KR20210042034A - Composition for improving respiratory disease comprising Artemisia capillaris extract as an active ingredient - Google Patents

Abstract

The present invention relates to: a food composition for improving the respiratory function and alleviating respiratory diseases, comprising an extract of Artemisia capillaris Thunb. as an active ingredient; health functional food comprising the food composition; and a respiratory disease preventing or treating pharmaceutical composition comprising the Artemisia capillaris Thunb. extract as an active ingredient. The Artemisia capillaris Thunb. extract of the present invention exhibits activities of inhibiting the activation of NETtosis of neutrophil extracellular traps, inhibiting inflammatory cytokine expression by cigarette smoke extraction (CSE) of bronchial epithelial cell line NCI-H292 cells, inhibiting lung tissue damage in a mouse model of respiratory disease induced by CSE and PPE, inhibiting infiltration of immune cells such as total cells, macrophages, lymphocytes, eosinophils, and neutrophils in BALF, and inhibiting the secretion of inflammatory cytokines and chemokines in BALF and lung tissue.

Description

Composition for improving respiratory disease comprising Artemisia capillaris extract as an active ingredient}

The present invention is a food composition for enhancing respiratory function and improving respiratory diseases, including an extract of Artemisia capillaris Thunb. Health functional food comprising the food composition; And it relates to a pharmaceutical composition for the prevention or treatment of respiratory diseases comprising the extract as an active ingredient.

Bronchial asthma is an allergic disease characterized by reversible airway obstruction, airway hypersensitivity (increased airway resistance), mucus hypersecretion, and high levels of IgE in the serum. When TH2 (T helper 2) type immune cells stimulated by various antigens inhaled into the airways produce IL-4, 5, 13, etc., inflammatory cells such as T cells, eosinophils and mast cells proliferate, differentiate, and activate the airways. It is also recognized as a chronic inflammatory disease because it migrates to and infiltrates the tissues around the airway and airways (J Clin Invest, 111: 291-297, 2003; N Engl J. Med. 2001; 44(5): 350-62; Toshio Hirano , Cytokine molecular biology, World Science, 2002). Therefore, in the development of asthma therapeutics, inhibition of infiltration of inflammatory cells such as eosinophils is one of the important targets.

Chronic obstructive pulmonary disease (COPD) is a chronic airway disease showing cough, sputum, shortness of breath, decreased expiratory flow, and impaired gas exchange. It is predicted to be the third cause of death in humans in 2012 (Am J Respir Crit Care Med, 2013, 187: 347-365; Am J Respir Crit Care Med, 2009, 180:396-406).

COPD is caused by a variety of causes, such as smoking, air pollution, chemicals, occupational factors, and genetic predisposition, and smoking is the main cause, and more than 80% of COPD patients have been found to be smokers (Biol Pharm Bull, 2012, 35:1752-1760). The pathogenesis of COPD involves inflammation, activation of proteolytic enzymes in the lungs, and oxidative stress, and the cells involved in inflammation are mainly neutrophils, macrophages, and T lymphocytes. These inflammatory cells produce reactive oxygen species, various inflammatory cytokines, and various proteolytic enzymes that cause tissue damage (Korean Tuberculosis and Respiratory Society, Respiratory Science Seoul: Gunja Publishing Co.; 2007, p 301-5;Am J Respir Crit Care Med, 1997 155, 1441-1447; Am J Physiol Lung CellMol Physiol, 2010, 298:L262-L269). In particular, neutrophils secrete substances such as elastase, collagenase, proteases such as MPO (myeloperoxidase), arachidonic acid metabolites, and reactive oxygen free radicals. It is known to play an important role in the onset of COPD by causing lung damage, and therefore, it has become an important target in the development of COPD therapeutics (Am J Respir Cell Mol Biol, 2013, 48:531-539; Eur Respir J, 1998. , 12:1200-1208).

Recently, it has been reported that the activation of netosis of neutrophil extracellular traps is involved in the pathogenesis of chronic lung/respiratory diseases including COPD (PLoS One. 2014 May 15; 9(5): e97784. ; Respir Res. 2015 May 22; 16:59.; J Immunol Res. 2017; 2017:6710278; Respirology. 2016 Apr; 21(3): 467-75).

