KR20150086442A - Composition for overcoming resistance to her2 inhibitor comprising ant2 sirna - Google Patents

Composition for overcoming resistance to her2 inhibitor comprising ant2 sirna Download PDF

Info

Publication number
KR20150086442A
KR20150086442A KR1020150004367A KR20150004367A KR20150086442A KR 20150086442 A KR20150086442 A KR 20150086442A KR 1020150004367 A KR1020150004367 A KR 1020150004367A KR 20150004367 A KR20150004367 A KR 20150004367A KR 20150086442 A KR20150086442 A KR 20150086442A
Authority
KR
South Korea
Prior art keywords
seq
nos
ant2
sirna
cancer
Prior art date
Application number
KR1020150004367A
Other languages
Korean (ko)
Other versions
KR101681597B1 (en
Inventor
김철우
장지영
Original Assignee
주식회사 바이오인프라
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오인프라 filed Critical 주식회사 바이오인프라
Publication of KR20150086442A publication Critical patent/KR20150086442A/en
Application granted granted Critical
Publication of KR101681597B1 publication Critical patent/KR101681597B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to a composition for overcoming resistance to a cancer cell apoptosis inducing and targeted anticancer agent by controlling expression of ANT2. More specifically, the present invention relates to: a pharmaceutical composition containing ANT2 siRNA as an active ingredient for inhibiting resistance to an HER2/neu targeted anticancer agent and increasing sensitivity for the same agent; and use of the same composition as an adjuvant for anticancer treatment. According to the present invention, the composition: has high selectivity with respect to cancer cells when applied with a targeted anticancer agent; increases anticancer activity; and thus can be advantageously used for anticancer treatment.

Description

ANT2 siRNA를 함유하는 HER2 표적 항암제에 대한 내성 극복을 위한 조성물{COMPOSITION FOR OVERCOMING RESISTANCE TO HER2 INHIBITOR COMPRISING ANT2 SIRNA}TECHNICAL FIELD The present invention relates to a composition for overcoming resistance to a HER2 target anticancer agent containing ANT2 siRNA,

본 발명은 표적 항암제의 내성 극복 조성물에 관한 것으로, 보다 상세하게는 ANT2 siRNA를 유효성분으로 함유하는 HER2 표적 항암제 내성 극복 조성물 및 이를 유효성분으로 함유하는 HER2 표적 항암제 내성 암의 치료용 조성물에 관한 것이다.
The present invention relates to a composition for overcoming tolerance to a target anticancer agent, and more particularly, to a composition for overcoming HER2 target anticancer drug resistance comprising ANT2 siRNA as an active ingredient and a composition for treating HER2 target anticancer drug resistant cancer comprising the same as an active ingredient .

종양(tumor)은 비정상적인 세포의 과잉으로 인하여 발생하는 비정상적이고 비제어적이며 무질서한 세포증식의 산물로써, 이러한 종양이 파괴적인 증식성, 침윤 및 전이성을 가지게 되면 악성종양(malignant tumor)으로 분류된다. 분자생물학적인 관점에서 볼 때 유전자의 변이에 의하여 발생하는 유전적 질환(genetic disease)이라고 할 수 있다. 악성종양에서 신생혈관 생성과 당분해의 증가는 저산소 상태의 미세환경을 나타내며, 이는 종양의 침습성, 전이 환자의 예후와 관련이 있는 것으로 알려져 있다. 혈관에서 산소, 포도당, 기타 영양소 등은 제한된 범위 내에서 확산에 의하여 공급되기 때문에 성장하는 악성 종양의 조직에서 신생혈관이 형성되지 않으면 종양세포들은 저산소증에 빠지게 되고 저산소증에 빠진 세포는 산소의 저분압 상태를 감지하여 저산소증 조절 유전자들을 발현시키려는 신호체계를 활성화시켜 그 환경에 적응하려는 변이를 일으켜 악성종양으로 자라게 된다. Tumors are the products of abnormal, non-hematological and disordered cell proliferation caused by abnormal cell hyperplasia. If these tumors have destructive proliferation, invasion and metastasis, they are classified as malignant tumors. It is a genetic disease caused by mutation of a gene from a molecular biological point of view. Neovascularization and increased glycosylation in malignant tumors represent a hypoxic microenvironment, which is known to be associated with tumor invasion and prognosis in metastatic patients. Since oxygen, glucose, and other nutrients are supplied by diffusion within a limited range of blood vessels, if neovascularization is not formed in the tissue of the growing malignant tumor, the tumor cells fall into hypoxia, and hypoxic cells become hypoxic And activates a signaling system to express hypoxic regulatory genes, resulting in mutations that adapt to the environment, resulting in malignant tumors.

현재까지 악성종양인 암을 치료하는 방법으로 주로 3가지 치료법 즉, 방사선 치료, 외과적인 수술 및 화학요법을 이용하고 있으며, 이 중 한 가지 또는 이들의 조합을 통해 암을 치료하고 있다. 구체적으로, 방사선 치료는 급성염증성 질환, 양성 또는 악성 종양, 내분비기능장애 및 알레르기성 질환 등에 사용되며, 일반적으로 급속히 분열하는 세포로 구성된 악성종양에 효과적으로 사용되고 있다. 이러한 방사선 치료는 방사선의 치료에 따라 정상조직의 기능 약화 또는 상실, 치료 후 치료부위에 피부질환이 발생할 우려가 있으며, 특히 장기의 발육이 진행되는 소아의 경우 지능발달 지연 또는 골 발육 장애 등 심각한 부작용을 초래할 수 있다.To date, there have been three treatments for cancer, malignant tumors: radiation therapy, surgery and chemotherapy, and one or a combination of these treatments. Specifically, radiation therapy is used for acute inflammatory diseases, benign or malignant tumors, endocrine dysfunction and allergic diseases, and is generally effectively used for malignant tumors composed of rapidly dividing cells. Such radiotherapy may result in the attenuation of function of normal tissue or loss of normal tissues, treatment of skin disease after treatment, and especially serious adverse effects such as delayed development of intelligence or development of osteoporosis in pediatric ongoing development of organs ≪ / RTI >

외과적 수술은 질병 조직을 대부분 제거하는 방법으로, 이러한 외과적 수술은 특정 부위, 예를 들면 유방, 결장 및 피부에 위치한 종양을 제거하는 데는 매우 효과적이지만, 척추와 같은 일부 부위에 있는 종양을 치료하거나 분산성 종양을 치료하기에는 부적절하다.Surgical surgery is a method of removing most of the diseased tissue. Such surgical operations are very effective in removing tumors located in specific areas such as breast, colon and skin, but they do not treat tumors in some areas such as the spine Or to treat dispersible tumors.

화학요법은 암세포의 복제 또는 대사를 교란시킴으로써 유방, 폐 및 정소의 암을 치료하는데 널리 이용되고 있는데, 이러한 방법에 있어서 가장 큰 단점은 암 치료에 이용되는 전신성 화학요법에 의하여 유도되는 부작용이다. 화학요법에 의한 부작용은 환자의 생명에 중요한 영향을 미치며 치료에 대한 환자의 불안감을 증가시킬 수 있다. 또한, 화학치료제와 관련된 부작용으로는 일반적으로 이러한 약물의 투여 시 주의해야 하는 용량 제한 독성(dose limiting toxicity, DLT)이다. 예를 들면, 점막염은 여러 항암제(항대사물질 세포독소제인 5-플루오로우라실, 메소트렉세이트 및 항종양 항생제인 독소루비신) 등에 대한 용량 제한 독성(DLT)이 있다. 이러한 화학 요법의 부작용 중 대부분은 심한 경우, 입원을 요하거나 통증을 치료하기 위하여 진통제를 필요로 하기도 한다. 이처럼, 화학치료제 및 방사선 치료에 의한 부작용들은 암 환자의 치료에 있어서 중요한 문제로 부각되고 있다.Chemotherapy is widely used to treat cancers of the breast, lungs and testes by disturbing the replication or metabolism of cancer cells. The biggest disadvantage of this method is the side effects induced by systemic chemotherapy used for cancer treatment. Side effects from chemotherapy can have a significant impact on the patient's life and can increase patient anxiety about treatment. In addition, side effects associated with chemotherapeutic agents are dose limiting toxicity (DLT), which should generally be taken into account when administering these drugs. For example, mucositis has dose-limiting toxicity (DLT) to several anticancer agents (5-fluorouracil, methotrexate and antitumor antibiotic doxorubicin, the antimetabolite cytotoxic agents). Most of these side effects of chemotherapy are severe, requiring hospitalization or requiring analgesics to treat pain. As such, side effects caused by chemotherapeutic agents and radiation therapy are becoming important issues in the treatment of cancer patients.

반면에, 유전자 치료(gene therapy)는 DNA 재조합 방법을 이용하여 치료용 유전자를 환자의 세포 안으로 도입시켜서 유전자 결함을 교정하거나 세포에 새로운 기능을 추가하여 인체 세포의 유전적 변형으로 인한 각종 유전질환, 암, 심혈관질환, 감염성 질병 및 자가면역질환 등을 치료하거나 예방하는 방법이다. 구체적으로는, 치료유전자(therapeutic gene)를 체내의 원하는 장기로 전달함으로써 세포 내에서 치료용 또는 정상 단백질이 발현될 수 있도록 유도하여 상기 질병들을 치료하는 방법을 유전자 치료(gene therapy)라고 한다. 기존의 화학요법은 세포에 대한 무차별적 공격으로 정상세포 및 암세포가 모두 영향을 받는 문제가 있었으나, 이러한 유전자 치료는 일반적인 약물에 의한 치료법에 비하여 우수한 선택성을 가질 수 있으며 다른 치료법으로 조절하기 어려운 질병의 치료를 개선함으로써 오랜 기간 동안 적용할 수 있다. 특정 표적인자만을 선택적으로 억제하는 표적 치료를 통해 기존의 화학요법으로 인한 부작용을 최소화할 수 있다는 장점이 있다. Gene therapy, on the other hand, uses DNA recombination techniques to introduce therapeutic genes into patient cells to correct genetic defects or to add new functions to cells, resulting in genetic disorders, Cancer, cardiovascular disease, infectious disease, and autoimmune disease. Specifically, gene therapy refers to a method of treating a disease caused by inducing therapy or normal protein expression in a cell by delivering a therapeutic gene to a desired organ in the body. Conventional chemotherapy has the problem that both normal cells and cancer cells are affected by indiscriminate attack on cells. However, such gene therapy can have excellent selectivity compared to general drug treatment, It can be applied for a long time by improving treatment. Target therapy that selectively inhibits specific target factors has the advantage of minimizing side effects from existing chemotherapy.

