KR20160041616A - Chemically cross-linked hyaluronic acid hyerogel particle, preparation method thereof and spheroid formation method using it - Google Patents

Abstract

Disclosed is a method for forming spheroid using hyaluronic acid hydrogel microspheres. The disclosed method for forming spheroid comprises the steps of: preparing chemically cross-linked hyaluronic acid hydrogel microspheres; swelling the hyaluronic acid hydrogel microspheres into a culture medium; mixing the swelled microspheres and cells and culturing the same.

Description

TECHNICAL FIELD The present invention relates to a chemically cross-linked hyaluronic acid hydrogel microparticle, a method for producing the same, and a method for forming a spheroid using the same. BACKGROUND ART < RTI ID = 0.0 >

The present invention relates to chemically cross-linked hyaluronic acid hydrogel microspheres that swell to form a porous structure, and a method for producing the same, and a method for producing the same, Lt; / RTI >

The body's cells and tissues grow, differentiate and develop while interacting with very complex three-dimensional structures. However, most cell cultures are made on a two-dimensional impermeable flat plane. Therefore, the two-dimensional cell culture has a limitation that it can not accurately simulate the cell environmental conditions in our body.

 In recent years, the cultivation of spheroids, which are three-dimensional cell tissues having equivalent functions in vivo, has attracted attention. In order to induce cell aggregation to simulate cancer and to induce normal secretion of insulin for the treatment of diabetes, a method of grafting coagulated cells to transplant islet cells is used. Mass production of speroids . In addition, as the stem cell research has matured, various methods have been attempted to apply 3-D embryonic stem cells to studies of various differentiation mechanisms.

Conventional three-dimensional cell culture methods include a hanging-drop method, a rotary culture method, a centrifugal separation method, and a micromolding method. For example, in Japanese Patent Laid-Open Publication No. 6-327465, A method in which a plurality of single cells are seeded in a well having a funnel shape and the single cells are flocculated and cleaved on the bottom surface to cultivate the spleoid; Korean Patent No. 10-1341572 discloses a plate portion and a method of extending from one surface of the plate portion And a plurality of cell receiving parts including a hollow tube in the interior of the cell culture container.

These three-dimensional cell culture methods can be used to evaluate the effects of regenerative medicine, hybrid artificial organs, production of bioactive materials, investigation and search of the functions of biological tissues or organs, screening of new drugs, An animal test substitution method, and a cell chip having a sensor function.

However, such conventional three-dimensional cell culture methods require separate culture equipment, and the culture method is complicated and the time required is long.

On the other hand, natural hyaluronic acid having excellent biocompatibility has no interspecific specificity, tissue or organ specificity, reduces moisture damage on the skin, maintains skin elasticity and damages the skin in the lower part of the skin, and collagen, It also acts as a lubricant to smooth the movement of the sidewall. However, when natural hyaluronic acid is used as it is, the mechanical properties are not good, and hyaluronidase, which is present in the body, is easily decomposed and removed by the enzyme, so that it is restricted in various applications.

In order to overcome the disadvantages of natural hyaluronic acid, many researches have been carried out to form a hydrogel through chemical modification or crosslinking using various crosslinking agents. The chemical modification of hyaluronic acid and the formation of hydrogel through cross-linking are generally carried out through alcohol groups and carboxylic acid groups present in the hyaluronic acid backbone. The carboxylic acid group of the main chain of hyaluronic acid is predominantly chemically modified by esterification, and the cross-linking reaction for hydrogel formation has been carried out using dihydrazide, dialdehyde, or disulfide. In addition, studies have been conducted to prepare a hydrogel by photo-crosslinking by introducing methacrylamide into a carboxylic acid group. On the other hand, the alcohol group of the hyaluronic acid main chain was studied using divinyl sulfone or diglycidyl ether (Lim et al, Colloids and Surfaces A: Physicochem Eng. Aspects 402 (2012) 80-87).

JP H6-327465 A KR 10-1341572 R

Colloids and Surfaces A: Physicochem. Eng. Aspects 402 (2012) 80? 87

It is an object of the present invention to provide chemically cross-linked hyaluronic acid hydrogel microspheres that exhibit a fast water swell behavior to form a porous pore structure.

Another object of the present invention is to provide a method for forming spleen, which is a three-dimensional cell tissue capable of maintaining the survival rate for a long period of time because the cells are living in the spleen.

To this end,

Wherein the alcohol group of hyaluronic acid and the alcohol group of poly (caprolactone) -b-hyperbranched polyglycerol are cross-linked by an ether bond by an epoxide crosslinking agent, and a hyaluronic acid hydrogel microparticle chemically crosslinked.

Also,

A w / o emulsion is formed by mixing i) an oily phase in which a surfactant is dissolved and ii) a basic aqueous solution of hyaluronic acid, poly (caprolactone) -b- hyperbranched polyglycerol and epoxide crosslinking agent dissolved therein to form a w / Wherein the hyaluronic acid hydrogel microparticles are in contact with each other.

