KR102843136B1 - Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Sophora flavescens extract or active component separated therefrom as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing or treating muscle disease or improving muscle function, comprising extracts of Manbyungcho, Dansam, or Gosam, or substances isolated therefrom, as active ingredients.
The extract of the common ginseng, the extract of the common ginseng, the extract of the common ginseng, the extract of the common ginseng, the icariside B2, the creoside IV, or the curaridinol of the present invention have an effect of preventing or treating muscle diseases or improving muscle function by improving the function of mitochondria and promoting the differentiation of myoblasts and the formation of myotubes, and thus can be used as a material for medicines, foods, etc.

Description

Composition for preventing or treating muscle disease or improving muscular functions comprising Sophora flavescens extract or active component separated therefrom as an active ingredient

The present invention relates to a composition for preventing or treating muscle disease or improving muscle function, comprising extracts of Manbyungcho, Dansam, or Gosam, or substances isolated therefrom, as active ingredients.

Muscle is a crucial component of the human body, originating from mesoderm stem cells. Responsible for approximately 40% of our body mass, muscles are located and supported by bones and tendons. Composed of bundles of muscle fibers, they move together and change cell size, triggering contraction. Muscles are categorized as skeletal, cardiac, and visceral, each generating force and inducing movement. They also protect organs such as bones, joints, and internal organs. Furthermore, muscle possesses regenerative capacity. When damaged, satellite cells and their surrounding environment can regenerate muscle, allowing it to regenerate and regain its original contraction and relaxation abilities.

Muscle diseases are caused by inherited genetic or environmental factors. With the recent trend of an aging society and longer lifespans, diseases related to muscle loss are on the rise. Human muscle mass declines by more than 1% annually after age 40, and by age 80, 50% of peak muscle mass has been lost. Therefore, muscle loss in old age is recognized as the most significant cause of overall decline in physical function. The incidence of these muscle diseases is on the rise worldwide compared to the past.

However, muscle diseases have diverse causes compared to other diseases, making accurate diagnosis challenging. Symptoms and severity vary depending on the type. Furthermore, many rare diseases have unknown mechanisms. Furthermore, muscle diseases progress rapidly, and patients often struggle to function independently as the disease progresses. However, there are virtually no effective treatments or preventative agents for the underlying conditions.

Meanwhile, "Rhododendron brachycarpum" is a plant in the Ericaceae family, and has been known since ancient times to be effective in treating bronchial diseases such as asthma, coughs, and phlegm. "Codonopsis pilosulate radix" is a plant in the Platycodon grandiflorum family, and its roots have been used since ancient times, and it is known to be effective in increasing white blood cells and treating lung cancer. "Sophora flavescens" is a plant in the legume family, and its roots have been used since ancient times, and it is known to have blood sugar-lowering, anti-tumor, antibacterial, and immune-suppressing effects.

However, there was no previous information on the preventive or therapeutic effects of muscle-related diseases or improvement of muscle function for Manbyungcho, Dansam, Gosam, or Icariside B2, Creoside IV, or Curaridinol isolated therefrom.

Against this backdrop, the inventors of the present invention have made great efforts to develop a composition effective in preventing or treating muscle-related diseases or improving muscle function from a substance derived from a natural material, and as a result, have confirmed that extracts of Manbyungcho, Dansam, and Gosam, or effective substances isolated therefrom, such as Icariside B2, Creoside IV, or Curaridinol, are effective, thereby completing the present invention.

Republic of Korea Publication Patent No. 10-2016-0066253

The purpose of the present invention is to provide a composition for preventing or treating muscle disease or improving muscle function, which comprises an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

Another object of the present invention is to provide a food composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

Another object of the present invention is to provide a health functional food for preventing or treating muscle disease or improving muscle function, which contains an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

Another object of the present invention is to provide a feed composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

Another object of the present invention is to provide a method for preparing a composition for preventing or treating muscle disease or improving muscle function, comprising the steps of obtaining a Manbyungcho extract from Manbyungcho; obtaining a Dansam extract from Dansam; or obtaining a Sophora ginseng extract from Sophora ginseng.

Another object of the present invention is to provide a method for preparing a composition for preventing or treating muscle disease or improving muscle function, comprising the steps of isolating icariside B2 from a Manbyungcho extract; isolating creaoside IV from a Dansam extract; or isolating curaridinol from a Gosam extract.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

As one aspect for achieving the above object, the present invention provides a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

The term "extract" in the present invention refers to a resultant substance, such as a liquid component obtained by soaking a target substance, such as the above-mentioned Manbyungcho, Dansam, or Gosam, in various solvents and then extracting it for a certain period of time at room temperature or under a temperature, or a solid component obtained by removing the solvent from the liquid component. In addition, it can be comprehensively interpreted to include dilutions of the above-mentioned resultant substances, concentrates thereof, adjusted preparations thereof, purified products, etc.

In addition, according to the present invention, there is no limitation on the parts of the plant, such as Manbyungcho, Dansam, and Gosam, and it may be an extract obtained from, for example, leaves, roots, stems, etc., and in one embodiment, it may be an extract of Manbyungcho leaves, Dansam roots, or Gosam roots.

The above extract can be obtained by extraction with water or various organic solvents, and is not particularly limited thereto, but preferably, water, alcohol having 1 to 4 carbon atoms, and/or a mixed solvent thereof can be extracted. In addition, the method for obtaining the above extract is also not particularly limited thereto, but preferably, a cold immersion extraction method in which the dried or processed product thereof is immersed in the above solvent and extracted at room temperature of 10 to 25°C, a heating extraction method in which the dried or processed product thereof is immersed in the above solvent and extracted, a heat extraction method in which the dried or processed product is heated to 40 to 100°C and extracted, an ultrasonic extraction method in which ultrasonic waves are applied to extract, a reflux extraction method using a reflux condenser, etc. can be used.

The above extraction solvent is preferably added in an amount of 1 to 20 times its weight, more preferably 10 times its weight. The extraction temperature is preferably 10 to 45°C, but is not limited thereto. In addition, the extraction time is preferably 1 to 5 days, and 3 days is most preferred, but is not limited thereto. Drying is preferably performed by reduced pressure drying, vacuum drying, boiling drying, spray drying, or freeze drying, and is more preferably freeze drying, but is not limited thereto.