Currently, bronchoalveolar lavage (BAL) is used as a means to monitor the course of diseases such as COPD and asthma.In bronchoalveolar lavage fluid (BALF), inflammatory cytokines, reactive oxygen species, leukotriene, and activation Inflammatory mediators such as complement are increased, and neutrophils, which account for less than 5% of normal lungs, increase to an extent that accounts for 80% of all cells (Am J Respir Crit Care Med 154(1): 76-81, 1996).

So far, no drugs have been reported to directly improve COPD or asthma, and current COPD or asthma treatments are aimed at reducing symptoms and complications, including bronchodilators (β2-agonists, anticholinergics, methylxanthines) and steroids (inhalation, Oral), etc. are mainly used.

An object of the present invention is a food composition for enhancing respiratory function and improving respiratory diseases comprising an extract of Artemisia capillaris Thunb. It is to provide a health functional food comprising the composition.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating respiratory diseases comprising an extract of Artemisia capillaris Thunb.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be considered that the scope of the present application is limited by the specific description described below.

As confirmed in the following Examples and Experimental Examples, the present inventors found that the extract of the present invention is a netosis of neutrophil extracellular traps induced by phorbol myristate acetate (PMA) . Inhibits (Netosis) activation, inhibits the expression of inflammatory cytokines by Cigarette Smoke Extraction (CSE) in NCI-H292 cells, a bronchial epithelial cell line, and further inhibits lung tissue damage in a mouse model of respiratory disease induced by CSE and PPE. And inhibits the invasion of immune cells such as total cells, macrophages, lymphocytes, eosinophils, and neutrophils in BALF, and inflammatory cytokines and chemokines in BALF and lung tissue. The present invention was completed by confirming that there is an activity to inhibit secretion.

One aspect of the present invention for achieving the above object is a food composition for enhancing respiratory function and improving respiratory diseases comprising an extract of Artemisia capillaris Thunb. And it provides a health functional food comprising the composition.

In the present invention, the term " Artemisia capillaris Thunb. " is a perennial plant of the dicotyledonous plant Campanula asteraceae, and is also called aetang mugwort or injin mugwort. Young sprouts are edible and are known to be effective against jaundice or to use the whole agius as a diuretic, but there is no known information on the reinforcement of respiratory function, improvement of respiratory diseases, prevention or treatment activity of the extracts or fractions of Sacheol Mugwort.

In the present invention, the term "extract" refers to a plant to be extracted, that is, stems, leaves, fruits, flowers, roots, and mixtures thereof of Mugwort, water, lower alcohols having 1 to 4 carbon atoms (methanol, ethanol, butanol, etc.), methylene chloride , Ethylene, acetone, hexane, ether, chloroform, ethyl acetate, butyl acetate, N,N-dimethylformamide (DMF), dimethyl sulfoxide (DMSO), 1,3-butylene glycol, propylene glycol, or a mixed solvent thereof It refers to an extract obtained by leaching using a supercritical extraction solvent such as carbon dioxide or pentane, or a fraction obtained by fractionating the extract. , Reflux, warming, ultrasonic radiation, supercritical extraction, etc. can be applied. In the case of a fractionated extract, a fraction obtained by suspending the extract in a specific solvent and then mixing and policing it with a solvent having a different polarity, the crude extract is adsorbed on a column filled with silica gel, etc., and then a hydrophobic solvent, a hydrophilic solvent, or a mixed solvent thereof is added. It means including the fraction obtained as a mobile phase. In addition, the meaning of the extract includes a concentrated liquid extract or a solid extract from which the extraction solvent has been removed by a method such as freeze drying, vacuum drying, hot air drying, spray drying, or the like. Preferably, it means an extract obtained by using water, ethanol or a mixed solvent thereof as an extraction solvent, more preferably an extract obtained by using a mixed solvent of water and ethanol as an extraction solvent.

In the present invention, the term "active ingredient" refers to a component that exhibits a desired activity alone, or that itself can exhibit activity together with a carrier that is not active.