Also,

Preparing chemically cross-linked hyaluronic acid hydrogel microspheres,

Swelling the hyaluronic acid hydrogel microparticles with a culture medium;

Mixing and culturing the swollen microspheres with cells

≪ / RTI >

According to the present invention, by chemically cross-linked hyaluronic acid hydrogel microparticles having a porosity due to rapid water swelling, cells are cultured to transfer oxygen and nutrients to the interior of the spheroids, thereby improving the cell survival rate and maintaining the survival rate over a long period of time . The thus formed spheroids can be usefully used for evaluating the toxicity of cell therapy agents and drug substances for transplantation.

Fig. 1 (A) is a reaction formula showing a method for producing hyaluronic acid hydrogel microparticles. Fig. 1 (B) shows a spectrum obtained by FT-IR analysis of hyaluronic acid and hyaluronic acid hydrogel microparticles.
2 schematically illustrates a method for forming a spoloid according to an embodiment of the present invention.
3 (A) is a photograph of the hyaluronic acid hydrogel microparticles prepared in Preparation Example 1 before swelling and after swelling with a field emission scanning microscope (FE-SEM, Model: JEOL, JSM-7000F) B is a graph showing the diameter distribution of the hyaluronic acid hydrogel microparticles swollen by an optical microscope, and FIG. 3C is a photograph showing the material exchange of the hyaluronic acid hydrogel microparticles using a trypan blue dye to be.
FIG. 4 is a graph showing the results of MTT analysis of the influence of hyaluronic acid hydrogel microparticles on the chondrocyte survival rate by preparing a culture medium by a general culture medium, an extract dilution method, and a direct contact method.
FIG. 5 shows the results of confirming the effect of hematoxylin-eosin staining on the cardiac tissue, kidney tissue, liver tissue, and lung tissue of mice in the hyaluronic acid hydrogel microparticle injection.
FIG. 6A shows the results of a three-day, seven-day observation of chondrocyte spheroids (Plain Cell aggregate) and hyaluronic acid hydrogel microparticles (HA Particle Cell aggregate) without using hyaluronic acid hydrogel microspheres FIG. 6B is a photograph showing the results of analysis of survival / death of cartilage cell spoloid at 7 days. FIG.
FIG. 7 is a graph showing the amount of collagen type II and the amount of aggrecan expressed in cartilage cell aggregate (hyaluronic acid hydrogel microparticles) and HA particle cell aggregate (hyaluronic acid hydrogel microparticles) FIG. 2 is a graph showing the results of real-time RT-PCR analysis. FIG.
FIG. 8 is a graph showing the effect of the hyaluronic acid hydrogel microparticles on cartilage cell aggregate (A in FIG. 8) and hyaluronic acid hydrogel microparticles (HA Particle Cell aggregate ) Were cultured for 1 week, 2 weeks, and 3 weeks, respectively, and then hematoxylin-eosin was stained and observed.
FIG. 9A is a graph showing the results of immunohistochemical staining of a 6-7 week old immunodeficient nude mouse with Plain-aggregate consisting solely of cartilage cells and cartilage cell spheroid (HA-aggregate) made with hyaluronic acid hydrogel microspheres FIG. 9B is a photograph of a tissue isolated from a 4-nude nude mouse, which was separated and subjected to hematoxylin-eosin staining and Alcian blue staining.
FIG. 10A is a photograph showing spleoid formed according to the number of cartilage cells, and FIG. 10B is a graph showing the diameter of each spoleoid.
FIG. 11A is a graph showing the results of a comparison between a 4-day, 7-day, 10-day, 10-day, and 5-day course of myocardial cell aggregate using hyaluronic acid hydrogel microparticles and a hyaluronic acid hydrogel microparticle. FIG. 11B is a graph showing diameters of the respective spheroids. FIG.
FIG. 12 is a graph showing changes in spermatogenesis and motility of long-term culture of myocardial cell aggregate and hyaluronic acid hydrogel microparticles without hyaluronic acid hydrogel microparticles This is a photograph showing the result.
FIG. 13A is a photograph showing the results of the analysis of the survival / death analysis of the third cardiac cell spleen, and FIG. 13B is a graph showing ATP activity of myocardial cell spoloids through luminescence.
FIG. 14 is a photograph showing the permeability of CM-DiI over time of myocardial cell spleoid (control) without hyaluronic acid hydrogel microparticles and hyaluronic acid using hyaluronic acid hydrogel microparticles with fluorescence microscope to be.
FIG. 15 is a photograph showing staining of myocardial cell spoiloid (Hyaluronic acid) using hematoxylin-eosin using myocardial cell spleoid control without hyaluronic acid hydrogel microparticle and hyaluronic acid hydrogel microparticle.

Hereinafter, the present invention will be described in more detail.

In the present invention, a chemically cross-linked hyaluronic acid hydrogel microparticle capable of forming a pore structure by swelling, a method of producing the same, and a method of forming a spheroid, which is a three-dimensional cell structure, through cell culture using the same.