In the present invention, the term "fraction" refers to a result obtained by a fractionation method for separating a specific component or a specific group from a mixture containing various components. In the present invention, the fraction may be interpreted as a fraction obtained by applying the extract of the above-mentioned Myrtle, Angelica, or Sophora japonica to various fractionation methods. The fractionation method is not particularly limited thereto, but may be a solvent fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed by passing the extract through an ultrafiltration membrane having a certain molecular weight cut-off value, a chromatography fractionation method, etc. In addition, the solvent used in the solvent fractionation method may be a polar solvent or a non-polar solvent without any particular limitation.

In the present invention, 'Icariside B2' can be represented by the following chemical formula 1.

[Chemical Formula 1]

The above Icaricide B2 is an organic compound having the chemical formula C ₁₉ H ₃₀ O ₈ .

Icariside B2 according to the present invention can be isolated from parts of the plant including the leaves, stems, and roots of the plant, and in one embodiment, can be isolated from an extract of the leaf of the plant. In addition, as long as the material of the Icariside B2 according to the present invention is the same, it is included in the scope of the present invention without limitation in the chemical synthesis known in the art, or in the acquisition or manufacturing process from other sources. In addition, the Icariside B2 can be obtained by extracting the plant extract with a single or mixed solvent, and any solvent known in the art can be used.

The extract of Manbyungcho according to the present invention may be an extract containing Icariside B2.

In the present invention, ‘creoside IV’ can be represented by the following chemical formula 2.

[Chemical Formula 2]

The above creatine IV is an organic compound having the chemical formula C ₁₇ H ₃₂ O ₁₀ .

Creoside IV according to the present invention can be obtained from an extract of any part of the ginseng plant without limitation and then separated therefrom. For example, it can be separated from a ginseng root extract.

In addition, if the substance of Creoside IV according to the present invention is the same, it is included in the scope of the present invention without limitation of chemical synthesis known in the art, or acquisition from other sources, or manufacturing process.

In addition, the above-mentioned creoside IV may be obtained by extracting the extract of the root of the ginseng root with a single or mixed solvent, and any known solvent may be used.

The ginseng extract according to the present invention may be an extract including creoside IV.

In the present invention, 'curaridinol' can be represented by the following chemical formula 3.

[Chemical Formula 3]

In the present invention, curaridinol is an organic compound having the chemical formula C ₂₆ H ₃₂ O ₇ .

Curaridinol according to the present invention can be obtained by obtaining an extract from any part of Sophora japonica and then separated therefrom, but in one embodiment, curaridinol can be separated from a Sophora japonica root extract.

In addition, if the material of curaridinol according to the present invention is the same, it is included in the scope of the present invention without limitation of chemical synthesis known in the art, or acquisition from other sources, or manufacturing process.

In addition, the above-mentioned curaridinol may be obtained by extracting the root extract of Gosam with a single or mixed solvent, and any known solvent may be used.

The ginseng extract according to the present invention may be an extract containing curaridinol.

In the present invention, "muscle" comprehensively refers to tendons, muscles, and tendons. "Muscle strength" refers to the ability of a muscle to exert force through contraction, and muscle strength is proportional to muscle mass. "Improving muscle strength" refers to increasing muscle mass by differentiating myogenic cells into muscle cells, thereby improving physical performance, maximal endurance, enhancing muscle recovery, reducing muscle fatigue, and improving energy balance. Furthermore, this muscle strength is related to the body's "mobility" or "exercise performance ability." "Exercise performance ability" refers to the ability to perform physical movements performed in daily life or sports quickly, strongly, for a long time, and skillfully, and "improving exercise performance ability" refers to the effect of improving muscle functions such as muscle strength and endurance. Furthermore, "muscle weakness" refers to a state in which the strength of one or more muscles is reduced. The muscle weakness may be limited to a single muscle, one side of the body, the upper or lower limbs, or may occur throughout the body. Additionally, subjective symptoms of muscle weakness, including muscle fatigue and muscle pain, can be objectively quantified through physical examination.

In addition, the term "muscle disease" in this specification refers to a disease or condition reported in the art as a muscle disease caused by muscle dysfunction, muscle wasting, or muscle degeneration. The muscle wasting or degeneration is caused by genetic factors, acquired factors, aging, etc., and muscle wasting is characterized by a gradual loss of muscle mass, and weakening and degeneration of muscles, particularly skeletal muscles or voluntary muscles and cardiac muscles. Examples of diseases related thereto include muscle wasting, sarcopenia, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy, and sarcopenia. The composition of the present invention has a muscle mass increasing effect, and the type of muscle is not limited.

The composition of the present invention has, for example, the efficacy of preventing, improving, and treating the above-mentioned diseases or conditions, such as sarcopenia and muscular dystrophy, by promoting differentiation of myogenic cells.

The composition of the present invention can be implemented in the form of various external compositions, including, but not limited to, pharmaceutical compositions, food (including food additives) compositions, quasi-drug compositions, feed (feed additive) compositions, and cosmetic compositions.

The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. Examples of such pharmaceutically acceptable carriers include carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.

Additionally, carriers for parenteral administration may include water, suitable oils, saline, aqueous glucose, and glycols. They may also contain stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol.

The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal administration.

The pharmaceutical composition of the present invention may be formulated as a preparation for oral or parenteral administration, depending on the route of administration as described above. When formulated, it may be prepared using one or more buffers (e.g., saline or PBS (phosphate buffered saline)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, or surfactants, diluents, or excipients.

Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, capsules, etc., and these solid preparations can be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or sugar-coated tablets can be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.

In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water or liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, or preservatives may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants, and anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, and preservatives may be additionally included.

When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of injections, transdermal administration agents, and nasal inhalants together with a suitable parenteral carrier according to methods known in the art. The injections must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and/or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the injections from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal may be additionally included. Additionally, the above injections may in most cases additionally contain isotonic agents such as sugar or sodium chloride.

Transdermal administration includes ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. "Transdermal administration" here refers to topically administering a pharmaceutical composition to the skin, thereby delivering an effective amount of the active ingredient contained in the pharmaceutical composition into the skin.

For inhalation administration, the compositions used according to the present invention may conveniently be delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or another suitable gas. For pressurized aerosols, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in the well-known prescription book of pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).

The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy or biological response modifiers.

As another aspect for achieving the above object, the present invention provides a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

The term "quasi-drug" used in the present invention means an article other than a device, machine or apparatus used for the purpose of diagnosing, treating, alleviating, managing or preventing a disease of a human or animal, and an article other than a device, machine or apparatus used for the purpose of exerting a pharmacological effect on the structure and function of a human or animal, and may include, but is not limited to, an oral preparation, and the method of formulation, dosage, method of use, components, etc. of a quasi-drug may be appropriately selected from conventional techniques known in the art.