이러한 유전자 치료를 효과적으로 하기 위해서는 치료 유전자를 원하는 표적세포에 전달하여 높은 효율로 발현할 수 있도록 하는 유전자 전달기술이 필요하다. 유전자 전달체는 원하는 치료 유전자를 대상 세포에 도입하기 위해 필요한 매개체로서, 이상적인 유전자 전달체는 인체에 무해하고 대량 생산이 용이하며 효율적으로 유전자를 전달 및 지속적으로 유전자를 발현할 수 있어야 한다. 이러한 유전자 전달체 기술은 유전자 치료 기술의 핵심 요소로서, 현재 유전자 치료에 많이 이용되는 대표적 유전자 전달체로는 아데노바이러스(adenovirus), 아데노부속바이러스(adeno-associated virus, AAV), 레트로바이러스(retrovirus)와 같은 바이러스성 전달체와 리포좀 및 폴리에틸렌이민과 같은 비바이러스성 전달체가 있다.In order to effectively perform such gene therapy, gene transfer technology is required to transfer a therapeutic gene to a desired target cell and express it at a high efficiency. The gene transporter is a mediator for introducing the desired therapeutic gene into the target cell. The ideal gene transporter is harmless to the human body, is easy to mass-produce, efficiently transduces the gene, and can continuously express the gene. Such gene transfer technology is a key element of gene therapy technology. Currently, representative gene carriers used for gene therapy include adenovirus, adeno-associated virus (AAV), retrovirus Viral carriers and nonviral carriers such as liposomes and polyethyleneimines.

유전자 치료의 전략 중 종양세포를 제어하는 전략으로는 종양억제 유전자를 이용하는 방법, 종양 선택적 살상 바이러스를 이용하는 방법, 자살 유전자를 이용하는 방법 및 면역조절 유전자를 도입하는 방법 등이 있다. 구체적으로 종양억제 유전자를 이용하는 방법은, 상당수의 암환자에서 유전자가 결핍 또는 변형되어 있는 p53과 같은 종양억제 유전자를 원형으로 인체에 전달하여 암을 치료하는 방법이며, 종양 선택적 살상바이러스를 이용하는 방법은, 암조직에서 변형되어 있는 종양억제 유전자의 활성을 이용하여 종양세포에서만 선택적으로 증식할 수 있는 바이러스 유전자 전달체를 인체에 도입하여 치료하는 방법으로서 두 가지 모두 종양세포를 직접적으로 사멸시키는 전략이다. 또한, 자살 유전자를 이용하는 방법 예를 들면, HSK-TK와 같은 감수성 유전자를 도입하여 종양세포의 자살을 유도하는 방법도 이와 같은 범주에 포함된다. 반면에, 면역 조절 유전자를 도입하는 방법은 항종양 면역반응을 증가시키는 인터루킨 12(IL-12), 인터루킨 4(IL-4), 인터루킨 7(IL-7), 감마 인터페론(γ-interferon) 및 종양괴사인자(tumor necrosis factor, TNF) 등의 유전자를 인체에 전달함으로써 T 세포를 매개로하여 종양을 인식하도록 유발하거나, 종양 유발 단백질을 차단함으로써 세포 자살을 유도하여 간접적으로 질병을 치료하는 전략이다.Strategies for controlling tumor cells among strategies for gene therapy include tumor suppressor genes, tumor selective killing viruses, suicide genes, and immunoregulatory genes. Specifically, a method using a tumor suppressor gene is a method of treating a cancer by transferring a tumor suppressor gene such as p53 deficient or transformed in a large number of cancer patients to a human body in a circular form, and a method using tumor selective killing virus , A method of introducing a viral gene carrier capable of selectively proliferating only in tumor cells using the activity of a tumor suppressor gene, which is modified in cancer tissues, to directly kill both tumor cells. Also included in this category is a method of using a suicide gene, for example, a method of inducing suicide of a tumor cell by introducing a susceptibility gene such as HSK-TK. On the other hand, methods of introducing immunomodulatory genes include interleukin 12 (IL-12), interleukin 4 (IL-4), interleukin 7 (IL-7), gamma interferon Tumor necrosis factor (TNF) is transmitted to the human body to induce the tumor to be recognized through T-cell mediation, or to induce apoptosis by blocking the tumor-induced protein to indirectly treat the disease .

최근 의료산업의 발전으로 인구의 평균연령이 상승하는 추세이나 암 발병에 의한 사망률은 여전히 높은 수준으로 이의 치료에 대한 연구가 활발하게 진행되고 있다. 특히 여성의 경우 최근에는 저출산, 짧은 수유기간, 이른 초경, 늦은 폐경 등의 요인과 함께 생리적으로 왕성한 신체적 변화를 겪는 시기에 여성 호르몬의 자극을 받는 횟수의 급격한 증가로 인한 유선조직의 민감도 증가, 식생활의 서구화, 생활환경의 오염 등의 이유로 유방암 발생이 급격하게 증가하고 있어, 유방암이 자궁경부암을 추월하여 여성암 1위가 되었다. 이러한 유방암의 발생빈도 및 유방암으로 인한 사망률의 증가는 현재의 서구화 실태로 보아 앞으로도 상당기간 지속될 것으로 예상된다. 유방암은 암세포의 성장으로 인한 주변 조직의 침범 또는 림프절 전이 등의 증상을 초래하는 것이 보통이므로, 유방암으로 인한 사망률을 줄이기 위해서는 유방암을 효과적으로 조기에 치료하는 것이 매우 중요하다. Recently, as the medical industry develops, the average age of the population rises, and the mortality due to cancer is still high. Especially for women, the sensitivity of the mammary gland tissue due to the rapid increase of the number of stimulation of female hormone during the physiological changes during the physiological changes, such as low birth rate, short feeding period, early menarche, late menopause, And wastage of living environment, breast cancer has been rapidly increasing, and breast cancer has overtaken cervical cancer and became the first female cancer. The incidence of breast cancer and mortality due to breast cancer is expected to continue for a considerable period of time based on current westernization. Since breast cancer usually causes symptoms such as invasion of surrounding tissues or lymph node metastasis due to the growth of cancer cells, it is very important to treat breast cancer effectively early to reduce the mortality rate from breast cancer.

유방암 세포는 세포 표면에 발현하는 상피 성장 인자 수용체(EGFR : Epidermal growth factor receptor)를 통해서 세포 내에 특정 신호전달 체계를 활성화시켜서 세포의 증식, 생존, 다른 조직으로의 이동과 침윤을 가능하게 한다고 알려져 있다. 특히, EGFR 가운데 HER2/neu(HER2)의 경우 유방암 환자의 30% 정도가 암 세포 표면에 과발현하고 있다고 보고되어 있는데 HER2/neu가 과발현되어 있는 경우 분화도가 좋지 않고 치료의 예후가 나쁘며, 호르몬수용체에 음성을 나타내어 호르몬 치료요법의 적용이 힘들며, 항암치료에 대한 강한 내성(multi-drug resistance)을 나타낸다고 알려져 있다. 암세포 표면의 HER2/neu의 발현은 HSP90(Heat shock protein 90) 단백질에 의해 유지되며, HSP90 단백질은 ATP가 결합할 때 그 기능을 수행할 수 있는 것이 알려져 있다. HER2/neu를 통해서 활성화되는 대표적인 신호전달체계로는 PI3K/Akt 신호전달체계가 알려져 있으며, 이 신호전달체계의 활성이 유방암 세포의 증식, 생존, 다른 조직으로의 이동과 침윤에 관여한다고 보고되어 있다. 따라서 HER2/neu의 발현을 낮추거나 HER2/neu를 통한 신호전달체계의 활성을 방해하는 방법을 이용해서 유방암을 치료하고자 하는 많은 시도들이 이루어지고 있다. 대표적으로는, 유방암 및 위암의 치료를 위한 표적 항암제로 트라스투주맙(trastuzumab) 단일클론항체 치료제가 알려져 있다. 트라스투주맙 단일클론항체는 암세포 표면의 HER2/neu에 결합하여 세포매개 세포독성(ADCC, Antibody-Dependent Cell-mediated Cytotoxicity)에 의한 면역체계 활성화를 통해 항암효과를 나타낸다. 이러한 치료제는 HER2 양성 암의 치료에 현저한 효과를 입증했지만, 최근 내성 문제가 부각되고 있다.It is known that breast cancer cells activate a specific signal transduction system within the cell through the epidermal growth factor receptor (EGFR) expressed on the cell surface, enabling cell proliferation, survival, migration and invasion to other tissues . In the case of HER2 / neu (HER2) among the EGFR, 30% of the breast cancer patients are over-expressed on the surface of cancer cells. When HER2 / neu is over-expressed, the degree of differentiation is poor and the prognosis of treatment is poor. It is known that hormone therapy is difficult to apply because of its negative symptoms, and it shows strong resistance to chemotherapy (multi-drug resistance). The expression of HER2 / neu on cancer cell surface is maintained by HSP90 (heat shock protein 90) protein, and it is known that HSP90 protein can perform its function when ATP binds. The PI3K / Akt signal transduction system is known to be activated through HER2 / neu, and it is reported that the activity of this signal transduction system is involved in the proliferation, survival, and migration and invasion of breast cancer cells . Thus, many attempts have been made to treat breast cancer using methods that lower the expression of HER2 / neu or interfere with the activity of the signaling pathway through HER2 / neu. Typically, a therapeutic agent for trastuzumab monoclonal antibody is known as a target anticancer drug for the treatment of breast cancer and stomach cancer. Trastuzumab monoclonal antibody binds to HER2 / neu on the surface of cancer cells and exhibits anticancer effect through activation of immune system by Antibody-Dependent Cell-mediated Cytotoxicity (ADCC). Although these therapies have proven to have significant effects in the treatment of HER2-positive cancers, resistance issues have recently emerged.

아데닌 뉴클레오티드 트랜스로케이터(ADP/ATP translocator, ANT)는 미토콘드리아 내막(inner membrane, IM)에 존재하는 효소로서 외막(outer membrane, OM)의 VDAC(voltage dependent anion channel)를 통하여 세포질로부터 미토콘드리아 내부로 ADP를 전달(import)하고 전자전달계(electron transfer chain system)를 거쳐 생성되는 ATP를 세포질로 방출(export)하는 기능을 수행하는 효소로 알려져 있다.
Adenine nucleotide transposon (ADP / ATP translocator, ANT) is an enzyme present in the inner membrane (IM) of the mitochondrial membrane. It acts as a signal pathway through the VDAC (voltage dependent anion channel) It is known as an enzyme that imports and exports ATP produced through an electron transfer chain system to the cytoplasm.

한국등록특허 제 10-0555211호 (2006.02.20)Korean Patent No. 10-0555211 (2006.02.20)

암세포에 대한 선택성이 개선되어 정상세포에 대한 부작용이 저감된 표적 항암제가 개발되어 임상에서 활발히 이용되고 있으나, 이에 대한 1차 내성 및 획득 내성이 보고 되고 있다. The selectivity for cancer cells has been improved, and the targeted anticancer drugs with reduced side effects against normal cells have been developed and used actively in clinical practice, but primary resistance and acquired resistance have been reported.

본 발명의 목적은 표적 항암제의 내성 극복 및 암세포에 대한 민감성 증진을 위한 약학적 조성물 및 이를 포함하는 효과적이고 부작용이 저감된 암 치료용 조성물을 제공하기 위한 것이다.
It is an object of the present invention to provide a pharmaceutical composition for overcoming tolerance of a target anticancer agent and for enhancing sensitivity to cancer cells and a composition for treating cancer with reduced side effects.