Specifically, the present invention relates to a process for preparing a poly (caprolactone) -b-hyperbranched polyglycerol (PCL-b- hb PG) comprising hyaluronic acid and poly (caprolactone) And a hyaluronic acid hydrogel microparticle crosslinked using the above-mentioned hyaluronic acid hydrogel microparticles.

The term "hyaluronic acid" as used herein means hyaluronic acid, hyaluronic acid salt, or a mixture of hyaluronic acid and hyaluronic acid salt. The hyaluronic acid salt may be selected from the group consisting of sodium hyaluronate, potassium hyaluronate, calcium hyaluronate, magnesium hyaluronate, zinc hyaluronate, cobalt hyaluronate and tetrabutylammonium hyaluronate.

These microspheres form a w / o emulsion by mixing i) an oily phase in which the surfactant is dissolved and ii) an aqueous solution of hyaluronic acid, poly (caprolactone) -b- hyperbranched polyglycerol and epoxide crosslinking agent dissolved in a basic aqueous solution Followed by conducting a crosslinking reaction.

The molecular weight of the hyaluronic acid used for preparing the hyaluronic acid hydrogel microspheres of the present invention is 300,000 to 10,000,000, preferably 700,000 to 2,000,000 on the basis of the number average molecular weight. The molecular weight of the poly (caprolactone) -b- hyperbranched polyglycerol is 1,000 to 50,000 based on the number average molecular weight. The molecular weight of the hyaluronic acid and the poly (caprolactone) -b- hyperbranched polyglycerol affects the viscosity of the w / o emulsion in the aqueous solution, so that it is suitably used within the above range.

The oil phase may be selected from the group consisting of vegetable oil, mineral oil, silicone oil and synthetic oil. Of these, cetyl ethylhexanoate, dodecane and heptane are preferred.

As the surfactant, at least one surfactant capable of stabilizing the w / o emulsion can be used. Preferably, cetyl PEG / PPG-10/1 dimethicone (cetyl PEG / PPG-10 / 1 dimethicone (ABIL EM-90), sorbitan sesquioleate (ARLACEL 83), polyethylene glycol (30) dipolyhydroxy stearate (ARLACEL P135) Can be used as an activator.

An epoxide crosslinking agent having two or more epoxy reactive groups for chemically crosslinking the hyaluronic acid and poly (caprolactone) -b-hyperbranched polyglycerol (poly (caprolactone) -b-hyperbranched polyglycerol: PCL-b- hb PG) . The alcohol group of hyaluronic acid and the alcohol group of poly (caprolactone) -b-hyperbranched polyglycerol are crosslinked by an ether bond by an epoxide crosslinking agent.

Examples of the crosslinking agent include polyethylene glycol diglycidyl ether, 1,4-butanediol diglycidyl ether, butylene glycol diglycidyl ether, ethylene glycol diglycidyl ether, 1,6-hexanediol diglycidyl Ether, propylene glycol diglycidyl ether, polypropylene glycol diglycidyl ether, polytetramethyl glycol diglycidyl ether, neopentyl glycol diglycidyl ether, polyglycerol polyglycidyl ether, diglycerol polyglycidyl ether, (Bis (2,3-epoxypropoxy) ethylene, pentaerythritol polyglycidyl ether, and sorbitol polyglycidyl ether (hereinafter referred to as " pentaerythritol polyglycidyl ether " ≪ / RTI >

In order for the cross-linking reaction of the hyaluronic acid, poly (caprolactone) -b- hyperbranched polyglycerol and the cross-linking agent to proceed in the aqueous solution, it is necessary to use a catalyst such as sodium hydroxide, potassium hydroxide, sodium hydrogencarbonate, ammonia and the like to increase the reactivity of the hydroxyl group of hyaluronic acid It is necessary to increase the pH of the basic aqueous solution in which the hyaluronic acid and the crosslinking agent are dissolved to 12 to 14 by using a base.

When the hyaluronic acid and the cross-linking agent are dissolved in the basic aqueous solution, it is preferable to dissolve the hyaluronic acid completely in a short period of time. When the aqueous solution is added to the oil After the w / o emulsion is prepared and the initial crosslinking reaction at 60 캜 is terminated, the reaction temperature is lowered to room temperature and neutralized with an aqueous solution of the base in the presence of an acid such as acetic acid, hydrochloric acid, sulfuric acid, nitric acid or citric acid Do.

The content of hyaluronic acid is 1 to 10% by weight with respect to the basic aqueous solution, and the content of poly (caprolactone) -b- hyperbranched polyglycerol with respect to the basic aqueous solution is 0.01 to 1% by weight.

The content of the surfactant is 1 to 10% by weight based on the total weight of the mixture of the oil phase and water phase of the w / o emulsion. The concentration of the surfactant affects the size and stability of the w / o emulsion. If the content of the surfactant is less than the above range, the particle size increases and the stability of the particles becomes unstable. On the other hand, o emulsion particles are stabilized, but the surface active agent has a disadvantage that impurities are increased in the finally obtained particles.

Ethanol, methanol, isopropyl alcohol, acetone, or tetrahydrofuran may be used for the microparticle washing obtained after the crosslinking reaction. The hyaluronic acid hydrogel microparticles thus prepared have a particle size of 0.1 to 10 mu m.

The hyaluronic acid hydrogel microparticles thus obtained have a porous pore structure due to a rapid water swelling behavior. Therefore, it is possible to circulate the solution fluidly during the formation of the spheroids by using the micropores and to deliver oxygen and nutrients to the inside of the spheroids, And survival rate can be maintained over a long period of time.

Hereinafter, the method for forming spheroids according to the present invention will be described in detail.

First, chemically cross-linked hyaluronic acid hydrogel microspheres are prepared.

The hyaluronic acid hydrogel microspheres are then swollen with the culture medium.

The culture medium may be used as a culture medium for cell culture, and any medium well known to those skilled in the art may be used without limitation. The basic medium may be artificially synthesized, or a commercially prepared medium may be used. Examples of commercially produced media include Dulbecco's Modified Eagle's Medium, Minimal Essential Medium (MEM), Basal Medium Eagle (BME), RPMI 1640, F-10, F-12, Essential Medium, G-MEM (Glasgow's Minimal Essential Medium), IMDM (Isocove's Modified Dulbecco's Medium), MEF, and mTeSR-1.

By this swelling process, the hyaluronic acid hydrogel microparticles increase in particle size up to 4 to 70 탆 and form a pore structure, which enables fluid circulation of solution and facilitates oxygen and nutrient delivery during cell culture .

Next, the swollen microspheres and cells are mixed and cultured.

At this time, the swollen microspheres and cells are preferably mixed at a weight ratio of 1: 2 to 1: 4. If the amount of the microspheres is less than the above range, it is difficult to form cells with a three-dimensional tissue structure. On the contrary, when the amount of the microspheres is too large, the oxygen and nutrient delivery to the inside of the sphere is difficult.

The cells that can be cultured are not particularly limited in the present invention, and any cells known in the art can be used. Examples of the cells include epithelial cells, fibroblasts, osteoblasts, chondrocytes, myocardial cells, hepatocytes, Cells and mesenchymal stem cells, endothelial progenitor cells, embryonic stem cells, myoblasts, cardiac stem cells and the like can be used. The mesenchymal stem cells may be isolated from bone marrow, muscle, fat, umbilical cord blood, amniotic membrane, or amniotic fluid. The vascular endothelial progenitor cells may be isolated from blood, umbilical cord blood, embryo or bone marrow, but not limited thereto.

The culture can be performed according to methods known in the art, depending on the type of cell, preferably a temperature 37 ℃ 1-10%, more preferably from 5% O _2, the incubator to provide a 5% CO ₂ environment in growth Lt; / RTI >

Hereinafter, preferred embodiments and experimental examples of the present invention will be described. The following examples and experimental examples are given for the purpose of more clearly expressing the present invention, but the present invention is not limited to the following examples.

Preparation Example 1: Hyaluronic acid hydrogel Microparticle  Produce

1 (A) is a reaction formula showing a process for producing a hyaluronic acid hydrogel microparticle. ARLACEL 83, a surfactant, was dissolved in a dodecane through a stirrer, and a solution of hyaluronic acid (number average molecular weight 1,500,000), poly (caprolactone) -b- hyperbranched polyglycerol (number average molecular weight 5000) and polyethylene glycol diglycidyl ether (PEGDG) as a cross-linking agent were dissolved via a stirrer. The 0.1 N aqueous potassium hydroxide solution in which hyaluronic acid, poly (caprolactone) -b- hyperbranched polyglycerol and the crosslinking agent were dissolved was slowly added to the dodecane in which the surfactant was dissolved, and the resulting mixture was stirred for 10 minutes at 7000 rpm in an emulsifier. To prepare a w / o emulsion. The w / o emulsion was transferred to a reactor and heated to 60 DEG C to conduct an initial crosslinking reaction while stirring to maintain the w / o emulsion. Acetic acid was added to neutralize the aqueous phase of the w / o emulsion while the temperature of the reactor was kept at room temperature while continuously stirring, and the crosslinking reaction was carried out while stirring the w / o emulsion at room temperature for 2 days. The obtained w / o emulsion was precipitated in acetone, ethanol or tetrahydrofuran to obtain crosslinked hyaluronic acid hydrogel microspheres in an aqueous solution of the w / o emulsion and washed, and the oil, surfactant, unreacted crosslinking agent , An aqueous solution in which the primary precipitated hyaluronic acid hydrogel microparticles are dispersed is made to precipitate again in acetone or tetrahydrofuran. The crosslinked hyaluronic acid hydrogel particles obtained through the above procedures were vacuum dried at 90 DEG C for 24 hours to completely remove residual solvents.

Structural properties of hyaluronic acid and hyaluronic acid hydrogel microspheres were analyzed by FT-IR. The wavelength was measured in the range of 750-4000 cm ^-1 and ATR method was used. The results are shown in Fig. 1B. In the spectrum of the hyaluronic acid specimen, a peak showing stretching vibration of OH and NH at 3200 ^- 3600 cm ^-1 was confirmed, and a peak due to amide II bonding was confirmed at 2892 cm ^-1 . In addition, 1604cm ^-1 in the stretching vibration peak of C = O, 1307-1410cm ^-1 was confirmed that the NH bending vibration peak. At 1035cm ^-1 , it was confirmed that stretching vibration of ether bond (COC) was observed. In the spectrum (red color) of the synthesized hyaluronic acid hydrogel microparticle, a peak showing elongation vibration of aliphatic CH appeared at 2925 cm ^-1 , and a peak at C = O stretching vibration of formyl group was observed at 1732 cm ^-1 .

Example 1 : Hyaluronic acid Hydrogel Microspheres Used cartilage cell Speroid formation

The hyaluronic acid hydrogel microspheres obtained in Preparation Example 1 were placed in DMEM high glucose medium containing 10% serum and fixed in a shaker at a temperature of 4 ° C for 30 minutes or longer, and then swelled beforehand. The cultured chondrocytes were treated with trypsinase and suspended in single cells. The suspended chondrocytes were counted and the swollen hyaluronic acid hydrogel microspheres were prepared and mixed with the cells for 1/3 of the cell number. The culture medium containing the cells and the microspheres was dispensed in a proportion of 50 쨉 l per well to a plate for current culture. And cultured in a 5% CO ₂ incubator at 37 ° C. After one day, it was confirmed whether spoloid was formed.

Example 2: Hyaluronic acid Hydrogel Microparticle To Used Myocardium cell Speroid formation

The hyaluronic acid hydrogel microspheres obtained in Preparation Example 1 were placed in a DMEM medium containing 10% FCS and swelled at 4 占 폚 for 30 minutes or more. The cultured rat fetal heart muscle cells were treated with trypsin enzyme and suspended in single cells. Suspended rat fetal cardiac cells were counted at 1 × 10 ⁵ , and swollen hyaluronic acid hydrogel microparticles were prepared in 1/3 of the cell volume and mixed with the cells in an e-tube. Cells and e-tubes containing microspheres were centrifuged at 1000 rpm for 3-5 min. The cell pellet was confirmed in an e-tube and then cultured in a 5% CO ₂ incubator at 37 ° C. After a day, it was confirmed that the microspheres and the cells were bundled together, then rinsed slowly with a pipette and replaced with a new medium. They were replaced with new medium every day and spleens were observed in the long term.

Experimental Example 1: Hyaluronic acid hydrogel Microparticle Of swelling Exchange of materials Confirm

1-1. Diameter change due to swelling of hyaluronic acid hydrogel microspheres

FIG. 3A is a photograph of the hyaluronic acid hydrogel microparticles prepared in Preparation Example 1 before and after swelling with a field emission scanning microscope (FE-SEM, Model: JEOL, JSM-7000F). As shown in FIG. 3A, hyaluronic acid hydrogel microspheres before swelling had a spherical shape and existed in the form of particles, but it was confirmed that pores were formed after swelling.

FIG. 3B is a graph showing diameter distribution after measuring swollen hyaluronic acid hydrogel microparts by an optical microscope and measuring their diameters. Hyaluronic acid hydrogel microspheres had a diameter of 5 ㎛ or less before swelling, and most swollen microspheres were swollen to 4 ~ 70 ㎛ after swelling.

1-2. Confirmation of substance exchange of hyaluronic acid hydrogel microparticle using trippiran-blue dye

The hyaluronic acid hydrogel microparticles obtained in Preparation Example 1 were mixed with PBS solution and swelled. Tripplane - 2 to 3 drops of blue dye were added to make the PBS solution blue. And centrifuged at regular time intervals to replace the hyaluronic acid hydrogel microparticles with fresh PBS solution. I took some of the hyaluronic acid hydrogel microspheres every time I replaced them and compared the colors. The results are shown in Fig. 3C.

As can be seen from FIG. 3C, the hyaluronic acid hydrogel microparticles showed a blue color with PBS mixed with a trypival-blue dye, but when the concentration of trypan blue was gradually diluted with PBS, the color of the microparticles was also light I checked the luggage. As a result, it can be seen that the hyaluronic acid hydrogel microparticles can circulate the solution fluidly.

Experimental Example 2: Hyaluronic acid Hydrogel Microparticle end cartilage cell On survival rate Affection effect

The effect of hyaluronic acid hydrogel microspheres on cell viability was investigated. The medium was prepared in three groups: 1) a general culture medium, 2) an extract dilution method, and 3) a direct contact method.

The extract dilution method was performed by diluting 2 g of hyaluronic acid hydrogel microparticles in 100 ml, incubating in a 5% CO ₂ incubator at 37 ° C for 3 days, centrifuging the supernatant of the culture medium to 0.2um filter, Lt; / RTI >

The direct contact method uses 2 g of hyaluronic acid hydrogel microparticles as a culture medium as it is in a 100 ml culture medium.

First, chondrocytes were seeded in a 96-well plate. The cell viability was determined by MTT assay (3- (4,5-dimethylthiazol-2yl) -2,5-diphenyl-2H-tetrazolium bromide MTT assay) Absorbance was measured. The results are shown in Fig. As shown in FIG. 4, there was no significant difference in the survival rate of hyaluronic acid hydrogel microparticles versus chondrocytes.

Experimental Example 3: Hyaluronic acid hydrogel Microparticle end In vivo in vivo ) Effect on mouse tissue

See if hyaluronic acid hydrogel microspheres migrate to other tissues and affect other organs when injecting hyaluronic acid hydrogel microspheres into 6-7 week old immunodeficient nude mice (Balb / C Nude, Charles River Laboratories) Respectively.

One week after subcutaneous injection, each organs of the mice were collected, fixed in 4% paraformaldehyde, and paraffin blocks were made to perform hematoxylin-eosin staining and histological examination.

FIG. 5 shows the effect of hyaluronic acid hydrogel microparticle injection on mouse heart tissue, kidney tissue, liver tissue and lung tissue through hematoxylin-eosin staining. As a result, hyaluronic acid hydrogel microparticles were present in all organs And all showed normal tissue findings.

Experimental Example 4: Hyaluronic acid Hydrogel Microparticle Wow together 3 Dimension By current culture made year Bone cell Speroid long time observe

The shape and size of chondrocyte spheroids (control group) without hyaluronic acid hydrogel microparticles and cartilage cell spheroids with hyaluronic acid hydrogel microparticles were observed at intervals of 3 and 7 days. The results are shown in Fig. 6A.

As can be seen from FIG. 6A, in the case of chondrocyte spheroid (control group) not using hyaluronic acid hydrogel microparticles, the size of the cell spoloid was decreased with time.

Cell viability was confirmed using a confocal fluorescence microscope by performing a live-dead assay on 7th day cartilage cell spoloids. Living cells show green fluorescence and dead cells show red fluorescence. The result is shown in Fig. 6B.

Referring to FIG. 6B, it was confirmed that dead cells were observed from the center of the cell spoloid consisting of only chondrocytes without using hyaluronic acid hydrogel microspheres. On the other hand, it was confirmed that most of the cell spoloids containing hyaluronic acid hydrogel microparticles are alive and dead cells are remarkably small.

Experimental Example 5: Cartilage formation relation Gene Expression compare

After making chondrocyte spheroid, we tried to identify the genes specifically expressed in chondrogenesis to examine tissue maturity. The housekeeping gene was Glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primers of collagen type II (COL II) and aggrecan (AGG) were prepared as follows. Collagen type 2-F; GCAAAGACGGCGCCAATGGAAT, Collagen type 2-R; AGCAAAGGCGCACATGTCGAT, Aggrecan-F; ACACCAACGAGACCTATGACGTGT, Aggrecan-R; ACTTCTCTGGCGACGTTGCGTAAA, GAPDH-F; TCAAGAAGGTGGTGAAGCAGGCAT, GAPDH-R; CCCTGTTGCTGTAGCCAAATTCGT. As shown in FIG. 7, when the amount of expression of collagen type II (COL II) and aggrecan (AGG) was compared by real-time RT-PCR, the amount of expression of collagen type II gene in hyaluronic acid hydrogel microparticle- aggregate), which was significantly increased.

Experimental Example 6: Hematoxylin - Eosin Dyeing through Cartilage cell Speroid observe

Each cell sphere was incubated for 1 week, 2 weeks, and 3 weeks, fixed in 4% paraformaldehyde, and paraffin blocks were made. And stained with hematoxylin and eosin. The results are shown in Fig. FIG. 8A is a plain-aggregate composed only of chondrocytes, and FIG. 8B is a chondrocyte spheroid (HA-aggregate) formed with hyaluronic acid hydrogel microspheres.

Referring to FIGS. 8A and 8B, when the hyaluronic acid hydrogel microparticles were formed with the chondrocyte cells, it was confirmed that the cells were almost not killed to the center of the sprooid than the spleoids formed only with the cells . In addition, it was confirmed that chronocellular tissue (Lacuna) similar to cartilage tissue was formed over time in spearoid containing hyaluronic acid hydrogel microspheres, confirming that the tissue was made denser.

Experimental Example 7: Nude Mouse Used Cartilage tissue Formation comparison

Chondrocytes stained with DiI (1,1'-dioctadecyl-3,3,3 ', 3'-tetramethyl indocarbocyanine perchlorate), a fluorescent substance, were prepared by current culture method.

A solution (10 μl) of DiI (1,1'-dioctadecyl-3,3,3 ', 3'-tetramethyl indocarbocyanine perchlorate) (10 μl) was added to DMEM high glucose medium without serum : 200 to prepare a cell-labeling solution. After mixing with chondrocyte cells, the cells were incubated at 37 ° C for about 15-20 minutes. After the culture medium was removed, the cells were washed three times with phosphate-buffered saline (PBS), and fluorescence microscopy was performed to confirm whether DiI was stained properly.

Aggregation of plaque-aggregate and hyaluronic acid hydrogels produced in chondrocytes only in 6-7 week old immunodeficient nude mice (Balb / C Nude, Charles River Laboratories) ) was injected into each dog to 2x10 ⁶ mice subcutaneously. The red arrows are cartilage cell spheroids made with hyaluronic acid hydrogel microspheres (HA-aggregate), and the blue arrows are plain-aggregate cartilage cells only. The position of the cells transplanted into the body using a fluorescence analysis imaging device (Xenogen) was confirmed on the day of transplantation and at 1 week, 2 weeks, 3 weeks, and 4 weeks.

A paraffin block was prepared by separating subcutaneous tissues of the 4-nude mouse corresponding to A in FIG. 9, and hematoxylin-eosin staining and Alcian blue staining were performed.

As shown in the results of FIGS. 9A and 9B, cartilage tissues were formed in the hypodermic tissues injected with hyaluronic acid hydrogel microparticles and HA-aggregate to confirm the cartilage cell lacuna , And it was confirmed that the tissues were firmer and denser when compared with the control group. In addition, the Alcian blue staining method is a water-soluble copper phthalocyanine derivative used to verify acidic mucinous polysaccharides. The degree of differentiation of cartilage tissues can be confirmed by using a hyaluronic acid hydrogel microparticle and HA-aggregate, And it was confirmed that it was dyed in blue color.

Experimental Example 8: Current culture (hanging-drop) Used cell On the water Following Speroid size compare

The number of cartilage cells per drop was adjusted to 200, 400, 800, 1600, and 3200 by using a plate for current culture, and spleoid was formed by injecting into each well.

FIG. 10A is a photograph showing spleoid formed according to the number of cartilage cells, and FIG. 10B is a graph showing the diameter of each spoleoid.

Referring to FIGS. 10A and 10B, the size of spoloid was gradually increased according to the number of cells between 200 and 800, but the size did not increase any more when the number of cells was 800 or more.

Experimental Example 9: Hyaluronic acid Hydrogel Microparticle end Myocardium cell On survival rate Affection effect

The 96-well plate was coated with collagen, and then 2 x 10 ⁴ seed cells of primary cultured rat fetal heart cells were seeded. To observe the effects of hyaluronic acid hydrogel microspheres on cell survival rate, MTT analysis was performed at 2, 3, and 7 days intervals with high concentrations of microspheres in culture medium at concentrations of 0, 1, 2, and 5 mg / ml. As a result, when cardiomyocytes were cultured in a culture medium containing a high concentration of hyaluronic acid hydrogel microparticles, there was no significant difference in cell survival rate, and it was confirmed that hyaluronic acid hydrogel microparticles did not affect myocardial cell survival rate.

Experimental Example 10 : Hyaluronic acid hydrogel Microparticle And myocardial cell spleens  Diameter measurement

The shape and size of myocardial cell spleoids mixed with control and hyaluronic acid hydrogel microparticles were observed at 4, 7, and 10 days intervals. As shown in A and B of FIG. 11, it was confirmed that the size of spoil decreased with time.

Experimental Example 11: Myocardial cell Speroid Long term At the time of culture Spearoid condition And motility Confirm

The medium was changed daily, keeping it in the e-tube from the day of speroid production, and cultured in a 5% CO ₂ incubator at 37 ° C for about 24 days.

FIG. 12 is a graph showing changes in spermatogenesis and motility of long-term culture of myocardial cell aggregate and hyaluronic acid hydrogel microparticles without using hyaluronic acid hydrogel microparticles. This is a photograph showing the result.

As shown in Fig. 12, the shape of spheroids remained constant even after long-term culture. It was also confirmed that beating was continued around the periphery of the sprooid. Also, myocardial cells were shown to be beating together like a lump.

Experimental Example 12: Myocardium cell Spearoid Cell survival rate Confirm

12-1. Identification of cell viability of myocardial cell spleod using Live-Dead assay

Spheroids were cultured for 3 days and subjected to a live-dead assay in the form of spleens. And photographed using a confocal fluorescence microscope. The results are shown in Fig. 13A.

Referring to FIG. 13A, it was confirmed that dead cells were observed from the center of the spherooid-only control. On the other hand, spearoid containing hyaluronic acid hydrogel microparticles was found to be mostly alive and dead cells were significantly smaller.

12-2. Confirmation of ATP activity of myocardial cell sphere from luminescence

The same number of spoolds were dispensed on a plate for 96-well luminescence, and the degree of luminescence was measured with Spectramax using Promega, G7570 kit.

As shown in the result of FIG. 13B, spearoid (HA) containing hyaluronic acid hydrogel microparticles exhibited an ATP activity about twice or more as compared with a control without using hyaluronic acid hydrogel microparticles Respectively. As shown in FIG. 13A, the survival rate of cells was increased by hyaluronic acid hydrogel microparticles, and it was confirmed through experiments that live healthy cells produce more ATP.

Experimental Example 13: In time Following CM-DiI Penetration rate compare

Each of the myocardial cell spleoids was reacted with CM-DiI-containing medium for 30 minutes and 1 hour. The sections were frozen, DAPI was stained, and myocardial cell spoloids were observed using a fluorescence microscope. The results are shown in Fig.

Referring to FIG. 14, when hyaluronic acid hydrogel microparticles were added to myocardial cell spheroids, CM-DiI staining appeared to penetrate more quickly. As a result, it can be expected that the cell culture fluid penetrates better into the sphere.

Experimental Example 14: Hematoxylin - Eosin Dyeing through Myocardial cell Speroid observe

Myocardial cell spoloids were cultured for 3 days and 7 days, fixed in 4% paraformaldehyde, and paraffin blocks were made. The cells were stained with hematoxylin and eosin and observed. The results are shown in Fig.

Referring to FIG. 15, when hyaluronic acid hydrogel microparticles were formed together with rat fetal cardiomyocytes, it was confirmed that the cells did not die to the center of spoil than to spleoids formed only with cells.

Claims (14)

A chemically cross-linked hyaluronic acid hydrogel microparticle in which the alcohol group of hyaluronic acid and the alcohol group of poly (caprolactone) -b-hyperbranched polyglycerol are crosslinked by an ether bond by an epoxide crosslinking agent. The composition of claim 1, wherein the epoxide crosslinking agent is
Polyethylene glycol diglycidyl ether, 1,4-butanediol diglycidyl ether, butylene glycol diglycidyl ether, ethylene glycol diglycidyl ether, 1,6-hexanediol diglycidyl ether, propylene glycol Diglycidyl ether, diglycidyl ether, polypropylene glycol diglycidyl ether, polytetramethyl glycol diglycidyl ether, neopentyl glycol diglycidyl ether, polyglycerol polyglycidyl ether, diglycerol polyglycidyl ether, (2, 3-epoxypropoxy) ethylene, pentaerythritol polyglycidyl ether, and sorbitol polyglycidyl ether in the group consisting of glycerol polyglycidyl ether, trimethylpropane polyglycidyl ether, 1,2- Selected from the group consisting of chemically crosslinked hyaluronic acid hydrogel microspheres. The method of claim 1, wherein the hyaluronic acid is selected from the group consisting of
A hyaluronic acid, a hyaluronic acid, or a mixture of hyaluronic acid and hyaluronic acid. 4. The method according to claim 3, wherein the hyaluronate is
Wherein the microparticles are at least one selected from the group consisting of sodium hyaluronate, potassium hyaluronate, calcium hyaluronate, magnesium hyaluronate, zinc hyaluronate, cobalt hyaluronate and tetrabutylammonium hyaluronate. The method of claim 1,
0.0 > 10 < / RTI > um. ≪ / RTI > A w / o emulsion is formed by mixing i) an oily phase in which a surfactant is dissolved and ii) a basic aqueous solution of hyaluronic acid, poly (caprolactone) -b- hyperbranched polyglycerol and epoxide crosslinking agent dissolved therein to form a w / Of the hyaluronic acid hydrogel microparticles. 7. The process according to claim 6, wherein the compound is one selected from the group consisting of cetyl ethylhexanoate (CEH), dodecane and heptane. 7. The composition of claim 6, wherein the surfactant is selected from the group consisting of cetyl PEG / PPG-10/1 dimethicone, sorbitan sesquioleate and polyethylene glycol (30) (30) dipolyhydroxy stearate. ≪ RTI ID = 0.0 > 21. < / RTI > The method according to claim 6, wherein the molecular weight of the hyaluronic acid is 700,000 to 2,000,000 based on the number average molecular weight. 7. The process according to claim 6, wherein the molecular weight of the poly (caprolactone) -b-hyperbranched polyglycerol is 1,000 to 50,000 based on the number average molecular weight. Preparing the chemically cross-linked hyaluronic acid hydrogel microparticles of claim 1;
Swelling the hyaluronic acid hydrogel microparticles with a culture medium;
Mixing and culturing the swollen microspheres with cells
≪ / RTI > 12. The method of claim 11,
And has a diameter of 0.1 to 10 mu m. 12. The method of claim 11, wherein the swollen microspheres
Lt; RTI ID = 0.0 > 4 < / RTI > 12. The method of claim 11,
The present invention also relates to a method for producing a human myoblast comprising the steps of culturing a human myeloma cell line, an epithelial cell, a fibroblast, an osteoblast, a cartilage cell, a cardiomyocyte, a hepatocyte, a human umbilical cord blood cell and an mesenchymal stem cell, an endothelial progenitor cell, an embryonic stem cell, ) Or a cardiac stem cell.

Images