 첨가한 후, 아르기닌(Arginine)을 1%(w/v, 아르기닌 중량/증류수 부피)의 농도로 첨가 여부로 구분하여 실험예(1% 아르기닌 첨가)와 비교예(1% 아르기닌 미첨가)로 구분하여 제조하였다. 각각 제조된 실험예와 비교예의 미강 혼합액을 고압멸균기(Autoclave)를 이용하여 121℃의 온도조건 및 1.1 기압의 압력조건에서 15분 동안 가열하여 미강을 호화시켰다. 상기 호화시킨 미강을 상온(15℃ 내지 20℃)으로 식혀, 미강 발효 대상물로 사용하였다.The fermentation raw rice bran is 20% (w/v, rice bran weight/volume of distilled water), 45% (w/v, rice bran weight/volume of distilled water) and 50% (w /v, rice bran weight/distilled water volume), and then arginine was added at a concentration of 1% (w/v, arginine weight/distilled water volume).Experimental example (addition of 1% arginine) And Comparative Example (1% arginine not added) was prepared by dividing. Rice bran were gelatinized by heating the prepared rice bran mixture of each of the experimental examples and comparative examples under a temperature condition of 121°C and a pressure condition of 1.1 atm using an autoclave for 15 minutes. The gelatinized rice bran was cooled to room temperature (15° C. to 20° C.) and used as a rice bran fermentation object.

상기 미강 발효 대상물인 아르기닌이 첨가된 미강 혼합액에 상기 약 6.70 log CFU/mL의 미강 발효용 종균을 1%(v/v) 접종하고, 멸균 유리막대를 이용하여 충분히 혼합한 후 30℃에서 48시간 동안 발효를 수행하였다. 상기 발효된 미강 발효물은 24시간 별로 발효물 내 생균수와 아미노산 함량의 변화를 분석하였다.1% (v/v) of the rice bran fermentation seeds of about 6.70 log CFU/mL were inoculated into the rice bran fermentation solution to which arginine, which is the target of rice bran fermentation, and sufficiently mixed using a sterilized glass rod, and then at 30° C. for 48 hours During the fermentation was carried out. The fermented rice bran fermentation product was analyzed for changes in the number of viable bacteria and amino acid content in the fermented product every 24 hours.

상기 생균수는 plate count법으로 분석하였고, 아미노산 함량의 변화는 24시간이 경과된 발효물을 상기 실시예 2-2에서수행한 HPLC 분석법으로 분석하였다. The number of viable cells was analyzed by the plate count method, and the change in amino acid content was analyzed by the HPLC analysis performed in Example 2-2 on the fermented product after 24 hours.

상기 plate count법은 다음과 같은 방법으로 수행하였다. 우선, 상기 발효물에 부피비를 기준으로 상기 발효물의 4배의 멸균수를 혼합한 후, 멸균가아제를 이용하여 착즙하였다. 상기 착즙한 착즙액을 단계적 희석법(Serial dilution, 10배 희석)으로 10배씩 희석하면서 희석액을 제조하였다. 상기 희석한 단계별 희석액을 MRS 고체배지(MRS plate)에 분주하고 도말한 후, 30℃에서 48시간 동안 배양하며, 24시간 별로 집락(colony) 숫자를 세어 CFU/mL로 계산하였다.The plate count method was performed in the following manner. First, the fermented product was mixed with sterilized water of 4 times the amount of the fermented product based on the volume ratio, and then juiced using a sterilized gauze. A dilution was prepared while diluting the juiced juice by 10 times by a stepwise dilution method (Serial dilution, 10 times dilution). The diluted stepwise dilution was dispensed on an MRS solid medium (MRS plate) and plated, incubated at 30° C. for 48 hours, and the number of colonies was counted every 24 hours and calculated as CFU/mL.

상기 측정된 생균수를 하기 표 11에 나타내었다.The measured number of viable cells is shown in Table 11 below.

첨가성분 함량Additive content 생균수 (log CFU/mL)Viable cell count (log CFU/mL) 미강 함량(w/v)Rice bran content (w/v) 아르기닌 함량(w/v)Arginine content (w/v) 24시간24 hours 48시간48 hours 20%20% 0%0% 7.33±0.507.33±0.50 7.34±0.407.34±0.40 1%One% 7.47±0.367.47±0.36 7.48±0.427.48±0.42 45%45% 0%0% 7.56±0.347.56±0.34 7.56±0.407.56±0.40 1%One% 8.13±0.168.13±0.16 7.49±0.397.49±0.39 50%50% 0%0% 7.48±0.257.48±0.25 7.31±0.257.31±0.25 1%One% 8.11±0.198.11±0.19 7.46±0.227.46±0.22

상기 표 11에 나타낸 바와 같이, 24시간 경과 시점을 기준으로 각각의 미강 첨가 함량(20%, 45% 및 50%) 모두에서, 상기 발효균주인 웨이셀라 코리엔시스 DB1 균주의 생균수는 1%(w/v) 아르기닌 첨가에 따라 생균수가 약 0.1 내지 0.6 log CFU/mL 정도가 증가하는 것으로 확인되어, 아르기닌의 첨가에 의해 생균수가 유의적으로 증가됨이 확인되었다. 특히, 상기 웨이셀라 코리엔시스 DB1 균주는 배양원액의 50% 이상이 고체(50%의 미강 및 1% 아르기닌)인 조건에서도 유효하게 생육하는 것으로 확인되어 발효가 가능한 것으로 확인되었다. 일반적인 미생물의 경우 높은 고형물 농도에서는 미생물 발효가 제한적이어서, 효율이 중요한 미생물 발효균주의 산업화에 있어서 제한적인 효과를 나타내는 반면, 본 발명의 균주인 상기 웨이셀라 코리엔시스 DB1 균주는 고농도의 고형물 농도에서도 미생물 발효가 유효한 것으로 확인되어, 산업적 효과가 클 것으로 기대되었다.As shown in Table 11, in all of the added rice bran content (20%, 45%, and 50%) based on the lapse of 24 hours, the number of viable cells of the fermentation strain Weisella coriensis DB1 strain was 1% (w /v) It was confirmed that the number of viable cells increased by about 0.1 to 0.6 log CFU/mL with the addition of arginine, and it was confirmed that the number of viable cells was significantly increased by the addition of arginine. In particular, the Weisella coriensis DB1 strain was confirmed to be able to fermentation because it was found to grow effectively even in a condition in which 50% or more of the culture stock solution was solid (50% rice bran and 1% arginine). In the case of general microorganisms, microbial fermentation is limited at high solids concentrations, thus exhibiting a limited effect in the industrialization of microbial fermentation strains where efficiency is important, whereas the Weisella coriensis DB1 strain, which is the strain of the present invention, ferments microorganisms even at high solids concentrations. Was confirmed to be effective, and the industrial effect was expected to be great.

3-2. 미강 발효를 위한 최적 발효 조건 확인3-2. Confirmation of optimal fermentation conditions for rice bran fermentation

상기 3-1에서 미강 발효에 적합한 균주로 확인된 상기 시트룰린 및 오르니틴 생산능을 가지며, 오르니틴 생산능이 다른 균주에 비해 현저하게 우수한 웨이셀라 코리엔시스 DB1 균주를 이용한 기능성 미강 발효물 제조를 위한 최적 조건을 확인하기 위해 최적 발효 pH 및 최적 발효 온도를 확인하였다.It has the citrulline and ornithine production ability identified as a strain suitable for rice bran fermentation in 3-1, and the ornithine production ability is remarkably superior to other strains. In order to confirm the conditions, the optimum fermentation pH and the optimum fermentation temperature were confirmed.