In addition to the above-mentioned ingredients, the quasi-drug composition of the present invention may further include a pharmaceutically acceptable carrier, excipient, or diluent, as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effects of the present invention, and may include, for example, fillers, bulking agents, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc.

As another aspect for achieving the above object, the present invention provides a food composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

The food composition of the present invention includes all forms, including functional foods, nutritional supplements, health foods, food additives, and feeds, and is intended for consumption by humans or animals, including livestock. The above-mentioned types of food compositions can be manufactured in various forms using conventional methods known in the art.

The above type of food composition can be manufactured in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (canned fruits, bottled fruits, jams, marmalades, etc.), fish, meats and processed foods thereof (ham, sausages, corned beef, etc.), breads and noodles (udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, taffy, dairy products (butter, cheese, etc.), edible plant oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (soybean paste, soy sauce, sauces, etc.), etc., and the above-mentioned effective ingredient can be added thereto to manufacture the composition.

In addition, nutritional supplements can be manufactured by adding the above-mentioned active ingredients to capsules, tablets, pills, etc. Furthermore, health functional foods can be manufactured in the form of tea, juice, and drinks, for example, and can be consumed by liquefying, granulating, encapsulating, or powdering them so that they can be consumed as health drinks. In addition, in order to use the above-mentioned Manbyungcho, Sosam, or Dansam in the form of a food additive, they can be manufactured and used in the form of a powder or concentrate. In addition, they can be manufactured in the form of a composition by mixing them with known active ingredients known to be effective in improving muscle strength.

In addition to the above, the health food of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents.

As another aspect for achieving the above object, the present invention provides a feed composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

In the present invention, the feed composition may be formulated in the form of a conventional feed and may include known feed ingredients. In addition, it may also be used as a feed additive added in the form of an additive to the feed being used. The feed additive of the present invention corresponds to a supplementary feed under the Feed Management Act, and may additionally include mineral preparations such as sodium bicarbonate (sodium bicarbonate), bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamins such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex; protected amino acids such as methionine and lysate; protected fatty acids such as fatty acid calcium salts; live bacteria such as probiotics (lactic acid bacteria), yeast cultures, and mold fermentations; and yeast agents.

The feed or feed additive of the present invention can be applied to a number of animal diets including mammals, poultry, and fish.

As another aspect for achieving the above object, the present invention provides a method for preparing a composition for preventing or treating muscle disease or improving muscle function, comprising the steps of obtaining a Manbyungcho extract from Manbyungcho; obtaining a Dansam extract from Dansam; or obtaining a Sophora chinensis extract from Sophora chinensis.

In the present invention, the extract of the common ginseng contains Icariside B2 as an effective ingredient.

In the present invention, the above-mentioned ginseng extract contains creoside IV as an effective ingredient.

In the present invention, the above-mentioned red ginseng extract contains curaridinol as an effective ingredient.

In another aspect for achieving the above object, the present invention provides a method for preparing a composition for preventing muscle disease or improving muscle function, comprising the steps of isolating icariside B2 from a Manbyungcho extract; isolating creaoside IV from a Dansam extract; or isolating curaridinol from a Gosam extract.

The extract of the present invention, or a substance isolated therefrom, of the common ginseng, the common ginseng, or the common ginseng has an effect of preventing or treating muscle diseases or improving muscle function, and can be used as a material for medicines, foods, etc.

Figure 1 shows the structure (Figure 1A) and separation schematic diagram (Figure 1B) of icariside B2.
Figure 2 shows the structure (Figure 2A) and separation schematic diagram (Figure 2B) of creoside Ⅳ.
Figure 3 shows the structure (Figure 3A) and separation schematic diagram (Figure 3B) of kuraridinol.
Figure 4 shows the results of nuclear magnetic resonance (NMR) measurements to confirm the structure of Icaricide B2 (Figure 4A: ¹ H NMR, Figure 4B: ¹³ C NMR).
Figure 5 shows the results of nuclear magnetic resonance (NMR) measurements to confirm the structure of creoside IV (Figure 5A: ¹ H NMR, Figure 5B: ¹³ C NMR).
Figure 6 shows the results of nuclear magnetic resonance (NMR) measurements to confirm the structure of curaridinol (Figure 6A: ¹ H NMR, Figure 6B: ¹³ C NMR).
Figure 7 shows the EGFP fluorescence expression image (Figure 7A) and quantitative analysis results (Figure 7B) that confirmed the effect of icaric acid bi2 treatment on mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy induced by an anticancer agent.
Figure 8 shows an EGFP fluorescence expression image (Figure 8A) and quantitative analysis results (Figure 8B) confirming the effect of creoside IV treatment on mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy induced by an anticancer agent.
Figure 9 shows an EGFP fluorescence expression image (Figure 9A) and quantitative analysis results (Figure 9B) confirming the effect of curaridinol treatment on mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy induced by an anticancer agent.
Figure 10 shows the results of RT-qPCR measurement of gene expression of MyoD (Figure 10A) and myogenin (Figure 10B) according to Icariside B2 treatment.
Figure 11 shows the results of RT-qPCR measurement of gene expression of MyoD (Figure 11A) and myogenin (Figure 11B) according to creoside IV treatment.
Figure 12 shows the results of RT-qPCR measurement of gene expression of MyoD (Figure 12A) and myogenin (Figure 12B) according to curaridinol treatment.
Figure 13 shows the results of RT-qPCR measurement of gene expression of Myh1 (Figure 13A), Myh2 (Figure 13B), Myh4 (Figure 13C), and Myh7 (Figure 13D) according to Icariside B2 treatment.
Figure 14 shows the results of measuring the gene expression of Myh1 (Figure 14A), Myh2 (Figure 14B), Myh4 (Figure 14C), and Myh7 (Figure 14D) according to Creoside IV treatment using RT-qPCR.
Figure 15 shows the results of RT-qPCR measurement of gene expression of Myh1 (Figure 15A), Myh2 (Figure 15B), Myh4 (Figure 15C), and Myh7 (Figure 15D) according to curaridinol treatment.
Figure 16 shows the results of immunofluorescence staining for the MHC-positive myotube cell image (Figure 16A) and the percentage of multinucleated MHC-positive myotube cells (Figure 16B) according to Icaricide B2 treatment.
Figure 17 shows the results of immunofluorescence staining for the image of MHC-positive myotube cells (Figure 17A) and the distribution of multinucleated MHC-positive myotube cells (Figure 17B) following Creoside IV treatment.
Figure 18 shows the results of immunofluorescence staining for the image of MHC-positive myotube cells (Figure 18A) and the distribution and ratio of multinucleated MHC-positive myotube cells (Figure 18B) according to curaridinol treatment.
Figure 19 shows the results of RT-qPCR measurement of gene expression of COX2 (Figure 19A), ATPase6 (Figure 19B), and SIRT3 (Figure 19C) according to Icariside B2 treatment.
Figure 20 shows the results of measuring the gene expression of SDHA (Figure 20A) and DRP1 (Figure 20B) according to Creoside IV treatment using RT-qPCR.

Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

Example 1: Preparation of Manbyungcho extract and Icariside B2

25 kg of the plant was extracted by immersion in 95% methanol at room temperature (25℃) twice over one week. The concentrated methanol extract was suspended in 3 L of distilled water. Solvent fractionation was performed using equal volumes of n-hexane, chloroform, ethyl acetate, and n-butanol using a separatory funnel. Column chromatography was performed on 320 g of the n-butanol fraction. 320 g of the n-butanol fraction was solidified by adsorption onto silica gel 70-230 mesh, and then loaded onto the column. chloroform and methanol were used as developing solvents in increasing polarity ratios to obtain a total of six subfractions (hereinafter referred to as 'B1 to B6').

MPLC was performed on 22 g of the obtained B2 using RP-C18 packing, and 29 subfractions were obtained using acetone, methanol, and water as developing solvents (hereinafter referred to as 'B2-1 to B2-29'). MPLC was performed on 2 g of the subfractions B2-27 using silica gel 230-400 mesh packing, and a white crystalline substance was obtained from 300 mg of B2-27-3, and as a result, the above icariside B2 was obtained (Figs. 1 and 4).

White amorphous powder; electron ionization mass spectrometry (EI-MS) m/z 386.19 [M]+; molecular formula C ₁₉ H ₃₀ O ₈ ; ¹ H-NMR (500 MHz, pyridine- d ₅ ) δ 7.18 (1H, d, J = 15.7 Hz, H-7), 6.52 (1H, d, J = 15.7 Hz, H-8), 4.96 (1H, d, J = 7.7 Hz, H-1'), 4.41 (1H, dd, J = 11.2, 4.2 Hz, H-3), 4.54-3.95 (6H, m, H-2'-H-6'), 2.60 (1H, dd, J = 14.6, 4.8 Hz, H-4a), 2.28 (3H, s, H-10), 1.97 (2H, d, J = 14.6 Hz, H-2a, H-4b), 1.53 (1H, dd, J = 12.3, 10.7 Hz, H-2b), 1.12 (6H, s, H-12, H-13), 0.96 (3H, s, H-11); ¹³ C-NMR (250 MHz, pyridine- d ₅ ) δ 197.4 (C-9), 143.3 (C-7), 133.6 (C-8), 103.4 (C-1'), 79.0 (C-5'), 78.8 (C-3'), 75.6 (C-2'), 71.9 (C-4'), 71.7 (C-3), 70.1 (C-6), 67.4 (C-5), 63.0 (C-6'), 45.0 (C-2), 38.3 (C-4), 35.4 (C-1), 29.3 (C-11), 28.0 (C-10), 25.6 (C-12), 20.2 (C-13).

Example 2: Preparation of Dangsam extract and Creoside IV

7 kg of the roots of the ginseng plant were extracted three times for 3 hours with 80% methanol under reflux cooling. The methanol extract was concentrated using a vacuum rotary evaporator, and MCI gel was suspended in water, and solvent fractionation was performed by column chromatography using methanol. 100 g of the methanol fraction was solidified by adsorption onto silica gel 230-400 mesh, and then loaded onto the column. The developing solvent was methyl chloride: methanol = 30:1 to 0:100, and the polarity was increased to obtain a total of five subfractions (hereinafter referred to as 'M1 to M5').

Column chromatography was performed on 15 g of the obtained M3 using RP-C18 packing, and 10 small fractions were obtained using a developing solvent of methanol:water = 40:60 to 0:100 (hereinafter referred to as 'M3-1 to M3-10'). Among these small fractions, 100 mg of M3-5 was recrystallized with methanol to obtain a white crystalline substance, and as a result, the above-mentioned creoside Ⅳ was obtained (Figs. 2 and 5).

White amorphous powder; Electron ionization mass spectrometry (EI-MS) m/z 396 [M]+; Molecular formula C ₁₇ H ₃₂ O ₁₀ ; ¹ H-NMR (500 MHz, CD ₃ OD) δ 0.87 (3H, t, J = 6.9, H-6), 1.28 (6H, m, H-3 ~ H-5), 1.57 (2H, m, H-2), 3.15~3.86 (m), 4.07 (1H, dd, J = 11.4, 1.7), 4.23 (1H, d, J = 7.8), 4.29 (1H, d, J = 6.5); ¹³ C-NMR (250 MHz, CD ₃ OD) δ 105.1 (C-1"), 104.3 (C-1´), 77.8 (C-3´), 76.7 (C-5´), 74.9 (C-2´), 74.1 (C-3"), 72.3 (C-2"), 71.5 (C-4´), 70.9 (C-1), 69.4 (C-6´ and C-4"), 66.7 (C-5"), 32.8 (C-4), 30.7 (C-2), 26.7 (C-3), 23.6 (C-5), 14.4 (C-6).

Example 3: Preparation of Gosam extract and Kuraridinol

10 kg of Sophora japonica roots were extracted three times for 3 hours under reflux with 99.9% methanol. The methanol extract was concentrated using a vacuum rotary evaporator and suspended in 3 L of distilled water. Solvent fractionation was performed using equal volumes of methylene chloride, ethyl acetate, and n-butanol using a separatory funnel. Column chromatography was performed on 250 g of the ethyl acetate fraction. 320 g of the n-butanol fraction was solidified by adsorption onto silica gel 70-230 mesh, and then loaded onto the column. The developing solvent was methylene chloride: methanol = 20:1 to 0:100, and the extraction was performed in increasing polarity ratios to obtain a total of 35 subfractions (hereinafter referred to as 'E1 to E35').