본 발명의 일 실시예에 따르면, 서열번호 1 및 23; 서열번호 2 및 24; 서열번호 3 및 25; 서열번호 4 및 26; 서열번호 5 및 27; 서열번호 6 및 28; 서열번호 7 및 29; 서열번호 8 및 30; 서열번호 9 및 31; 서열번호 10 및 32; 서열번호 11 및 33; 서열번호 12 및 34; 서열번호 13 및 35; 서열번호 14 및 36; 서열번호 15 및 37; 서열번호 16 및 38; 서열번호 17 및 39; 서열번호 18 및 40; 서열번호 19 및 41; 서열번호 20 및 42; 서열번호 21 및 43; 및, 서열번호 22 및 44로 이루어진 군에서 선택되는 적어도 한 쌍의 ANT2(Adenine nucleotide translocator2) 특이적 siRNA를 포함하는 것을 특징으로 하는 표적 항암제 내성 극복을 위한 약학적 조성물이 제공된다.According to one embodiment of the present invention, the nucleotide sequences of SEQ ID NOS: 1 and 23; SEQ ID NOS: 2 and 24; SEQ ID NOS: 3 and 25; SEQ ID NOS: 4 and 26; SEQ ID NOS: 5 and 27; SEQ ID NOS: 6 and 28; SEQ ID NOS: 7 and 29; SEQ ID NOS: 8 and 30; SEQ ID NOS: 9 and 31; SEQ ID NOS: 10 and 32; SEQ ID NOS: 11 and 33; SEQ ID NOS: 12 and 34; SEQ ID NOS: 13 and 35; SEQ ID NOS: 14 and 36; SEQ ID NOS: 15 and 37; SEQ ID NOS: 16 and 38; SEQ ID NOS: 17 and 39; SEQ ID NOS: 18 and 40; SEQ ID NOS: 19 and 41; SEQ ID NOS: 20 and 42; SEQ ID NOS: 21 and 43; And at least one pair of ANT2 (Adenine nucleotide translocator2) -specific siRNA selected from the group consisting of SEQ ID NOs: 22 and 44, is provided.

또한, 상기 표적 항암제는 HER2 표적 항암제일 수 있다.In addition, the target anticancer agent may be a HER2 target anticancer agent.

또한, 상기 HER2 표적 항암제는 트라스투주맙(trastuzumab)일 수 있다.In addition, the HER2 anticancer agent may be trastuzumab.

본 발명의 다른 실시예에 따르면, 서열번호 1 및 23; 서열번호 2 및 24; 서열번호 3 및 25; 서열번호 4 및 26; 서열번호 5 및 27; 서열번호 6 및 28; 서열번호 7 및 29; 서열번호 8 및 30; 서열번호 9 및 31; 서열번호 10 및 32; 서열번호 11 및 33; 서열번호 12 및 34; 서열번호 13 및 35; 서열번호 14 및 36; 서열번호 15 및 37; 서열번호 16 및 38; 서열번호 17 및 39; 서열번호 18 및 40; 서열번호 19 및 41; 서열번호 20 및 42; 서열번호 21 및 43; 및, 서열번호 22 및 44로 이루어진 군에서 선택되는 적어도 한 쌍의 ANT2(Adenine nucleotide translocator2) 특이적 siRNA를 포함하는 것을 특징으로 하는 표적 항암제 내성 극복을 위한 암 치료 보조제가 제공된다.According to another embodiment of the present invention, the nucleotide sequences of SEQ ID NOS: 1 and 23; SEQ ID NOS: 2 and 24; SEQ ID NOS: 3 and 25; SEQ ID NOS: 4 and 26; SEQ ID NOS: 5 and 27; SEQ ID NOS: 6 and 28; SEQ ID NOS: 7 and 29; SEQ ID NOS: 8 and 30; SEQ ID NOS: 9 and 31; SEQ ID NOS: 10 and 32; SEQ ID NOS: 11 and 33; SEQ ID NOS: 12 and 34; SEQ ID NOS: 13 and 35; SEQ ID NOS: 14 and 36; SEQ ID NOS: 15 and 37; SEQ ID NOS: 16 and 38; SEQ ID NOS: 17 and 39; SEQ ID NOS: 18 and 40; SEQ ID NOS: 19 and 41; SEQ ID NOS: 20 and 42; SEQ ID NOS: 21 and 43; And at least one pair of ANT2 (Adenine nucleotide translocator2) -specific siRNA selected from the group consisting of SEQ ID NOs: 22 and 44. The present invention also provides an adjuvant for cancer therapy for overcoming the anticancer drug resistance.

또한, 상기 표적 항암제는 HER2 표적 항암제일 수 있다.In addition, the target anticancer agent may be a HER2 target anticancer agent.

또한, 상기 HER2 표적 항암제는 트라스투주맙(trastuzumab)일 수 있다.In addition, the HER2 anticancer agent may be trastuzumab.

또한, 상기 암은 유방암을 포함할 수 있다.The cancer may also include breast cancer.

본 발명의 또 다른 실시예에 따르면, ANT2(Adenine nucleotide translocator2) 특이적 siRNA; 및 HER2 표적 항암제를 유효성분으로 함유하는 것을 특징으로 하는 암 치료용 조성물이 제공된다.According to another embodiment of the present invention, an siRNA specific for ANT2 (Adenine nucleotide translocator2); And a HER2 target anticancer agent as an active ingredient.

또한, 상기 siRNA는 서열번호 1 및 23; 서열번호 2 및 24; 서열번호 3 및 25; 서열번호 4 및 26; 서열번호 5 및 27; 서열번호 6 및 28; 서열번호 7 및 29; 서열번호 8 및 30; 서열번호 9 및 31; 서열번호 10 및 32; 서열번호 11 및 33; 서열번호 12 및 34; 서열번호 13 및 35; 서열번호 14 및 36; 서열번호 15 및 37; 서열번호 16 및 38; 서열번호 17 및 39; 서열번호 18 및 40; 서열번호 19 및 41; 서열번호 20 및 42; 서열번호 21 및 43; 및, 서열번호 22 및 44로 이루어진 군에서 선택되는 적어도 한 쌍일 수 있다.Also, the siRNA may be selected from the group consisting of SEQ ID NOs: 1 and 23; SEQ ID NOS: 2 and 24; SEQ ID NOS: 3 and 25; SEQ ID NOS: 4 and 26; SEQ ID NOS: 5 and 27; SEQ ID NOS: 6 and 28; SEQ ID NOS: 7 and 29; SEQ ID NOS: 8 and 30; SEQ ID NOS: 9 and 31; SEQ ID NOS: 10 and 32; SEQ ID NOS: 11 and 33; SEQ ID NOS: 12 and 34; SEQ ID NOS: 13 and 35; SEQ ID NOS: 14 and 36; SEQ ID NOS: 15 and 37; SEQ ID NOS: 16 and 38; SEQ ID NOS: 17 and 39; SEQ ID NOS: 18 and 40; SEQ ID NOS: 19 and 41; SEQ ID NOS: 20 and 42; SEQ ID NOS: 21 and 43; And at least one pair selected from the group consisting of SEQ ID NOS: 22 and 44.

또한, 상기 HER2 표적 항암제는 트라스투주맙(trastuzumab)일 수 있다.In addition, the HER2 anticancer agent may be trastuzumab.

또한, 상기 암은 유방암을 포함할 수 있다.
The cancer may also include breast cancer.

본 발명의 일 실시예에 따른 조성물은 HER2/neu 표적 단일클론 항체 및 이와 유사한 표적 항암제에 대한 암세포의 내성을 극복할 수 있다.The composition according to one embodiment of the present invention can overcome the resistance of cancer cells to HER2 / neu target monoclonal antibodies and similar target anticancer agents.

또한, 본 발명의 일 실시예에 따른 조성물은 HER2/neu 표적 단일클론 항체 및 이와 유사한 표적 항암제의 암 세포에 대한 민감성을 증대시킬 수 있다.In addition, the composition according to one embodiment of the present invention can increase the sensitivity of HER2 / neu target monoclonal antibodies and similar target anticancer drugs to cancer cells.

또한, 본 발명의 일 실시예에 따른 조성물은 ANT2 단백질의 발현을 저감시켜 효과적으로 암세포의 세포 사멸을 유도할 뿐만 아니라, 종래 표적 항암제와 병용 투여할 경우 암 치료 효과를 향상시킬 수 있다.
In addition, the composition according to one embodiment of the present invention not only effectively induces apoptosis of cancer cells by reducing the expression of ANT2 protein, but also can improve the cancer treatment effect when it is administered in combination with a conventional anticancer drug.

도 1은 본 발명의 ANT2 siRNA의 ANT2 발현 저감 효과를 유방암 세포에서 측정한 도이고,
도 2는 본 발명의 ANT2 siRNA의 유방암 세포에 대한 세포사멸 효과를 측정한 도이고,
도 3은 본 발명의 ANT2 siRNA 및 허셉틴의 병용사용시 유방암 세포에 대한 세포사멸 효과를 측정한 도이다.
FIG. 1 is a graph showing the effect of the ANT2 siRNA of the present invention on the reduction of ANT2 expression in breast cancer cells,
FIG. 2 is a graph showing the cytotoxic effect of ANT2 siRNA of the present invention on breast cancer cells,
FIG. 3 is a graph showing the cytotoxic effect on breast cancer cells when the ANT2 siRNA of the present invention and Herceptin are used in combination.

본 발명은 ANT2(Adenine nucleotide translocator2) siRNA를 유효성분으로 함유하는 표적 항암제 내성 저해 및 민감성 증진용 약학적 조성물, 및 이를 유효성분으로 함유하는 암 치료용 조성물에 관한 것이다.The present invention relates to a pharmaceutical composition for inhibiting tolerance to a target anticancer drug containing an ANT2 (Adenine nucleotide translocator2) siRNA as an active ingredient and for enhancing sensitivity, and a composition for treating cancer comprising the same as an effective ingredient.

이하, 본 발명에 대해 보다 상세히 설명한다.
Hereinafter, the present invention will be described in more detail.

본 발명의 발명자들은 ANT2의 발현을 저감시키는 경우에 암세포의 생존에 필요한 에너지(ATP) 공급이 원활하지 않게 되고 HSP90이 제 기능을 수행하지 못하여 HER2/neu(HER2)의 발현이 저감되고 분해가 촉진될 것으로 예상하고 실험을 수행하였으며, ANT2에 특이적 결합하는 siRNA를 처리하였을 때 암세포에서 세포 사멸이 유도될 뿐 아니라 HER2/neu 단일클론항체에 대한 내성이 조절되고, HER2/neu 단일클론항체의 암세포에 대한 사멸 효과가 증대되는 것을 확인하여 본 발명을 안출한 것이다.
The inventors of the present invention have found that when the expression of ANT2 is reduced, the supply of energy (ATP) necessary for the survival of cancer cells becomes insufficient, HSP90 fails to function, and the expression of HER2 / neu (HER2) When ANT2-specific siRNA was treated, the cell death was induced in the cancer cells as well as the resistance to the HER2 / neu monoclonal antibody was controlled, and the cancer cells of the HER2 / neu monoclonal antibody The present invention has been made.

상기 ANT2는 포유동물 유래, 바람직하게는 사람 또는 사람과 동일한 계통의 ANT2 및 그의 돌연변이체일 수 있다. 사람과 같은 계통이라 함은 유전자 또는 mRNA가 사람의 ANT2 유전자 또는 mRNA와 80% 이상의 서열 유사성을 가진 다른 포유동물을 말하는 것으로, 구체적으로 사람, 영장류, 설치류 등을 포함할 수 있다.The ANT2 may be ANT2 derived from mammals, preferably a human or a human, and mutants thereof. A human-like line refers to another mammal whose gene or mRNA has more than 80% sequence similarity with a human ANT2 gene or mRNA, and may specifically include humans, primates, rodents, and the like.

본 발명에서 siRNA는 RNA interference (RNAi) 경로를 유발하는 작은 저해 RNA 이중가닥 (small inhibitory RNA duplexes)을 의미한다. 구체적으로, siRNA는 센스 RNA 가닥과 그에 상보적인 안티센스 가닥을 포함하며, 양가닥이 15 내지 30bp, 바람직하게는 19 내지 25bp를 포함하는 RNA 이중 가닥이다. siRNA는 이중가닥 영역을 포함하며 단일 가닥이 헤어핀(hairpin) 또는 stem-loop 구조를 형성하는 구조이거나, 2개의 분리된 가닥의 이중가닥일 수 있다. 센스 RNA 가닥은 표적 유전자의 mRNA 서열의 뉴클레오타이드 서열과 동일한 서열을 가지며, 센스 가닥과 이에 상보적인 안티센스 가닥이 서로 왓슨과 크릭의 상보적인 염기서열 결합에 의해서 이중 가닥을 이룬다. siRNA의 안티센스 가닥은 RISC(RNA-Induced Silencing Complex)에 포집되어 RISC가 안티센스 가닥과 상보적인 목표 mRNA를 확인한 후 절단 또는 번역(translational) 저해를 유도하게 한다. 상기 상보적의 의미는 폴리뉴클레오타이드의 양 가닥이 염기쌍을 형성할 수 있음을 의미한다.In the present invention, siRNA refers to small inhibitory RNA duplexes that cause RNA interference (RNAi) pathway. Specifically, the siRNA comprises a sense RNA strand and an antisense strand complementary thereto, and both strands are RNA double strands containing 15 to 30 bp, preferably 19 to 25 bp. The siRNA may be a structure comprising a double-stranded region and a single strand forming a hairpin or stem-loop structure, or it may be a double strand of two separate strands. The sense RNA strand has the same sequence as the nucleotide sequence of the mRNA sequence of the target gene, and the sense strand and its complementary antisense strand are double-stranded by complementary base sequence combination of Watson and Creek. The antisense strand of the siRNA is captured in an RNA-Induced Silencing Complex (RISC), which allows RISC to induce cleavage or translational inhibition after identifying a target mRNA complementary to the antisense strand. The complementary meaning is that both strands of the polynucleotide can form base pairs.

본 발명에 따른 ANT2 siRNA는 상기 ANT2의 mRNA 또는 cDNA 내부의 연속하는 15 내지 25bp로 이루어진 영역을 표적으로 하며, 서열번호 1 내지 22 및 상기 서열에 상보적인 서열인 서열번호 23 내지 44로 이루어진 군에서 선택된 적어도 한쌍의 서열로 구성된 이중가닥 염기서열이다. 본 발명에서 제공하는 상기 ANT2 siRNA는 ANT2에 대한 서열 특이성이 매우 높아 표적 유전자의 전사체에 특이적으로 상보적 결합하여 RNA 간섭 효율성을 증가시키므로 ANT2의 발현 및 합성 억제 효율이 우수하다.
The ANT2 siRNA according to the present invention targets a region consisting of 15 to 25 bp consecutive in the mRNA or cDNA of the ANT2 and is selected from the group consisting of SEQ ID NOS: 1 to 22 and SEQ ID NOS: 23 to 44 which is a sequence complementary to the above sequence Stranded nucleotide sequence consisting of at least one pair of selected sequences. The ANT2 siRNA provided by the present invention has a very high sequence specificity for ANT2 and specifically binds complementarily to a transcript of a target gene to increase the efficiency of RNA interference, and thus the expression and synthesis inhibition efficiency of ANT2 is excellent.

본 발명의 일 실시예에 따르면, ANT2의 합성 또는 발현을 특이적으로 저해하는 siRNA를 포함하는 조성물이 제공된다. 본 발명의 다른 실시예에서, 상기 ANT2의 합성 또는 발현을 특이적으로 저해하는 siRNA를 포함하는 표적 항암 치료제의 내성 극복 및 민감성 증진용 암 치료 보조제가 제공된다. 본 발명의 또 다른 실시예에서, 상기 ANT2의 합성 또는 발현을 특이적으로 저해하는 siRNA 및 HER2/neu 표적 항암 치료제를 포함하는 암 치료용 조성물이 제공된다.
According to one embodiment of the present invention, there is provided a composition comprising an siRNA that specifically inhibits the synthesis or expression of ANT2. In another embodiment of the present invention, there is provided an adjuvant for cancer therapy for overcoming resistance and sensitivity of a target cancer therapy agent comprising siRNA specifically inhibiting the synthesis or expression of ANT2. In another embodiment of the present invention, there is provided a composition for treating cancer comprising an siRNA and a HER2 / neu target anti-cancer therapeutic agent specifically inhibiting the synthesis or expression of ANT2.

본 발명에 있어 약학적 조성물은 약제학적으로 허용 가능한 담체를 포함할 수 있다. 상기 약제학적으로 허용 가능한 담체는 생리식염수, 폴리에틸렌글리콜, 에탄올, 식물성 오일, 링거액, 덱스트로스 용액, 글리세롤 및 이소프로필미리스테이트 등을 포함할 수 있으며, 이에 한정되지는 않는다. In the present invention, the pharmaceutical composition may comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include, but is not limited to, physiological saline, polyethylene glycol, ethanol, vegetable oil, Ringer's solution, dextrose solution, glycerol and isopropyl myristate.

본 발명의 조성물은 치료용 보조제 등 약제학적 제제로 제조될 수 있다. 본 발명의 약제학적 제제는 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체, 희석제 및 부형제로 이루어진 군에서 선택되는 적어도 하나를 이용하여 제제화 함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수 있다. 상기 제제는 분산제 또는 안정화제를 더 포함할 수 있다.The composition of the present invention may be prepared from a pharmaceutical preparation such as a therapeutic adjuvant. The pharmaceutical preparations of the present invention can be prepared by using at least one selected from the group consisting of pharmaceutically acceptable carriers, diluents and excipients according to a method which can be easily carried out by those having ordinary skill in the art to which the present invention belongs. Or by formulating it into a unit dose form or by inserting it into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules. The formulation may further comprise a dispersant or stabilizer.

필요에 따라, 상기 약제학적 제제는 약제학적으로 허용되는 담체를 더 포함할 수 있다. 상기 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 예를 들면, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일이 있으나 이에 한정되는 것은 아니다.If desired, the pharmaceutical preparation may further comprise a pharmaceutically acceptable carrier. Such pharmaceutically acceptable carriers are those conventionally used in the field of the present invention and include for example lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, But are not limited to, crystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

필요에 따라, 본 발명의 약제학적 제제는 상기 성분들 이외에 당업계에 공지된 첨가물을 더 포함할 수 있다. 예를 들면, 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 희석제, 가용화제, 결합제, 붕해제 및 보존제로 이루어진 군에서 선택되는 적어도 하나를 더 포함할 수 있으나 이에 한정되는 것은 아니다.If desired, the pharmaceutical preparations of the present invention may further contain additives known in the art in addition to the above components. But is not limited to, at least one selected from the group consisting of a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a diluent, a solubilizing agent, a binder, a disintegrating agent and a preservative.

본 발명의 조성물은 목적 조직에 도달할 수 있는 한 투여방법에는 제한이 없다. 예를 들면, 경구 또는 비경구로 투여할 수 있고, 비경구 투여인 경우에는 피부 도포, 직장 주입, 정맥내 주입, 피하 주입, 근육 주입, 복강 주입, 경피 투여 등으로 투여할 수 있다. The composition of the present invention is not limited as long as it can reach the target tissues. For example, it can be administered orally or parenterally. In the case of parenteral administration, it can be administered by skin application, rectal injection, intravenous injection, subcutaneous injection, muscle injection, intraperitoneal injection, transdermal administration or the like.

본 발명의 조성물의 일일 투여량은 투여되는 질환 종류 및 중증도, 환자의 연령 및 성별, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정되며 상기 요소를 모두 고려하여 부작용 없이 최대 효과를 얻을 수 있는 양으로, 당업자에 의해 용이하게 결정될 수 있다. 예를 들면, 약 0.0001 내지 100mg/kg, 바람직하게는 0.001 내지 10mg/kg일 수 있으며, 필요에 따라 상기 투여량을 수회에 나누어 일정시간 간격으로 투여할 수 있다.The daily dose of the composition of the present invention may vary depending on factors such as the type and severity of the disease to be treated, the age and sex of the patient, sensitivity to the drug, administration time, administration route and rate of release, And can be easily determined by those skilled in the art in such an amount that the maximum effect can be obtained without any adverse effect considering all of the factors. For example, it may be about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg, and the dose may be administered in several divided doses at regular intervals.

본 발명의 조성물의 투여 대상 환자는 포유 동물, 바람직하게는 사람, 영장류, 설치류일 수 있다.The subject to which the composition of the present invention is administered may be a mammal, preferably a human, a primate, or a rodent.

본 발명의 조성물을 적용할 수 있는 암은 폐암, 간암, 대장암, 췌장암, 위암, 유방암, 난소암, 신장암, 갑상선암, 식도암, 전립선암 등으로 이루어진 군에서 선택된 적어도 하나일 수 있으며, HER2/neu 발현에 관련된 암종인 것이 바람직하다. 예를 들면, 유방암 또는 위암일 수 있으나 이에 한정되는 것은 아니다. 또한, 본 발명의 조성물을 적용할 수 있는 암은 HER2/neu 표적 항암제에 대한 내성을 가진 암종인 것이 바람직하다. 상기 표적 항암제로는 트라스투주맙, 보다 상세하게는 허셉틴(herceptin) 등이 있으나 이에 한정되는 것은 아니다.
The cancer to which the composition of the present invention can be applied may be at least one selected from the group consisting of lung cancer, liver cancer, colon cancer, pancreatic cancer, gastric cancer, breast cancer, ovarian cancer, kidney cancer, thyroid cancer, neu < / RTI > expression. For example, breast cancer or stomach cancer. Also, it is preferable that the cancer to which the composition of the present invention can be applied is a carcinoma having resistance to HER2 / neu target anticancer drug. Examples of the anticancer agent include but are not limited to trastuzumab, more specifically, herceptin.

이하, 본 발명의 이해를 돕기 위하여 본 발명을 하기 실시예에 의거하여 좀 더 상세하게 설명한다. 단, 이들 실시예는 본 발명을 예시하는 것일 뿐 첨부된 특허청구범위를 제한하는 것이 아니며, 본 발명의 범주 및 기술사상 범위 내에서 실시예에 대한 다양한 변경 및 수정이 가능함은 당업자에게 있어서 명백한 것이며, 이러한 변형 및 수정이 첨부된 특허청구범위에 속하는 것도 당연한 것이다.
BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in more detail with reference to the following examples. It will be apparent to those skilled in the art that these embodiments are illustrative of the present invention and are not intended to limit the scope of the appended claims and that various changes and modifications may be made to the embodiments within the scope and spirit of the invention , And it is natural that such variations and modifications fall within the scope of the appended claims.

실시예Example

<ANT2 siRNA의 제작><Preparation of ANT2 siRNA>

ANT2 siRNA를 제작하기 위하여 우선 Genebank Accession No. NM_001152의 ANT2 mRNA 염기서열(SLC25A5)을 미국 국립생명공학정보센터(Nationanl Center for Biotechnology Information, NCBI, http://www.ncbi.nlm.nih.gov/)로부터 입수하였다. 이 염기서열을 siRNA 예측 프로그램(http://www.ambion.com/technical, resources/siRNA target finder)에 대입하여 적합한 ANT2 siRNA 후보 염기서열을 확보하였다. 후보 염기서열에 기초한 센스 및 안티센스 서열로 구성된 이중가닥 염기서열은 한국의 Bioneer사에 합성을 의뢰하여 제조하였으며, ANT2 mRNA의 감소 효과를 세포수준(in vitro)에서 확인하여 최종으로 ANT2의 발현을 저감시키는 서열번호 1 내지 22로 구성된 22개의 센스서열 및 그에 상보적인 서열번호 23 내지 44로 구성된 22개의 안티센스서열로 이루어진 22쌍의 ANT2 siRNA를 얻었다. 본 발명에 따른 ANT2 siRNA는 하기 표 1에 정리하였다.
To prepare ANT2 siRNA, The ANT2 mRNA sequence (SLC25A5) of NM_001152 was obtained from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/). This nucleotide sequence was assigned to the siRNA prediction program (http://www.ambion.com/technical, resources / siRNA target finder) to obtain a suitable ANT2 siRNA candidate sequence. The double-stranded nucleotide sequence consisting of sense and antisense sequences based on the candidate nucleotide sequence was prepared by requesting synthesis from Bioneer, Korea, and the reduction effect of ANT2 mRNA was confirmed at the cell level (in vitro) to finally reduce the expression of ANT2 22 pairs of ANT2 siRNAs consisting of 22 sense sequences consisting of SEQ ID NOS: 1 to 22 and 22 antisense sequences consisting of SEQ ID Nos. 23 to 44 complementary thereto were obtained. The ANT2 siRNA according to the present invention is summarized in Table 1 below.

siRNA 표시siRNA display 센스서열Sense sequence 안티센스서열Antisense sequence 서열번호SEQ ID NO: 상세염기서열(5'→3')Detailed nucleotide sequence (5 'to 3') 서열번호SEQ ID NO: 상세염기서열(5'→3')Detailed nucleotide sequence (5 'to 3') ANT2 siRNA #1ANT2 siRNA # 1 1One GCAAUACAAAGGCAUUAUAUUGCAAUACAAAGGCAUUAUAUU 2323 UAUAAUGCCUUUGUAUUGCUUUAUAAUGCCUUUGUAUUGCUU ANT2 siRNA #2ANT2 siRNA # 2 22 CCAAUGUCAUCAGAUACUUUUCCAAUGUCAUCAGAUACUUUU 2424 AAGUAUCUGAUGACAUUGGUUAAGUAUCUGAUGACAUUGGUU ANT2 siRNA #3ANT2 siRNA # 3 33 UUAACUUCGCUUCAAAGAUUUUAACUUCGCUUCAAAGAUU 2525 UCUUUGAAGGCGAAGUUAAUUUCUUUGAAGGCGAAGUUAAUU ANT2 siRNA #4ANT2 siRNA # 4 44 UAACUUCGCCUUCAAGAUUUUAACUUCGCCUUCAAGAUUU 2626 AUCUUUGAAGGCGAAGUUAUUAUCUUUGAAGGCGAAGUUAUU ANT2 siRNA #5ANT2 siRNA # 5 55 CCUUCAAAGAUAAAUACAAUUCCUUCAAAGAUAAAUACAAUU 2727 UUGUAUUUAUCUUUGAAGGUUUUGUAUUUAUCUUUGAAGGUUU ANT2 siRNA #6ANT2 siRNA # 6 66 CUGGUUAAGAUCUACAAAUUUCUGGUUAAGAUCUACAAAUUU 2828 AUUUUGUAGAUCUUAACCAGUUAUUUUGUAGAUCUUAACCAGUU ANT2 siRNA #7ANT2 siRNA # 7 77 GGUUAAGAUCUACAAAUCUUUGGUUAAGAUCUACAAAUCUUU 2929 AGAUUUUGUAGAUCUUAACCUUAGAUUUUGUAGAUCUUAACCUU ANT2 siRNA #8ANT2 siRNA # 8 88 CCUACUUCGGUAUCUAUGAUUCCUACUUCGGUAUCUAUGAUU 3030 UCAUAGAUACCGAAGUAGGUUUCAUAGAUACCGAAGUAGGUU ANT2 siRNA #9ANT2 siRNA # 9 99 GUUGACUUCCUAUCCAUUUUUGUUGACUUCCUAUCCAUUUUU 3131 AAAUGGAUAGGAAGUCAACUUAAAUGGAUAGGAAGUCAACUU ANT2 siRNA #10ANT2 siRNA # 10 1010 GUCUUGUAUGAUGAAAUCAUUGUCUUGUAUGAUGAAAUCAUU 3232 UGAUUUCAUCAUACAAGACUUUGAUUUCAUCAUACAAGACUU ANT2 siRNA #11ANT2 siRNA # 11 1111 GAUGAAAUCAAGAAGUACAUUGAUGAAAUCAAGAAGUACAUU 3333 UGUACUUCUUGAUUUCAUCUUUGUACUUCUUGAUUUCAUCUUU ANT2 siRNA #12ANT2 siRNA # 12 1212 AAAUCAAGAAGUACACAUAUUAAAUCAAGAAGUACACAUAUU 3434 UAUGUGUACUUCUUGAUUUUUUAUGUGUACUUCUUGAUUUUU ANT2 siRNA #13ANT2 siRNA # 13 1313 CAAGAAGUACACAUAAGUUUUCAAGAAGUACACAUAAGUUUU 3535 AACUUAUGUGUACUUCUUGUUAACUUAUGUGUACUUCUUGUU ANT2 siRNA #14ANT2 siRNA # 14 1414 GAAGUACACAUAAGUUAUUUUGAAGUACACAUAAGUUAUUUU 3636 AAUAACUUAUGUGUACUUCUUAAUAACUUAUGUGUACUUCUU ANT2 siRNA #15ANT2 siRNA # 15 1515 ACACAUAAGUUAUUUCCUAUUACACAUAAGUUAUUUCCUAUU 3737 UAGGAAAUAACUUAUGUGUUUUAGGAAAUAACUUAUGUGUUU ANT2 siRNA #16ANT2 siRNA # 16 1616 CAUGUUGUAUUAUAUAACAUUCAUGUUGUAUUAUAUAACAUU 3838 UGUUAUAUAAUACAACAUGUUUGUUAUAUAAUACAACAUGUU ANT2 siRNA #17ANT2 siRNA # 17 1717 GUUGUAUUAUAUAACAUAUUUGUUGUAUUAUAUAACAUAUUU 3939 AUAUGUUAUAUAAUACAACUUAUAUGUUAUAUAAUACAACUU ANT2 siRNA #18ANT2 siRNA # 18 1818 GUAUUAUAUAACAUAUCUUUUGUAUUAUAUAACAUAUCUUUU 4040 AAGAUAUGUUAUAUAAUACUUAAGAUAUGUUAUAUAAUACUU ANT2 siRNA #19ANT2 siRNA # 19 1919 GAAGCAAUAAUAUUCAUCUUUGAAGCAAUAAUAUUCAUCUUU 4141 AGAUGAAUAUUAUUGCUUCUUAGAUGAAUAUUAUUGCUUCUU ANT2 siRNA #20ANT2 siRNA # 20 2020 CUCUUAAAGCCAUUUCCAUUUCUCUUAAAGCCAUUUCCAUUU 4242 AUGGAAAUGGCUUUAAGAGUUAUGGAAAUGGCUUUAAGAGUU ANT2 siRNA #21ANT2 siRNA # 21 2121 CCUGAUAAAUAACAAAUUUUUCCUGAUAAAUAACAAAUUUUU 4343 AAAUUUGUUAUUUAUCAGGUUAAAUUUGUUAUUUAUCAGGUU ANT2 siRNA #22ANT2 siRNA # 22 2222 GCUACAUUCGAAUAAAUACUUGCUACAUUCGAAUAAAUACUU 4444 GUAUUUAUUCGAAUGUAGCUUGUAUUUAUUCGAAUGUAGCUU

<ANT2 siRNA의 ANT2 발현 저하 효과 확인><Confirmation of ANT2 expression-lowering effect of ANT2 siRNA>

상기 22쌍의 ANT2 siRNA의 세포수준에서의 ANT2 mRNA의 발현 저하 효과는 ANT2 siRNA를 인간 유방암 세포주인 MDA-MB-231에 도입하고 24시간 후 total RNA로 qRT-PCR을 수행하여 ANT2의 발현양상을 측정하여 확인하였다.The ANT2 mRNA expression level of the 22 pairs of ANT2 siRNA was lowered by the addition of ANT2 siRNA to MDA-MB-231, a human breast cancer cell line, by qRT-PCR with total RNA after 24 hours, Respectively.

MDA-MB-231 세포주는 10% FBS 및 1% 항생제가 첨가된 DMEM배지를 이용하였으며 37℃, 5% CO2 환경 조건 하에 배양한 것을 이용하였다. 항생제로는 100ug/ml 농도의 페니실린 및 100ug/ml 농도의 스트렙토마이신을 첨가하였다.MDA-MB-231 cells were cultured in DMEM medium supplemented with 10% FBS and 1% antibiotic and cultured at 37 ° C and 5% CO 2 . As antibiotics, 100 ug / ml of penicillin and 100 ug / ml of streptomycin were added.