상기 최적 발효 pH 및 최적 발효 온도는 각각의 발효 조건에서 상기 3-1에서 확인한 생균수를 측정하는 방법으로 생균수를 측정하여 확인하였다. 구체적으로, 상기 실시예 3-1에서 제조된 회수한 균체에 멸균수를 가하여 약 6.70 log CFU/mL의 농도로 현탁하여, 미강 발효용 종균을 상기 미강을 3차 증류수에 20%(w/v, 미강 중량/증류수 부피) 의 비율로 첨가한 후, 아르기닌(Arginine)을 1%(w/v, 아르기닌 중량/증류수 부피)의 농도로 첨가한 다음 고압멸균기(Autoclave)를 이용하여 121℃의 온도조건 및 1.1 기압의 압력조건에서 15분 동안 가열하여 미강을 호화시키고 상온으로 식혀 제조한 미강 발효 대상물에 접종한 후, 각각의 조건에서 48시간 동안 발효를 수행하였다. 상기 발효된 미강 발효물은 24시간 별로 발효물 내 생균수를 상기 3-1의 방법과 같이 plate count법으로 측정하였다. 상기 발효 조건을 달리하며 발효를 수행한 것은 우선, 30℃에서 pH를 달리하며 발효를 수행한 후에 최적 pH를 확인하고, 이후 최적 pH에서 온도를 달리하며 발효하는 방법으로 수행하였다.The optimum fermentation pH and optimum fermentation temperature were confirmed by measuring the number of viable cells by measuring the number of viable cells identified in 3-1 under each fermentation condition. Specifically, sterilized water was added to the recovered cells prepared in Example 3-1 and suspended at a concentration of about 6.70 log CFU/mL, and the rice bran fermentation seeds were 20% (w/v) in tertiary distilled water. , Rice bran weight/volume of distilled water), and then arginine was added at a concentration of 1% (w/v, arginine weight/volume of distilled water), and then a temperature of 121℃ using an autoclave. The rice bran was gelatinized by heating under conditions and a pressure of 1.1 atm for 15 minutes, cooled to room temperature, and then inoculated into the prepared rice bran fermentation target, and fermentation was performed for 48 hours under each condition. In the fermented rice bran fermentation, the number of viable bacteria in the fermentation product was measured every 24 hours by a plate count method as in the method of 3-1. Fermentation was performed with different fermentation conditions, first, fermentation was performed at 30° C. with different pH, and then the optimum pH was checked, and thereafter, the fermentation was performed by varying the temperature at the optimum pH.

상기 발효조건, 구체적으로 발효 온도 및 발효 pH 조건에 따른 발효 후 상기 웨이셀라 코리엔시스 DB1 균주의 생균수를 확이한 결과를 각각 도 9 및 도 10에 나타내었다.After fermentation according to the fermentation conditions, specifically fermentation temperature and fermentation pH conditions, the results of confirming the number of viable cells of the Weisella coriensis DB1 strain are shown in FIGS. 9 and 10, respectively.

상기 도 9에 바타낸 바와 같이, 상기 최적 발효 pH는 pH 6.0 내지 pH 6.5인 것으로 확인되었다. 구체적으로, 상기 미강을 호화시킨 미강 발효 대상물을 5 N HCl 또는 5 N NaOH를 사용하여 pH를 pH 4.0 내지 pH 7.0으로 조절한 후, 각 pH 별로 48시간 동안 발효하며 24시간 마다 생균수를 확인한 결과, pH 4.0부터 pH가 증가하여 약산성이 될수록 생균수가 증가하여 pH 6.0에서 생균수가 유의적으로 증가하여 24시간을 기준으로 생균수가 8.10 log CFU/mL인 것으로 확인되었고, pH 6.5에서도 pH 6.0과 유사한 생균수가 8.20 log CFU/mL인 것으로 확인된 반면, pH 7.0에서는 오히려 생균수가 유의적으로 낮아져, 상기 웨이셀라 코리엔시스 DB1 균주를 이용하여 미강을 발효하는데는 pH 6.0 내지 pH 6.5가 최적인 것으로 확인되었다.As shown in FIG. 9, the optimum fermentation pH was confirmed to be pH 6.0 to pH 6.5. Specifically, after adjusting the pH of the rice bran fermentation object gelatinizing the rice bran to pH 4.0 to pH 7.0 using 5 N HCl or 5 N NaOH, fermentation for 48 hours at each pH, and the number of viable bacteria every 24 hours. , As the pH increased from pH 4.0, the number of viable cells increased as the pH became weaker, and the number of viable cells increased significantly at pH 6.0, and it was confirmed that the number of viable cells was 8.10 log CFU/mL based on 24 hours, and the viable cells similar to pH 6.0 at pH 6.5. While the number was confirmed to be 8.20 log CFU/mL, the number of viable cells was significantly lowered at pH 7.0, and pH 6.0 to pH 6.5 were found to be optimal for fermenting rice bran using the Weisella coriensis DB1 strain.

또한, 상기 도 10에 나타낸 바와 같이, 상기 최적 발효 온도는 25℃ 내지 30℃인것으로 확인되었다. 상기 도 10에서 확인된 최적 pH인 pH 6.5에서 온도를 달리하며 확인된 결과, 발효 온도가 20℃이하에서는 발효가 잘 진행되지 않은 반면, 25℃에서는 생균수가 유의적으로 증가하여 24시간을 기준으로 생균수가 7.97 log CFU/mL인 것으로 확인되었고, 30℃에서는 25℃ 보다 더 발효 효율이 높아, 생균수가 8.10 log CFU/mL인 것으로 확인된 반면, 발효 온도가 37℃에서경우 30℃에 비해 생균수가 유의적으로 낮아, 최적 발효 온도는 25℃ 내지 30℃, 더 바람직하게는 30℃인 것으로 확인되었다.In addition, as shown in FIG. 10, the optimum fermentation temperature was confirmed to be 25 ℃ to 30 ℃. As a result of varying the temperature at pH 6.5, which is the optimum pH identified in FIG. 10, fermentation did not proceed well when the fermentation temperature was less than 20°C, whereas at 25°C, the number of viable cells was significantly increased and thus, based on 24 hours. The number of viable cells was found to be 7.97 log CFU/mL, and the fermentation efficiency was higher than 25°C at 30°C, and the number of viable cells was confirmed to be 8.10 log CFU/mL, whereas the number of viable cells at 37°C compared to 30°C. Significantly low, the optimum fermentation temperature was found to be 25 ℃ to 30 ℃, more preferably 30 ℃.

상기 도 9 및 도 10의 결과에 따라, 상기 웨이셀라 코리엔시스 DB1 균주를 이용한 기능성 미강 발효물 제조를 위한 최적 발효 조건은 pH 6.0 내지 pH 6.5의 pH 조건 및 25℃ 내지 30℃의 온도 조건인 것으로 확인되었다.According to the results of FIGS. 9 and 10, the optimal fermentation conditions for the production of functional rice bran fermentation products using the Weisella coriensis DB1 strain are a pH condition of pH 6.0 to pH 6.5 and a temperature condition of 25°C to 30°C. Confirmed.

또한, 상기 최적 발효 pH를 상기 2-2에서 수행한 HPLC 분석을 통해, 아르기닌과 오르니틴, 시트룰린 함량의 변화를 분석하여 확인하였다. 구체적으로, 상기 실시예 3-1에서 제조된 회수한 균체에 멸균수를 가하여 약 6.70 log CFU/mL의 농도로 현탁하여, 미강 발효용 종균을 상기 미강을 3차 증류수에 20%(w/v, 미강 중량/증류수 부피) 의 비율로 첨가한 후, 아르기닌(Arginine)을 1%(w/v, 아르기닌 중량/증류수 부피)의 농도로 첨가한 다음 고압멸균기(Autoclave)를 이용하여 121℃의 온도조건 및 1.1 기압의 압력조건에서 15분 동안 가열하여 미강을 호화시키고 상온으로 식혀 제조한 미강 발효 대상물에 접종한 후, 상기 미강 발효 대상물의 초기 pH를 달리하며, 각각의 조건에서 48시간 동안 발효를 수행하였다. 상기 48시간 경과된 각각의 발효물 전체를 건조하여 건조된 미강발효물을 수득하였다.In addition, the optimum fermentation pH was confirmed by analyzing changes in the contents of arginine, ornithine, and citrulline through HPLC analysis performed in 2-2. Specifically, sterilized water was added to the recovered cells prepared in Example 3-1 and suspended at a concentration of about 6.70 log CFU/mL, and the rice bran fermentation seeds were 20% (w/v) in tertiary distilled water. , Rice bran weight/volume of distilled water), and then arginine was added at a concentration of 1% (w/v, arginine weight/volume of distilled water), and then a temperature of 121℃ using an autoclave. After inoculating the rice bran fermentation target prepared by heating the rice bran by heating for 15 minutes under conditions and pressure conditions of 1.1 atm and cooling it to room temperature, the initial pH of the rice bran fermentation target is changed, and fermentation is performed for 48 hours under each condition. Performed. The entire fermented product after 48 hours was dried to obtain a dried rice bran fermented product.

상기 수득한 미강 발효물을 대상으로 상기 실시예 2-2에서 수행한 HPLC 분석법으로 아르기닌과 오르니틴, 시트룰린 함량의 변화를 분석하였으며, 그 결과를 하기 표 12에 나타내었다.Changes in the contents of arginine, ornithine, and citrulline were analyzed by the HPLC analysis performed in Example 2-2 on the obtained fermented rice bran, and the results are shown in Table 12 below.

NoNo Peak NamePeak Name 아미노산 함량(mg/L)Amino acid content (mg/L) pH 5.0pH 5.0 pH 6.0pH 6.0 pH 6.5pH 6.5 pH 7.0pH 7.0 1 One Arginine Arginine 37,694.6637,694.66 32,724.5632,724.56 32,899.8432,899.84 37,437.6237,437.62 2 2 OrnithineOrnithine 5,864.215,864.21 8,495.688,495.68 8,358.408,358.40 6,092.426,092.42 3 3 CitrullineCitrulline 201.68201.68 1,897.841,897.84 1,882.881,882.88 51.2151.21 TotalTotal 43,760.5643,760.56 43,118.0843,118.08 43,141.1243,141.12 43,581.2443,581.24

상기 표 12에 나타낸 바와 같이, 시트룰린 생산량 및 오르니틴 생산량의 측면에서, 최적 pH는 pH 6 내지 pH 6.5인 것으로 확인되어, 생균수를 측정한 것과 같은 결과를 확인하였다. 따라서, 상기 웨이셀라 코리엔시스 DB1 균주를 이용한 미강 발효를 위해서는 미강에 아르기닌을 첨가한 발효물을 이용하여 pH 6 내지 pH 6.5에서 발효시키는 것이 최적인 것으로 확인되었다.As shown in Table 12, in terms of citrulline production and ornithine production, the optimum pH was found to be from pH 6 to pH 6.5, confirming the same results as measuring the number of viable cells. Therefore, it was confirmed that for fermentation of rice bran using the Weisella coriensis DB1 strain, fermentation at pH 6 to pH 6.5 using a fermented product containing arginine to rice bran is optimal.

상기 결과를 종합하여, 상기 웨이셀라 코리엔시스 DB1 균주는 미강 발효에 적합하고, 미강 발효를 통해 오르니틴을 생성할 뿐만 아니라, 미강 발효물에 아르기닌이 첨가된 경우에 현저하게 높은 수율로 시트룰린과 오르니틴을 생산할 수 있으며, 상기 웨이셀라 코리엔시스 DB1 균주를 이용한 미강 발효를 위해서는 미강에 아르기닌을 첨가한 발효물을 이용하여 30℃ 및 pH 6.0 내지 pH 6.5에서 발효시키는 것이 최적인 것으로 확인되었다.In summary, the Weissella coriensis DB1 strain is suitable for rice bran fermentation, and produces ornithine through rice bran fermentation, and when arginine is added to the rice bran fermentation, citrulline and orni Tin can be produced, and for the rice bran fermentation using the Weisella coriensis DB1 strain, it has been found that fermentation at 30° C. and pH 6.0 to pH 6.5 using a fermented product containing arginine to rice bran is optimal.

3-3. 미강 발효물의 건조 방법 확인3-3. Confirmation of drying method of fermented rice bran

상기 제조된 미강 발효물의 보관 및 사용의 용이성을 개선하기 위해 건조시켜 미강 발효 건조물을 제조하였다. 상기 미강 발효 건조물의 제조에 적합한 건조법을 확인하기 위하여, 상기 3-2에서 제조된 미강 발효물을 열풍 건조와 동결 건조로 각각 건조하였다.In order to improve the ease of storage and use of the prepared rice bran fermented product, it was dried to prepare a rice bran fermented product. In order to confirm a drying method suitable for the preparation of the dried rice bran fermentation, the fermented rice bran prepared in 3-2 was dried by hot air drying and freeze drying, respectively.

상기 열풍 건조는 상기 3-2에서 제조된 미강 발효물을 40℃에서 16시간 동안 열풍 건조법으로 수행하였다. 상기 동결 건조는 - 70℃에서 72시간 동안 동결 건조법으로 수행하였다. 상기 각각의 건조법으로 건조하여 수득한 미강 발효물을 도 11a(동결 건조) 및 도 11b에 나타내었다.The hot air drying was performed by hot air drying the fermented rice bran prepared in 3-2 at 40° C. for 16 hours. The freeze drying was performed at -70°C for 72 hours by a freeze drying method. The rice bran fermented products obtained by drying by the respective drying methods are shown in Figs. 11A (freeze drying) and Fig. 11B.

상기 각각의 건조법으로 제조된 미강 발효 건조물에 대해 미강 원물(생미강)을 비교예로 하여, 관능검사를 수행하였다. 관능 검사는 6개월 이상 훈련된 조선대학교 식품영양학과 대학생 및 석박사 연구원 중 10명의 관능요원을 대상으로 상긱 각각의 샘플을 흰색의 편평한 플라스틱 접시에 담아 임의의 순서로 관능요원들에게 제공한 후, 묘사적 관능검사법으로 수행하였다.For the rice bran fermented dried products prepared by each of the above drying methods, the original rice bran (fresh rice bran) was used as a comparative example, and a sensory test was performed. The sensory test was conducted on 10 sensory workers among college students and master's doctorate researchers in the Department of Food Science and Nutrition at Chosun University who had been trained for more than 6 months. Each sample of Sangik was placed on a flat white plastic plate and provided to the sensory personnel in a random order. It was carried out by an appropriate sensory test method.

상기 관능검사 결과, 비교예인 미강 원물은 식감이 거칠고 도정 전 곡류에서 느낄 수 있는 특유의 지푸라기와 같은 맛과 향이 느껴졌으며, 씹고 삼킨 후에도 입안에 잔여물이 많이 남아 거북감을 느끼는 것으로 평가되었다. 한편, 미강 발효 동결 건조물의 경우, 식감이 곱게 갈린 미숫가루 혹은 콩가루와 같고 부드러워 입안에서 녹는 듯하고, 삼킨 후에도 입안에 잔여물이 거의 남지 않아 적절한 신맛과 고소한 맛이 어우러지는 것으로 평가되었다. 또한, 미강 발효 열풍건조물의 경우, 동결건조법으로 건조한 동결 건조물 보다 좀 더 거친 식감이기 때문에 씹히는 맛이 있고, 적당히 부드럽고 신맛과 고소한 맛이 어우러지는 것으로 평가되었다.As a result of the sensory test, the raw rice bran as a comparative example had a rough texture and a characteristic straw-like taste and aroma that can be felt in grains before milling, and it was evaluated that even after chewing and swallowing, a lot of residues remained in the mouth and felt uncomfortable. On the other hand, in the case of the freeze-dried fermented rice bran, the texture is similar to finely ground rice flour or soybean flour, and it seems to dissolve in the mouth because it is soft, and there is almost no residue in the mouth even after swallowing. In addition, the rice bran fermented hot air dried product was evaluated as having a bitter texture than the freeze-dried product dried by the freeze drying method, so that it had a chewy taste, and was moderately soft and combined with acidity and savory taste.

상기 평가에서 기호도가 가장 우수한 것으로 평가된 열풍 건조법으로 건조된 미강 발효 열풍 건조물과 미강 원물 자체에 포함된 아미노산 성분 함량을 각 고조물을 3차 증류수에 녹인 후, 상기 실시예 2-2에서 수행한 HPLC 분석법으로 분석하였으며, 그 결과를 하기 표 13에 나타내었다. 하기 표 13의 단위는 분석대상인 건조물 1 kg 당 해당 아미노산의 함량(mg)을 나타낸다(mg/kg). 또한, 하기 표 13의 N.D는 해당 아미노산이 발견되지 않았다는 것을 의미한다.After dissolving the amino acid components contained in the rice bran fermented hot air dried product and the rice bran original product itself, which were dried by the hot air drying method, which was evaluated as having the best acceptability in the above evaluation, each of the high algae was dissolved in tertiary distilled water, and then carried out in Example 2-2. It was analyzed by HPLC analysis, and the results are shown in Table 13 below. The units in Table 13 below represent the content (mg) of the corresponding amino acid per kg of dry matter to be analyzed (mg/kg). In addition, N.D in Table 13 means that the corresponding amino acid was not found.

Figure pat00010
Figure pat00010

상기 표 13에 나타낸 바와 같이, 미강 발효 열풍 건조물에서 시트룰린의 경우 2,816.02 mg의 시트룰린이 확인되어, 생미강에서 17.01 mg인 것에 비해 약 166배의 시트룰린 함량이 증가된 것으로 확인되었고, 오르니틴의 경우에도 미강 원물에서는 오르니틴이 발견되지 않은 반면에, 본 발명의 웨이셀라 코리엔시스 DB1 균주를 첨가하여 미강을 발효시키는 경우에 발효물 8,744.10 mg의 오르니틴 함량이 확인되어, 오르니틴 함량이 현저하게 증가되는 것이 확인되었다.As shown in Table 13, in the case of citrulline, 2,816.02 mg of citrulline was confirmed in the dry rice fermentation hot air, and it was confirmed that the citrulline content was increased by about 166 times compared to 17.01 mg in the fresh rice bran, and even in the case of ornithine While ornithine was not found in the original rice bran, when the rice bran was fermented by adding the Weissella coriensis DB1 strain of the present invention, the ornithine content of the fermented product 8,744.10 mg was confirmed, and the ornithine content was remarkably increased. Was confirmed.

상기 최적의 미강 발효물 제조 조건 및 방법으로 제조된 최종 미강 발효건조물에서 항비만 성분인 오르니틴과 시트룰린 함량이 총 11,560.12 mg/kg으로 나타나, 본 발명의 방법으로 제조된 미강 발효 건조물은 항비만 효과가 우수할 것으로 평가되었다. 상기 항비만 효과가 우수할 것으로 평가된 최종 상기 시트룰린 및 오르니틴 생산능을 가지며, 오르니틴 생산능이 다른 균주에 비해 현저하게 우수한 웨이셀라 코리엔시스 DB1 균주를 이용한 기능성 미강 발효 열풍 건조물의 항비만 효과를 확인하기 위하여 동물실험을 수행하였다.The total amount of ornithine and citrulline, which are anti-obesity components, was 11,560.12 mg/kg in the final rice bran fermented dried product prepared by the optimal fermented rice bran fermentation conditions and method, and the fermented rice bran fermented product prepared by the method of the present invention has an anti-obesity effect. Was evaluated to be excellent. The anti-obesity effect of the functional rice bran fermentation hot air dried product using the Weissella coriensis DB1 strain, which has the final citrulline and ornithine production ability evaluated to be excellent in the anti-obesity effect, and has remarkably superior ornithine production ability compared to other strains. Animal experiments were performed to confirm.

3-4. 미강 발효물의 항비만 효과 확인3-4. Confirmation of anti-obesity effect of fermented rice bran

상기 미강 발효 열풍 건조물의 항비만 효과를 동물실험을 통해 확인하였다.The anti-obesity effect of the rice bran fermented hot air dried product was confirmed through animal experiments.

우선, 실험동물은 생후 6주된 수컷 C57BL/6N 마우스 40마리를 중앙실험동물(Seoul, 대한민국)에서 구입하여 조선대학교 실험동물센터에서 1주일간 고형사료로 적응시킨 후 다음 난괴법(randomized block design)에 의해서 각 처리 군 당 10마리씩 나누어 스테인리스 케이지에 1마리씩 분리하여 사육하였다. 상기 실험동물센터 사육조건은 18 ± 2℃의 온도조건 및 상대습도 50 내지 55%의 습도조건을 유지하였으며, 광주기(08:00 내지 20:00) 및 암주기를 12시간 간격으로 조절하였다.First, for the experimental animals, 40 6-week-old male C57BL/6N mice were purchased from a central laboratory animal (Seoul, Korea) and adapted to solid feed at the Chosun University Laboratory Animal Center for 1 week, followed by randomized block design. By dividing 10 animals for each treatment group, 1 dog was separated and reared in a stainless steel cage. The experimental animal center breeding conditions maintained a temperature condition of 18 ± 2 ℃ and a humidity condition of 50 to 55% relative humidity, and the photoperiod (08:00 to 20:00) and the dark cycle were adjusted at 12 hour intervals.

상기 7일 후, 상기 실험 동물은 난괴법(randomized com-plete block desigh)에 따라 정상식이군(normal diet group, ND), 고지방고콜레스테롤식이군(high-fat/high-cholesterol group, HFCD), 고지방고콜레스테롤식이와 5%(w/w, 첨가물 중량/식이 전체 중량) 미강원물 첨가군(high-fat/high-cholesterol group + 5%(w/w) rice bran group, HFCD-RB) 및 고지방고콜레스테롤식이와 5%(w/w) 상기 미강 발효 열풍 건조물 첨가군(high-fat/high-cholesterol group + 5%(w/w) fermented rice bran group, HFCD-FRB)으로 10마리씩 군을 나누어 실험에 사용되었다.After the 7 days, the experimental animals were subjected to a normal diet group (ND), a high fat high cholesterol diet group (high-fat/high-cholesterol group, HFCD), high fat according to a randomized com-plete block desigh. High cholesterol diet and 5% (w/w, additive weight/total weight of diet) rice bran group (high-fat/high-cholesterol group + 5% (w/w) rice bran group, HFCD-RB) and high fat Divide groups of 10 animals into a high cholesterol diet and 5% (w/w) rice bran fermentation hot air dried product addition group (high-fat/high-cholesterol group + 5% (w/w) fermented rice bran group, HFCD-FRB) Used in the experiment.

실험 기간 동안 식이 섭취량과 체중은 일주일에 한 번씩 일정한 시간에 측정하였으며, 물과 사료는 제한없이 섭취시켰다. 상기 실험에 사용된 식이 중 정상식이와 고지방고콜레스테롤식이는 AIN-93 정제식이(Reeves et al.,J Nutr. 123: 1939-1951, 1993)를 기반으로 제조하였으며, 정상식이는 열량대비 10 kcal% 지방을 공급하여 제조하였고, 고지방고콜레스테롤식이는 열량대비 35 kcal% 지방과 1.25% 콜레스테롤을 첨가 제조하여 공급하였다. During the experiment, dietary intake and body weight were measured once a week at a certain time, and water and feed were ingested without restriction. Among the diets used in the above experiment, the normal diet and the high fat high cholesterol diet were prepared based on the AIN-93 tablet diet (Reeves et al., J Nutr. 123: 1939-1951, 1993), and the normal diet was 10 kcal compared to calories. It was prepared by supplying% fat, and the high fat high cholesterol diet was prepared by adding 35 kcal% fat and 1.25% cholesterol compared to calories.

상기 각각의 실험군의 실험동물은 10주 동안 상기 식이를 유지하였다. 상기 10주 동안 식이를 유지한 후, 항비만 효과는 실험동물의 간 및 지방조직 부위별 무게를 측정하는 방법과 간 조직의 병리조직학적 검사 및 지방세포 크기의 측정을 통해 확인하였다. Experimental animals in each of the experimental groups maintained the diet for 10 weeks. After maintaining the diet for the above 10 weeks, the anti-obesity effect was confirmed by measuring the weight of each part of the liver and adipose tissue of the experimental animal, histopathological examination of the liver tissue, and measurement of the size of adipocytes.

상기 실험동물의 간 및 지방조직의 무게 측정은 다음과 같은 방법으로 수행하였다. 우선, 실험동물을 희생시켜, 장기를 적출하였다. 구체적으로, 상기 실험동물은 물은 급여하면서 12시간 절식시킨 후 에틸 에테르를 이용하여 마취하고, 개복한 후 상기 실험동물의 장기, 구체적으로 간과 백색 지방조직(부고환 지방조직, 장간막 지방조직, 등 지방조직 및 신장주변 지방조직)을 적출하여 생리식염수로 세척한 다음 수분을 제거하고 무게를 측정하였다.The weight of the liver and adipose tissue of the experimental animal was measured by the following method. First, the experimental animals were sacrificed and the organs were harvested. Specifically, the experimental animal was fed water and fasted for 12 hours, anesthetized with ethyl ether, and the organs of the experimental animal after laparotomy, specifically liver and white adipose tissue (epididymal adipose tissue, mesenteric adipose tissue, etc.) Tissues and adipose tissue around the kidney) were removed, washed with physiological saline, water was removed, and the weight was measured.

상기 적출한 간과 백색 지방조직의 무게는 부검 전 절식된 체중 100 g에 대한 상대 중량으로 계산하여 산출하여, 그 결과를 하기 표 14에 나타내었다. 하기 표 14의 단위는 분석대상인 실험동물 100 g 당 지방의 함량(g)을 나타낸다(g/100 g body wt.). 하기 표 14의 AT는 지방조직(adipose tissue)를 의미하고, 총 백색 지방조직(Total white AT, Total white adipose tissue)은 적출된 4개 조직의 지방조직의 측정된 무게를 총 합산한 결과를 의미한다.The weight of the extracted liver and white adipose tissue was calculated by calculating the relative weight to 100 g of the fasted body weight before autopsy, and the results are shown in Table 14 below. The units in Table 14 below represent the content (g) of fat per 100 g of the experimental animal to be analyzed (g/100 g body wt.). AT in Table 14 below means adipose tissue, and Total white AT (Total white adipose tissue) means the result of summing the measured weights of the adipose tissues of the four extracted tissues. do.

구분division 정상식이
(ND)
Normal diet
(ND)
고지방
고콜레스테롤
식이(HFCD)
High fat
High cholesterol
Diet (HFCD)
고지방고콜레스테롤식이+미강
(HFCD-RB)
High fat high cholesterol diet + rice bran
(HFCD-RB)
고지방고콜레스테롤식이+발효미강
(HFCD-FRB)
High fat high cholesterol diet + fermented rice bran
(HFCD-FRB)
총 백색 지방조직
(Total white AT)
Total white adipose tissue
(Total white AT)
0.87±0.010.87±0.01 1.44±0.041.44±0.04 1.25±0.041.25±0.04 1.08±0.041.08±0.04
부고환 지방조직
(Epididymal
white AT)
Epididymis adipose tissue
(Epididymal
white AT)
0.46±0.020.46±0.02 0.82±0.040.82±0.04 0.69±0.030.69±0.03 0.64±0.020.64±0.02
장간막 지방조직
(Mesenteric
white AT)
Mesenteric adipose tissue
(Mesenteric
white AT)
0.22±0.010.22±0.01 0.32±0.020.32±0.02 0.26±0.050.26±0.05 0.24±0.010.24±0.01
등 지방조직
(Retroperitioneal white AT)
Back fat tissue
(Retroperitioneal white AT)
0.09±0.010.09±0.01 0.26±0.020.26±0.02 0.21±0.040.21±0.04 0.21±0.020.21±0.02
신장주변 지방조직
(Perinenal
white AT)
Adipose tissue around the kidney
(Perinenal
white AT)
0.02±0.000.02±0.00 0.06±0.020.06±0.02 0.05±0.010.05±0.01 0.04±0.010.04±0.01

기존 연구에 의하면, 비만에 의해 유도되는 건강 이상 증상은 체중 증가 자체보다는 복강에 위치한 백색 지방조직의 증가때문인 것으로 확인되었으므로, 상기 미강 발효 열풍 건조물의 항비만 효과를 확인하기 위하여, 백색 지방조직의 무게를 측정하였다. 구체적으로, 백색 지방조직에 해당하는 부고환 지방조직, 장간막 지방조직, 등 지방조직 및 신장주변 지방조직의 무게를 측정하였으며, 그 결과를 상기 표 14에 나타내었다.According to previous studies, it was confirmed that the abnormal health symptoms induced by obesity are due to an increase in white adipose tissue located in the abdominal cavity rather than the weight gain itself.In order to confirm the anti-obesity effect of the rice bran fermented hot air dry matter, the weight of the white adipose tissue Was measured. Specifically, the weights of epididymal adipose tissue, mesenteric adipose tissue, etc. and adipose tissue around the kidney were measured, and the results are shown in Table 14 above.

상기 표 14에 나타낸 바와 같이, 정상식이군(normal diet group, ND group)에 비하여 고지방고콜레스테롤식이군(high-fat/high-cholesterol group, HFCD group)에서, 총 백색 지방조직의 무게를 비롯하여 부고환 지방조직, 장간막 지방조직, 등 지방조직 및 신장주변 지방조직의 무게가 모두 유의적으로 증가하는 것으로 확인되었다. 한편, 고지방고콜레스테롤식이를 하는 경우에도, 미강을 5%(w/w) 함께 섭취시킨 미강원물 첨가군(high-fat/high-cholesterol + 5%(w/w) rice bran group, HFCD-RB group)의 경우, 고지방고콜레스테롤식이군(HFCD group)에 비해, 총 백색 지방조직의 무게는 물론 부고환 지방조직, 장간막 지방조직, 등 지방조직 및 신장주변 지방조직의 무게가 모두 유의적으로 감소하는 것으로 확인되었다. 특히, 미강 발효 열풍 건조물을 5%(w/w) 함께 섭취시킨 미강 발효 열풍 건조물 첨가군(high-fat/high-cholesterol + 5%(w/w) fermented rice bran group, HFCD-FRB)의 경우, 고지방고콜레스테롤식이군은 물론 미강원물 첨가군에 비해서도 유의적으로 지방조직의 무게가 감소되는 것이 확인되어, 발효과정을 통해 미강이 가지는 항비만 효과가 현저하게 개선되는 것이 확인되었다. As shown in Table 14, in the high-fat/high-cholesterol group (high-fat/high-cholesterol group, HFCD group) compared to the normal diet group (ND group), epididymal fat including the weight of the total white adipose tissue The weight of tissue, mesenteric adipose tissue, back adipose tissue, and adipose tissue around the kidney were all significantly increased. On the other hand, even in the case of a high-fat, high-cholesterol diet, rice bran group, HFCD- added rice bran group (high-fat/high-cholesterol + 5% (w/w) rice bran group, HFCD-) RB group) significantly reduced the weight of total white adipose tissue, epididymal adipose tissue, mesenteric adipose tissue, back adipose tissue, and peri-renal adipose tissue, compared to the high fat high cholesterol diet group (HFCD group). It was confirmed to be. In particular, in the case of the rice bran fermented rice bran group (HFCD-FRB) in which 5% (w/w) dry rice bran fermentation was ingested together with hot air dried rice bran fermented rice (high-fat/high-cholesterol + 5% (w/w) fermented rice bran group). , It was confirmed that the weight of the adipose tissue was significantly reduced compared to the high-fat high-cholesterol diet group as well as the rice gang source addition group, and it was confirmed that the anti-obesity effect of rice bran was significantly improved through the fermentation process.

상기 적출된 실험동물의 부고환 조직의 지방세포의 크기를 비교하여, 항비만 효과를 확인하였다. 구체적으로, 상기 적출된 부고환 조직의 크기를 일정하게 자른 후, 10% 포르말린(formalin) 용액으로 24시간 동안 고정시킨 후, 흐르는 물에서 과잉의 고정액을 제거하고, 에탄올(ethyl alcohol)을 이용하여 조직 속의 수분을 제거하였다. 이 후, 자일렌(Xylene)을 이용하여 조직 속의 에탄올을 제거한 후, 파라핀(paraffin) 처리를 하여 조직 공간을 채운 다음 3 μm 두께로 박절하여 부고환 조직 절편(slide)을 제작하였다. 상기 부고환 조직 절편을 slide에 부착시켜 말린 다음 헤마톡실린 에오신 염색(H&E stain, Hematoxylin and eosin stain)한 후, 광학 현미경(light microscope, TS100, Nikon, 일본)으로 지방세포를 관찰하였으며, 그 결과를 도 12에 나타내었다. 또한, 상기 지방세포를 관찰한 결과 즉, 지방세포를 촬영한 사진을 Image analyzer program(National Institute of Mental Health, USA)을 이용하여 분석하여, 실험군 간의 지방세포의 크기를 비교하였으며, 그 결과를 도 13에 나타내었다.By comparing the size of adipocytes in the epididymis tissues of the extracted experimental animals, the anti-obesity effect was confirmed. Specifically, the extracted epididymis tissue was cut to a constant size, fixed with 10% formalin solution for 24 hours, and then excess fixative was removed from flowing water, and the tissue was The moisture in the inside was removed. Thereafter, after removing ethanol from the tissue using xylene, paraffin treatment was performed to fill the tissue space, and then cut to a thickness of 3 μm to prepare an epididymal tissue slide. The epididymis tissue section was attached to a slide, dried, and then stained with hematoxylin and eosin (H&E stain, Hematoxylin and eosin stain), and then adipocytes were observed with a light microscope (TS100, Nikon, Japan). It is shown in Figure 12. In addition, the result of observing the adipocytes, that is, a picture of adipocytes, was analyzed using an image analyzer program (National Institute of Mental Health, USA), and the sizes of adipocytes between the experimental groups were compared, and the results are shown. It is shown in 13.

상기 도 12 및 도 13에 나타낸 바와 같이, 정상식이군(ND group)에 비하여 고지방고콜레스테롤식이군(HFCD group)의 경우, 부고환 지방세포의 크기가 비대되어, 더 크고 선명하게 관찰되는 것이 확인되었다. 한편, 섭취시킨 미강 발효 열풍 건조물 첨가군 (HFCD-FRB group)의 경우, 고지방고콜레스테롤식이군 (HFCD group)에 비하여 지방세포의 크기가 유의하게 저하된 것이 확인되었으며, 정상식이군과 유사할 정도로 지방세포의 비대화가 억제된 것이 확인되었다. 미강원물 첨가군(HFCD-RB group)의 경우, 고지방고콜레스테롤식이군(HFCD group)에 비하여 지방세포의 크기가 저하되기는 하였으나, 유의적인 차이는 나타나지 않은 것으로 확인되었다.As shown in FIGS. 12 and 13, in the case of the high fat high cholesterol diet group (HFCD group) compared to the normal diet group (ND group), the size of the epididymal adipocytes was enlarged, and thus it was confirmed that it was observed larger and more clearly. On the other hand, in the case of the ingested rice bran fermentation hot air dried product added group (HFCD-FRB group), it was confirmed that the size of adipocytes was significantly decreased compared to the high fat high cholesterol diet group (HFCD group). It was confirmed that cell hypertrophy was suppressed. In the case of the rice grain added group (HFCD-RB group), the size of adipocytes decreased compared to the high fat high cholesterol diet group (HFCD group), but no significant difference was found.

또한, 상기 적출된 실험동물의 간에 대해 병리조직학적 검사를 수행하여 항비만 효과를 확인하였다. 구체적으로, 상기 적출된 간을 4% paraformaldehyde 용액으로 고정시킨 후, - 25

Figure pat00011
에서 Cryocut Microtme(Leica CM1800, 독일)를 사용하여 3 μm두께로 잘라 간 조직 절편을 제작하였다. 상기 간 조직 절편을 slide에 부착시켜 말린 다음 Oil-Red O 용액으로 1시간 처리하여 염색한 후, 수세, 주화 및 탈수단계를 차례로 수행한 다음 봉입제로 봉입한 후, 광학 현미경(light microscope)으로 관찰하여 지방세포를 관찰하였으며, 그 결과를 하기 도 14에 나타내었다.In addition, pathological histologic examination was performed on the liver of the extracted experimental animals to confirm the anti-obesity effect. Specifically, after fixing the extracted liver with 4% paraformaldehyde solution, -25
Figure pat00011
Using a Cryocut Microtme (Leica CM1800, Germany) was cut to a thickness of 3 μm to prepare a liver tissue section. After attaching the liver tissue section to a slide, drying it, treating it with an Oil-Red O solution for 1 hour, dyeing, washing, coining, and dehydrating in order, then encapsulating with an encapsulant, and observed with a light microscope. The adipocytes were observed, and the results are shown in FIG. 14 below.

상기 도 14에 나타낸 바와 같이, 정상식이군(ND group)에 비하여 고지방고콜레스테롤식이군(HFCD group)의 경우, 간 조직에서 지방질이 축적되는 것이 확인되었다. 구체적으로, 고지방고콜레스테롤식이군(HFCD group)의 경우 간 조직 전반에서 Oil-Red O 용액에 의해 붉게 염색된 지방구가 확인되어, 간조직에 있는 간세포 내 지방 축적이 뚜렷하게 확인되었다. 한편, 미강 발효 열풍 건조물 첨가군(HFCD-FRB group)과 미강원물 첨가군(HFCD-RB group)의 경우, 고지방고콜레스테롤식이군(HFCD group)에 비하여 간 세포 내에 지방축적이 제한적으로 진행된 것이 확인되었으며, 특히 미강 발효 열풍 건조물 첨가군(HFCD-FRB group)의 경우, 정상식이군(ND group)과 유사한 색깔인 반면, 미강원물 첨가군(HFCD-RB group)의 경우 약간 보라색에 가깝게 확인되어, 미강원물 보다 미강 발효물을 첨가하는 경우, 항비만 효과가 더 우수한 것으로 확인되었다. As shown in FIG. 14, in the case of the high fat high cholesterol diet group (HFCD group) compared to the normal diet group (ND group), it was confirmed that fat was accumulated in the liver tissue. Specifically, in the case of the high-fat high-cholesterol diet group (HFCD group), red-stained fat cells with Oil-Red O solution were identified throughout the liver tissue, and fat accumulation in hepatocytes in the liver tissue was clearly confirmed. On the other hand, in the case of the rice bran fermentation hot air dried product added group (HFCD-FRB group) and the rice bran added group (HFCD-RB group), fat accumulation in liver cells was limited compared to the high fat high cholesterol diet group (HFCD group). In particular, in the case of the rice bran fermented hot air dried product added group (HFCD-FRB group), the color was similar to that of the normal diet group (ND group), whereas the rice bran added group (HFCD-RB group) was found to be slightly purple. , It was found that the anti-obesity effect was more excellent when the rice bran fermented product was added than the rice bran.

상기 웨이셀라 코리엔시스 DB1 균주는 미강 발효에 적합한 안전성이 우수한 미생물로, 미강을 발효하여 시트룰린과 오르니틴을 생산할 수 있으며, 상기 웨이셀라 코리엔시스 DB1 균주를 이용한 본 발명의 제조방법으로 제조할 경우, 미강 자체에 발견되지 않거나 제한적 성분만 발견된 시트룰린과 오르니틴을 현저하게 증가된 미강 발효물을 제조할 수 있으며, 이러한 고 함량의 항비만 성분 즉, 시트룰린과 오르니틴을 포함한 미강 발효 열풍 건조물은 항비만 효과가 우수할 뿐만 아니라, 기호도도 우수하여 항비만 효과를 발휘하기 위한 여러 용도로 다양하게 사용할 수 있을 것으로 기대된다. The Weisella coriensis DB1 strain is a microorganism with excellent safety suitable for fermentation of rice bran, and can produce citrulline and ornithine by fermenting rice bran, and when produced by the production method of the present invention using the Weisella coriensis DB1 strain, Rice bran fermentation products with remarkably increased citrulline and ornithine, which are not found in the rice bran itself or only limited components, can be prepared, and such high content of anti-obesity components, namely, rice bran fermentation hot air dried products including citrulline and ornithine, Not only has the obesity effect excellent, but it also has excellent preference, so it is expected that it can be used in various purposes for exerting the anti-obesity effect.

한국생명공학연구원Korea Research Institute of Bioscience and Biotechnology KCTC13653BPKCTC13653BP 2018100220181002

Claims (15)