For the obtained E15 32 g, a silica gel 230-400 mesh filler was used, and the developing solvent was methylene chloride: methanol = 20:1 to 1:1, to obtain six subfractions (hereinafter referred to as 'E15-1 to E15-6'). Among the subfractions, for 2.77 g of E15-3, a silica gel 230-400 mesh filler was used, and the developing solvent was hexane: ethyl acetate = 1:1 to 0:100, to obtain a yellow crystalline substance from 1.08 g of E15-3-3, and as a result, the curaridinol was obtained (Figs. 3 and 6).

Yellow amorphous powder; electron ionization mass spectrometry (EI-MS) m/z 456 [M]+; molecular formula C ₂₆ H ₃₂ O ₇ ; ¹ H-NMR (500 MHz, DMSO- d ₆ ) δ 14.86 (1H, s, OH-9), 10.17 (1H. s, OH-7), 7.94 (1H, d, J = 15.6 Hz, H-2), 7.86 (1H, d, J = 15.6 Hz, H-3), 7.43 (1H, d, J = 8.6 Hz, H-6'), 6.38 (1H, d, J = 2.2 Hz, H-3'), 6.32 (1H, dd, J = 2.2, 8.6 Hz, H-5'), 6.04 (1H, s, H-6), 4.57 (1H, br s, H-9"a), 4.47 (1H, d, J = 2.2 Hz, H-9"b), 3.83 (3H, s, OCH3), 2.55 (2H, m, H-1"), 2.35 (1H, m,H-2"), 1.64 (3H, s,H-10"), 1.35 (2H, m, H-3"), 1.19 (2H, m, H-4"), 1.02 (3H, s, H-6"), 1.01 (3H, s, H-7"); ¹³ C-NMR (250 MHz, DMSO- d ₆ ) δ 191.96 (C-4), 165.28 (C-9), 162.75 (C-7), 161.14 (C-4'), 160.27 (C-5), 159.02 (C-2'), 148.00 (C-8"), 138.63 (C-2), 130.31 (C-6'), 122.79 (C-3), 113.74 (C-1'), 110.92 (C-9"), 108.05 (C-5'), 106.73 (C-8), 104.41 (C-10), 102.58 (C-3'), 90.66 (C-6), 68.64 (C-5"), 55.49 (OCH3), 46.41 (C-2"), 41.57 (C-4"), 29.55 (C-6"), 29.00 (C-7"), 27.10 (C-1"), 26.65 (C-3"), 17.85 (C-10").

Experimental Example 1: Confirmation of the effect of Icaricide B2 on mitochondria damage caused by anticancer drug-induced muscle atrophy in a zebrafish model.

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory were maintained in a 3.5 L acrylic tank under conditions of 28.5±1℃ temperature and 14/10 h light/dark cycle with the approval of the Animal Experiment Ethics Committee of Sookmyung Women's University, and were fed diet (live Brine shrimp (artemia) and Tetramin, 16106, Germany) twice a day. The embryos used in the experiment were obtained through mating of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

In order to confirm the effect of Icaricide B2 on alleviating mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy, embryos 1 day after fertilization were treated with an anticancer drug (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to create a muscle atrophy zebrafish model, and Icaricide B2, isolated from the extract of Rhododendron amurense in Example 1, was treated at 1, 10, and 100 ng/ml. 48 hours after treatment with the extract, Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos were used to observe the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria, and the mitochondrial images in muscle cells were observed using a confocal microscope (Carl Zeiss, Germany).

As a result, we confirmed that the brightness of EGFP expressed in mitochondria was significantly reduced compared to the control group due to mitochondrial damage in muscle cells of zebrafish embryos treated with FOLFIRI, and the expression level gradually increased as Icariside B2 was treated at concentrations of 1, 10, and 100 ng/ml, and it was confirmed that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated, especially at a concentration of 100 ng/ml (Fig. 7). Therefore, through the above results, we confirmed that Icariside B2 can inhibit the occurrence of muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

Experimental Example 2: Confirmation of the effect of Creoside IV on mitochondria damage caused by muscle atrophy in a zebrafish model of anticancer drug-induced muscle atrophy.

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory were maintained in a 3.5 L acrylic tank under conditions of 28.5±1℃ temperature and 14/10 h light/dark cycle with the approval of the Animal Experiment Ethics Committee of Sookmyung Women's University, and were fed diet (live Brine shrimp (artemia) and Tetramin, 16106, Germany) twice a day. The embryos used in the experiment were obtained through mating of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

In order to confirm the effect of Creoside IV on alleviating mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy, embryos 1 day after fertilization were treated with an anticancer drug (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to create a muscle atrophy zebrafish model, and Creoside IV, isolated from the root extract of Dansam in Example 2, was treated at 1, 10, and 100 ng/ml. 48 hours after treatment with the extract, Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos were used to observe the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria, and the mitochondrial images in muscle cells were observed using a confocal microscope (Carl Zeiss, Germany).

As a result, we confirmed that the brightness of EGFP expressed in mitochondria was significantly reduced compared to the control group due to mitochondrial damage in the muscle cells of zebrafish embryos treated with FOLFIRI, and the expression level gradually increased as Creoside IV was treated at concentrations of 1, 10, and 100 ng/ml, confirming that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated, especially at concentrations of 10 and 100 ng/ml (Fig. 8). Therefore, through the above results, we confirmed that Creoside IV can suppress muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

Experimental Example 3: Confirmation of the effect of curaridinol on mitochondria damage caused by anticancer drug-induced muscle atrophy in a zebrafish model.

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory were maintained in a 3.5 L acrylic tank under conditions of 28.5±1℃ temperature and 14/10 h light/dark cycle with the approval of the Animal Experiment Ethics Committee of Sookmyung Women's University, and were fed diet (live Brine shrimp (artemia) and Tetramin, 16106, Germany) twice a day. The embryos used in the experiment were obtained through mating of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

To confirm the effect of curaridinol on alleviating mitochondrial damage caused by muscle atrophy in a zebrafish model of muscular atrophy, embryos 1 day after fertilization were treated with an anticancer drug (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to create a zebrafish model of muscular atrophy, and curaridinol, isolated from the Sophora japonica root extract in Example 3, was treated at 0.01, 0.1, and 1 ng/ml. 48 hours after treatment with the extract, Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos were used to observe the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria, and the mitochondrial images in muscle cells were observed using a confocal microscope (Carl Zeiss, Germany).