In the present invention, the term "respiratory function enhancement" refers to maintaining the original function of the respiratory organs such as the nasal cavity, pharynx, larynx, trachea, bronchi, and lungs in a healthy state, or according to smoking, fine dust, activation of neutrophil netosis, or other respiratory diseases. It refers to any action that improves the function of the respiratory tract, which has been deteriorated due to symptoms, to its original healthy state.

In addition, in the present invention, the term "respiratory disease" refers to a disease occurring in the respiratory tract of an individual such as the nasal cavity, pharynx, larynx, trachea, bronchi, and lungs. Specifically, the respiratory disease is a respiratory disease caused by smoking or fine dust ; Or, it may mean a lung disease accompanying Netosis, but is not particularly limited thereto. More specifically, the respiratory disease may mean a pulmonary disease accompanied by symptoms of sputum, shortness of breath, airway irritability, airway obstruction, mucus hypersecretion, decrease in expiratory flow rate and/or impaired gas exchange, and more specifically asthma , Chronic obstructive pulmonary disease (COPD), tracheitis, bronchitis, diffuse interstitial lung disease, acute respiratory distress syndrome (ARDS), acute lung injury, cystic fibrosis, capillary It may mean one or more selected from the group consisting of bronchitis, influenza virus infection, pneumonia, tuberculosis, and transfusion-related acute lung injury. , Most specifically, may mean asthma or COPD.

In the composition of the present invention, the active ingredient may be included in an arbitrary amount (effective amount) according to the specific use, formulation, purpose of combination, etc., as long as it can exhibit the activity of enhancing respiratory function and improving respiratory disease, preventing or treating respiratory disease. , A typical effective amount may be determined within the range of 0.001% to 20.0% by weight based on the total weight of the composition. The "effective amount" means when the composition of the present invention is administered to an individual subject to the composition of the present invention during the administration period according to the recommendations of a person skilled in the art, enhancing respiratory function and improving respiratory disease, preventing or treating effects, asthma or It refers to the amount of the active ingredient contained in the composition of the present invention that can exhibit the intended functional and pharmacological effects such as the improvement effect of COPD. Such an effective amount can be determined experimentally within the range of ordinary skill of a person skilled in the art.

The subject to which the composition of the present invention can be applied may be mammals such as dogs, cats, cows, horses, pigs, and humans, and a human may be preferable.

In addition, the composition of the present invention, in addition to the active ingredient, in order to enhance the convenience of taking or ingestion through addition of similar activities such as anti-inflammatory activity and anti-allergic activity, safety has already been verified in the art and is known to have the corresponding activity. Any compound or natural extract may be further included.

These compounds or extracts include compounds, extracts, and pharmaceuticals listed in the pharmacopoeia of each country ('Korean Pharmacopoeia' in Korea), health functional food code of each country ('health functional food standards and standards' notified by the Ministry of Food and Drug Safety in Korea). National laws governing the manufacture and sale of compounds or extracts and health functional foods that have been licensed in accordance with the laws of each country governing manufacturing and sales (the'Pharmaceutical Affairs Act' in Korea) ('Health Functional Food Act' in Korea) Depending on the functional compound or extract may be included. For example, according to the Korean'Health Functional Food Act', complexes such as MSM (dimethylsulfonylmethane), N-acetylglucosamine, etc., which are recognized for anti-inflammatory function, and Enterococcus faecalis heat-treated dry powder, which is recognized for anti-allergic function, and guava leaf extract, etc. , Complexes such as stalk extract, lobule extract, picaopreto powder, and the like, PLAG (1-palmitoyl-2-linoleoyl-3-acetyl-rac-glycerol), etc. will correspond to these compounds or extracts, and are not particularly limited thereto. . One or more of these compounds or natural extracts may be included in the composition of the present invention together with the active ingredient.

The composition of the present invention may be understood as a food composition in a specific embodiment, and the food may include a health function (sex) food.