김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주. Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) strain isolated from kimchi and having citrulline and ornithine production capacity. 제1항에 있어서,
상기 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주는 아르기닌(Arginine)이 첨가된 배지에서 최적 생육 pH가 pH 5.0인 것을 특징으로 하는 것인 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주.
The method of claim 1,
The way Cellar Corey N-Sys DB1 (Weissella koreensis DB1, KCTC 13653BP ) strain Arginine (Arginine) is a way Cellar optimum growth pH in the added medium is. Characterized in that the pH 5.0 Corey N-Sys DB1 (Weissella koreensis DB1, KCTC 13653BP ) Strain.
미강 발효물 제조방법에 있어서,
제 1 항의 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하여 발효하는 단계를 포함하는 것을 특징으로 하는 미강 발효물 제조방법.
In the method for producing fermented rice bran,
A method for producing a rice bran fermentation product comprising the step of fermenting by adding a strain of Weissella koreensis DB1 (KCTC 13653BP) isolated from the kimchi of claim 1 and having citrulline and ornithine producing ability.
미강, 아르기닌(Arginine) 및 물을 혼합하여 혼합물을 제조하는 발효원물 제조단계;
상기 혼합물을 가열하여 미강을 호화시켜 호화 미강 혼합물을 제조하는 호화 미강 제조단계;
상기 호화 미강 혼합물에 제 1 항의 김치로부터 분리되고, 시트룰린 및 오르니틴 생산능을 가진 웨이셀라 코리엔시스 DB1(Weissella koreensis DB1, KCTC 13653BP) 균주를 첨가하는 균주 첨가 단계; 및
상기 균주가 첨가된 호화 미강 혼합물을 발효하여 미강 발효물을 제조하는 발효 단계
를 포함하는 것을 특징으로 하는 미강 발효물 제조방법.
A fermentation raw material manufacturing step of mixing rice bran, arginine, and water to prepare a mixture;
Gelatinized rice bran manufacturing step of preparing a gelatinized rice bran mixture by heating the mixture to gelatinize the rice bran;
A strain addition step of adding a strain of Weissella koreensis DB1 (Weissella koreensis DB1, KCTC 13653BP) isolated from the kimchi of claim 1 to the gelatinized rice bran mixture and having citrulline and ornithine-producing ability; And
Fermentation step of fermenting the rice bran mixture to which the strain is added to prepare a rice bran fermentation product
Rice bran fermentation production method comprising a.
제 4 항에 있어서,
상기 발효원물 제조단계는 상기 혼합물에 미강을 10%(w/v) 내지 80%(w/v)의 농도로 첨가하고, 아르기닌(Arginine)을 0.1%(w/v) 내지 5%(w/v)의 농도로 첨가하는 방법으로 수행하는 것을 특징으로 하는 미강 발효물 제조방법.
The method of claim 4,
In the fermentation raw material manufacturing step, rice bran is added to the mixture at a concentration of 10% (w/v) to 80% (w/v), and arginine is added to 0.1% (w/v) to 5% (w/v). A method for producing fermented rice bran, characterized in that it is carried out by adding at a concentration of v).
제 4 항에 있어서,
상기 호화 미강 제조단계는 상기 혼합물을 100℃ 내지 140℃의 온도 조건 및 0.9 기압 내지 1.5 기압의 압력 조건에서 10분 내지 20분 동안 가열하여 미강을 호화시키는 방법으로 수행하는 것을 특징으로 하는 미강 발효물 제조방법.
The method of claim 4,
The step of preparing the gelatinized rice bran is a fermented rice bran, characterized in that the mixture is heated for 10 to 20 minutes under a temperature condition of 100°C to 140°C and a pressure condition of 0.9 to 1.5 atm to gelatinize the rice bran Manufacturing method.
제 4 항에 있어서,
상기 발효 단계는 상기 균주가 첨가된 호화 미강 혼합물의 초기 pH가 pH 6.0 내지 pH 6.5이고, 발효 온도가 25℃ 내지 30℃인 조건에서 발효시키는 방법으로 수행하는 것을 특징으로 하는 미강 발효물 제조방법.
The method of claim 4,
The fermentation step is a method for producing fermented rice bran fermentation, characterized in that the fermentation is carried out under a condition where the initial pH of the gelatinized rice bran mixture to which the strain is added is pH 6.0 to pH 6.5 and the fermentation temperature is 25°C to 30°C.
제 4 항에 있어서,
상기 미강 발효물 제조방법은 상기 미강 발효물을 건조하는 미강 발효물건조 단계를 더욱 포함하는 것을 특징으로 하는 미강 발효물 제조방법.
The method of claim 4,
The method for producing fermented rice bran further comprises a step of drying the fermented rice bran of drying the fermented rice bran.
제 8 항에 있어서,
상기 건조 단계는 30℃ 내지 60℃의 온도 조건에서 1시간 내지 40시간 동안 열풍 건조법으로 수행하거나 - 50℃ 내지 - 80℃의 온도 조건에서 20시간 내지 100시간 동안 동결 건조법으로 수행하는 것을 특징으로 하는 미강 발효물 제조방법.
The method of claim 8,
The drying step is characterized in that it is performed by a hot air drying method for 1 hour to 40 hours at a temperature condition of 30 ℃ to 60 ℃ or a freeze drying method at a temperature condition of -50 ℃ to -80 ℃ for 20 hours to 100 hours Rice bran fermentation manufacturing method.
제 3 항 또는 제 4 항의 미강 발효물 제조방법으로 제조된 미강 발효물.Fermented rice bran produced by the method of manufacturing fermented rice bran according to claim 3 or 4. 제 10 항의 미강 발효물은 미강 발효물 내에 시트룰린 함량이 2,500 mg/kg 내지 3,500 mg/kg이고, 오르니틴 함량이 5,500 mg/kg 내지 10,500 mg/kg인 것을 특징으로 하는 미강 발효물. The rice bran fermentation product of claim 10 has a citrulline content of 2,500 mg/kg to 3,500 mg/kg in the rice bran fermentation product, and an ornithine content of 5,500 mg/kg to 10,500 mg/kg. 제 10 항의 미강 발효물을 유효성분으로 포함하는 비만 개선 또는 예방용 식품 조성물.A food composition for improving or preventing obesity comprising the fermented rice bran of claim 10 as an active ingredient. 제 12 항에 있어서,
상기 비만 개선 또는 예방용 식품 조성물은 건강기능성 식품인 것을 특징으로 하는 비만 개선 또는 예방용 식품 조성물.
The method of claim 12,
The food composition for improving or preventing obesity is a food composition for improving or preventing obesity, characterized in that the health functional food.
제 10 항의 미강 발효물을 유효성분으로 포함하는 고지혈증 개선 또는 예방용 식품 조성물.A food composition for improving or preventing hyperlipidemia comprising the fermented rice bran of claim 10 as an active ingredient. 제 14 항에 있어서,
상기 고지혈증 개선 또는 예방용 식품 조성물은 건강기능성 식품인 것을 특징으로 하는 고지혈증 개선 또는 예방용 식품 조성물.
The method of claim 14,
The food composition for improving or preventing hyperlipidemia is a food composition for improving or preventing hyperlipidemia, characterized in that it is a health functional food.
KR1020190131979A 2019-10-23 2019-10-23 Method for preparing fermented rice bran by using weissella koreensis and fermented rice bran prepared thereby Active KR102414355B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190131979A KR102414355B1 (en) 2019-10-23 2019-10-23 Method for preparing fermented rice bran by using weissella koreensis and fermented rice bran prepared thereby

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190131979A KR102414355B1 (en) 2019-10-23 2019-10-23 Method for preparing fermented rice bran by using weissella koreensis and fermented rice bran prepared thereby

Related Child Applications (1)

Application Number Title Priority Date Filing Date
KR1020210007510A Division KR20210048446A (en) 2021-01-19 2021-01-19 Method for preparing fermented rice bran by using weissella koreensis and fermented rice bran prepared thereby

Publications (2)

Publication Number Publication Date
KR20210048110A true KR20210048110A (en) 2021-05-03
KR102414355B1 KR102414355B1 (en) 2022-07-04

Family

ID=75910964

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190131979A Active KR102414355B1 (en) 2019-10-23 2019-10-23 Method for preparing fermented rice bran by using weissella koreensis and fermented rice bran prepared thereby

Country Status (1)

Country Link
KR (1) KR102414355B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116640689A (en) * 2023-05-16 2023-08-25 四川农业大学 Panda source Gao Liwei Shewanella kk64 and application thereof

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100880382B1 (en) 2007-01-22 2009-01-23 윤심 Composition comprising rice bran as a main component, method for preparing rice bran fermentation composition using same, and rice bran fermentation composition produced thereby
KR20120021788A (en) 2010-08-17 2012-03-09 우석대학교 산학협력단 Weissella koreensis ms1-14 originated from natural sea salt
KR101177245B1 (en) 2012-02-09 2012-08-24 윤선영 Dietary supplement containing fermented rice bran of brown rice and manufacturing method thereof
KR101357663B1 (en) 2011-05-27 2014-02-05 한국식품연구원 Hepatoprotection fermented food comprising fermented rice bran and method of manufacturing the same
KR20150024958A (en) * 2013-08-27 2015-03-10 (주)건우애듀 Solid phase fermentation method of grains using useful microorganism and functional fermentation composition manufactured by the same
KR101523139B1 (en) 2013-09-30 2015-05-27 인제대학교 산학협력단 Composition containing rice bran fermented extract for prevention or treatment of cardiovascular disease
KR101618953B1 (en) 2013-06-07 2016-05-09 인제대학교 산학협력단 Composition containing rice bran fermented extract for prevention or treatment of stroke
KR101733967B1 (en) 2014-07-21 2017-05-11 우석대학교 산학협력단 The method for manufacturing barley bran fermented material containing ornithine and barley bran fermented material containing ornithine thereof
KR20170086196A (en) 2016-01-18 2017-07-26 주식회사 알카비즈 Rice bran composition and preparing method for fermented rice bran composition
KR20180133372A (en) 2018-12-10 2018-12-14 유한회사 아이에스티케이3 Cosmetic composition containing fermented rice bran fermented lactic acid bacteria composition

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100880382B1 (en) 2007-01-22 2009-01-23 윤심 Composition comprising rice bran as a main component, method for preparing rice bran fermentation composition using same, and rice bran fermentation composition produced thereby
KR20120021788A (en) 2010-08-17 2012-03-09 우석대학교 산학협력단 Weissella koreensis ms1-14 originated from natural sea salt
KR101357663B1 (en) 2011-05-27 2014-02-05 한국식품연구원 Hepatoprotection fermented food comprising fermented rice bran and method of manufacturing the same
KR101177245B1 (en) 2012-02-09 2012-08-24 윤선영 Dietary supplement containing fermented rice bran of brown rice and manufacturing method thereof
KR101618953B1 (en) 2013-06-07 2016-05-09 인제대학교 산학협력단 Composition containing rice bran fermented extract for prevention or treatment of stroke
KR20150024958A (en) * 2013-08-27 2015-03-10 (주)건우애듀 Solid phase fermentation method of grains using useful microorganism and functional fermentation composition manufactured by the same
KR101523139B1 (en) 2013-09-30 2015-05-27 인제대학교 산학협력단 Composition containing rice bran fermented extract for prevention or treatment of cardiovascular disease
KR101733967B1 (en) 2014-07-21 2017-05-11 우석대학교 산학협력단 The method for manufacturing barley bran fermented material containing ornithine and barley bran fermented material containing ornithine thereof
KR20170086196A (en) 2016-01-18 2017-07-26 주식회사 알카비즈 Rice bran composition and preparing method for fermented rice bran composition
KR20180133372A (en) 2018-12-10 2018-12-14 유한회사 아이에스티케이3 Cosmetic composition containing fermented rice bran fermented lactic acid bacteria composition

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Journal of Applied Microbiology. 2012, vol. 113, pp. 1507-1516.* *
Weissella koreensis strain DB1 16S ribosomal RNA gene, partial sequence, GenBank: MH450055.1, 2018.06.12.* *
유지현. 미강·맥강 유래 오르니틴 생성 유산균 분리 및 미강·맥강 발효 추출물의 항산화 효과. 2015, 우석대학교 대학원 석사학위논문.* *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116640689A (en) * 2023-05-16 2023-08-25 四川农业大学 Panda source Gao Liwei Shewanella kk64 and application thereof
CN116640689B (en) * 2023-05-16 2024-01-26 四川农业大学 Panda source Gao Liwei Shewanella kk64 and application thereof

Also Published As

Publication number Publication date
KR102414355B1 (en) 2022-07-04

Similar Documents

Publication Publication Date Title
KR101705545B1 (en) Composition for preventing respiratorydisease, immune-enhancing, anti-obesity containing fermented Platycodon grandiflorum
KR101680014B1 (en) Lactic acid bacterium isolated from Kimchi for treating inflammatory bowel disease and uses thereof
KR101900667B1 (en) Combined Fermented Broth of Mixed Extraction Oriental Medicine Material, Method for Preparing the Same, and Composition for Health Functional Food or Food Additive Comprising the Same
KR20160056489A (en) preparing method of fermented soybean enhancing physiological active substance and the physiological active substance thereby
KR20200145127A (en) Composition and method for yogurt with enhanced GABA using barley and yogurt produced by the same
JP2025533788A (en) Composition containing fermented kiwi fruit for preventing or improving alcoholic liver damage
KR101936498B1 (en) Manufacturing method of chicken broth with ginseng having ferment chickens
KR102214532B1 (en) health food composition using pomegranate fermented by lactic acid bacteria and manufacturing method thereof
KR20170120264A (en) Fermented chestnut puree of probiotic lactic acid bacteria and foods composition, medicinal composition including the same
KR20200014992A (en) An anti-obesity composition comprising Gelidium amansii extract and Salicornia europaea extract
KR20100126887A (en) Liquid Feed Additives for Aquaculture Flounder
KR102190239B1 (en) Novel Lactobacillus plantarum Lb41 strain and compositions for the prevention and treatment of obesity containing the same
KR102414355B1 (en) Method for preparing fermented rice bran by using weissella koreensis and fermented rice bran prepared thereby
KR20180094208A (en) Preparing method of fermentative metabolites from stachys sieboldii having imrpoving cognitive fuctions
JP7007644B2 (en) Manufacturing method of lactic acid bacteria, fermented lactic acid bacteria food, blood pressure regulator, and fermented lactic acid bacteria food
CN113973966A (en) A kind of seabuckthorn compound probiotic fruit cake and preparation method thereof
JP2023000116A (en) Method for producing fermented honey
KR100657028B1 (en) Functional Yokan Composition with Hemp and Manufacturing Method Thereof
KR101770583B1 (en) Sunsik using barley flour fermentation products and the manufacturing method thereof
KR20120040458A (en) Pear jam composition comprising fermented materials using lactic acid bacteria, and the preparation method thereof
KR20180040894A (en) Novel Lactobacillus plantarum Lb41 strain and compositions for the prevention and treatment of obesity containing the same
KR20210048446A (en) Method for preparing fermented rice bran by using weissella koreensis and fermented rice bran prepared thereby
KR102506366B1 (en) Lactobacillus plantarum KU15120 strain or its use
KR101829980B1 (en) A method of preparing fermented sargassum thunbergii having anti-inflammatory
KR20190122187A (en) Novel Lactobacillus plantarum Lb41 strain and compositions for the prevention and treatment of obesity containing the same

Legal Events

Date Code Title Description
PA0109 Patent application

Patent event code: PA01091R01D

Comment text: Patent Application

Patent event date: 20191023

PA0201 Request for examination
PA0302 Request for accelerated examination

Patent event date: 20200917

Patent event code: PA03022R01D

Comment text: Request for Accelerated Examination

Patent event date: 20191023

Patent event code: PA03021R01I

Comment text: Patent Application

AMND Amendment
PE0902 Notice of grounds for rejection

Comment text: Notification of reason for refusal

Patent event date: 20201203

Patent event code: PE09021S01D

AMND Amendment
PA0107 Divisional application

Comment text: Divisional Application of Patent

Patent event date: 20210119

Patent event code: PA01071R01D

E902 Notification of reason for refusal
PE0902 Notice of grounds for rejection

Comment text: Notification of reason for refusal

Patent event date: 20210316

Patent event code: PE09021S01D

PG1501 Laying open of application
AMND Amendment
E601 Decision to refuse application
PE0601 Decision on rejection of patent

Patent event date: 20210805

Comment text: Decision to Refuse Application

Patent event code: PE06012S01D

Patent event date: 20210316

Comment text: Notification of reason for refusal

Patent event code: PE06011S01I

Patent event date: 20201203

Comment text: Notification of reason for refusal

Patent event code: PE06011S01I

X091 Application refused [patent]
AMND Amendment
PX0901 Re-examination

Patent event code: PX09011S01I

Patent event date: 20210805

Comment text: Decision to Refuse Application

Patent event code: PX09012R01I

Patent event date: 20210616

Comment text: Amendment to Specification, etc.

Patent event code: PX09012R01I

Patent event date: 20210119

Comment text: Amendment to Specification, etc.

Patent event code: PX09012R01I

Patent event date: 20201021

Comment text: Amendment to Specification, etc.

PX0601 Decision of rejection after re-examination

Comment text: Decision to Refuse Application

Patent event code: PX06014S01D

Patent event date: 20211108

Comment text: Amendment to Specification, etc.

Patent event code: PX06012R01I

Patent event date: 20211005

Comment text: Decision to Refuse Application

Patent event code: PX06011S01I

Patent event date: 20210805

Comment text: Amendment to Specification, etc.

Patent event code: PX06012R01I

Patent event date: 20210616

Comment text: Notification of reason for refusal

Patent event code: PX06013S01I

Patent event date: 20210316

Comment text: Amendment to Specification, etc.

Patent event code: PX06012R01I

Patent event date: 20210119

Comment text: Notification of reason for refusal

Patent event code: PX06013S01I

Patent event date: 20201203

Comment text: Amendment to Specification, etc.

Patent event code: PX06012R01I

Patent event date: 20201021

X601 Decision of rejection after re-examination
J201 Request for trial against refusal decision
PJ0201 Trial against decision of rejection

Patent event date: 20211209

Comment text: Request for Trial against Decision on Refusal

Patent event code: PJ02012R01D

Patent event date: 20211108

Comment text: Decision to Refuse Application

Patent event code: PJ02011S01I

Patent event date: 20210805

Comment text: Decision to Refuse Application

Patent event code: PJ02011S01I

Appeal kind category: Appeal against decision to decline refusal

Appeal identifier: 2021101003141

Request date: 20211209

J301 Trial decision

Free format text: TRIAL NUMBER: 2021101003141; TRIAL DECISION FOR APPEAL AGAINST DECISION TO DECLINE REFUSAL REQUESTED 20211209

Effective date: 20220421

PJ1301 Trial decision

Patent event code: PJ13011S01D

Patent event date: 20220421

Comment text: Trial Decision on Objection to Decision on Refusal

Appeal kind category: Appeal against decision to decline refusal

Request date: 20211209

Decision date: 20220421

Appeal identifier: 2021101003141

PS0901 Examination by remand of revocation
GRNO Decision to grant (after opposition)
PS0701 Decision of registration after remand of revocation

Patent event date: 20220524

Patent event code: PS07012S01D

Comment text: Decision to Grant Registration

Patent event date: 20220425

Patent event code: PS07011S01I

Comment text: Notice of Trial Decision (Remand of Revocation)

GRNT Written decision to grant
PR0701 Registration of establishment

Comment text: Registration of Establishment

Patent event date: 20220624

Patent event code: PR07011E01D

PR1002 Payment of registration fee

Payment date: 20220624

End annual number: 3

Start annual number: 1

PG1601 Publication of registration
PR1001 Payment of annual fee

Payment date: 20250602

Start annual number: 4

End annual number: 4