As a result, it was confirmed that the brightness of EGFP expressed in mitochondria was reduced compared to the control group due to mitochondrial damage in the muscle cells of zebrafish embryos treated with FOLFIRI, and the expression level gradually increased as curaridinol was treated at concentrations of 0.01, 0.1, and 1 ng/ml, confirming that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated at all concentrations (Fig. 9). Therefore, through the above results, it was confirmed that curaridinol can suppress the occurrence of muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

Experimental Example 4: Confirmation of the effects of Icaricide B2 on inducing myogenic differentiation and promoting myotube formation.

Based on the results of Experimental Example 1 above, the following cell experiment was conducted using C2C12 myoblasts to confirm the effect of icariside B2 on myoblast differentiation and myotube formation. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and seeded at a concentration of 2 x 10 5 cells/ml in 6-well plates with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing ¹⁵ % fetal bovine serum (Gibco, Grand Island, NY, USA). After 24 hours of culture, when the cell confluency reached approximately 90%, the medium was replaced with differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for approximately 72 hours. The experimental group was treated with DM and Icariside B2 at concentrations of 0.1, 1, 10, and 100 ng/ml, and the control group was treated with DMSO, the vehicle, in DM and cultured under the same conditions.

4-1: Effect of Icaricide B2 on Promoting Myogenic Cell Differentiation

To determine the effect of Icaricide B2 on myogenic cell differentiation, The mRNA expression of MyoD, myogenin, and MHC (myosin heavy chain) isoforms, which are markers associated with the differentiation of C2C12 myoblasts into myotubes, was measured by RT-qPCR. To this end, C2C12 cells were treated with Icariside B2 and cultured to induce differentiation using the same method described above. Trizol solution was added to lyse the cells and centrifuge them. Chloroform and isopropanol were added to the supernatant, centrifuged, and the supernatant was removed. After removing all remaining solutions, the RNA pellet was dissolved in nuclease-free water. The concentration of the extracted RNA was measured, its purity confirmed, and cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). The synthesized cDNA was subjected to quantitative PCR using the qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 1.

Gene description Primers Sequences (5' →3') Sequence number ATPase6 F ACACACCAAAAGGACGAACA 1 R GAAGGAAGTGGGCAAGTGAG 2 COX2 F ATGGCCTACCCATTCCAACT 3 R CGGGGTTGTTGATTTCGTC 4 GAPDH F CGTGCCGCCTGGAGAAAC 5 R TGGGAGTTGCTGTTGAAGTCG 6 Myh1 F GAGGGACAGTTCATCGATAGCAA 7 R GGGCCAACTTGTCATCTCTCAT 8 Myh2 F CCGCAATGCAGAAGAGAAA 9 R TTCACGGTCTGCTCCATGT 10 Myh4 F CAGGACTTGGTGGACAAACTACA 11 R TTTAGTGTGAACCTCTCGGCTC 12 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 13 R GGAGCGCAAGTTTGTCATAAGT 14 MyoD F AAACCCCAATGCGATTTATCAGG 15 R TAAGCTTCATCTTTTGGGCGTGA 16 Myogenin F ACAGCATCACGGTGGAGGATATGT 17 R CCCTGCTACAGAAGTGATGGCTTT 18 SIRT3 F CGTTGTGAAACCCGACATTG 19 R TCCCCTAGCTGGACCACATC 20

As a result, the expression levels of MyoD, an early stage marker of myoblast differentiation, and myogenin, an intermediate stage marker, significantly increased in all groups treated with Icaricide Bi2 at concentrations of 0.1, 1, 10, and 100 ng/ml compared to the control group (Fig. 10). The expression levels of MHC isoforms, which are late stage markers of myoblast differentiation and are related to muscle contraction speed and function, were measured, and the gene expression levels of all MHC isoforms (Myh1, Myh2, Myh4, and Myh7) were increased in a concentration-dependent manner in the group treated with Icaricide Bi2. In particular, the gene expression of Myh1 and Myh2 significantly increased compared to the control group at all concentrations, and the expression levels of Myh4 and Myh7 were significantly increased in the groups treated with 1, 10, and 100 ng/ml (Fig. 13). These results demonstrate that Icaricide Bi2 has a differentiation-promoting effect on C2C12 myoblasts.

4-2: Effect of Icaricide B2 on the Promotion of Myotube Formation

To determine the extent of MHC-positive myotube formation by Icaricide B2, immunofluorescence staining was used. For this purpose, cells differentiated under the same conditions described above were washed with phosphate-buffered saline (PBS) after removing DM, fixed with 4% paraformaldehyde for 30 minutes, washed again with PBS, permeabilized with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum, the cells were stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were captured with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were counted from randomly selected areas within the captured images (Scale bar = 100 μm). After analyzing the number of MHC-positive, multinucleated myotubes, the number of multinucleated-MHC-positive myotubes was expressed as a percentage by applying the total cell number.

As a result, the images of MHC-positive myotube cells expressed by red fluorescence and the proportion of multinucleated MHC-positive myotube cells observed through DAPI staining are shown in Fig. 16A and Fig. 16B, respectively. It was confirmed that the formation of MHC-positive myotube cells was promoted by icaridide B2 treatment compared to the control group (Fig. 16A). In addition, the formation of multinucleated MHC-positive myotube cells with three or more nuclei was increased in a concentration-dependent manner by icaridide B2 treatment, and the proportion of multinucleated MHC-positive myotube cells significantly increased in the experimental groups treated with 1, 10, and 100 ng/ml compared to the control group (Fig. 16B). The above results demonstrate that icaridide B2 has the effect of inducing differentiation of C2C12 myotubes and promoting myotube cell formation.

4-3: Confirmation of regulation of gene expression related to mitochondrial function by Icaricide B2

To determine whether the effects of Icaricide B2 on promoting C2C12 myoblast differentiation and myotube formation are related to mitochondrial function, the gene expression levels of electron transport complexes and mitochondrial function-related markers present in the mitochondrial inner membrane of myoblasts were measured by RT-qPCR. The primer sequences used are shown in Table 1. As a result, the expression level of COX2, which constitutes the mitochondrial inner membrane electron transport complex IV, was significantly increased compared to the control group, especially in the 0.1, 10, and 100 ng/ml treatment groups (Fig. 19A). In addition, the expression of ATPase 6, a marker of electron transport complex V involved in the final step of oxidative phosphorylation for mitochondrial ATP production, was significantly increased in all groups treated with Icaricide B2 compared to the control group (Fig. 19B). SIRT3, which plays a crucial role in maintaining mitochondrial energy homeostasis, also showed a significant increase in expression in all groups treated with icaricide B2 in a dose-dependent manner compared to the control group (Fig. 19C). These results demonstrate that the stimulating effects of icaricide B2 on myogenic differentiation and myotube formation are related to improved mitochondrial function through the activation of mitochondrial energy metabolism and the maintenance of homeostasis.