In the present invention, the term "health functional food" refers to a food manufactured and processed in the form of tablets, capsules, powders, granules, liquids and pills using raw materials or ingredients having useful functions for the human body. The "functionality" refers to obtaining a useful effect for health purposes such as controlling nutrients or physiological effects on the structure and function of the human body. The health functional food of the present invention can be prepared by a method commonly used in the art, and at the time of manufacture, it can be prepared by adding raw materials and ingredients commonly added in the art. In addition, the formulation of the health functional food may be prepared without limitation as long as it is a formulation recognized as a health functional food. The food composition of the present invention can be prepared in various forms of formulation, and unlike general drugs, it has the advantage of not having side effects that may occur when taking the drug for a long time using food as a raw material, and is excellent in portability. Health functional foods can be consumed as an adjuvant to enhance the effect of improving asthma or COPD, and further enhancing respiratory function and improving respiratory disease.

The food composition of the present invention may be prepared in any form, such as beverages such as tea, juice, carbonated beverages, ionized beverages, processed oils such as milk, yogurt, gums, rice cakes, Korean confectionery, bread, Foods such as confectionery and noodles, tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jelly, and health functional food preparations such as bars can be prepared. In addition, the food composition of the present invention can be classified as a product as long as it conforms to the enforcement regulations at the time of manufacture and distribution in terms of legal and functional classification. For example, it is a health functional food according to the Korean'Health Functional Food Act', or confectionery, bean, tea, and beverages according to each food type according to the food code of the Korean'Food Sanitation Act' (``Food Standards and Standards'' notified by the Ministry of Food and Drug Safety). , Special use food, etc.

In addition, the food composition of the present invention may contain food additives in addition to the active ingredients. Food additives can generally be understood as substances that are added to food and mixed or infiltrated in manufacturing, processing, or preserving food. Since they are consumed daily and for a long time with food, their safety must be ensured. Food additives with guaranteed safety are limited in terms of ingredients or functions in the food additive code according to the laws of each country governing the manufacture and distribution of food ('Food Sanitation Act' in Korea). In the Korean Food Additives Code (“Food Additive Standards and Standards” notified by the Ministry of Food and Drug Safety), food additives are classified into chemical synthetic products, natural additives, and mixed preparations in terms of ingredients.These food additives are sweeteners and flavors in terms of function. It is categorized into agents, preservatives, emulsifiers, acidulants, and thickeners.

The sweetener is used to impart an appropriate sweet taste to food, and natural or synthetic ones may be used. Preferably, a natural sweetener is used, and examples of the natural sweetener include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose, and maltose.

The flavoring agent may be used to improve taste or aroma, and both natural and synthetic ones may be used. Preferably, it is the case of using a natural one. In the case of using natural ones, the purpose of nutrient enhancement can be combined in addition to flavor. As a natural flavoring agent, it may be obtained from apples, lemons, tangerines, grapes, strawberries, peaches, or the like, or from green tea leaves, roundtails, bamboo leaves, cinnamon, chrysanthemum leaves, jasmine, and the like. In addition, you can use those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, and ginkgo. The natural flavoring agent may be a liquid concentrate or a solid extract. In some cases, synthetic flavoring agents may be used. As synthetic flavoring agents, esters, alcohols, aldehydes, terpenes, and the like may be used.

As the preservative, calcium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid), etc. can be used, and as emulsifiers, acacia gum, carboxymethylcellulose, xanthan gum, Pectin and the like may be used, and as the acidulant, arithmetic, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid, and the like may be used. In addition to the purpose of enhancing taste, the acidulant may be added so that the food composition has an appropriate acidity for the purpose of inhibiting the growth of microorganisms.

As the thickener, a suspending agent, a settling agent, a gel-forming agent, a swelling agent, and the like may be used.

In addition to the food additives described above, the food composition of the present invention may include a physiologically active substance or minerals known in the art for the purpose of supplementing and reinforcing functionality and nutritional properties and ensuring stability as a food additive. Examples of the physiologically active substances include catechins contained in green tea, vitamins such as vitamin B1, vitamin C, vitamin E, and vitamin B12, tocopherol, dibenzoyl thiamine, and the like, and as minerals, calcium preparations such as calcium citrate, stearic acid Magnesium preparations such as magnesium, iron preparations such as iron citrate, chromium chloride, potassium iodide, selenium, germanium, vanadium, and zinc.

In the food composition of the present invention, the food additives described above may be included in an appropriate amount to achieve the purpose according to the product type, and in relation to other food additives that may be included in the food composition of the present invention, You can refer to the Food Additives Code.

Another aspect of the present invention for achieving the above object provides a pharmaceutical composition for preventing or treating respiratory diseases comprising an extract of Artemisia capillaris Thunb. The terms sacheol wormwood, extract, active ingredient and respiratory disease are as described above.

The term "prevention" of the present invention refers to all actions of suppressing or delaying symptoms of respiratory diseases of an individual by administering a composition comprising a wormwood extract according to the present invention.

The term "treatment" of the present invention refers to all actions in which symptoms of an individual's respiratory diseases are improved or cured by administration of a composition including a wormwood extract according to the present invention.

The pharmaceutical composition of the present invention may be prepared in an oral formulation or parenteral formulation according to an administration route by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient. Specifically, the route of administration may be any suitable route including a local route, an oral route, an intravenous route, an intramuscular route, and direct absorption through mucosal tissue, and two or more routes may be used in combination. An example of a combination of two or more routes is a case in which two or more formulations of drugs are combined according to the route of administration, for example, when one drug is first administered by an intravenous route and the second drug is administered by a local route.

Pharmaceutically acceptable carriers are well known in the art depending on the route of administration or formulation, and specifically, reference may be made to the pharmacopoeia of each country, including the'Korean Pharmacopoeia'.

When the pharmaceutical composition of the present invention is prepared in an oral dosage form, powders, granules, tablets, pills, dragees, capsules, solutions, gels, syrups, suspensions, wafers according to a method known in the art together with a suitable carrier It can be prepared in a formulation such as. Examples of suitable carriers at this time include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol, starches such as corn starch, potato starch, wheat starch, cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, Celluloses such as hydroxypropylmethylcellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyol, vegetable oil, ethanol, grease Serol, etc. are mentioned. In the case of formulation, appropriate binders, lubricants, disintegrants, colorants, and diluents may be included as needed. Suitable binders include starch, magnesium aluminum silicate, starch ferryst, gelatin, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone, glucose, corn sweetener, sodium alginate, polyethylene glycol, wax, etc., and lubricants include oleic acid. Sodium, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silica, talcum, stearic acid, magnesium salts and calcium salts thereof, polydecylene glycol, etc., and as disintegrating agents starch, methyl cellulose , Agar, bentonite, xanthan gum, starch, alginic acid, or a sodium salt thereof. Moreover, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, etc. are mentioned as a diluent.

When the pharmaceutical composition of the present invention is prepared in a parenteral dosage form, it may be formulated in the form of an injection, a transdermal administration, a nasal inhalation and a suppository according to a method known in the art together with a suitable carrier. When formulated as an injection, an aqueous isotonic solution or suspension may be used as a suitable carrier, and specifically, triethanol amine-containing PBS (phosphate buffered saline), sterile water for injection, an isotonic solution such as 5% dextrose, etc. may be used. . When formulated as a transdermal administration, it can be formulated in the form of an ointment, cream, lotion, gel, external solution, pasta, liniment, air roll, and the like. In the case of nasal inhalants, suitable propellants such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, etc. can be used to form an aerosol spray.When formulated as a suppository, the carrier is Withepsol ( witepsol), tween 61, polyethylene glycols, cacao butter, laurin paper, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearates, sorbitan fatty acid esters, and the like.

The specific formulation of pharmaceutical compositions is known in the art, and for example, Remington's Pharmaceutical Sciences (19th ed., 1995) may be referred to. This document is considered as part of this specification.

The preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 mg/kg to 10 g/kg per day, preferably 0.001 mg/kg to 1 g, depending on the patient's condition, weight, sex, age, patient severity, and route of administration. May be in the /kg range. Administration can be made once a day or divided into several times. Such dosage should not be construed as limiting the scope of the invention in any aspect.

Sacheol wormwood extract of the present invention inhibits the activation of netosis of neutrophil extracellular traps, inhibits the expression of inflammatory cytokines by Cigarette Smoke Extraction (CSE) of the bronchial epithelial cell line NCI-H292 cells, Inhibits lung tissue damage in mouse models of respiratory diseases induced by CSE and PPE, inhibits invasion of immune cells such as total cells, macrophages, lymphocytes, eosinophils and neutrophils in BALF, and secretes inflammatory cytokines and chemokines in BALF and lung tissues. It exhibits an activity that inhibits.

1 and 2 are the total number of cells counted from the bronchoalveolar lavage fluid (BALF) after administration of the Mugwort extract of the present invention and ROF as a positive control for the PPE/CSE-induced respiratory disease (COPD) mouse model; And it shows the results of analyzing the immune cells (Macrophage, Lympocyte, Neutrophils and Eosinophil) in BALF through Diff-Quick staining.
3 shows the results of staining lung tissue extracted from a respiratory disease (COPD) mouse model.
Figure 4 shows the results of confirming the damage inhibitory activity of NCI-H292 cells induced by fine dust according to the treatment with a wormwood mugwort extract.
Figure 5 shows the results of measuring the expression level of MUC5AC mRNA in NCI-H292 cells according to the treatment of Sacheol Mugwort extract.

Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example: Sample preparation

An extract of Sacheol Mugwort (extracted part: above-ground part) was prepared to confirm the activity of improving lung disease. Extracts were obtained by adding 10 times the weight of 70% ethanol to the dried powder of each natural substance to be extracted, and repeatedly extracting them twice at 50°C for 6 hours, filtered, concentrated under reduced pressure, and freeze-dried to obtain powder.

Experimental Example 1: PPE+CSE-induced respiratory disease (COPD) mouse model

BALB/C mice (male, 5 weeks old) were purchased from Orient Bio, and were purified for 1 week, and were grouped with n=10. The sample treatment group was orally administered the sample at a concentration of 200 mg/kg for 24 days from one week before COPD induction to pre-dissection, and the Naive and COPD groups were administered the same amount of PBS. At this time, the positive control, Roflumilast (ROF) group, was administered orally at a concentration of 10 mg/kg every day after induction. For COPD induction, 1.2 units of Porcine Pancreatic Elastase (PPE) and 100% Cigarette Smoke Extraction (CSE) were used. 1.2 unit of PPE was injected three times through intra nasal once every 7 days, and 20 µl of CSE was treated through intra nasal for 3 days from the day after PPE treatment, but after the last PPE treatment, the dissection proceeded the next day without CSE treatment. I did. The dissection was performed after anesthetizing with isoflurane using an inhalation anesthesia. During the experiment, feed and drinking water were provided in the form of self-catering, and were raised in an environment of 24 ℃ and 60% humidity.

Experimental Example 2: Analysis of the total number of cells infiltrated into BALF and immune cells in BALF through Diff-Quick staining

2-1: Total number of cells infiltrated into BALF

After injecting 1 mL of PBS through the respiratory tract of a respiratory disease (COPD) model mouse, it was gently massaged to recover 700 μL of bronchoalveolar lavage fluid (BALF). 10 uL of the recovered BALF solution was mixed with the Accustain T solution in the same amount, and 12 uL was injected into the Accuchip channel, and then total cells were automatically counted with a cell counter (ADAM-MC, NANOENTEK. INC, Korea) (FIG. 1).

2-2: Analysis of immune cells in BALF through Diff-Quick staining

The recovered BALF was separated into a supernatant and a cell pellet through centrifugation under conditions of 300×g and 5 minutes. The cell pellet was resuspended by adding 700 μL of PBS, and 150 μL of this BALF suspension was centrifuged at 1000 rpm, 10 min, 4°C with a Cytospin device (Centrifuge 5403, Eppendorf, Hamburg, Germany), and the BALF cells were placed on the slide. Attached. Thereafter, the cells were stained according to the protocol of the manufacturer (1-5-1 Wakinohamakaigandori, chuo-ku, Kobe, Japan) using a Diff-Quick staining reagent and observed under a microscope (FIG. 2).

Experimental Example 3: Histological examination

Lung tissue was removed from the dissected respiratory disease (COPD) model mouse, the mesenchyme of the lung was removed, and then fixed in 10% neutral buffered formalin for 3 days. The fixed tissue was dehydrated with ethyl alcohol and xylene, embedded with paraffin, trimmed, and cut into 5 um thickness. After attaching the prepared section to the slide, it was stained with H&E to confirm the general shape and observed under a microscope (FIG. 3).

Experimental Example 4: NCI-H292 cell damage inhibitory activity induced by fine dust

For H292 cells, a cover glass was added to each well of a 6-well cell culture plate and then coated with collagen was used. For collagen coating, Cell matrix type IC (Nitta) was diluted 15 times in 0.02N HCl, treated for 30 minutes per well, and washed 3 times with DPBS before use. H292 cells were inoculated at a concentration of 3×10 ⁵ cells/well and cultured for 24 hours at 37° C. and 5% carbon dioxide (CO _{2 ).} After 24 hours of cultivation, starvation was performed for 24 hours under conditions of _{37° C. and 5% carbon dioxide (CO 2} ) by replacing the medium with the concentration of FBS lowered to 0.2% in the composition of the culture medium. Afterwards, RPMI1640 medium to which serum was not added was used for the treatment of samples and irritants. CRM (Urban aerosols No. 28, NIES) was used as an irritant, and the final concentration was 100 μg/mL, and the mixture was incubated for 24 hours after simultaneous treatment with Mugwort. After the culture was completed, it was washed twice with DPBS, and the cover glass was recovered, followed by Diff Quick (Sysmex) staining. As for the dyeing, three kinds of dyeing solutions were sequentially dyed according to the protocol of the manufacturer (Sysmex). After completion of staining, the protective effect was confirmed by comparison with the degree of damage to the cells by CRM through microscopic observation (FIG. 4).

Experimental Example 5: Analysis of MUC5AC mRNA expression level using NCI-H292 cells

According to the method of Experimental Example 1, NCI-H292 cells were treated with fine dust (CRM) and mugwort samples and cultured, and then the cells were recovered using QiAzol Lysis Reagent (QIAGEN). RNA extraction was performed according to the manufacturer's protocol using RNeasy Mini kit (QIAGEN), and cDNA synthesis was performed using Maxime RT Premix (iNtRoN). Genes were amplified using the synthesized cDNA, SYBR Green PCR kit (QIAGEN), and primer pairs. MUC5AC primer (Forward: TCAACGGAGACTGCGAGTACAC, Reverse CTTGATGGCCTTGGAGCA) was used for the analysis. Real-time PCR was performed at 95 ^o C for 15 minutes, 95 ^o C for 15 seconds, 60 ^o C for 15 seconds, 72 ^o C for 15 seconds, and 50 cycles were repeated. The mRNA expression level of MUC5AC was confirmed to be the degree of inhibition during sample treatment compared to the ability of generating MUC5AC by CRM based on control cells that were not treated with anything. As a result, it was confirmed that the MUC5AC mRNA expression level was reduced to a level similar to that of the control group not treated with any of the MUC5AC mRNA extracts (Fig. 5).

From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts are included in the scope of the present invention.

Claims (10)

Artemisia capillaris Thunb. ) A food composition for enhancing respiratory function and improving respiratory diseases, including an extract as an active ingredient.
The composition of claim 1, wherein the extract is water, ethanol, or a mixed solvent extract thereof.
The composition of claim 1, wherein the respiratory disease is a pulmonary disease accompanied by symptoms of cough, sputum, shortness of breath, airway irritability, airway obstruction, mucus hypersecretion, decrease in expiratory flow rate and/or impaired gas exchange. .
The composition of claim 1, wherein the respiratory disease is asthma, COPD, diffuse interstitial lung disease, acute respiratory distress syndrome (ARDS) or acute lung injury.
The composition of claim 4, wherein the respiratory disease is asthma or COPD.
A health functional food comprising the food composition of any one of claims 1 to 5.
A pharmaceutical composition for preventing or treating respiratory diseases, comprising a sacheol wormwood extract as an active ingredient.
The composition of claim 7, wherein the extract is water, ethanol, or a mixed solvent extract thereof.
The composition of claim 7, wherein the respiratory disease is asthma, COPD, diffuse interstitial lung disease, acute respiratory distress syndrome (ARDS) or acute lung injury.
The composition of claim 9, wherein the respiratory disease is asthma or COPD.

Images