ANT2 siRNA의 MDA-MB-231세포주 내 도입은 비바이러스성 전달체인 LipofectamineTM2000(Invitrogen)을 이용하였다. 유방암 세포주인 MDA-MB-231을 6wells-plate에 웰당 5x105cells(60~70% confluency)로 준비한 뒤, 24시간 후에 ANT2 siRNA # 1내지 #22 샘플별로 ANT2 siRNA 100nM, LipofectamineTM2000 6ul를 잘 섞어 10분간 보관 후 준비된 세포주에 골고루 뿌려주었다. 이 때 LipofectamineTM2000 복합체 형성과 세포로의 도입을 최대화하기 위해, 세포 배양액으로서 10% FBS와 항생제가 포함된 complete DMEM 배지가 아닌 최소 성장배지인 opti-MEM를 사용하여 37℃, 5% CO2 환경 조건 하에 24시간 배양하였다. 음성 대조군으로는 ANT2 발현을 차단하지 못하고 또한 세포내 특정 mRNA의 발현에 영향을 끼치지 않는 스크램블(scrambled) siRNA(Ambion사)를 처리하였다.The introduction of ANT2 siRNA into the MDA-MB-231 cell line was performed using Lipofectamine 2000 (Invitrogen), a nonviral delivery vehicle. MDA-MB-231, a breast cancer cell line, was prepared at 5 × 10 5 cells / well (60-70% confluency) on a 6 wells plate. After 24 hours, ANT2 siRNAs # 1 to # 22 were treated with 100 nM of ANT2 siRNA and 6 ul of Lipofectamine 2000 After mixing for 10 minutes, the cells were evenly distributed on the prepared cell line. To maximize the formation of Lipofectamine TM 2000 complexes and introduction into cells, the cells were cultured in opti-MEM medium supplemented with 10% FBS and complete DMEM medium containing antibiotics at 37 ° C and 5% CO 2 And cultured under environmental conditions for 24 hours. As a negative control, scrambled siRNA (Ambion), which did not block ANT2 expression and did not affect the expression of specific mRNA in cells, was treated.

24시간 배양후 ANT2 siRNA 또는 스크램블 siRNA가 도입된 세포주에 Trizol(Invitrogen)을 처리하여 total RNAs를 분리하고 RT-qPCR kit(Promega)을 이용하여 실시간 역전사 중합효소 증폭법(RT-qPCR; real-time reverse transcription-polymerase chain reaction)을 실시하였다. 이후, 역전사 반응으로부터 얻어진 cDNA를 주형으로 하여 ANT2의 프라이머와 SYBR mixture를 이용하여 중합효소 증폭법을 수행하였다(35cycle; 94℃ 1분, 55℃ 1분, 72℃, 2분). 독립적인 실험을 3회 반복하여 평균값을 계산하고 동일한 양의 RNA가 사용되었음을 확인하기 위해서 house keeping 유전자인 GAPDH의 발현 양으로 결과값을 보정하였다. ANT2 프라이머는 서열번호 45 및 46의 염기서열로 이루어진 것을 이용하고 GAPDH 프라이머는 서열번호 47 및 48의 염기서열로 이루어진 것을 이용하였다. 그 결과는 도 1에 도시하였다. 도 1에서 ANT2 유전자 발현의 상대적인 변화량(ANT2 Reduction(%))은 하기 공식에 따라 계산하였으며, 데이터는 fold upregulation/downregulation을 나타낸다.
After culturing for 24 hours, total RNAs were isolated by treating Trizol (Invitrogen) with ANT2 siRNA or scrambled siRNA, and RT-qPCR (real-time PCR) using RT-qPCR kit (Promega) reverse transcription-polymerase chain reaction). PCR amplification was then carried out using the primer of ANT2 and the SYBR mixture (35 cycles: 94 ° C for 1 min, 55 ° C for 1 min, 72 ° C for 2 min) using the cDNA obtained from the reverse transcription reaction as a template. Independent experiments were repeated three times to calculate the mean value and the results were corrected for the amount of expression of the house keeping gene, GAPDH, to confirm that the same amount of RNA was used. The ANT2 primer was composed of the nucleotide sequence of SEQ ID NOs: 45 and 46, and the GAPDH primer was composed of the nucleotide sequence of SEQ ID NOs: 47 and 48. The results are shown in Fig. In Figure 1, the relative change in ANT2 gene expression (ANT2 Reduction (%)) was calculated according to the following formula and the data indicates fold upregulation / downregulation.

[수학식 1] fold change = 2-ΔΔCt, Fold change = 2 -? Ct,

(여기서, ΔΔCt = (Ct of gene of interest, treated -Ct of HK gene, treated) - (Ct of gene of interest, control -Ct of HK gene, control)이고,(Ct of gene of interest, Ct of HK gene, treated) - (Ct of gene of interest, Ct of HK gene, control)

Ct는 threshold cycle number이고,Ct is the threshold cycle number,

HK house-keeping gene이다.)
HK house-keeping gene.)

도 1을 참고하면, 본 발명의 22쌍 ANT2 siRNA는 암세포에서 ANT2 mRNA의 발현을 높은 수준으로 억제하는 것을 확인할 수 있다.
Referring to FIG. 1, it can be confirmed that the 22-pair ANT2 siRNA of the present invention suppresses the expression of ANT2 mRNA to a high level in cancer cells.

<암세포에 대한 ANT2 siRNA의 세포사멸 효과 확인><Confirmation of the apoptotic effect of ANT2 siRNA on cancer cells>

본 발명의 22쌍 ANT2 siRNA의 암세포에 대한 세포사멸 효과는 인간 유방암 세포주인 MDA-MB-231을 대상으로 확인하였다. 96 wells에 웰당 5x104로 MDA-MB-231 세포를 시딩하고, 상기 세포주에 ANT2 siRNA # 1 내지 #22 샘플별로 ANT2 siRNA를 도입하여 48시간 배양한 후 CCK-8 assay를 이용하여 세포 사멸 수준을 분석하였다. 음성 대조군으로는 스크램블 siRNA(Ambion사)를 도입한 것을 이용하였다. 사포 사멸도는 음성 대조군에서의 세포 생존률을 100으로 하여 ANT2 siRNA를 처리한 실험군의 상대적인 생존률을 계산하여 측정하였다. 샘플별로 독립적인 실험을 3회 반복하여 평균값을 계산하고 그 결과를 도 2에 도시하였다.The cytotoxic effect of the 22-pair ANT2 siRNA of the present invention on the cancer cells was confirmed in the human breast cancer cell line MDA-MB-231. MDA-MB-231 cells were seeded in 96 wells at 5 × 10 4 cells per well and ANT2 siRNAs # 1 to # 22 were introduced into the cell line for ANT2 siRNAs for 48 hours. Cell death was then measured using the CCK-8 assay Respectively. As the negative control group, scramble siRNA (Ambion) was used. The degree of saprophytic cell death was measured by calculating the relative survival rate of the ANT2 siRNA treated group with a cell viability of 100 in the negative control group. An independent experiment was repeated three times to calculate an average value, and the results are shown in FIG.

도 2를 참고하면, 본 발명의 22쌍 ANT2 siRNA는 암세포에서 높은 수준의 세포사멸을 유도하는 것을 확인할 수 있다.
Referring to FIG. 2, it can be confirmed that the 22-pair ANT2 siRNA of the present invention induces a high level of cell death in cancer cells.

<표적 항암제에 내성을 갖는 암세포에 대한 ANT2 siRNA의 세포사멸 효과 및 표적 항암제와 병용시 암세포의 세포사멸 증진효과 확인><Determination of the apoptotic effect of ANT2 siRNA on cancer cells resistant to the target anticancer agent and the effect of enhancing the apoptosis of cancer cells in combination with the target anticancer agent>

유방암의 치료에 사용되는 표적 항암제 중 HER2/neu를 표적으로 하는 허셉틴(herceptin)에 대한 치료 반응성이 매우 낮은 세포주인 인간 유방암 세포주 Jimt-1을 대상으로 본 발명의 ANT2 siRNA의 세포사멸 효과, 표적 항암제의 내성극복 효과 및 표적 항암제와 병용시의 세포사멸 증진효과를 확인하였다.The human breast cancer cell line Jimt-1, which is a cell line with a very low therapeutic response to HER2 / neu-targeted herceptin, is used for the treatment of breast cancer. The cell death kills the ANT2 siRNA of the present invention, And the effect of enhancing apoptosis in combination with the anticancer agent was confirmed.

인간 유방암 세포주 Jimt-1의 배양은 MDA-MB-231과 동일한 배지에서 동일한 환경조건으로 배양하였다. Jimt-1로의 ANT2 siRNA의 도입은 상기 기술한 MDA-MB-231세포주를 대상으로 한 실험과 동일하게 LipofectamineTM2000(Invitrogen)을 이용하여 수행하였다. 표적 항암제 내성 암세포주에 대한 ANT2 siRNA의 세포사멸 효과 확인을 위한 샘플은 ANT2 siRNA 100nM만을 도입하여 48시간 배양하고, Jimt-2의 허셉틴 내성 확인은 허셉틴 100ug/ml만을 처리하여 48시간 배양하였다. ANT2 siRNA 및 허셉틴 병용시의 사포사멸 증진 효과 확인을 위한 샘플은 ANT2 siRNA 100nM 도입하여 24시간 배앙한 후 허셉틴 100ug/ml을 처리하고 24시간 추가 배양하였다. 음성 대조군으로 스크램블 siRNA(Ambion사)를 도입한 것을 이용하였다. 사포 사멸도는 음성 대조군에서의 세포 생존률을 100으로 하여 각 실험군의 상대적인 생존률을 계산하여 측정하였다. 샘플별로 독립적인 실험을 3회 반복하여 평균값을 계산하고 그 결과를 도 3에 도시하였다.Cultures of human breast cancer cell line Jimt-1 were cultured in the same medium as MDA-MB-231 under the same environmental conditions. The introduction of ANT2 siRNA into Jimt-1 was carried out using Lipofectamine TM 2000 (Invitrogen) as in the MDA-MB-231 cell line described above. To confirm the apoptotic effect of ANT2 siRNA on the anti-cancer drug resistant cancer cell line, only 100 nM of ANT2 siRNA was introduced and cultured for 48 hours. Herceptin resistance of Jimt-2 was confirmed by treating with 100 ug / ml of Herceptin only for 48 hours. Samples for confirming the effect of saponin-killing on ANT2 siRNA and Herceptin were incubated with 100 nM of ANT2 siRNA for 24 hours and treated with 100 ug / ml of Herceptin and further cultured for 24 hours. And a scrambled siRNA (Ambion) was introduced as a negative control group. The degree of saprophytic cell death was measured by calculating the relative survival rate of each experimental group with a cell viability of 100 in the negative control group. An independent experiment was repeated three times for each sample to calculate an average value, and the results are shown in FIG.

도 3을 참고하면, HER2/neu 표적 항암제에 내성을 가진 암세포에 대하여 ANT2 siRNA가 높은 사멸 효과를 나타내는 것을 확인할 수 있다. 또한, ANT2 siRNA 및 HER2/neu 표적 항암제를 병용 처리할 경우 ANT2 siRNA를 단독으로 처리한 실험군에 비교하여 암세포의 세포 사멸 효과가 유의적으로 뚜렷하게 증가하였다. 상기 결과를 참고하면, HER2/neu 단일클론항체에 대한 내성을 갖는 암세포에서 ANT2 siRNA를 이용하여 ANT2의 발현을 저감시키는 경우에 HER2/neu 단백질의 발현저감 및 이로 인한 세포 내 신호전달을 약화시켜, 결과적으로 HER2/neu 단일클론항체에 의한 세포내 신호 전달 체계의 약화 효과를 극대화시킴으로써, ANT2 siRNA를 HER2/neu 단일클론항체와 병용하는 경우 암세포의 HER2/neu 단일클론항체에 대한 내성을 극복하고 민감성을 증대시킬 수 있는 효과를 나타내는 것을 확인할 수 있다. 또한, ANT2 siRNA로 유도되는 HER2/neu 발현저감은 트라스투주맙으로 유도되는 HER2/neu 발현저감과 상이한 기전으로, ANT2 siRNA 및 트라스투주맙을 병용하는 암의 치료는 기전상 이점을 가져 시너지 효과를 보이므로 암 치료에 보다 효과적이다.Referring to FIG. 3, it can be confirmed that ANT2 siRNA shows a high killing effect on cancer cells resistant to HER2 / neu target anticancer drug. In addition, when combined with ANT2 siRNA and HER2 / neu target anticancer agent, the cytotoxic effect of cancer cells was significantly increased compared to the group treated with ANT2 siRNA alone. The above results indicate that when ANT2 expression is reduced by using ANT2 siRNA in cancer cells having resistance to HER2 / neu monoclonal antibody, expression of HER2 / neu protein is reduced and intracellular signal transduction is weakened, As a result, by maximizing the weakening effect of HER2 / neu monoclonal antibody on the intracellular signal transduction system, ANT2 siRNA can be used in combination with HER2 / neu monoclonal antibody to overcome the resistance of cancer cells to HER2 / neu monoclonal antibody, Can be increased. In addition, the reduction of HER2 / neu expression induced by ANT2 siRNA is a different mechanism from the reduction of HER2 / neu expression induced by trastuzumab, and the treatment of cancer using ANT2 siRNA and trastuzumab has a synergistic effect It is more effective for cancer treatment because it is visible.

<110> Bioinfra Inc. <120> COMPOSITION FOR OVERCOMING RESISTANCE TO HER2 INHIBITOR COMPRISING ANT2 SIRNA <150> KR 14/006035 <151> 2014-01-17 <160> 48 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 1 gcaauacaaa ggcauuauau u 21 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 2 ccaaugucau cagauacuuu u 21 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 3 uuaacuucgc uucaaagauu 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 4 uaacuucgcc uucaagauuu 20 <210> 5 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 5 ccuucaaaga uaaauacaau u 21 <210> 6 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 6 cugguuaaga ucuacaaauu u 21 <210> 7 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 7 gguuaagauc uacaaaucuu u 21 <210> 8 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 8 ccuacuucgg uaucuaugau u 21 <210> 9 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 9 guugacuucc uauccauuuu u 21 <210> 10 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 10 gucuuguaug augaaaucau u 21 <210> 11 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 11 gaugaaauca agaaguacau u 21 <210> 12 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 12 aaaucaagaa guacacauau u 21 <210> 13 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 13 caagaaguac acauaaguuu u 21 <210> 14 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 14 gaaguacaca uaaguuauuu u 21 <210> 15 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 15 acacauaagu uauuuccuau u 21 <210> 16 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 16 cauguuguau uauauaacau u 21 <210> 17 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 17 guuguauuau auaacauauu u 21 <210> 18 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 18 guauuauaua acauaucuuu u 21 <210> 19 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 19 gaagcaauaa uauucaucuu u 21 <210> 20 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 20 cucuuaaagc cauuuccauu u 21 <210> 21 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 21 ccugauaaau aacaaauuuu u 21 <210> 22 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 22 gcuacauucg aauaaauacu u 21 <210> 23 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 23 uauaaugccu uuguauugcu u 21 <210> 24 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 24 aaguaucuga ugacauuggu u 21 <210> 25 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 25 ucuuugaagg cgaaguuaau u 21 <210> 26 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 26 aucuuugaag gcgaaguuau u 21 <210> 27 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 27 uuguauuuau cuuugaaggu u 21 <210> 28 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 28 auuuuguaga ucuuaaccag uu 22 <210> 29 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 29 agauuuugua gaucuuaacc uu 22 <210> 30 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 30 ucauagauac cgaaguaggu u 21 <210> 31 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 31 aaauggauag gaagucaacu u 21 <210> 32 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 32 ugauuucauc auacaagacu u 21 <210> 33 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 33 uguacuucuu gauuucaucu u 21 <210> 34 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 34 uauguguacu ucuugauuuu u 21 <210> 35 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 35 aacuuaugug uacuucuugu u 21 <210> 36 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 36 aauaacuuau guguacuucu u 21 <210> 37 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 37 uaggaaauaa cuuauguguu u 21 <210> 38 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 38 uguuauauaa uacaacaugu u 21 <210> 39 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 39 auauguuaua uaauacaacu u 21 <210> 40 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 40 aagauauguu auauaauacu u 21 <210> 41 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 41 agaugaauau uauugcuucu u 21 <210> 42 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 42 auggaaaugg cuuuaagagu u 21 <210> 43 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 43 aaauuuguua uuuaucaggu u 21 <210> 44 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 44 guauuuauuc gaauguagcu u 21 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for ANT2 <400> 45 ccgcagcgcc gtagtcaaa 19 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for ANT2 <400> 46 agtctgtcaa gaatgctcaa 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for GAPDH <400> 47 accacagtcc atgccatcac 20 <210> 48 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for GAPDH <400> 48 tccaccaccc tgttgctgt 19 <110> Bioinfra Inc. <120> COMPOSITION FOR OVERCOMING RESISTANCE TO HER2 INHIBITOR          COMPRISING ANT2 SIRNA <150> KR 14/006035 <151> 2014-01-17 <160> 48 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 1 gcaauacaaa ggcauuauau u 21 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 2 ccaaugucau cagauacuuu u 21 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 3 uuaacuucgc uucaaagauu 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 4 uaacuucgcc uucaagauuu 20 <210> 5 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 5 ccuucaaaga uaaauacaau u 21 <210> 6 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 6 cugguuaaga ucuacaaauu u 21 <210> 7 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 7 gguuaagauc uacaaaucu u 21 <210> 8 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 8 ccuacuucgg uaucuaugau u 21 <210> 9 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 9 guugacuucc uauccauuuu u 21 <210> 10 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 10 gucuuguaug augaaaucau u 21 <210> 11 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 11 gaugaaauca agaaguacau u 21 <210> 12 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 12 aaaucaagaa guacacauau u 21 <210> 13 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 13 caagaaguac acauaaguuu u 21 <210> 14 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 14 gaaguacaca uaaguuauuu u 21 <210> 15 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 15 acacauaagu uauuuccuau u 21 <210> 16 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 16 cauguuguau uauauaacau u 21 <210> 17 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 17 guuguauuau auaacauauu u 21 <210> 18 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 18 guauuauaua acauaucuuu u 21 <210> 19 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 19 gaagcaauaa uauucaucuu u 21 <210> 20 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 20 cucuuaaagc cauuuccauu u 21 <210> 21 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 21 ccugauaaau aacaaauuuu u 21 <210> 22 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Sense sequence of ANT2 siRNA <400> 22 gcuacauucg aauaaauacu u 21 <210> 23 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 23 uauaaugccu uuguauugcu u 21 <210> 24 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 24 aaguaucuga ugacauuggu u 21 <210> 25 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 25 ucuuugaagg cgaaguuaau u 21 <210> 26 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 26 aucuuugaag gcgaaguuau u 21 <210> 27 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 27 uuguauuuau cuuugaaggu u 21 <210> 28 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 28 auuuuguaga ucuuaaccag uu 22 <210> 29 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 29 agauuuugua gaucuuaacc uu 22 <210> 30 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 30 ucauagauac cgaaguaggu u 21 <210> 31 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 31 aaauggauag gaagucaacu u 21 <210> 32 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 32 ugauuucauc auacaagacu u 21 <210> 33 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 33 uguacuucuu gauuucaucu u 21 <210> 34 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 34 uauguguacu ucuugauuuu u 21 <210> 35 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 35 aacuuaugug uacuucuugu u 21 <210> 36 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 36 aauaacuuau guguacuucu u 21 <210> 37 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 37 uaggaaauaa cuuauguguu u 21 <210> 38 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 38 uguuauauaa uacaacaugu u 21 <210> 39 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 39 auauguuaua uaauacaacu u 21 <210> 40 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 40 aagauauguu auauaauacu u 21 <210> 41 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 41 agaugaauau uauugcuu u 21 <210> 42 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 42 auggaaaugg cuuuaagagu u 21 <210> 43 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 43 aaauuuguua uuuaucaggu u 21 <210> 44 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Anti-sense sequence of ANT2 siRNA <400> 44 guauuuauuc gaauguagcu u 21 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for ANT2 <400> 45 ccgcagcgcc gtagtcaaa 19 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for ANT2 <400> 46 agtctgtcaa gaatgctcaa 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for GAPDH <400> 47 accacagtcc atgccatcac 20 <210> 48 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for GAPDH <400> 48 tccaccaccc tgttgctgt 19

Claims (11)

서열번호 1 및 23; 서열번호 2 및 24; 서열번호 3 및 25; 서열번호 4 및 26; 서열번호 5 및 27; 서열번호 6 및 28; 서열번호 7 및 29; 서열번호 8 및 30; 서열번호 9 및 31; 서열번호 10 및 32; 서열번호 11 및 33; 서열번호 12 및 34; 서열번호 13 및 35; 서열번호 14 및 36; 서열번호 15 및 37; 서열번호 16 및 38; 서열번호 17 및 39; 서열번호 18 및 40; 서열번호 19 및 41; 서열번호 20 및 42; 서열번호 21 및 43; 및, 서열번호 22 및 44로 이루어진 군에서 선택되는 적어도 한 쌍의 ANT2(Adenine nucleotide translocator2) 특이적 siRNA를 포함하는 것을 특징으로 하는 표적 항암제 내성 극복을 위한 약학적 조성물.
SEQ ID NOS: 1 and 23; SEQ ID NOS: 2 and 24; SEQ ID NOS: 3 and 25; SEQ ID NOS: 4 and 26; SEQ ID NOS: 5 and 27; SEQ ID NOS: 6 and 28; SEQ ID NOS: 7 and 29; SEQ ID NOS: 8 and 30; SEQ ID NOS: 9 and 31; SEQ ID NOS: 10 and 32; SEQ ID NOS: 11 and 33; SEQ ID NOS: 12 and 34; SEQ ID NOS: 13 and 35; SEQ ID NOS: 14 and 36; SEQ ID NOS: 15 and 37; SEQ ID NOS: 16 and 38; SEQ ID NOS: 17 and 39; SEQ ID NOS: 18 and 40; SEQ ID NOS: 19 and 41; SEQ ID NOS: 20 and 42; SEQ ID NOS: 21 and 43; And at least one pair of ANT2 (Adenine nucleotide translocator2) -specific siRNA selected from the group consisting of SEQ ID NOs: 22 and 44. The pharmaceutical composition for overcoming the anticancer drug resistance.
제 1항에 있어서, 상기 표적 항암제는 HER2 표적 항암제인 것을 특징으로 하는 표적 항암제 내성 극복을 위한 약학적 조성물.
The pharmaceutical composition for overcoming anticancer drug resistance according to claim 1, wherein the target anticancer agent is a HER2 target anticancer agent.
제 2 항에 있어서, 상기 HER2 표적 항암제는 트라스투주맙(trastuzumab)인 것을 특징으로 하는 표적 항암제 내성 극복을 위한 약학적 조성물.
3. The pharmaceutical composition according to claim 2, wherein the HER2 antitumor agent is trastuzumab.
서열번호 1 및 23; 서열번호 2 및 24; 서열번호 3 및 25; 서열번호 4 및 26; 서열번호 5 및 27; 서열번호 6 및 28; 서열번호 7 및 29; 서열번호 8 및 30; 서열번호 9 및 31; 서열번호 10 및 32; 서열번호 11 및 33; 서열번호 12 및 34; 서열번호 13 및 35; 서열번호 14 및 36; 서열번호 15 및 37; 서열번호 16 및 38; 서열번호 17 및 39; 서열번호 18 및 40; 서열번호 19 및 41; 서열번호 20 및 42; 서열번호 21 및 43; 및, 서열번호 22 및 44로 이루어진 군에서 선택되는 적어도 한 쌍의 ANT2(Adenine nucleotide translocator2) 특이적 siRNA를 포함하는 것을 특징으로 하는 표적 항암제 내성 극복을 위한 암 치료 보조제.
SEQ ID NOS: 1 and 23; SEQ ID NOS: 2 and 24; SEQ ID NOS: 3 and 25; SEQ ID NOS: 4 and 26; SEQ ID NOS: 5 and 27; SEQ ID NOS: 6 and 28; SEQ ID NOS: 7 and 29; SEQ ID NOS: 8 and 30; SEQ ID NOS: 9 and 31; SEQ ID NOS: 10 and 32; SEQ ID NOS: 11 and 33; SEQ ID NOS: 12 and 34; SEQ ID NOS: 13 and 35; SEQ ID NOS: 14 and 36; SEQ ID NOS: 15 and 37; SEQ ID NOS: 16 and 38; SEQ ID NOS: 17 and 39; SEQ ID NOS: 18 and 40; SEQ ID NOS: 19 and 41; SEQ ID NOS: 20 and 42; SEQ ID NOS: 21 and 43; And at least one pair of ANT2 (Adenine nucleotide translocator2) -specific siRNA selected from the group consisting of SEQ ID NOs: 22 and 44. The cancer therapeutic aid for overcoming the anticancer drug resistance.
제 4항에 있어서, 상기 표적 항암제는 HER2 표적 항암제인 것을 특징으로 하는 표적 항암제 내성 극복을 위한 암 치료 보조제.
5. The cancer therapeutic aid for overcoming anticancer drug resistance according to claim 4, wherein the target anticancer agent is a HER2 target anticancer agent.
제 5항에 있어서, 상기 HER2 표적 항암제는 트라스투주맙(trastuzumab)인 것을 특징으로 하는 표적 항암제 내성 극복을 위한 암 치료 보조제.
[Claim 5] The method according to claim 5, wherein the HER2 anticancer agent is trastuzumab.
제 4항에 있어서, 상기 암은 유방암을 포함하는 것을 특징으로 하는 표적 항암제 내성 극복을 위한 암 치료 보조제.
5. The cancer therapeutic aid for overcoming the anticancer drug resistance according to claim 4, wherein the cancer comprises breast cancer.
ANT2(Adenine nucleotide translocator2) 특이적 siRNA; 및
HER2 표적 항암제를 유효성분으로 함유하는 것을 특징으로 하는 암 치료용 조성물.
ANT2 (Adenine nucleotide translocator2) specific siRNA; And
A composition for treating cancer, which comprises an HER2 anticancer agent as an active ingredient.
제 8항에 있어서, 상기 siRNA는 서열번호 1 및 23; 서열번호 2 및 24; 서열번호 3 및 25; 서열번호 4 및 26; 서열번호 5 및 27; 서열번호 6 및 28; 서열번호 7 및 29; 서열번호 8 및 30; 서열번호 9 및 31; 서열번호 10 및 32; 서열번호 11 및 33; 서열번호 12 및 34; 서열번호 13 및 35; 서열번호 14 및 36; 서열번호 15 및 37; 서열번호 16 및 38; 서열번호 17 및 39; 서열번호 18 및 40; 서열번호 19 및 41; 서열번호 20 및 42; 서열번호 21 및 43; 및, 서열번호 22 및 44로 이루어진 군에서 선택되는 적어도 한 쌍인 것을 특징으로 하는 암 치료용 조성물.
9. The siRNA according to claim 8, wherein the siRNA is selected from the group consisting of SEQ ID NOS: 1 and 23; SEQ ID NOS: 2 and 24; SEQ ID NOS: 3 and 25; SEQ ID NOS: 4 and 26; SEQ ID NOS: 5 and 27; SEQ ID NOS: 6 and 28; SEQ ID NOS: 7 and 29; SEQ ID NOS: 8 and 30; SEQ ID NOS: 9 and 31; SEQ ID NOS: 10 and 32; SEQ ID NOS: 11 and 33; SEQ ID NOS: 12 and 34; SEQ ID NOS: 13 and 35; SEQ ID NOS: 14 and 36; SEQ ID NOS: 15 and 37; SEQ ID NOS: 16 and 38; SEQ ID NOS: 17 and 39; SEQ ID NOS: 18 and 40; SEQ ID NOS: 19 and 41; SEQ ID NOS: 20 and 42; SEQ ID NOS: 21 and 43; And SEQ ID NO: 22 and SEQ ID NO: 44.
제 8항에 있어서, 상기 HER2 표적 항암제는 트라스투주맙(trastuzumab)인 것을 특징으로 하는 암 치료용 조성물.
The composition according to claim 8, wherein the HER2 anticancer agent is trastuzumab.
제 8항에 있어서, 상기 암은 유방암을 포함하는 것을 특징으로 하는 암 치료용 조성물.9. The composition for treating cancer according to claim 8, wherein the cancer comprises breast cancer.
KR1020150004367A 2014-01-17 2015-01-12 Composition for overcoming resistance to her2 inhibitor comprising ant2 sirna KR101681597B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20140006035 2014-01-17
KR1020140006035 2014-01-17

Publications (2)

Publication Number Publication Date
KR20150086442A true KR20150086442A (en) 2015-07-28
KR101681597B1 KR101681597B1 (en) 2016-12-01

Family

ID=53875635

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150004367A KR101681597B1 (en) 2014-01-17 2015-01-12 Composition for overcoming resistance to her2 inhibitor comprising ant2 sirna

Country Status (1)

Country Link
KR (1) KR101681597B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100555211B1 (en) 2002-07-16 2006-03-03 주식회사 팬제노믹스 Her-2/neu DNA VACCINE HAVING ANTI-CANCER ACTIVITY
KR20120095263A (en) * 2011-02-18 2012-08-28 주식회사 바이오인프라 Method for treating breast cancer by decreasing the expression of adenine nucleotide translocator 2 mrna

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100555211B1 (en) 2002-07-16 2006-03-03 주식회사 팬제노믹스 Her-2/neu DNA VACCINE HAVING ANTI-CANCER ACTIVITY
KR20120095263A (en) * 2011-02-18 2012-08-28 주식회사 바이오인프라 Method for treating breast cancer by decreasing the expression of adenine nucleotide translocator 2 mrna

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NCBI Reference Sequence: NM_001152.4 (2013.11.23. 공개) *

Also Published As

Publication number Publication date
KR101681597B1 (en) 2016-12-01

Similar Documents

Publication Publication Date Title
WO2019000146A1 (en) Sirna of human programmed cell death receptor 1 and use thereof
US20110046067A1 (en) COMPOSITIONS COMPRISING HUMAN EGFR-siRNA AND METHODS OF USE
Hu et al. Combinational RNAi gene therapy of hepatocellular carcinoma by targeting human EGFR and TERT
KR20070101610A (en) Gene therapy for cancer using small interfering rna specific to ant2 and a method to overcome tolerance to antitumor agent
US11524047B2 (en) Pharmaceutical compositions for preventing or treating pulmonary metastasis of cancer including CHI3L1 inhibitor as active ingredient
US20110293600A1 (en) Anticancer Composition Comprising Antitumor Agent and Substance Having Inhibitory Effects on L1CAM Activity and Expression
Wei et al. Cell-directed aptamer therapeutic targeting for cancers including those within the central nervous system
US10221418B2 (en) Composition for treating cancer associated with HPV infection
CN108913690B (en) PD-1 specific interference sequence, plasmid, attenuated salmonella and application in tumor resistance
KR101999515B1 (en) Nucleic acids for simultaneous inhibition of AR gene and mTOR gene
KR101993377B1 (en) Nucleic acids for simultaneous inhibition of BCL2 gene and BI-1 gene
KR101681597B1 (en) Composition for overcoming resistance to her2 inhibitor comprising ant2 sirna
JP7412576B2 (en) Application of peginterferon and proto-oncogene product-targeted inhibitors in the synergistic treatment of renal cancer
JP5683261B2 (en) Double-stranded nucleic acid molecule suitable for cancer prevention or treatment, cancer cell growth inhibitor, and pharmaceutical
KR101865025B1 (en) Nucleic acids for simultaneous inhibition of mTOR gene and STAT3 gene
US20180214546A1 (en) Modulation of srpx2-mediated angiogenesis
KR102654518B1 (en) Lsp1 deficient t cell
JP7498448B2 (en) Cancer growth inhibitor containing as an active ingredient an inhibitor of ncRNA expression derived from the SNHG12 gene
KR101464360B1 (en) Adenovirus Containing Ribozyme and shRNA, and Therapeutic Composition Comprising Thereof
CN107737123B (en) Cancer treatment medicine capable of killing tumor stem cells and application thereof
KR102026142B1 (en) Anti-Cancer and Anti-Metastasis Composition Comprising CRIF1 Antagonist
WO2015113511A1 (en) Sirna in tandem expression and uses thereof in treating chronic lymphocytic leukemia
KR101514281B1 (en) Pharmaceutical composition for the prevention or treatment of cancer comprising complementary dsRNA to the promoter region of VHL gene
KR20240087867A (en) Genetically engineered bacterial expressing multiple miRNA targeting cancer cells
KR20240086750A (en) Gene expression system for targeting cancer cells

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
AMND Amendment
X701 Decision to grant (after re-examination)
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20191029

Year of fee payment: 4