Experimental Example 5: Confirmation of the effects of Creoside IV on inducing myogenic cell differentiation and promoting myotube cell formation.

Based on the results of Experimental Example 2 above, the following cell experiment was conducted using C2C12 myoblasts to confirm the effect of Creoside IV on myoblast differentiation and myotube formation. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and seeded at a concentration of 2 x 10 5 cells/ml in 6-well plates with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). After 24 hours of culture, when the cell confluency reached approximately ⁹⁰ %, the medium was replaced with differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for approximately 72 hours. The experimental group was treated with DM and Creoside IV at concentrations of 1, 10, and 100 ng/ml, and the control group was treated with DMSO as a vehicle and cultured under the same conditions.

5-1: Creoside IV's effect on promoting myogenic cell differentiation

To determine the effect of Creoside IV on myogenic cell differentiation, The mRNA expression of MyoD, myogenin, and MHC (myosin heavy chain) isoforms, which are markers associated with the differentiation of C2C12 myoblasts into myotubes, was measured by RT-qPCR. To this end, C2C12 cells were treated with Creoside IV and cultured to induce differentiation using the same method described above. Trizol solution was added to lyse the cells and centrifuge them. Chloroform and isopropanol were added to the supernatant, centrifuged, and the supernatant was removed. After removing all remaining solutions, the RNA pellet was dissolved in nuclease-free water. The concentration of the extracted RNA was measured, the purity was confirmed, and cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). The synthesized cDNA was subjected to quantitative PCR using the qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 2.

Gene description Primers Sequences (5' →3') Sequence number Drp1 F TCTGCAGCTAGTCCACGTTTC 21 R ACCCCATTCTTCTGCTTCAA 22 GAPDH F CGTGCCGCCTGGAGAAAC 23 R TGGGAGTTGCTGTTGAAGTCG 24 Myh1 F GAGGGACAGTTCATCGATAGCAA 25 R GGGCCAACTTGTCATCTCTCAT 26 Myh2 F CCGCAATGCAGAAGAGAAA 27 R TTCACGGTCTGCTCCATGT 28 Myh4 F CAGGACTTGGTGGACAAACTACA 29 R TTTAGTGTGAACCTCTCGGCTC 30 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 31 R GGAGCGCAAGTTTGTCATAAGT 32 MyoD F AAACCCCAATGCGATTTATCAGG 33 R TAAGCTTCATCTTTTGGGCGTGA 34 Myogenin F ACAGCATCACGGTGGAGGATATGT 35 R CCCTGCTACAGAAGTGATGGCTTT 36 SDHA F CAGAAGTCGATGCAGAACCA 37 R CGACCCGCACTTTGTAATCT 38

As a result, the expression levels of MyoD, an early stage marker of myogenic cell differentiation, and myogenin, an intermediate stage marker, were significantly increased in all groups treated with Creoside IV at concentrations of 1, 10, and 100 ng/ml compared to the control group (Fig. 11). The expression levels of MHC isoforms, which are late stage markers of myogenic cell differentiation and are related to muscle contraction speed and function, were measured, and the gene expression levels of Myh1, Myh2, Myh4, and Myh7 were significantly increased in all groups treated with Creoside IV at concentrations of 1, 10, and 100 ng/ml compared to the control group (Fig. 14). These results demonstrate that Creoside IV has a differentiation-promoting effect on C2C12 myogenic cells.

5-2: Creoside IV's effect on promoting myotube formation

To determine the extent of MHC-positive myotube formation by Creoside IV, immunofluorescence staining was used. For this purpose, cells differentiated under the same conditions described above were washed with phosphate-buffered saline (PBS) after removing DM, fixed with 4% paraformaldehyde for 30 minutes, washed again with PBS, permeabilized with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum, the cells were stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were captured with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were counted from randomly selected areas within the captured images (Scale bar = 100 μm). After analyzing the number of MHC-positive, multinucleated myotubes, the number of multinucleated-MHC-positive myotubes was expressed as a percentage by applying the total cell number.

As a result, the images of MHC-positive myotube cells expressed by red fluorescence and the distribution of multinucleated MHC-positive myotube cells observed through DAPI staining are shown in Fig. 17A and Fig. 17B, respectively. It was confirmed that the formation of MHC-positive myotube cells was promoted by Creoside IV treatment compared to the control group (Fig. 17A). In the experimental groups treated with 1, 10, and 100 ng/ml of Creoside IV, the formation of multinucleated MHC-positive myotube cells increased, and in particular, the number of MHC-positive myotube cells with 2 to 4 nuclei significantly increased at a concentration of 100 ng/ml, and the number of MHC-positive myotube cells with 5 or more nuclei significantly increased in the groups treated with 1 and 10 ng/ml of Creoside IV compared to the control group (Fig. 17B). The above results show that Creoside IV has the effect of inducing differentiation of C2C12 myoblasts and promoting myotube formation.

5-3: Confirmation of regulation of gene expression related to mitochondrial function by Creoside IV

To determine whether the effects of Creoside IV on promoting C2C12 myoblast differentiation and myotube formation are related to mitochondrial function, the gene expression levels of SDHA, which constitutes electron transport chain complex II in the mitochondrial inner membrane of myoblasts, and DRP1, which regulates mitochondrial fission, were measured by RT-qPCR. The primer sequences used are shown in Table 2. As a result, the expression level of SDHA was significantly increased compared to the control group, especially in the 10 and 100 ng/ml treatment groups, while conversely, the expression of DRP1, which is involved in mitochondrial fission, was significantly decreased (Fig. 20). These results indicate that the effects of Creoside IV on promoting C2C12 myoblast differentiation and myotube formation are related to the improvement of mitochondrial function through the activation of mitochondrial energy metabolism and the alleviation of mitochondrial damage.

Experimental Example 6: Confirmation of the effects of curaridinol on inducing myogenic differentiation and promoting myotube formation.

Based on the results of Experimental Example 3 above, the following cell experiment was conducted using C2C12 myoblasts to confirm the effect of curaridinol on myoblast differentiation and myotube formation. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and seeded at a concentration of 2 x 10 5 cells/ml in 6-well plates with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). After 24 hours of culture, when the cell confluency reached approximately ⁹⁰ %, the medium was replaced with differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for approximately 72 hours. The experimental group was treated with DM together with the extract of the root of Gosam and the curaridinol isolated from it at concentrations of 0.01, 0.1, and 1 ng/ml, and the control group was treated with DMSO as a vehicle in DM and cultured under the same conditions.

6-1: Curaridinol's effect on promoting myogenic cell differentiation

To determine the effect of curaridinol on myogenic cell differentiation, The mRNA expression of MyoD, myogenin, and MHC (myosin heavy chain) isoforms, which are markers associated with the differentiation of C2C12 myoblasts into myotubes, was measured by RT-qPCR. To this end, C2C12 cells were treated with curaridinol and cultured to induce differentiation using the same method described above. Trizol solution was added to lyse the cells and centrifuge them. Chloroform and isopropanol were added to the supernatant, centrifuged, and the supernatant was removed. After removing all remaining solutions, the RNA pellet was dissolved in nuclease-free water. The concentration of the extracted RNA was measured, the purity was confirmed, and cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). The synthesized cDNA was subjected to quantitative PCR using the qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 3.

Gene description Primers Sequences (5' →3') Sequence number GAPDH F CGTGCCGCCTGGAGAAAC 39 R TGGGAGTTGCTGTTGAAGTCG 40 Myh1 F GAGGGACAGTTCATCGATAGCAA 41 R GGGCCAACTTGTCATCTCTCAT 42 Myh2 F CCGCAATGCAGAAGAGAAA 43 R TTCACGGTCTGCTCCATGT 44 Myh4 F CAGGACTTGGTGGACAAACTACA 45 R TTTAGTGTGAACCTCTCGGCTC 46 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 47 R GGAGCGCAAGTTTGTCATAAGT 48 MyoD F AAACCCCAATGCGATTTATCAGG 49 R TAAGCTTCATCTTTTGGGCGTGA 50 Myogenin F ACAGCATCACGGTGGAGGATATGT 51 R CCCTGCTACAGAAGTGATGGCTTT 52

As a result, the expression levels of MyoD, an early stage marker of myogenic cell differentiation, and myogenin, an intermediate stage marker, significantly increased in the groups treated with curaridinol at concentrations of 0.01, 0.1, and 1 ng/ml compared to the control group, and in particular, the expression level was significantly higher in the 1 ng/ml treatment group than in the other concentrations (Fig. 12).

In addition, when we measured the expression levels of MHC isoforms, which are terminal markers of myoblast differentiation and are related to muscle contraction speed and function, the mRNA expression levels of Myh1, Myh2, and Myh4 were all significantly increased in the curaridinol-treated group (0.01, 0.1, 1 ng/ml) compared to the control group, and the expression level of Myh7, a slow muscle fiber-related gene, was also significantly increased at all concentrations compared to the control group (Fig. 15). The above results show that curaridinol has an effect of promoting differentiation of C2C12 myoblasts.

6-2: Curaridinol's effect on promoting myotube formation

To determine the extent of MHC-positive myotube formation by curaridinol, immunofluorescence staining was used. For this purpose, cells differentiated under the same conditions described above were washed with phosphate-buffered saline (PBS) after removing DM, fixed with 4% paraformaldehyde for 30 minutes, washed again with PBS, permeabilized with 0.1% Triton X-100 for 30 minutes, and then washed again with PBS. After blocking in 5% horse serum, the cells were stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were captured with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were counted from randomly selected areas within the captured images (Scale bar = 100 μm). After analyzing the number of MHC-positive, multinucleated myotubes, the number of multinucleated-MHC-positive myotubes was expressed as a percentage by applying the total cell number.

As a result, the images of MHC-positive myotubes expressed by red fluorescence and the distribution of multinucleated MHC-positive myotubes observed through DAPI staining are shown in Figures 18A and 18B, respectively. It was confirmed that the formation of MHC-positive myotubes was promoted by curaridinol treatment compared to the control group (Figure 18A). In addition, in the experimental groups treated with 0.01, 0.1, and 1 ng/ml of curaridinol, the number of mononuclear MHC-positive myotubes significantly decreased compared to the control group, whereas the formation of multinucleated MHC-positive myotubes increased. In particular, the proportion of MHC-positive myotubes with six or more nuclei significantly increased in a concentration-dependent manner compared to the control group at all concentrations of curaridinol (Figure 18B). These results demonstrate that curaridinol has the effect of inducing differentiation of C2C12 myotubes and promoting myotube formation.

The experimental examples described in this specification and the attached drawings demonstrate the effects of the active substances of Icariside B2, Creoside IV or Curaridinol, and it is obvious to a person skilled in the art that an extract obtained by separating the active substances also exhibits the effects.

From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Attach an electronic file of the sequence list

Claims (13)

A pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising curaridinol as an active ingredient.
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A composition, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia. A pharmaceutical composition for preventing or improving muscle disease or improving muscle function, containing curaridinol as an active ingredient.
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A composition, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia. A food composition for preventing or improving muscle disease or improving muscle function, containing curaridinol as an active ingredient.
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A composition, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia. A feed composition for preventing or improving muscle disease or improving muscle function, containing curaridinol as an active ingredient,
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A composition, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia. In any one of the first to fourth paragraphs,
A composition wherein the above curaridinol is isolated from a ginseng extract. In paragraph 5,
A composition wherein the above-mentioned ginseng extract is extracted by at least one method selected from the group consisting of cold extraction, heating, ultrasonic extraction, and reflux extraction. In any one of the first to fourth paragraphs,
A composition wherein the above muscle disease is a muscle disease caused by decreased muscle function, muscle wasting or muscle degeneration. delete In any one of the first to fourth paragraphs,
A composition wherein the above curaridinol has an activity of alleviating mitochondrial damage, inducing myoblast differentiation, or promoting myotube formation. In any one of the first to fourth paragraphs,
A composition wherein the curaridinol increases the expression of at least one selected from the group consisting of MyoD, myogenin, Myh1, Myh2, Myh4 and Myh7. A health functional food for preventing or improving muscle disease or improving muscle function, comprising a food composition according to Article 3. delete A method for producing a composition for preventing or treating muscle disease or improving muscle function, comprising curaridinol as an active ingredient, comprising a step of isolating curaridinol from a ginseng extract.
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A manufacturing method, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia.