KR102843136B1 - Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Sophora flavescens extract or active component separated therefrom as an active ingredient - Google Patents

Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Sophora flavescens extract or active component separated therefrom as an active ingredient

Info

Publication number
KR102843136B1
KR102843136B1 KR1020220163367A KR20220163367A KR102843136B1 KR 102843136 B1 KR102843136 B1 KR 102843136B1 KR 1020220163367 A KR1020220163367 A KR 1020220163367A KR 20220163367 A KR20220163367 A KR 20220163367A KR 102843136 B1 KR102843136 B1 KR 102843136B1
Authority
KR
South Korea
Prior art keywords
muscle
composition
disease
curaridinol
function
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
KR1020220163367A
Other languages
Korean (ko)
Other versions
KR20220166246A (en
Inventor
김성은
허지원
송은주
김민정
권윤주
정윤희
Original Assignee
숙명여자대학교산학협력단
한국한의약진흥원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 숙명여자대학교산학협력단, 한국한의약진흥원 filed Critical 숙명여자대학교산학협력단
Publication of KR20220166246A publication Critical patent/KR20220166246A/en
Application granted granted Critical
Publication of KR102843136B1 publication Critical patent/KR102843136B1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/48Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
    • A61K36/489Sophora, e.g. necklacepod or mamani
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/34Campanulaceae (Bellflower family)
    • A61K36/344Codonopsis
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K10/00Animal feeding-stuffs
    • A23K10/30Animal feeding-stuffs from material of plant origin, e.g. roots, seeds or hay; from material of fungal origin, e.g. mushrooms
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/111Aromatic compounds
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/163Sugars; Polysaccharides
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105Plant extracts, their artificial duplicates or their derivatives
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/125Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives containing carbohydrate syrups; containing sugars; containing sugar alcohols; containing starch hydrolysates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/12Ketones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7024Esters of saccharides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/316Foods, ingredients or supplements having a functional effect on health having an effect on regeneration or building of ligaments or muscles

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Polymers & Plastics (AREA)
  • Mycology (AREA)
  • Food Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Botany (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Nutrition Science (AREA)
  • Zoology (AREA)
  • Animal Husbandry (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Neurology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

본 발명은 만병초, 당삼, 또는 고삼 추출물 또는 이로부터 분리된 물질을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 조성물에 관한 것이다.
본 발명의 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀은 미토콘드리아의 기능을 개선하고 근원세포의 분화 및 근관세포의 형성을 촉진시킴으로써, 근육 질환 예방 또는 치료용 또는 근기능 개선용 효과를 가지고 있어, 의약품, 식품 등의 소재로 활용가능하다.
The present invention relates to a composition for preventing or treating muscle disease or improving muscle function, comprising extracts of Manbyungcho, Dansam, or Gosam, or substances isolated therefrom, as active ingredients.
The extract of the common ginseng, the extract of the common ginseng, the extract of the common ginseng, the extract of the common ginseng, the icariside B2, the creoside IV, or the curaridinol of the present invention have an effect of preventing or treating muscle diseases or improving muscle function by improving the function of mitochondria and promoting the differentiation of myoblasts and the formation of myotubes, and thus can be used as a material for medicines, foods, etc.

Description

고삼 추출물 또는 이로부터 분리된 물질을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 조성물 {Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Sophora flavescens extract or active component separated therefrom as an active ingredient}Composition for preventing or treating muscle disease or improving muscular functions comprising Sophora flavescens extract or active component separated therefrom as an active ingredient

본 발명은 만병초, 당삼, 또는 고삼 추출물 또는 이로부터 분리된 물질을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 조성물에 관한 것이다.The present invention relates to a composition for preventing or treating muscle disease or improving muscle function, comprising extracts of Manbyungcho, Dansam, or Gosam, or substances isolated therefrom, as active ingredients.

근육(muscle)은 인체를 구성하는 중요한 요소로, 중배엽의 줄기세포에서 발현되는 조직이다. 근육은 우리 몸의 40% 정도를 담당하며, 뼈와 힘줄에 지지해서 위치하고 근섬유 다발들로 이루어져 서로 움직이고 세포의 크기를 변하도록 하여 수축을 유발한다. 근육은 골격근육, 심장근육, 내장근육으로 구분되는데, 각각의 위치에서 힘을 만들어내고 움직임을 유발하며, 뼈, 관절, 내장 등의 신체기관을 보호하는 역할도 한다. 또한, 근육은 재생 능력을 가지고 있어, 근육이 손상을 받게 되면 위성세포와 그 주변 환경에 의해서 변성된 후 다시 원래의 수축 이완 능력을 가진 근육으로 재생될 수 있다.Muscle is a crucial component of the human body, originating from mesoderm stem cells. Responsible for approximately 40% of our body mass, muscles are located and supported by bones and tendons. Composed of bundles of muscle fibers, they move together and change cell size, triggering contraction. Muscles are categorized as skeletal, cardiac, and visceral, each generating force and inducing movement. They also protect organs such as bones, joints, and internal organs. Furthermore, muscle possesses regenerative capacity. When damaged, satellite cells and their surrounding environment can regenerate muscle, allowing it to regenerate and regain its original contraction and relaxation abilities.

근육질환은 선천적인 유전이나 환경적인 원인에 의해서 발생되며, 최근 고령화 사회 및 수명 연장의 흐름에 따라 근 감소와 관련된 질환이 증가하고 있다. 사람의 근육은 40세 이후부터 매년 1% 이상씩 감소하고, 80세가 되면 최대 근육량의 50% 수준이 감소됨으로써, 노년의 근육 감소는 전반적인 신체기능을 떨어뜨리는 가장 중요한 원인으로 인식되고 있다. 이러한 근육질환은 과거에 비해 전 세계적으로 증가 추세에 있다.Muscle diseases are caused by inherited genetic or environmental factors. With the recent trend of an aging society and longer lifespans, diseases related to muscle loss are on the rise. Human muscle mass declines by more than 1% annually after age 40, and by age 80, 50% of peak muscle mass has been lost. Therefore, muscle loss in old age is recognized as the most significant cause of overall decline in physical function. The incidence of these muscle diseases is on the rise worldwide compared to the past.

하지만, 근육질환은 그 원인이 다른 질환에 비해 다양하기 때문에 정확한 진단이 쉽지 않고, 그 종류에 따라 증상 및 질환의 강도도 다양하며, 희귀 질환의 형태로 정확한 메커니즘이 밝혀지지 못한 경우가 많다. 또, 근육질환은 그 증상이 급격하게 진행되고, 근육질환 환자들은 상기 질환이 진행됨에 따라 혼자서는 일상적인 생활이 어려울 정도로 고통 받고 있으나, 근본적인 관련 질환에 대한 치료제나 이를 예방할 수 있는 유효한 물질들은 거의 없는 실정이다. However, muscle diseases have diverse causes compared to other diseases, making accurate diagnosis challenging. Symptoms and severity vary depending on the type. Furthermore, many rare diseases have unknown mechanisms. Furthermore, muscle diseases progress rapidly, and patients often struggle to function independently as the disease progresses. However, there are virtually no effective treatments or preventative agents for the underlying conditions.

한편, "만병초(Rhododendron brachycarpum)"는 진달래과에 속하는 식물로, 예로부터 천식, 기침, 가래 등 기관지 질환에 효능이 좋다고 알려져 있다. "당삼(Codonopsis pilosulate radix)"은 도라지과 식물로 예로부터 뿌리를 주로 사용하였으며 백혈구 증가, 폐암에 효능이 있는 것으로 알려져 있다. "고삼(Sophora flavescens)"은 콩과에 속하는 식물로 예로부터 주로 뿌리부위를 사용하였으며 혈당을 낮추거나 항종양, 항균, 면역기능 억제 작용 등이 알려져 있다. Meanwhile, "Rhododendron brachycarpum" is a plant in the Ericaceae family, and has been known since ancient times to be effective in treating bronchial diseases such as asthma, coughs, and phlegm. "Codonopsis pilosulate radix" is a plant in the Platycodon grandiflorum family, and its roots have been used since ancient times, and it is known to be effective in increasing white blood cells and treating lung cancer. "Sophora flavescens" is a plant in the legume family, and its roots have been used since ancient times, and it is known to have blood sugar-lowering, anti-tumor, antibacterial, and immune-suppressing effects.

그러나, 만병초, 당삼, 고삼, 또는 이로부터 분리된 이카리사이드 비2, 크레오사이드 Ⅳ 또는 쿠라리디놀에 대하여 근육 관련 질환의 예방 또는 치료 효과, 근기능 개선에 대해서는 기존에 전혀 알려진 바가 없었다.However, there was no previous information on the preventive or therapeutic effects of muscle-related diseases or improvement of muscle function for Manbyungcho, Dansam, Gosam, or Icariside B2, Creoside IV, or Curaridinol isolated therefrom.

이러한 배경 하에 본 발명자들은 천연 소재 유래의 물질로부터 근육관련 질환의 예방 또는 치료나 근기능 개선에 효과가 있는 조성물을 개발하고자 예의 노력한 결과, 만병초, 당삼, 고삼 추출물 또는 이로부터 분리된 유효물질인 이카리사이드 비2, 크레오사이드 Ⅳ 또는 쿠라리디놀이 효과가 있음을 확인함으로써 본 발명을 완성하였다.Against this backdrop, the inventors of the present invention have made great efforts to develop a composition effective in preventing or treating muscle-related diseases or improving muscle function from a substance derived from a natural material, and as a result, have confirmed that extracts of Manbyungcho, Dansam, and Gosam, or effective substances isolated therefrom, such as Icariside B2, Creoside IV, or Curaridinol, are effective, thereby completing the present invention.

대한민국 공개특허 제10-2016-0066253호Republic of Korea Publication Patent No. 10-2016-0066253

본 발명의 목적은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 조성물을 제공하는 것이다.The purpose of the present invention is to provide a composition for preventing or treating muscle disease or improving muscle function, which comprises an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명의 다른 목적은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 약학적 조성물을 제공하는 것이다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명의 다른 목적은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 의약외품 조성물을 제공하는 것이다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명의 다른 목적은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 식품 조성물을 제공하는 것이다.Another object of the present invention is to provide a food composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명의 다른 목적은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 건강기능식품을 제공하는 것이다.Another object of the present invention is to provide a health functional food for preventing or treating muscle disease or improving muscle function, which contains an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명의 다른 목적은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 사료 조성물을 제공하는 것이다.Another object of the present invention is to provide a feed composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명의 다른 목적은 만병초로부터 만병초 추출물을 수득하는 단계; 당삼으로부터 당삼 추출물을 수득하는 단계; 또는 고삼으로부터 고삼 추출물을 수득하는 단계를 포함하는, 근육질환 예방 또는 치료용 또는 근기능 개선용 조성물 제조방법을 제공하는 것이다.Another object of the present invention is to provide a method for preparing a composition for preventing or treating muscle disease or improving muscle function, comprising the steps of obtaining a Manbyungcho extract from Manbyungcho; obtaining a Dansam extract from Dansam; or obtaining a Sophora ginseng extract from Sophora ginseng.

본 발명의 다른 목적은 만병초 추출물로부터 이카리사이드 비2를 분리하는 단계; 당삼 추출물로부터 크레오사이드 IV를 분리하는 단계; 또는 고삼 추출물로부터 쿠라리디놀을 분리하는 단계를 포함하는, 근육질환 예방 또는 치료용 또는 근기능 개선용 조성물 제조방법을 제공하는 것이다.Another object of the present invention is to provide a method for preparing a composition for preventing or treating muscle disease or improving muscle function, comprising the steps of isolating icariside B2 from a Manbyungcho extract; isolating creaoside IV from a Dansam extract; or isolating curaridinol from a Gosam extract.

이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

상기 목적을 달성하기 위한 일 양태로서, 본 발명은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 약학적 조성물을 제공한다.As one aspect for achieving the above object, the present invention provides a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명에서 용어 "추출물"은 목적하는 물질, 예컨대 상기 만병초, 당삼 또는 고삼을 다양한 용매에 침지한 다음, 상온 또는 가온 상태에서 일정시간 동안 추출하여 수득한 액상성분, 상기 액상성분으로부터 용매를 제거하여 수득한 고형분 등의 결과물을 의미한다. 뿐만 아니라, 상기 결과물의 희석액, 이들의 농축액, 이들의 조정제물, 정제물 등을 모두 포함하는 것으로 포괄적으로 해석될 수 있다. The term "extract" in the present invention refers to a resultant substance, such as a liquid component obtained by soaking a target substance, such as the above-mentioned Manbyungcho, Dansam, or Gosam, in various solvents and then extracting it for a certain period of time at room temperature or under a temperature, or a solid component obtained by removing the solvent from the liquid component. In addition, it can be comprehensively interpreted to include dilutions of the above-mentioned resultant substances, concentrates thereof, adjusted preparations thereof, purified products, etc.

또한, 본 발명에 따른 만병초, 당삼, 고삼의 부위에 제한 없이, 예를 들어, 잎, 뿌리, 줄기 등으로부터 얻어지는 추출물일 수 있으며, 일 구현예로, 만병초의 잎, 당삼 뿌리 또는 고삼 뿌리 추출물일 수 있다. In addition, according to the present invention, there is no limitation on the parts of the plant, such as Manbyungcho, Dansam, and Gosam, and it may be an extract obtained from, for example, leaves, roots, stems, etc., and in one embodiment, it may be an extract of Manbyungcho leaves, Dansam roots, or Gosam roots.

상기 추출물은 물 또는 다양한 유기용매 등으로 추출하여 수득할 수 있으며, 특별히 이에 제한되지 않으나, 바람직하게는 물, 탄소수 1 내지 4의 알코올 및 또는 이들의 혼합 용매로 추출할 수 있다. 또한, 상기 추출물을 수득하기 위한 방법 역시 특별히 이에 제한되지 않으나, 바람직하게는 이의 건조물 또는 가공물 등을 상기 용매에 침지하고, 10 내지 25℃의 상온에서 추출하는 냉침 추출법, 40 내지 100℃로 가열하여 추출하는 가열 추출법, 초음파를 가하여 추출하는 초음파 추출법, 환류냉각기를 이용한 환류추출법 등의 방법을 사용할 수 있다. The above extract can be obtained by extraction with water or various organic solvents, and is not particularly limited thereto, but preferably, water, alcohol having 1 to 4 carbon atoms, and/or a mixed solvent thereof can be extracted. In addition, the method for obtaining the above extract is also not particularly limited thereto, but preferably, a cold immersion extraction method in which the dried or processed product thereof is immersed in the above solvent and extracted at room temperature of 10 to 25°C, a heating extraction method in which the dried or processed product thereof is immersed in the above solvent and extracted, a heat extraction method in which the dried or processed product is heated to 40 to 100°C and extracted, an ultrasonic extraction method in which ultrasonic waves are applied to extract, a reflux extraction method using a reflux condenser, etc. can be used.

상기 추출용매는 중량의 1~20배 첨가하여 추출하는 것이 바람직하며, 더 바람직하게는 10배 첨가하는 것이다. 추출온도는 10~45℃인 것이 바람직하나 이에 한정하지 않는다. 또한, 추출시간은 1~5일인 것이 바람직하며, 3일이 가장 바람직하나 이에 한정하지 않는다. 건조는 감압건조, 진공건조, 비등건조, 분무건조 또는 동결건조하는 것이 바람직하며, 더 바람직하게는 동결건조이나 이에 한정하지 않는다. The above extraction solvent is preferably added in an amount of 1 to 20 times its weight, more preferably 10 times its weight. The extraction temperature is preferably 10 to 45°C, but is not limited thereto. In addition, the extraction time is preferably 1 to 5 days, and 3 days is most preferred, but is not limited thereto. Drying is preferably performed by reduced pressure drying, vacuum drying, boiling drying, spray drying, or freeze drying, and is more preferably freeze drying, but is not limited thereto.

본 발명에서 용어 "분획물"은 다양한 구성성분을 포함하는 혼합물로부터 특정 성분 또는 특정 그룹을 분리하는 분획방법에 의하여 얻어진 결과물을 의미한다. 본 발명에 있어서, 상기 분획물은 상기 만병초, 당삼 또는 고삼 추출물을 다양한 분획방법에 적용하여 수득한 분획물로 해석될 수 있다. 상기 분획방법은 특별히 이에 제한되지 않으나, 다양한 용매를 처리하여 수행하는 용매 분획법, 일정한 분자량 컷-오프 값을 갖는 한외 여과막을 통과시켜 수행하는 한외여과 분획법 또는 크로마토그래피 분획법 등일 수 있다. 또한, 상기 용매 분획법에 사용되는 용매는 극성 용매 또는 비극성 용매를 특별한 제한없이 사용할 수 있다.In the present invention, the term "fraction" refers to a result obtained by a fractionation method for separating a specific component or a specific group from a mixture containing various components. In the present invention, the fraction may be interpreted as a fraction obtained by applying the extract of the above-mentioned Myrtle, Angelica, or Sophora japonica to various fractionation methods. The fractionation method is not particularly limited thereto, but may be a solvent fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed by passing the extract through an ultrafiltration membrane having a certain molecular weight cut-off value, a chromatography fractionation method, etc. In addition, the solvent used in the solvent fractionation method may be a polar solvent or a non-polar solvent without any particular limitation.

본 발명에서 '이카리사이드 비2'는 하기 화학식 1로 표시될 수 있다.In the present invention, 'Icariside B2' can be represented by the following chemical formula 1.

[화학식 1][Chemical Formula 1]

상기 이카리사이드 비2는 C19H30O8의 화학식을 갖는 유기 화합물이다.The above Icaricide B2 is an organic compound having the chemical formula C 19 H 30 O 8 .

본 발명에 따른 이카리사이드 비2는 만병초의 잎, 줄기, 뿌리 등을 포함한 부위에서 분리될 수 있고, 일 구현예로, 만병초 잎 추출물로부터 분리된 것일 수 있다. 그외에도, 본 발명에 따른 이카리사이드 비2의 물질이 동일하다면, 동 기술분야에 알려진 화학적 합성, 또는 그외 다른 출처로부터의 수득, 제조과정에 제한없이, 본 발명의 범주에 포함된다. 또한 상기 이카리사이드 비2는 만병초 추출물을 단독 또는 혼합 용매로 추출하여 수득된 것일 수 있고, 당해 공지된 임의의 용매를 사용할 수 있다.Icariside B2 according to the present invention can be isolated from parts of the plant including the leaves, stems, and roots of the plant, and in one embodiment, can be isolated from an extract of the leaf of the plant. In addition, as long as the material of the Icariside B2 according to the present invention is the same, it is included in the scope of the present invention without limitation in the chemical synthesis known in the art, or in the acquisition or manufacturing process from other sources. In addition, the Icariside B2 can be obtained by extracting the plant extract with a single or mixed solvent, and any solvent known in the art can be used.

본 발명에 따른 만병초 추출물은 이카리사이드 비2를 포함한 추출물일 수 있다. The extract of Manbyungcho according to the present invention may be an extract containing Icariside B2.

본 발명에서 '크레오사이드 IV'는 하기 화학식 2로 표시될 수 있다.In the present invention, ‘creoside IV’ can be represented by the following chemical formula 2.

[화학식 2][Chemical Formula 2]

상기 크레오사이드 IV는 C17H32O10의 화학식을 갖는 유기 화합물이다.The above creatine IV is an organic compound having the chemical formula C 17 H 32 O 10 .

본 발명에 따른 크레오사이드 Ⅳ는 당삼의 부위에 제한 없이 추출물을 수득한 후 그로부터 분리될 수 있고, 일 예로, 당삼 뿌리 추출물로부터 분리된 것일 수 있다.Creoside IV according to the present invention can be obtained from an extract of any part of the ginseng plant without limitation and then separated therefrom. For example, it can be separated from a ginseng root extract.

그외에도, 본 발명에 따른 크레오사이드 Ⅳ의 물질이 동일하다면, 동 기술분야에 알려진 화학적 합성, 또는 그외 다른 출처로부터의 수득, 제조과정의 제한없이, 본 발명의 범주에 포함된다.In addition, if the substance of Creoside IV according to the present invention is the same, it is included in the scope of the present invention without limitation of chemical synthesis known in the art, or acquisition from other sources, or manufacturing process.

또한 상기 크레오사이드 Ⅳ는 당삼 뿌리 추출물의 단독 또는 혼합 용매로 추출하여 수득된 것일 수 있고, 당해 공지된 임의의 용매를 사용할 수 있다.In addition, the above-mentioned creoside IV may be obtained by extracting the extract of the root of the ginseng root with a single or mixed solvent, and any known solvent may be used.

본 발명에 따른 당삼 추출물은 크레오사이드 Ⅳ를 포함한 추출물일 수 있다. The ginseng extract according to the present invention may be an extract including creoside IV.

본 발명에서 '쿠라리디놀'은 하기 화학식 3으로 표시될 수 있다.In the present invention, 'curaridinol' can be represented by the following chemical formula 3.

[화학식 3][Chemical Formula 3]

본 발명에서, 쿠라리디놀은 C26H32O7의 화학식을 갖는 유기 화합물이다. In the present invention, curaridinol is an organic compound having the chemical formula C 26 H 32 O 7 .

본 발명에 따른 쿠라리디놀은 고삼의 부위에 제한 없이 추출물을 수득한 후 그로부터 분리될 수 있으나, 일 구현예로, 쿠라리디놀은 고삼 뿌리 추출물로부터 분리된 것일 수 있다.Curaridinol according to the present invention can be obtained by obtaining an extract from any part of Sophora japonica and then separated therefrom, but in one embodiment, curaridinol can be separated from a Sophora japonica root extract.

그외에도, 본 발명에 따른 쿠라리디놀의 물질이 동일하다면, 동 기술분야에 알려진 화학적 합성, 또는 그외 다른 출처로부터의 수득, 제조과정의 제한없이, 본 발명의 범주에 포함된다.In addition, if the material of curaridinol according to the present invention is the same, it is included in the scope of the present invention without limitation of chemical synthesis known in the art, or acquisition from other sources, or manufacturing process.

또한 상기 쿠라리디놀은 고삼 뿌리 추출물의 단독 또는 혼합 용매로 추출하여 수득된 것일 수 있고, 당해 공지된 임의의 용매를 사용할 수 있다.In addition, the above-mentioned curaridinol may be obtained by extracting the root extract of Gosam with a single or mixed solvent, and any known solvent may be used.

본 발명에 따른 고삼 추출물은 쿠라리디놀을 포함한 추출물일 수 있다.The ginseng extract according to the present invention may be an extract containing curaridinol.

본 발명에서 '근'은 심줄, 근육, 건을 포괄적으로 지칭한다. '근력'은 근육의 수축에 의해 힘을 발휘할 수 있는 능력을 의미하며, 상기 근력은 근육량에 비례한다. '근력개선'은 근원세포를 근육세포로 분화시켜 근육량을 증가시키고, 신체 수행능력의 개선, 최대 지구력의 개선, 근육 회복의 강화, 근육 피로의 감소, 에너지 수지를 개선시키는 것을 의미한다. 또한 이러한 근력은 신체의 '운동성' 또는 '운동수행능력'과 관련이 있다. '운동수행능력'이란 일상생활이나 스포츠에서 수행되는 신체동작을 빠르게, 강하게, 오래, 능숙하게 할 수 있는 능력을 말하며, '운동수행능력 개선'이란 근력, 근지구력과 같은 근 기능 개선 효과를 의미한다. 또한, '근력 약화'는 한 개 또는 그 이상의 근육의 힘이 감소된 상태를 의미한다. 상기 근력 약화는 어느 한 근육이나, 몸의 한쪽, 상지나 하지 등에 국한될 수도 있고, 전신에 걸쳐 나타날 수도 있다. 또한 근피로나 근육통을 포함하는 주관적인 근력 약화 증상은 이학적 검진을 통해 객관적인 방법으로 정량화될 수 있다.In the present invention, "muscle" comprehensively refers to tendons, muscles, and tendons. "Muscle strength" refers to the ability of a muscle to exert force through contraction, and muscle strength is proportional to muscle mass. "Improving muscle strength" refers to increasing muscle mass by differentiating myogenic cells into muscle cells, thereby improving physical performance, maximal endurance, enhancing muscle recovery, reducing muscle fatigue, and improving energy balance. Furthermore, this muscle strength is related to the body's "mobility" or "exercise performance ability." "Exercise performance ability" refers to the ability to perform physical movements performed in daily life or sports quickly, strongly, for a long time, and skillfully, and "improving exercise performance ability" refers to the effect of improving muscle functions such as muscle strength and endurance. Furthermore, "muscle weakness" refers to a state in which the strength of one or more muscles is reduced. The muscle weakness may be limited to a single muscle, one side of the body, the upper or lower limbs, or may occur throughout the body. Additionally, subjective symptoms of muscle weakness, including muscle fatigue and muscle pain, can be objectively quantified through physical examination.

또한, 본 명세서에서 '근육 질환'은 근기능 저하, 근육 소모 또는 근육 퇴화로 인한 근육질환으로 당업계에 보고된 질병 또는 상태를 말한다. 상기 근육 소모 또는 퇴화는 유전적 요인, 후천적 요인, 노화 등을 원인으로 발생하며, 근육 소모는 근육량의 점진적 손실, 근육, 특히 골격근 또는 수의근 및 심장근육의 약화 및 퇴행을 특징으로 한다. 이와 관련된 질환의 예로는 근손실, 근감소, 긴장감퇴증(atony), 근위축증(muscular atrophy), 근이영양증(muscular dystrophy), 근육 퇴화, 근무력증, 악액질(cachexia), 심위축증(cardiotrophy) 및 근육감소증(sarcopenia) 등을 들 수 있다. 본 발명의 조성물은 근육량 증대 효과가 있으며, 근육은 그 종류를 제한하지 않는다.In addition, the term "muscle disease" in this specification refers to a disease or condition reported in the art as a muscle disease caused by muscle dysfunction, muscle wasting, or muscle degeneration. The muscle wasting or degeneration is caused by genetic factors, acquired factors, aging, etc., and muscle wasting is characterized by a gradual loss of muscle mass, and weakening and degeneration of muscles, particularly skeletal muscles or voluntary muscles and cardiac muscles. Examples of diseases related thereto include muscle wasting, sarcopenia, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy, and sarcopenia. The composition of the present invention has a muscle mass increasing effect, and the type of muscle is not limited.

본 발명의 조성물은 일 예로, 근원세포의 분화 촉진을 통해, 근감소증, 근위축증 등 상기 언급된 질환 또는 상태의 예방, 개선, 치료 효능을 가지고 있다.The composition of the present invention has, for example, the efficacy of preventing, improving, and treating the above-mentioned diseases or conditions, such as sarcopenia and muscular dystrophy, by promoting differentiation of myogenic cells.

이러한 본 발명의 조성물은, 이에 제한되는 것은 아니나, 약학적 조성물, 식품(식품 첨가제 포함) 조성물, 의약외품 조성물, 사료(사료 첨가제) 조성물, 화장료 조성물 등의 외용형태의 다양한 조성물의 형태로 구현될 수 있다.The composition of the present invention can be implemented in the form of various external compositions, including, but not limited to, pharmaceutical compositions, food (including food additives) compositions, quasi-drug compositions, feed (feed additive) compositions, and cosmetic compositions.

본 발명의 약학적 조성물은 약학적으로 허용 가능한 담체를 더 포함할 수 있다. 약학적으로 허용되는 담체로 예컨대, 경구 투여용 담체 또는 비경구 투여용 담체를 추가로 포함할 수 있다. 경구 투여용 담체는 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등을 포함할 수 있다.The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. Examples of such pharmaceutically acceptable carriers include carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.

또한 비경구 투여용 담체는 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등을 포함할 수 있다. 또한, 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다.Additionally, carriers for parenteral administration may include water, suitable oils, saline, aqueous glucose, and glycols. They may also contain stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol.

본 발명의 약학적 조성물은 인간을 비롯한 포유동물에 임의의 방법으로 투여할 수 있다. 예를 들어, 경구 또는 비경구로 투여할 수 있으며, 비경구적인 투여방법으로는 이에 제한되는 것은 아니나, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장내 투여일 수 있다.The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal administration.

본 발명의 약학적 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화할 수 있다. 제형화할 경우에는 하나 이상의 완충제(예를 들어, 식염수 또는 PBS (phosphate buffered saline)), 항산화제, 정균제, 킬레이트화제(예를 들어, EDTA 또는 글루타치온), 충진제, 증량제, 결합제, 아쥬반트(예를 들어, 알루미늄 하이드록사이드), 현탁제, 농후제, 습윤제, 붕해제 또는 계면활성제, 희석제 또는 부형제를 사용하여 조제될 수 있다.The pharmaceutical composition of the present invention may be formulated as a preparation for oral or parenteral administration, depending on the route of administration as described above. When formulated, it may be prepared using one or more buffers (e.g., saline or PBS (phosphate buffered saline)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, or surfactants, diluents, or excipients.

경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 또는 캡슐제 등이 포함되며, 이러한 고형제제는 본 발명의 약학적 조성물과 적어도 하나 이상의 부형제, 예를 들면, 전분(옥수수 전분, 밀 전분, 쌀 전분, 감자 전분 등 포함), 칼슘카보네이트(calcium carbonate), 수크로스(sucrose), 락토오스(lactose), 덱스트로오스, 솔비톨, 만니톨, 자일리톨, 에리스리톨 말티톨, 셀룰로즈, 메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 또는 젤라틴 등을 섞어 조제될 수 있다. 예컨대, 활성성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제 또는 당의정제를 수득할 수 있다.Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, capsules, etc., and these solid preparations can be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or sugar-coated tablets can be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.

단순한 부형제 이외에 마그네슘 스티레이트 탈크(Talc) 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제 또는 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물 또는 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면, 습윤제, 감미제, 방향제 또는 보존제 등이 포함될 수 있다. 또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있으며, 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water or liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, or preservatives may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants, and anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, and preservatives may be additionally included.

비경구적으로 투여하는 경우 본 발명의 약학적 조성물은 적합한 비경구용 담체와 함께 주사제, 경피 투여제 및 비강 흡입제의 형태로 당업계에 공지된 방법에 따라 제형화될 수 있다. 상기 주사제의 경우에는 반드시 멸균되어야 하며 박테리아 및 진균과 같은 미생물의 오염으로부터 보호되어야 한다. 주사제의 경우 적합한 담체의 예로는 이에 한정되지는 않으나, 물, 에탄올, 폴리올(예를 들어, 글리세롤, 프로필렌 글리콜 및 액체 폴리에틸렌 글리콜 등), 이들의 혼합물 및/또는 식물유를 포함하는 용매 또는 분산매질일 수 있다. 보다 바람직하게는, 적합한 담체로는 행크스 용액, 링거 용액, 트리에탄올 아민이 함유된 PBS 또는 주사용 멸균수, 10 % 에탄올, 40 % 프로필렌 글리콜 및 5 % 덱스트로즈와 같은 등장 용액 등을 사용할 수 있다. 상기 주사제를 미생물 오염으로부터 보호하기 위해서는 파라벤, 클로로부탄올, 페놀, 소르빈산, 티메로살 등과 같은 다양한 항균제 및 항진균제를 추가로 포함할 수 있다. 또한, 상기 주사제는 대부분의 경우 당 또는 나트륨 클로라이드와 같은 등장화제를 추가로 포함할 수 있다.When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of injections, transdermal administration agents, and nasal inhalants together with a suitable parenteral carrier according to methods known in the art. The injections must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and/or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the injections from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal may be additionally included. Additionally, the above injections may in most cases additionally contain isotonic agents such as sugar or sodium chloride.

경피 투여제의 경우 연고제, 크림제, 로션제, 겔제, 외용액제, 파스타제, 리니멘트제, 에어롤제 등의 형태가 포함된다. 여기에서 '경피 투여'는 약학적 조성물을 국소적으로 피부에 투여하여 약학적 조성물에 함유된 유효한 양의 활성성분이 피부 내로 전달되는 것을 의미한다.Transdermal administration includes ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. "Transdermal administration" here refers to topically administering a pharmaceutical composition to the skin, thereby delivering an effective amount of the active ingredient contained in the pharmaceutical composition into the skin.

흡입 투여제의 경우, 본 발명에 따라 사용되는 조성물은 적합한 추진제, 예를 들면, 디클로로플루오로메탄, 트리클로로플루오로메탄, 디클로로테트라플루오로에탄, 이산화탄소 또는 다른 적합한 기체를 사용하여, 가압 팩 또는 연무기로부터 에어로졸 스프레이 형태로 편리하게 전달 할 수 있다. 가압 에어로졸의 경우, 투약 단위는 계량된 양을 전달하는 밸브를 제공하여 결정할 수 있다. 예를 들면, 흡입기 또는 취입기에 사용되는 젤라틴 캡슐 및 카트리지는 화합물, 및 락토즈 또는 전분과 같은 적합한 분말 기제의 분말 혼합물을 함유하도록 제형화할 수 있다. 비경구 투여용 제형은 모든 제약 화학에 일반적으로 공지된 처방서인 문헌(Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour)에 기재되어 있다.For inhalation administration, the compositions used according to the present invention may conveniently be delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or another suitable gas. For pressurized aerosols, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in the well-known prescription book of pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).

본 발명의 약학적 조성물은 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 또는 생물학적 반응조절제를 사용하는 방법들과 병행하여 사용될 수 있다.The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy or biological response modifiers.

상기 목적을 달성하기 위한 또 다른 양태로서, 본 발명은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 의약외품 조성물을 제공한다.As another aspect for achieving the above object, the present invention provides a pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명에서 사용되는 용어 "의약외품"은 사람이나 동물의 질병을 진단, 치료, 경감, 처치 또는 예방할 목적으로 사용하는 물품 중 기구, 기계 또는 장치가 아닌 것 및 사람이나 동물의 구조와 기능에 약리학적 영향을 줄 목적으로 사용하는 물품 중 기구, 기계 또는 장치가 아닌 것을 제외한 물품을 의미하며, 일 구체예로 내복용 제제를 포함할 수 있으나 이에 제한되는 것이 아니며, 의약외품의 제제화 방법, 용량, 이용방법, 구성성분 등은 기술분야에 공지된 통상의 기술로부터 적절히 선택될 수 있다.The term "quasi-drug" used in the present invention means an article other than a device, machine or apparatus used for the purpose of diagnosing, treating, alleviating, managing or preventing a disease of a human or animal, and an article other than a device, machine or apparatus used for the purpose of exerting a pharmacological effect on the structure and function of a human or animal, and may include, but is not limited to, an oral preparation, and the method of formulation, dosage, method of use, components, etc. of a quasi-drug may be appropriately selected from conventional techniques known in the art.

본 발명의 의약외품 조성물에는 상기 성분 외에 필요에 따라 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 더욱 포함할 수 있다. 상기 약학적으로 허용 가능한 담체, 부형제 또는 희석제는 본 발명의 효과를 해하지 않는 한 제한되지 않으며, 예를 들어 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제, 윤활제, 감미제, 방향제, 보존제 등을 포함할 수 있다.In addition to the above-mentioned ingredients, the quasi-drug composition of the present invention may further include a pharmaceutically acceptable carrier, excipient, or diluent, as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effects of the present invention, and may include, for example, fillers, bulking agents, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc.

상기 목적을 달성하기 위한 또 다른 양태로서, 본 발명은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 식품 조성물을 제공한다.As another aspect for achieving the above object, the present invention provides a food composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명의 식품 조성물은 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food), 식품 첨가제(food additives), 및 사료 등의 모든 형태를 포함하며, 인간 또는 가축을 비롯한 동물을 취식대상으로 한다. 상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.The food composition of the present invention includes all forms, including functional foods, nutritional supplements, health foods, food additives, and feeds, and is intended for consumption by humans or animals, including livestock. The above-mentioned types of food compositions can be manufactured in various forms using conventional methods known in the art.

상기 유형의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다. 일반 식품으로는 이에 한정되지 않지만 음료(알콜성 음료 포함), 과실 및 그의 가공식품(과일통조림, 병조림, 잼, 마아말레이드 등), 어류, 육류 및 그 가공식품(햄, 소시지 콘비이프 등), 빵류 및 면류(우동, 메밀국수, 라면, 스파게이트, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(버터, 치즈 등), 식용식물 유지, 마가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(된장, 간장, 소스 등) 등에 상기 유효성분을 첨가하여 제조할 수 있다. The above type of food composition can be manufactured in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (canned fruits, bottled fruits, jams, marmalades, etc.), fish, meats and processed foods thereof (ham, sausages, corned beef, etc.), breads and noodles (udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, taffy, dairy products (butter, cheese, etc.), edible plant oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (soybean paste, soy sauce, sauces, etc.), etc., and the above-mentioned effective ingredient can be added thereto to manufacture the composition.

또한, 영양보조제로는 캡슐, 정제, 환 등에 상기 유효성분을 첨가하여 제조할 수 있다. 또한, 건강기능식품으로는 이에 한정되지 않지만 예를 들면, 차, 주스 및 드링크의 형태로 제조하여 건강음료로 음용할 수 있도록 액상화, 과립화, 캡슐화 및 분말화하여 섭취할 수 있다. 또한, 상기 만병초, 고삼 또는 당삼을 식품 첨가제의 형태로 사용하기 위해서는 분말 또는 농축액 형태로 제조하여 사용할 수 있다. 또한, 근력개선에 효과가 있다고 알려진 공지의 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.In addition, nutritional supplements can be manufactured by adding the above-mentioned active ingredients to capsules, tablets, pills, etc. Furthermore, health functional foods can be manufactured in the form of tea, juice, and drinks, for example, and can be consumed by liquefying, granulating, encapsulating, or powdering them so that they can be consumed as health drinks. In addition, in order to use the above-mentioned Manbyungcho, Sosam, or Dansam in the form of a food additive, they can be manufactured and used in the form of a powder or concentrate. In addition, they can be manufactured in the form of a composition by mixing them with known active ingredients known to be effective in improving muscle strength.

상기 외에 본 발명의 건강식품은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산, 펙트산의 염, 알긴산, 알긴산의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올 또는 탄산화제 등을 함유할 수 있다.In addition to the above, the health food of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents.

상기 목적을 달성하기 위한 또 다른 양태로서, 본 발명은 만병초 추출물, 당삼 추출물, 고삼 추출물, 이카리사이드 비2, 크레오사이드 IV, 또는 쿠라리디놀을 유효성분으로 포함하는 근육 질환 예방 또는 치료용 또는 근기능 개선용 사료 조성물을 제공한다.As another aspect for achieving the above object, the present invention provides a feed composition for preventing or treating muscle disease or improving muscle function, comprising an extract of Manbyungcho, an extract of Dansam, an extract of Sophora japonica, Icariside B2, Creoside IV, or Curaridinol as an active ingredient.

본 발명에 있어서, 상기 사료 조성물은, 통상의 사료 형태로 제제화될 수 있고, 알려진 사료성분을 함께 포함할 수 있다. 또한, 사용되는 사료에 첨가제 형태로 가미되는, 사료첨가제로서도 사용될 수 있다. 본 발명의 사료첨가제는 사료관리법상의 보조사료에 해당하며, 탄산수소나트륨(중조), 벤토나이트(bentonite), 산화마그네슘, 복합광물질 등의 광물질제제, 아연, 구리, 코발트, 셀레늄 등의 미량 광물질인 미네랄제제, 케로틴, 비타민 E, 비타민 A, D, E, 니코틴산, 비타민 B 복합체 등의 비타민제, 메티오닌, 리이산 등의 보호아미노산제, 지방산 칼슘염 등의 보호지방산제, 생균제(유산균제), 효모배양물, 곰팡이 발효물 등의 생균, 효모제 등이 추가로 포함될 수 있다.In the present invention, the feed composition may be formulated in the form of a conventional feed and may include known feed ingredients. In addition, it may also be used as a feed additive added in the form of an additive to the feed being used. The feed additive of the present invention corresponds to a supplementary feed under the Feed Management Act, and may additionally include mineral preparations such as sodium bicarbonate (sodium bicarbonate), bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamins such as carotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex; protected amino acids such as methionine and lysate; protected fatty acids such as fatty acid calcium salts; live bacteria such as probiotics (lactic acid bacteria), yeast cultures, and mold fermentations; and yeast agents.

본 발명의 사료 또는 사료첨가제는 포유류, 가금 및 어류를 포함하는 다수의 동물식이에 적용할 수 있다.The feed or feed additive of the present invention can be applied to a number of animal diets including mammals, poultry, and fish.

상기 목적을 달성하기 위한 또 다른 양태로서, 본 발명은 만병초로부터 만병초 추출물을 수득하는 단계; 당삼으로부터 당삼 추출물을 수득하는 단계; 또는 고삼으로부터 고삼 추출물을 수득하는 단계를 포함하는, 근육질환 예방 또는 치료용 또는 근기능 개선용 조성물 제조방법을 제공한다.As another aspect for achieving the above object, the present invention provides a method for preparing a composition for preventing or treating muscle disease or improving muscle function, comprising the steps of obtaining a Manbyungcho extract from Manbyungcho; obtaining a Dansam extract from Dansam; or obtaining a Sophora chinensis extract from Sophora chinensis.

본 발명에 있어서, 상기 만병초 추출물은 이카리사이드 비2를 유효성분으로 포함한다. In the present invention, the extract of the common ginseng contains Icariside B2 as an effective ingredient.

본 발명에 있어서, 상기 당삼 추출물은 크레오사이드 IV를 유효성분으로 포함한다.In the present invention, the above-mentioned ginseng extract contains creoside IV as an effective ingredient.

본 발명에 있어서, 상기 고삼 추출물은 쿠라리디놀을 유효성분으로 포함한다.In the present invention, the above-mentioned red ginseng extract contains curaridinol as an effective ingredient.

상기 목적을 달성하기 위한 또 다른 양태로서, 본 발명은 만병초 추출물로부터 이카리사이드 비2를 분리하는 단계; 당삼 추출물로부터 크레오사이드 IV를 분리하는 단계; 또는 고삼 추출물로부터 쿠라리디놀을 분리하는 단계를 포함하는, 근육 질환 예방 또는 근기능 개선용 조성물 제조방법을 제공한다.In another aspect for achieving the above object, the present invention provides a method for preparing a composition for preventing muscle disease or improving muscle function, comprising the steps of isolating icariside B2 from a Manbyungcho extract; isolating creaoside IV from a Dansam extract; or isolating curaridinol from a Gosam extract.

본 발명의 만병초, 당삼, 또는 고삼 추출물 또는 이로부터 분리된 물질은 근육 질환 예방 또는 치료용 또는 근기능 개선용 효과를 가지고 있어, 의약품, 식품 등의 소재로 활용가능하다. The extract of the present invention, or a substance isolated therefrom, of the common ginseng, the common ginseng, or the common ginseng has an effect of preventing or treating muscle diseases or improving muscle function, and can be used as a material for medicines, foods, etc.

도 1은 이카리사이드 비2(icariside B2)의 구조(도 1A) 및 분리 모식도(도 1B)를 나타낸 것이다.
도 2는 크레오사이드 Ⅳ(creoside Ⅳ)의 구조(도 2A) 및 분리 모식도(도 2B)를 나타낸 것이다.
도 3은 쿠라리디놀(kuraridinol)의 구조(도 3A) 및 분리 모식도(도 3B)를 나타낸 것이다.
도 4는 이카리사이드 비2 구조 확인을 위한 핵자기공명(NMR)측정 결과를 나타낸 것이다(도 4A: 1H NMR, 도 4B: 13C NMR).
도 5는 크레오사이드 Ⅳ 구조 확인을 위한 핵자기공명(NMR)측정 결과를 나타낸 것이다(도 5A: 1H NMR, 도 5B: 13C NMR).
도 6은 쿠라리디놀 구조 확인을 위한 핵자기공명(NMR)측정 결과를 나타낸 것이다(도 6A: 1H NMR, 도 6B: 13C NMR).
도 7은 항암제로 유도된 근위축 제브라피쉬모델에서 이카리사이드 비2 처리에 따른 근위축에 의한 미토콘드리아 손상에 미치는 영향을 확인한 EGFP 형광발현 이미지(도 7A) 및 정량 분석 결과(도 7B)를 나타낸 것이다.
도 8은 항암제로 유도된 근위축 제브라피쉬모델에서 크레오사이드 Ⅳ 처리에 따른 근위축에 의한 미토콘드리아 손상에 미치는 영향을 확인한 EGFP 형광발현 이미지(도 8A) 및 정량 분석 결과(도 8B)이다.
도 9는 항암제로 유도된 근위축 제브라피쉬모델에서 쿠라리디놀 처리에 따른 근위축에 의한 미토콘드리아 손상에 미치는 영향을 확인한 EGFP 형광발현 이미지(도 9A) 및 정량 분석 결과(도 9B)이다.
도 10은 이카리사이드 비2 처리에 따른 MyoD(도 10A), myogenin(도 10B)의 유전자 발현을 RT-qPCR로 측정한 결과를 나타낸 것이다.
도 11은 크레오사이드 Ⅳ 처리에 따른 MyoD(도 11A), myogenin(도 11B)의 유전자 발현을 RT-qPCR로 측정한 결과이다.
도 12는 쿠라리디놀 처리에 따른 MyoD(도 12A), myogenin(도 12B)의 유전자 발현을 RT-qPCR로 측정한 결과이다.
도 13은 이카리사이드 비2 처리에 따른 Myh1(도 13A), Myh2(도 13B), Myh4(도 13C), Myh7(도 13D)의 유전자 발현을 RT-qPCR로 측정한 결과를 나타낸 것이다.
도 14는 크레오사이드 Ⅳ 처리에 따른 Myh1(도 14A), Myh2(도 14B), Myh4(도 14C), Myh7(도 14D)의 유전자 발현을 RT-qPCR로 측정한 결과이다.
도 15는 쿠라리디놀 처리에 따른 Myh1(도 15A), Myh2(도 15B), Myh4(도 15C), Myh7(도 15D)의 유전자 발현을 RT-qPCR로 측정한 결과이다.
도 16은 이카리사이드 비2 처리에 따른 MHC-양성 근관세포 이미지(도 16A)와 다핵성 MHC-양성 근관세포 비율(도 16B)을 면역형광 염색(immunofluorescence staining)으로 확인한 결과를 나타낸 것이다.
도 17은 크레오사이드 Ⅳ 처리에 따른 MHC-양성 근관세포 이미지(도 17A)와 다핵성 MHC-양성 근관세포 분포(도 17B)를 면역형광 염색(immunofluorescence staining)으로 확인한 결과이다.
도 18은 쿠라리디놀 처리에 따른 MHC-양성 근관세포 이미지(도 18A)와 다핵성 MHC-양성 근관세포 분포 및 비율(도 18B)을 면역형광 염색(immunofluorescence staining)으로 확인한 결과이다.
도 19는 이카리사이드 비2 처리에 따른 COX2(도 19A), ATPase6(도 19B) 및 SIRT3(도 19C)의 유전자 발현을 RT-qPCR로 측정한 결과를 나타낸 것이다.
도 20은 크레오사이드 Ⅳ 처리에 따른 SDHA(도 20A), DRP1(도 20B)의 유전자 발현을 RT-qPCR로 측정한 결과이다.
Figure 1 shows the structure (Figure 1A) and separation schematic diagram (Figure 1B) of icariside B2.
Figure 2 shows the structure (Figure 2A) and separation schematic diagram (Figure 2B) of creoside Ⅳ.
Figure 3 shows the structure (Figure 3A) and separation schematic diagram (Figure 3B) of kuraridinol.
Figure 4 shows the results of nuclear magnetic resonance (NMR) measurements to confirm the structure of Icaricide B2 (Figure 4A: 1 H NMR, Figure 4B: 13 C NMR).
Figure 5 shows the results of nuclear magnetic resonance (NMR) measurements to confirm the structure of creoside IV (Figure 5A: 1 H NMR, Figure 5B: 13 C NMR).
Figure 6 shows the results of nuclear magnetic resonance (NMR) measurements to confirm the structure of curaridinol (Figure 6A: 1 H NMR, Figure 6B: 13 C NMR).
Figure 7 shows the EGFP fluorescence expression image (Figure 7A) and quantitative analysis results (Figure 7B) that confirmed the effect of icaric acid bi2 treatment on mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy induced by an anticancer agent.
Figure 8 shows an EGFP fluorescence expression image (Figure 8A) and quantitative analysis results (Figure 8B) confirming the effect of creoside IV treatment on mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy induced by an anticancer agent.
Figure 9 shows an EGFP fluorescence expression image (Figure 9A) and quantitative analysis results (Figure 9B) confirming the effect of curaridinol treatment on mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy induced by an anticancer agent.
Figure 10 shows the results of RT-qPCR measurement of gene expression of MyoD (Figure 10A) and myogenin (Figure 10B) according to Icariside B2 treatment.
Figure 11 shows the results of RT-qPCR measurement of gene expression of MyoD (Figure 11A) and myogenin (Figure 11B) according to creoside IV treatment.
Figure 12 shows the results of RT-qPCR measurement of gene expression of MyoD (Figure 12A) and myogenin (Figure 12B) according to curaridinol treatment.
Figure 13 shows the results of RT-qPCR measurement of gene expression of Myh1 (Figure 13A), Myh2 (Figure 13B), Myh4 (Figure 13C), and Myh7 (Figure 13D) according to Icariside B2 treatment.
Figure 14 shows the results of measuring the gene expression of Myh1 (Figure 14A), Myh2 (Figure 14B), Myh4 (Figure 14C), and Myh7 (Figure 14D) according to Creoside IV treatment using RT-qPCR.
Figure 15 shows the results of RT-qPCR measurement of gene expression of Myh1 (Figure 15A), Myh2 (Figure 15B), Myh4 (Figure 15C), and Myh7 (Figure 15D) according to curaridinol treatment.
Figure 16 shows the results of immunofluorescence staining for the MHC-positive myotube cell image (Figure 16A) and the percentage of multinucleated MHC-positive myotube cells (Figure 16B) according to Icaricide B2 treatment.
Figure 17 shows the results of immunofluorescence staining for the image of MHC-positive myotube cells (Figure 17A) and the distribution of multinucleated MHC-positive myotube cells (Figure 17B) following Creoside IV treatment.
Figure 18 shows the results of immunofluorescence staining for the image of MHC-positive myotube cells (Figure 18A) and the distribution and ratio of multinucleated MHC-positive myotube cells (Figure 18B) according to curaridinol treatment.
Figure 19 shows the results of RT-qPCR measurement of gene expression of COX2 (Figure 19A), ATPase6 (Figure 19B), and SIRT3 (Figure 19C) according to Icariside B2 treatment.
Figure 20 shows the results of measuring the gene expression of SDHA (Figure 20A) and DRP1 (Figure 20B) according to Creoside IV treatment using RT-qPCR.

이하, 본 발명을 하기 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예만으로 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

실시예 1: 만병초 추출물 및 이카리사이드 비2(Icariside B2) 준비Example 1: Preparation of Manbyungcho extract and Icariside B2

만병초 25 kg을 95% 메탄올로 1주일 동안 2회에 걸쳐 실온 25℃에서 침지 추출하였다. 농축된 메탄올 추출물에 증류수 3 L를 넣어 현탁하였다. 분액 깔대기를 이용하여 동량의 노르말헥산(n-hexane), 클로로포름(chloroform) 에틸아세테이트(ethyl acetate) 및 노르말부탄올(n-butanol)을 이용하여 용매분획을 수행하였다. 노르말부탄올 분획물 320 g에 대하여 컬럼 크로마토 그래피를 수행하였다. 노르말부탄올 분획물 320 g을 실리카 겔 70-230 메쉬(mesh)에 흡착시켜 고체화 한 후에 이를 컬럼에 로딩하고, 전개용매는 클로로포름 및 메탄올을 사용하여 극성을 증가시키는 비율로 진행하여 총 6개의 소분획들을 얻었다(이하 'B1 ~ B6'이라 명명함).25 kg of the plant was extracted by immersion in 95% methanol at room temperature (25℃) twice over one week. The concentrated methanol extract was suspended in 3 L of distilled water. Solvent fractionation was performed using equal volumes of n-hexane, chloroform, ethyl acetate, and n-butanol using a separatory funnel. Column chromatography was performed on 320 g of the n-butanol fraction. 320 g of the n-butanol fraction was solidified by adsorption onto silica gel 70-230 mesh, and then loaded onto the column. chloroform and methanol were used as developing solvents in increasing polarity ratios to obtain a total of six subfractions (hereinafter referred to as 'B1 to B6').

수득한 B2 22 g에 대하여 RP-C18 충진제를 MPLC로 수행하였고, 전개용매는 아세톤 및 메탄올 및 물을 이용하여 29개의 소분획들을 얻었다(이하 'B2-1 ~ B2-29'이라 명명함). 소분획 중 B2-27 2 g에 대하여 실리카 겔 230-400 메쉬(mesh) 충진제를 MPLC로 수행하였고, B2-27-3 300 mg에서 흰색의 결정형태 물질을 얻었으며, 그 결과, 상기 이카리사이드 비2를 수득하였다(도 1 및 도 4).MPLC was performed on 22 g of the obtained B2 using RP-C18 packing, and 29 subfractions were obtained using acetone, methanol, and water as developing solvents (hereinafter referred to as 'B2-1 to B2-29'). MPLC was performed on 2 g of the subfractions B2-27 using silica gel 230-400 mesh packing, and a white crystalline substance was obtained from 300 mg of B2-27-3, and as a result, the above icariside B2 was obtained (Figs. 1 and 4).

흰색 비정질 분말; 전자 이온화 질량 분석기 (EI-MS) m/z 386.19 [M]+; 분자식 C19H30O8; 1H-NMR (500 MHz, pyridine-d 5) δ 7.18 (1H, d, J = 15.7 Hz, H-7), 6.52 (1H, d, J = 15.7 Hz, H-8), 4.96 (1H, d, J = 7.7 Hz, H-1'), 4.41 (1H, dd, J = 11.2, 4.2 Hz, H-3), 4.54-3.95 (6H, m, H-2'-H-6'), 2.60 (1H, dd, J = 14.6, 4.8 Hz, H-4a), 2.28 (3H, s, H-10), 1.97 (2H, d, J = 14.6 Hz, H-2a, H-4b), 1.53 (1H, dd, J = 12.3, 10.7 Hz, H-2b), 1.12 (6H, s, H-12, H-13), 0.96 (3H, s, H-11); 13C-NMR (250 MHz, pyridine-d 5) δ 197.4 (C-9), 143.3 (C-7), 133.6 (C-8), 103.4 (C-1'), 79.0 (C-5'), 78.8 (C-3'), 75.6 (C-2'), 71.9 (C-4'), 71.7 (C-3), 70.1 (C-6), 67.4 (C-5), 63.0 (C-6'), 45.0 (C-2), 38.3 (C-4), 35.4 (C-1), 29.3 (C-11), 28.0 (C-10), 25.6 (C-12), 20.2 (C-13).White amorphous powder; electron ionization mass spectrometry (EI-MS) m/z 386.19 [M]+; molecular formula C 19 H 30 O 8 ; 1 H-NMR (500 MHz, pyridine- d 5 ) δ 7.18 (1H, d, J = 15.7 Hz, H-7), 6.52 (1H, d, J = 15.7 Hz, H-8), 4.96 (1H, d, J = 7.7 Hz, H-1'), 4.41 (1H, dd, J = 11.2, 4.2 Hz, H-3), 4.54-3.95 (6H, m, H-2'-H-6'), 2.60 (1H, dd, J = 14.6, 4.8 Hz, H-4a), 2.28 (3H, s, H-10), 1.97 (2H, d, J = 14.6 Hz, H-2a, H-4b), 1.53 (1H, dd, J = 12.3, 10.7 Hz, H-2b), 1.12 (6H, s, H-12, H-13), 0.96 (3H, s, H-11); 13 C-NMR (250 MHz, pyridine- d 5 ) δ 197.4 (C-9), 143.3 (C-7), 133.6 (C-8), 103.4 (C-1'), 79.0 (C-5'), 78.8 (C-3'), 75.6 (C-2'), 71.9 (C-4'), 71.7 (C-3), 70.1 (C-6), 67.4 (C-5), 63.0 (C-6'), 45.0 (C-2), 38.3 (C-4), 35.4 (C-1), 29.3 (C-11), 28.0 (C-10), 25.6 (C-12), 20.2 (C-13).

실시예 2: 당삼 추출물 및 크레오사이드 Ⅳ(Creoside Ⅳ) 준비Example 2: Preparation of Dangsam extract and Creoside IV

당삼 뿌리 7 kg을 80% 메탄올로 환류냉각하여 3시간동안 3회에 걸쳐 추출하였다. 감압회전 진공농축기를 이용하여 농축된 메탄올 추출물에 MCI 겔을 물에 현탁하여 메탄올을 사용하여 컬럼 크로마토그래피로 용매분획을 수행하였다. 메탄올 분획물 100 g을 실리카 겔 230-400 메쉬(mesh)에 흡착시켜 고체화 한 후에 이를 컬럼에 로딩하고, 전개용매는 메틸클로라이드 : 메탄올 = 30 : 1 내지 0 : 100을 사용하여 극성을 증가시키는 비율로 진행하여 총 5개의 소분획들을 얻었다(이하 'M1 ~ M5'이라 명명함).7 kg of the roots of the ginseng plant were extracted three times for 3 hours with 80% methanol under reflux cooling. The methanol extract was concentrated using a vacuum rotary evaporator, and MCI gel was suspended in water, and solvent fractionation was performed by column chromatography using methanol. 100 g of the methanol fraction was solidified by adsorption onto silica gel 230-400 mesh, and then loaded onto the column. The developing solvent was methyl chloride: methanol = 30:1 to 0:100, and the polarity was increased to obtain a total of five subfractions (hereinafter referred to as 'M1 to M5').

수득한 M3 15 g에 대하여 RP-C18 충진제로 컬럼 크로마토그래피를 수행하였고, 전개용매는 메탄올 : 물 = 40 : 60 내지 0 : 100을 이용하여 10개의 소분획들을 얻었다(이하 'M3-1 ~ M3-10'이라 명명함). 이 소분획 중 M3-5 100 mg에 메탄올로 재결정화하여 흰색의 결정형태 물질을 얻었으며, 그 결과, 상기 크레오사이드 Ⅳ를 수득하였다(도 2 및 도 5).Column chromatography was performed on 15 g of the obtained M3 using RP-C18 packing, and 10 small fractions were obtained using a developing solvent of methanol:water = 40:60 to 0:100 (hereinafter referred to as 'M3-1 to M3-10'). Among these small fractions, 100 mg of M3-5 was recrystallized with methanol to obtain a white crystalline substance, and as a result, the above-mentioned creoside Ⅳ was obtained (Figs. 2 and 5).

흰색 비정질 분말; 전자 이온화 질량 분석기 (EI-MS) m/z 396 [M]+; 분자식 C17H32O10; 1H-NMR (500 MHz, CD3OD) δ 0.87 (3H, t, J = 6.9, H-6), 1.28 (6H, m, H-3 ~ H-5), 1.57 (2H, m, H-2), 3.15~3.86 (m), 4.07 (1H, dd, J = 11.4, 1.7), 4.23 (1H, d, J = 7.8), 4.29 (1H, d, J = 6.5); 13C-NMR (250 MHz, CD3OD) δ 105.1 (C-1"), 104.3 (C-1´), 77.8 (C-3´), 76.7 (C-5´), 74.9 (C-2´), 74.1 (C-3"), 72.3 (C-2"), 71.5 (C-4´), 70.9 (C-1), 69.4 (C-6´ and C-4"), 66.7 (C-5"), 32.8 (C-4), 30.7 (C-2), 26.7 (C-3), 23.6 (C-5), 14.4 (C-6).White amorphous powder; Electron ionization mass spectrometry (EI-MS) m/z 396 [M]+; Molecular formula C 17 H 32 O 10 ; 1 H-NMR (500 MHz, CD 3 OD) δ 0.87 (3H, t, J = 6.9, H-6), 1.28 (6H, m, H-3 ~ H-5), 1.57 (2H, m, H-2), 3.15~3.86 (m), 4.07 (1H, dd, J = 11.4, 1.7), 4.23 (1H, d, J = 7.8), 4.29 (1H, d, J = 6.5); 13 C-NMR (250 MHz, CD 3 OD) δ 105.1 (C-1"), 104.3 (C-1´), 77.8 (C-3´), 76.7 (C-5´), 74.9 (C-2´), 74.1 (C-3"), 72.3 (C-2"), 71.5 (C-4´), 70.9 (C-1), 69.4 (C-6´ and C-4"), 66.7 (C-5"), 32.8 (C-4), 30.7 (C-2), 26.7 (C-3), 23.6 (C-5), 14.4 (C-6).

실시예 3: 고삼 추출물 및 쿠라리디놀(Kuraridinol) 준비Example 3: Preparation of Gosam extract and Kuraridinol

고삼 뿌리 10 kg을 99.9% 메탄올로 환류냉각하여 3시간동안 3회에 걸쳐 추출하였다. 감압회전 진공농축기를 이용하여 농축된 메탄올 추출물에 증류수 3 L를 넣어 현탁하였다. 분액 깔대기를 이용하여 동량의 메틸렌 클로라이드(methylene chloride), 에틸아세테이트(ethyl acetate) 및 노르말부탄올(n-butanol)을 이용하여 용매분획을 수행하였다. 에틸아세테이트 분획물 250 g에 대하여 컬럼 크로마토 그래피를 수행하였다. 노르말부탄올 분획물 320 g을 실리카 겔 70-230 메쉬(mesh)에 흡착시켜 고체화 한 후에 이를 컬럼에 로딩하고, 전개용매는 메틸렌 클로라이드 : 메탄올 = 20 : 1 내지 0 : 100 을 사용하여 극성을 증가시키는 비율로 진행하여 총 35개의 소분획들을 얻었다 (이하 'E1 ~ E35'이라 명명함).10 kg of Sophora japonica roots were extracted three times for 3 hours under reflux with 99.9% methanol. The methanol extract was concentrated using a vacuum rotary evaporator and suspended in 3 L of distilled water. Solvent fractionation was performed using equal volumes of methylene chloride, ethyl acetate, and n-butanol using a separatory funnel. Column chromatography was performed on 250 g of the ethyl acetate fraction. 320 g of the n-butanol fraction was solidified by adsorption onto silica gel 70-230 mesh, and then loaded onto the column. The developing solvent was methylene chloride: methanol = 20:1 to 0:100, and the extraction was performed in increasing polarity ratios to obtain a total of 35 subfractions (hereinafter referred to as 'E1 to E35').

수득한 E15 32 g에 대하여 실리카 겔 230-400 메쉬(mesh) 충진제를 사용하였고, 전개용매는 메틸렌 클로라이드 : 메탄올 = 20 : 1 내지 1 : 1 을 이용하여 6개의 소분획들을 얻었다(이하 'E15-1 ~ E15-6'이라 명명함). 소분획 중 E15-3 2.77 g에 대하여 실리카 겔 230-400 메쉬(mesh) 충진제를 사용하였고, 전개용매는 헥산 : 에틸아세테이트 = 1 : 1 내지 0 : 100 을 이용하여 E15-3-3 1.08 g에서 노란색의 결정형태 물질을 얻었으며, 그 결과, 상기 쿠라리디놀을 수득하였다(도 3 및 도 6). For the obtained E15 32 g, a silica gel 230-400 mesh filler was used, and the developing solvent was methylene chloride: methanol = 20:1 to 1:1, to obtain six subfractions (hereinafter referred to as 'E15-1 to E15-6'). Among the subfractions, for 2.77 g of E15-3, a silica gel 230-400 mesh filler was used, and the developing solvent was hexane: ethyl acetate = 1:1 to 0:100, to obtain a yellow crystalline substance from 1.08 g of E15-3-3, and as a result, the curaridinol was obtained (Figs. 3 and 6).

노란색 비정질 분말; 전자 이온화 질량 분석기 (EI-MS) m/z 456 [M]+; 분자식 C26H32O7; 1H-NMR (500 MHz, DMSO-d 6 ) δ 14.86 (1H, s, OH-9), 10.17 (1H. s, OH-7), 7.94 (1H, d, J = 15.6 Hz, H-2), 7.86 (1H, d, J = 15.6 Hz, H-3), 7.43 (1H, d, J = 8.6 Hz, H-6'), 6.38 (1H, d, J = 2.2 Hz, H-3'), 6.32 (1H, dd, J = 2.2, 8.6 Hz, H-5'), 6.04 (1H, s, H-6), 4.57 (1H, br s, H-9"a), 4.47 (1H, d, J = 2.2 Hz, H-9"b), 3.83 (3H, s, OCH3), 2.55 (2H, m, H-1"), 2.35 (1H, m ,H-2"), 1.64 (3H, s ,H-10"), 1.35 (2H, m, H-3"), 1.19 (2H, m, H-4"), 1.02 (3H, s, H-6"), 1.01 (3H, s, H-7"); 13C-NMR (250 MHz, DMSO- d 6 ) δ 191.96 (C-4), 165.28 (C-9), 162.75 (C-7), 161.14 (C-4'), 160.27 (C-5), 159.02 (C-2'), 148.00 (C-8"), 138.63 (C-2), 130.31 (C-6'), 122.79 (C-3), 113.74 (C-1'), 110.92 (C-9"), 108.05 (C-5'), 106.73 (C-8), 104.41 (C-10), 102.58 (C-3'), 90.66 (C-6), 68.64 (C-5"), 55.49 (OCH3), 46.41 (C-2"), 41.57 (C-4"), 29.55 (C-6"), 29.00 (C-7"), 27.10 (C-1"), 26.65 (C-3"), 17.85 (C-10").Yellow amorphous powder; electron ionization mass spectrometry (EI-MS) m/z 456 [M]+; molecular formula C 26 H 32 O 7 ; 1 H-NMR (500 MHz, DMSO- d 6 ) δ 14.86 (1H, s, OH-9), 10.17 (1H. s, OH-7), 7.94 (1H, d, J = 15.6 Hz, H-2), 7.86 (1H, d, J = 15.6 Hz, H-3), 7.43 (1H, d, J = 8.6 Hz, H-6'), 6.38 (1H, d, J = 2.2 Hz, H-3'), 6.32 (1H, dd, J = 2.2, 8.6 Hz, H-5'), 6.04 (1H, s, H-6), 4.57 (1H, br s, H-9"a), 4.47 (1H, d, J = 2.2 Hz, H-9"b), 3.83 (3H, s, OCH3), 2.55 (2H, m, H-1"), 2.35 (1H, m,H-2"), 1.64 (3H, s,H-10"), 1.35 (2H, m, H-3"), 1.19 (2H, m, H-4"), 1.02 (3H, s, H-6"), 1.01 (3H, s, H-7"); 13 C-NMR (250 MHz, DMSO- d 6 ) δ 191.96 (C-4), 165.28 (C-9), 162.75 (C-7), 161.14 (C-4'), 160.27 (C-5), 159.02 (C-2'), 148.00 (C-8"), 138.63 (C-2), 130.31 (C-6'), 122.79 (C-3), 113.74 (C-1'), 110.92 (C-9"), 108.05 (C-5'), 106.73 (C-8), 104.41 (C-10), 102.58 (C-3'), 90.66 (C-6), 68.64 (C-5"), 55.49 (OCH3), 46.41 (C-2"), 41.57 (C-4"), 29.55 (C-6"), 29.00 (C-7"), 27.10 (C-1"), 26.65 (C-3"), 17.85 (C-10").

실험예 1: 이카리사이드 비2의 항암제 유도 근위축 제브라피쉬 모델에서 근위축에 의한 미토콘드리아 손상 완화 효과 확인Experimental Example 1: Confirmation of the effect of Icaricide B2 on mitochondria damage caused by anticancer drug-induced muscle atrophy in a zebrafish model.

본 연구실에서 제작된 Tg (Xla.Eef1a1:mlsEGFP) 제브라피쉬들은 숙명여자대학교 동물실험윤리위원회의 승인 하에 28.5±1℃ 온도 및 14/10시간 명암 주기 조건의 3.5L 아크릴 탱크에서 관리하며 1일 2회 식이(live Brine shrimp (artemia)와 Tetramin, 16106, Germany)를 급여를 통해 사육되었으며, 실험에 사용된 배아는 Tg (Xla.Eef1a1:mlsEGFP) 제브라피쉬의 교배를 통해 얻어졌다. Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory were maintained in a 3.5 L acrylic tank under conditions of 28.5±1℃ temperature and 14/10 h light/dark cycle with the approval of the Animal Experiment Ethics Committee of Sookmyung Women's University, and were fed diet (live Brine shrimp (artemia) and Tetramin, 16106, Germany) twice a day. The embryos used in the experiment were obtained through mating of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

근위축 제브라피쉬모델을 통해 이카리사이드 비2의 근위축에 의한 미토콘드리아 손상 완화효과를 확인하기 위해, 수정 후 1일 경과한 배아에 항암제(FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan)를 처리하여 근위축 제브라피쉬모델을 만들고, 실시예 1에서 만병초 추출물로부터 분리된 이카리사이드 비2를 1, 10, 100 ng/ml를 처리하였다. 추출물 처리 48시간 후 미토콘드리아에서 발현되는 EGFP (MLS-EGFP)의 실시간 형태관찰을 통해 미토콘드리아의 생리적 활성을 보여주는 Tg (Xla.Eef1a1:mlsEGFP) 제브라피쉬 배아를 이용하여 근육세포에서의 미토콘드리아 이미지를 공초점현미경(Carl Zeiss, Germany)을 통해 관찰하였다.In order to confirm the effect of Icaricide B2 on alleviating mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy, embryos 1 day after fertilization were treated with an anticancer drug (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to create a muscle atrophy zebrafish model, and Icaricide B2, isolated from the extract of Rhododendron amurense in Example 1, was treated at 1, 10, and 100 ng/ml. 48 hours after treatment with the extract, Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos were used to observe the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria, and the mitochondrial images in muscle cells were observed using a confocal microscope (Carl Zeiss, Germany).

그 결과, FOLFIRI 처리된 제브라피쉬 배아의 근육세포에서 미토콘드리아의 손상에 의해 대조군보다 미토콘드리아에서 발현되는 EGFP의 밝기가 유의하게 감소함을 확인하였고, 이카리사이드 비2를 1, 10, 100 ng/ml의 농도로 처리함에 따라 그 발현량이 점차 증가하여 특히 FOLFIRI에 의한 미토콘드리아의 손상 정도가 100 ng/ml의 농도에서 유의하게 완화됨을 확인하였다(도 7). 따라서 위의 결과들을 통해 이카리사이드 비2가 항암제(FOLFIRI) 처리에 의한 근육세포의 미토콘드리아 손상을 회복시켜 근위축 발생을 억제할 수 있음을 확인하였다.As a result, we confirmed that the brightness of EGFP expressed in mitochondria was significantly reduced compared to the control group due to mitochondrial damage in muscle cells of zebrafish embryos treated with FOLFIRI, and the expression level gradually increased as Icariside B2 was treated at concentrations of 1, 10, and 100 ng/ml, and it was confirmed that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated, especially at a concentration of 100 ng/ml (Fig. 7). Therefore, through the above results, we confirmed that Icariside B2 can inhibit the occurrence of muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

실험예 2: 크레오사이드 IV의 항암제 유도 근위축 제브라피쉬 모델에서 근위축에 의한 미토콘드리아 손상 완화 효과 확인Experimental Example 2: Confirmation of the effect of Creoside IV on mitochondria damage caused by muscle atrophy in a zebrafish model of anticancer drug-induced muscle atrophy.

본 연구실에서 제작된 Tg (Xla.Eef1a1:mlsEGFP) 제브라피쉬들은 숙명여자대학교 동물실험윤리위원회의 승인 하에 28.5±1℃ 온도 및 14/10시간 명암 주기 조건의 3.5L 아크릴 탱크에서 관리하며 1일 2회 식이(live Brine shrimp (artemia)와 Tetramin, 16106, Germany)를 급여를 통해 사육되었으며, 실험에 사용된 배아는 Tg (Xla.Eef1a1:mlsEGFP) 제브라피쉬의 교배를 통해 얻어졌다. Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory were maintained in a 3.5 L acrylic tank under conditions of 28.5±1℃ temperature and 14/10 h light/dark cycle with the approval of the Animal Experiment Ethics Committee of Sookmyung Women's University, and were fed diet (live Brine shrimp (artemia) and Tetramin, 16106, Germany) twice a day. The embryos used in the experiment were obtained through mating of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

근위축 제브라피쉬모델을 통해 크레오사이드 Ⅳ의 근위축에 의한 미토콘드리아 손상 완화효과를 확인하기 위해, 수정 후 1일 경과한 배아에 항암제(FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan)를 처리하여 근위축 제브라피쉬모델을 만들고, 실시예 2에서 당삼 뿌리 추출물로부터 분리된 크레오사이드 Ⅳ를 1, 10, 100 ng/ml를 처리하였다. 추출물 처리 48시간 후 미토콘드리아에서 발현되는 EGFP (MLS-EGFP)의 실시간 형태관찰을 통해 미토콘드리아의 생리적 활성을 보여주는 Tg (Xla.Eef1a1:mlsEGFP) 제브라피쉬 배아를 이용하여 근육세포에서의 미토콘드리아 이미지를 공초점현미경(Carl Zeiss, Germany)을 통해 관찰하였다. In order to confirm the effect of Creoside IV on alleviating mitochondrial damage caused by muscle atrophy in a zebrafish model of muscle atrophy, embryos 1 day after fertilization were treated with an anticancer drug (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to create a muscle atrophy zebrafish model, and Creoside IV, isolated from the root extract of Dansam in Example 2, was treated at 1, 10, and 100 ng/ml. 48 hours after treatment with the extract, Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos were used to observe the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria, and the mitochondrial images in muscle cells were observed using a confocal microscope (Carl Zeiss, Germany).

그 결과, FOLFIRI 처리된 제브라피쉬 배아의 근육세포에서 미토콘드리아의 손상에 의해 대조군보다 미토콘드리아에서 발현되는 EGFP의 밝기가 유의하게 감소함을 확인하였고, 크레오사이드 Ⅳ를 1, 10, 100 ng/ml의 농도로 처리함에 따라 그 발현량이 점차 증가하여 FOLFIRI에 의한 미토콘드리아의 손상 정도가 특히 10, 100 ng/ml의 농도에서 유의하게 완화됨을 확인하였다(도 8). 따라서 위 결과들을 통해 크레오사이드 Ⅳ이 항암제(FOLFIRI) 처리에 의한 근육세포의 미토콘드리아 손상을 회복시켜 근위축 발생을 억제할 수 있음을 확인하였다.As a result, we confirmed that the brightness of EGFP expressed in mitochondria was significantly reduced compared to the control group due to mitochondrial damage in the muscle cells of zebrafish embryos treated with FOLFIRI, and the expression level gradually increased as Creoside IV was treated at concentrations of 1, 10, and 100 ng/ml, confirming that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated, especially at concentrations of 10 and 100 ng/ml (Fig. 8). Therefore, through the above results, we confirmed that Creoside IV can suppress muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

실험예 3: 쿠라리디놀의 항암제 유도 근위축 제브라피쉬 모델에서 근위축에 의한 미토콘드리아 손상 완화 효과 확인Experimental Example 3: Confirmation of the effect of curaridinol on mitochondria damage caused by anticancer drug-induced muscle atrophy in a zebrafish model.

본 연구실에서 제작된 Tg (Xla.Eef1a1:mlsEGFP) 제브라피쉬들은 숙명여자대학교 동물실험윤리위원회의 승인 하에 28.5±1℃ 온도 및 14/10시간 명암 주기 조건의 3.5L 아크릴 탱크에서 관리하며 1일 2회 식이(live Brine shrimp (artemia)와 Tetramin, 16106, Germany)를 급여를 통해 사육되었으며, 실험에 사용된 배아는 Tg (Xla.Eef1a1:mlsEGFP) 제브라피쉬의 교배를 통해 얻어졌다. Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory were maintained in a 3.5 L acrylic tank under conditions of 28.5±1℃ temperature and 14/10 h light/dark cycle with the approval of the Animal Experiment Ethics Committee of Sookmyung Women's University, and were fed diet (live Brine shrimp (artemia) and Tetramin, 16106, Germany) twice a day. The embryos used in the experiment were obtained through mating of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

근위축 제브라피쉬모델을 통해 쿠라리디놀의 근위축에 의한 미토콘드리아 손상 완화효과를 확인하기 위해, 수정 후 1일 경과한 배아에 항암제(FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan)를 처리하여 근위축 제브라피쉬모델을 만들고, 실시예 3에서 고삼 뿌리 추출물로부터 분리된 쿠라리디놀을 0.01, 0.1, 1 ng/ml를 처리하였다. 추출물 처리 48시간 후 미토콘드리아에서 발현되는 EGFP (MLS-EGFP)의 실시간 형태관찰을 통해 미토콘드리아의 생리적 활성을 보여주는 Tg (Xla.Eef1a1:mlsEGFP) 제브라피쉬 배아를 이용하여 근육세포에서의 미토콘드리아 이미지를 공초점현미경(Carl Zeiss, Germany)을 통해 관찰하였다.To confirm the effect of curaridinol on alleviating mitochondrial damage caused by muscle atrophy in a zebrafish model of muscular atrophy, embryos 1 day after fertilization were treated with an anticancer drug (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) to create a zebrafish model of muscular atrophy, and curaridinol, isolated from the Sophora japonica root extract in Example 3, was treated at 0.01, 0.1, and 1 ng/ml. 48 hours after treatment with the extract, Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos were used to observe the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria, and the mitochondrial images in muscle cells were observed using a confocal microscope (Carl Zeiss, Germany).

그 결과, FOLFIRI 처리된 제브라피쉬 배아의 근육세포에서 미토콘드리아의 손상에 의해 대조군보다 미토콘드리아에서 발현되는 EGFP의 밝기가 감소함을 확인하였고, 쿠라리디놀을 0.01, 0.1. 1 ng/ml의 농도로 처리함에 따라 그 발현량이 점차 증가하여 FOLFIRI에 의한 미토콘드리아의 손상정도가 모든 농도에서 유의하게 완화됨을 확인하였다(도 9). 따라서 위 결과들을 통해 쿠라리디놀이 항암제(FOLFIRI) 처리에 의한 근육세포의 미토콘드리아 손상을 회복시켜 근위축 발생을 억제할 수 있음을 확인하였다.As a result, it was confirmed that the brightness of EGFP expressed in mitochondria was reduced compared to the control group due to mitochondrial damage in the muscle cells of zebrafish embryos treated with FOLFIRI, and the expression level gradually increased as curaridinol was treated at concentrations of 0.01, 0.1, and 1 ng/ml, confirming that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated at all concentrations (Fig. 9). Therefore, through the above results, it was confirmed that curaridinol can suppress the occurrence of muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

실험예 4: 이카리사이드 비2의 근원세포 분화 유도 및 근관세포 형성 촉진 효과 확인Experimental Example 4: Confirmation of the effects of Icaricide B2 on inducing myogenic differentiation and promoting myotube formation.

상기 실험예 1 결과를 기반으로 이카리사이드 비2가 근원세포 분화(myoblast differentiation) 및 근관세포(myotube) 형성에 미치는 영향을 확인하고자 C2C12 근원세포(myoblast)를 이용하여 다음과 같은 세포실험을 진행하였다. C2C12 근원세포는 American Type Culture Collection (Manassas, VA, USA)에서 구입하여 15% fetal bovine serum (Gibco, Grand Island, NY, USA)을 함유한 Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA)로 6-웰 플레이트에 2 x 105 cells/ml 농도로 seeding 하였다. 24시간 배양 후 cell의 confluency가 약 90% 되었을 때, 2% horse serum (HyClone, Logan, UT, USA)을 함유한 분화 배지(differentiation medium, DM)로 교환하여 약 72시간 동안 분화를 유도하였다. 실험군은 DM에 이카리사이드 비2를 0.1, 1, 10, 100 ng/ml의 농도로 함께 처리하였고, 대조군은 DM에 vehicle인 DMSO를 처리하여 동일한 조건으로 배양하였다.Based on the results of Experimental Example 1 above, the following cell experiment was conducted using C2C12 myoblasts to confirm the effect of icariside B2 on myoblast differentiation and myotube formation. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and seeded at a concentration of 2 x 10 5 cells/ml in 6-well plates with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15 % fetal bovine serum (Gibco, Grand Island, NY, USA). After 24 hours of culture, when the cell confluency reached approximately 90%, the medium was replaced with differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for approximately 72 hours. The experimental group was treated with DM and Icariside B2 at concentrations of 0.1, 1, 10, and 100 ng/ml, and the control group was treated with DMSO, the vehicle, in DM and cultured under the same conditions.

4-1: 이카리사이드 비2의 근원세포 분화 촉진 효과4-1: Effect of Icaricide B2 on Promoting Myogenic Cell Differentiation

이카리사이드 비2가 근원세포 분화에 미치는 효과를 확인하고자, C2C12 근원세포의 근관세포로의 분화 유도 과정과 관련된 지표들인 MyoD, myogenin 및 MHC (myosin heavy chain) isoforms의 mRNA 발현을 RT-qPCR로 측정하였다. 이를 위해 상기 기재된 동일한 방법으로 C2C12에 이카리사이드 비2를 처리하고 배양하여 분화를 유도한 후, Trizol 용액을 첨가해 세포를 용해시키고 원심분리하였다. 그 상층액에 클로로포름(chloroform)과 이소프로파놀(isopropanol)을 각각 첨가하고 원심분리를 한 후 상층액을 제거하였다. 남은 용액을 다 제거한 후 RNA 펠렛(pellet)을 nuclease free water를 사용하여 용해시켰다. 추출된 RNA의 농도를 측정하고 순도를 확인한 후 qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK)를 이용하여 cDNA를 합성하였다. 합성된 cDNA는 qPCRBIO SyGreen Mix (PCR Biosystem Ltd.)를 이용하여 정량적 PCR을 수행하였다. 사용된 프라이머 서열(primer sequence)은 표 1에 나타내었다.To determine the effect of Icaricide B2 on myogenic cell differentiation, The mRNA expression of MyoD, myogenin, and MHC (myosin heavy chain) isoforms, which are markers associated with the differentiation of C2C12 myoblasts into myotubes, was measured by RT-qPCR. To this end, C2C12 cells were treated with Icariside B2 and cultured to induce differentiation using the same method described above. Trizol solution was added to lyse the cells and centrifuge them. Chloroform and isopropanol were added to the supernatant, centrifuged, and the supernatant was removed. After removing all remaining solutions, the RNA pellet was dissolved in nuclease-free water. The concentration of the extracted RNA was measured, its purity confirmed, and cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). The synthesized cDNA was subjected to quantitative PCR using the qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 1.

Gene descriptionGene description PrimersPrimers Sequences (5' →3')Sequences (5' →3') 서열번호Sequence number ATPase6ATPase6 FF ACACACCAAAAGGACGAACAACACACCAAAAGGACGAACA 11 RR GAAGGAAGTGGGCAAGTGAGGAAGGAAGTGGGCAAGTGAG 22 COX2COX2 FF ATGGCCTACCCATTCCAACTATGGCCTACCCATTCCAACT 33 RR CGGGGTTGTTGATTTCGTCCGGGGTTGTTGATTTCGTC 44 GAPDHGAPDH FF CGTGCCGCCTGGAGAAACCGTGCCGCCTGGAGAAAC 55 RR TGGGAGTTGCTGTTGAAGTCGTGGGAGTTGCTGTTGAAGTCG 66 Myh1Myh1 FF GAGGGACAGTTCATCGATAGCAAGAGGGACAGTTCATCGATAGCAA 77 RR GGGCCAACTTGTCATCTCTCATGGGCCAACTTGTCATCTCTCAT 88 Myh2Myh2 FF CCGCAATGCAGAAGAGAAACCGCAATGCAGAAGAGAAA 99 RR TTCACGGTCTGCTCCATGTTTCACGGTCTGCTCCATGT 1010 Myh4Myh4 FF CAGGACTTGGTGGACAAACTACACAGGACTTGGTGGACAAACTACA 1111 RR TTTAGTGTGAACCTCTCGGCTCTTTAGTGTGAACCTCTCGGCTC 1212 Myh7Myh7 FF CTCAAGCTGCTCAGCAATCTATTTCTCAAGCTGCTCAGCAATCTATTT 1313 RR GGAGCGCAAGTTTGTCATAAGTGGAGCGCAAGTTTGTCATAAGT 1414 MyoDMyoD FF AAACCCCAATGCGATTTATCAGGAAACCCCAATGCGATTTATCAGG 1515 RR TAAGCTTCATCTTTTGGGCGTGATAAGCTTCATCTTTTGGGCGTGA 1616 MyogeninMyogenin FF ACAGCATCACGGTGGAGGATATGTACAGCATCACGGTGGAGGATATGT 1717 RR CCCTGCTACAGAAGTGATGGCTTTCCCTGCTACAGAAGTGATGGCTTT 1818 SIRT3SIRT3 FF CGTTGTGAAACCCGACATTGCGTTGTGAAACCCGACATTG 1919 RR TCCCCTAGCTGGACCACATCTCCCCTAGCTGGACCACATC 2020

그 결과, 근원세포 분화 초기단계 지표 MyoD 및 중기단계 지표 myogenin의 발현량이 대조군에 비해 이카리사이드 비2를 0.1, 1, 10, 100 ng/ml의 농도로 처리한 모든 군에서 유의적으로 증가하였다(도 10). 근원세포 분화 말기 마커이자 근육의 수축 속도 및 기능과 관련 있는 MHC isoforms의 발현량을 측정한 결과, 모든 MHC isoforms (Myh1, Myh2, Myh4, Myh7)의 유전자 발현량이 이카리사이드 비2를 처리한 군에서 농도 의존적으로 증가하였다. 특히 Myh1, Myh2 유전자 발현은 모든 농도에서 대조군 대비 유의하게 증가하였고, Myh4, Myh7 발현량은 1, 10, 100 ng/ml로 처리한 군에서 유의하게 증가함을 확인하였다(도 13). 이상의 결과는 이카리사이드 비2가 C2C12 근원세포의 분화 촉진 효과를 지님을 보여준다.As a result, the expression levels of MyoD, an early stage marker of myoblast differentiation, and myogenin, an intermediate stage marker, significantly increased in all groups treated with Icaricide Bi2 at concentrations of 0.1, 1, 10, and 100 ng/ml compared to the control group (Fig. 10). The expression levels of MHC isoforms, which are late stage markers of myoblast differentiation and are related to muscle contraction speed and function, were measured, and the gene expression levels of all MHC isoforms (Myh1, Myh2, Myh4, and Myh7) were increased in a concentration-dependent manner in the group treated with Icaricide Bi2. In particular, the gene expression of Myh1 and Myh2 significantly increased compared to the control group at all concentrations, and the expression levels of Myh4 and Myh7 were significantly increased in the groups treated with 1, 10, and 100 ng/ml (Fig. 13). These results demonstrate that Icaricide Bi2 has a differentiation-promoting effect on C2C12 myoblasts.

4-2: 이카리사이드 비2의 근관세포 형성 촉진 효과4-2: Effect of Icaricide B2 on the Promotion of Myotube Formation

면역형광 염색(immunofluorescence staining)을 통해 이카리사이드 비2에 의한 MHC-양성 근관세포 형성 정도를 확인하고자 하였다. 이를 위해 상기 기재된 동일한 조건에서 분화된 세포에 DM을 제거한 후 인산완충생리식염수(phosphate buffered saline; PBS)로 세척하고 4% 파라포름알데하이드(paraformaldehyde)로 30분간 고정하였다. 다시 PBS로 세척하고 0.1% Triton X-100으로 30분간 투과시킨 후 PBS로 세척하였다. 5% horse serum 용액에서 블로킹한 후 항-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA)로 염색하였다. PBS로 세척한 후 Alexa Fluor 568-접합 2차 항체와 DAPI (D9542, Sigma, St. Louis, MO, USA)로 처리하였다. 이미지는 형광현미경(Logos Biosystem, Anyang, South Korea)으로 촬영하였다. 촬영한 이미지 내 무작위로 선택된 부위에서 다핵성 근관세포(multinucleated MHC-expressing myotubes)를 산출하였다(Scale bar = 100 μm). MHC-양성이며, 다핵성(multinucleated)인 근관세포수를 분석한 후, 총 세포 수(total cells)를 적용하여 multinucleated-MHC-양성 근관세포수(MHC-positive myotubes)를 백분율로 나타내었다. To determine the extent of MHC-positive myotube formation by Icaricide B2, immunofluorescence staining was used. For this purpose, cells differentiated under the same conditions described above were washed with phosphate-buffered saline (PBS) after removing DM, fixed with 4% paraformaldehyde for 30 minutes, washed again with PBS, permeabilized with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum, the cells were stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were captured with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were counted from randomly selected areas within the captured images (Scale bar = 100 μm). After analyzing the number of MHC-positive, multinucleated myotubes, the number of multinucleated-MHC-positive myotubes was expressed as a percentage by applying the total cell number.

그 결과, 적색 형광으로 발현되는 MHC-양성 근관세포 이미지와 DAPI 염색을 통해 관찰한 다핵성 MHC-양성 근관세포 비율을 도 16A와 도 16B에 각각 나타내었다. 이카리사이드 비2 처리에 의해 대조군 대비 MHC-양성 근관세포 형성이 촉진됨을 확인하였다(도 16A). 또한 이카리사이드 비2 처리에 의해 3개 이상의 핵을 가진 다핵의 MHC-양성 근관세포의 형성이 농도 의존적으로 증가하여 1, 10, 100 ng/ml 처리한 실험군에서 대조군 대비 다핵의 MHC-양성 근관세포의 비율이 유의하게 증가하였다(도 16B). 이상의 결과는 이카리사이드 비2가 C2C12 근원세포의 분화 유도 및 근관세포 형성 촉진 효과를 지님을 보여준다.As a result, the images of MHC-positive myotube cells expressed by red fluorescence and the proportion of multinucleated MHC-positive myotube cells observed through DAPI staining are shown in Fig. 16A and Fig. 16B, respectively. It was confirmed that the formation of MHC-positive myotube cells was promoted by icaridide B2 treatment compared to the control group (Fig. 16A). In addition, the formation of multinucleated MHC-positive myotube cells with three or more nuclei was increased in a concentration-dependent manner by icaridide B2 treatment, and the proportion of multinucleated MHC-positive myotube cells significantly increased in the experimental groups treated with 1, 10, and 100 ng/ml compared to the control group (Fig. 16B). The above results demonstrate that icaridide B2 has the effect of inducing differentiation of C2C12 myotubes and promoting myotube cell formation.

4-3: 이카리사이드 비2의 미토콘드리아 기능 관련 유전자 발현 조절 확인4-3: Confirmation of regulation of gene expression related to mitochondrial function by Icaricide B2

이카리사이드 비2의 C2C12 근원세포 분화 및 근관세포 형성 촉진 효과가 미토콘드리아의 기능과 관련이 있는지 확인하기 위하여, 근원세포의 미토콘드리아 내막에 존재하는 전자전달계 복합체 및 미토콘드리아 기능 관련 마커의 유전자 발현량을 RT-qPCR로 측정하였다. 사용된 프라이머 서열(primer sequence)은 표 1에 나타내었다. 그 결과, 특히 0.1, 10, 100 ng/ml 처리군에서 미토콘드리아 내막 전자전달계 복합체 IV를 구성하는 COX2의 발현량이 대조군보다 유의적으로 증가하였다(도 19A). 또한 미토콘드리아 ATP 생성을 위한 산화적 인산화 과정의 마지막 과정에 관여하는 전자전달계 복합체 V 마커인 ATPase 6 발현은 이카리사이드 비2를 처리한 모든 군에서 대조군 대비 유의하게 증가하였다(도 19B). 미토콘드리아 에너지 대사의 항상성 유지에 중요한 역할을 하는 SIRT3 역시 이카리사이드 비2를 처리한 모든 군에서 대조군 대비 농도 의존적으로 유의하게 그 발현이 증가하였다(도 19C). 이러한 결과는 이카리사이드 비2의 근원세포 분화 및 근관세포 형성 촉진 효과가 미토콘드리아의 에너지 대사 활성화와 항상성 유지를 통한 미토콘드리아의 기능 개선과 관련이 있음을 보여준다.To determine whether the effects of Icaricide B2 on promoting C2C12 myoblast differentiation and myotube formation are related to mitochondrial function, the gene expression levels of electron transport complexes and mitochondrial function-related markers present in the mitochondrial inner membrane of myoblasts were measured by RT-qPCR. The primer sequences used are shown in Table 1. As a result, the expression level of COX2, which constitutes the mitochondrial inner membrane electron transport complex IV, was significantly increased compared to the control group, especially in the 0.1, 10, and 100 ng/ml treatment groups (Fig. 19A). In addition, the expression of ATPase 6, a marker of electron transport complex V involved in the final step of oxidative phosphorylation for mitochondrial ATP production, was significantly increased in all groups treated with Icaricide B2 compared to the control group (Fig. 19B). SIRT3, which plays a crucial role in maintaining mitochondrial energy homeostasis, also showed a significant increase in expression in all groups treated with icaricide B2 in a dose-dependent manner compared to the control group (Fig. 19C). These results demonstrate that the stimulating effects of icaricide B2 on myogenic differentiation and myotube formation are related to improved mitochondrial function through the activation of mitochondrial energy metabolism and the maintenance of homeostasis.

실험예 5: 크레오사이드 Ⅳ의 근원세포 분화 유도 및 근관세포 형성 촉진 효과 확인Experimental Example 5: Confirmation of the effects of Creoside IV on inducing myogenic cell differentiation and promoting myotube cell formation.

상기 실험예 2 결과를 기반으로 크레오사이드 Ⅳ이 근원세포 분화(myoblast differentiation) 및 근관세포(myotube) 형성에 미치는 영향을 확인하고자 C2C12 근원세포(myoblast)를 이용하여 다음과 같은 세포실험을 진행하였다. C2C12 근원세포는 American Type Culture Collection (Manassas, VA, USA)에서 구입하여 15% fetal bovine serum (Gibco, Grand Island, NY, USA)을 함유한 Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA)로 6-웰 플레이트에 2 x 105 cells/ml 농도로 seeding 하였다. 24시간 배양 후 cell의 confluency가 약 90% 되었을 때, 2% horse serum (HyClone, Logan, UT, USA)을 함유한 분화 배지(differentiation medium, DM)로 교환하여 약 72시간 동안 분화를 유도하였다. 실험군은 DM에 크레오사이드 Ⅳ을 1, 10, 100 ng/ml의 농도로 함께 처리하였고, 대조군은 DM에 vehicle인 DMSO를 처리하여 동일한 조건으로 배양하였다.Based on the results of Experimental Example 2 above, the following cell experiment was conducted using C2C12 myoblasts to confirm the effect of Creoside IV on myoblast differentiation and myotube formation. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and seeded at a concentration of 2 x 10 5 cells/ml in 6-well plates with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). After 24 hours of culture, when the cell confluency reached approximately 90 %, the medium was replaced with differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for approximately 72 hours. The experimental group was treated with DM and Creoside IV at concentrations of 1, 10, and 100 ng/ml, and the control group was treated with DMSO as a vehicle and cultured under the same conditions.

5-1: 크레오사이드 IV의 근원세포 분화 촉진 효과5-1: Creoside IV's effect on promoting myogenic cell differentiation

크레오사이드 Ⅳ이 근원세포 분화에 미치는 효과를 확인하고자, C2C12 근원세포의 근관세포로의 분화 유도 과정과 관련된 지표들인 MyoD, myogenin 및 MHC (myosin heavy chain) isoforms의 mRNA 발현을 RT-qPCR로 측정하였다. 이를 위해 상기 기재된 동일한 방법으로 C2C12에 크레오사이드 Ⅳ를 처리하고 배양하여 분화를 유도한 후, Trizol 용액을 첨가해 세포를 용해시키고 원심분리하였다. 그 상층액에 클로로포름(chloroform)과 이소프로파놀(isopropanol)을 각각 첨가하고 원심분리를 한 후 상층액을 제거하였다. 남은 용액을 다 제거한 후 RNA 펠렛(pellet)을 nuclease free water를 사용하여 용해시켰다. 추출된 RNA의 농도를 측정하고 순도를 확인한 후 qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK)를 이용하여 cDNA를 합성하였다. 합성된 cDNA는 qPCRBIO SyGreen Mix (PCR Biosystem Ltd.)를 이용하여 정량적 PCR을 수행하였다. 사용된 프라이머 서열(primer sequence)은 표 2에 나타내었다. To determine the effect of Creoside IV on myogenic cell differentiation, The mRNA expression of MyoD, myogenin, and MHC (myosin heavy chain) isoforms, which are markers associated with the differentiation of C2C12 myoblasts into myotubes, was measured by RT-qPCR. To this end, C2C12 cells were treated with Creoside IV and cultured to induce differentiation using the same method described above. Trizol solution was added to lyse the cells and centrifuge them. Chloroform and isopropanol were added to the supernatant, centrifuged, and the supernatant was removed. After removing all remaining solutions, the RNA pellet was dissolved in nuclease-free water. The concentration of the extracted RNA was measured, the purity was confirmed, and cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). The synthesized cDNA was subjected to quantitative PCR using the qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 2.

Gene descriptionGene description PrimersPrimers Sequences (5' →3')Sequences (5' →3') 서열번호Sequence number Drp1Drp1 FF TCTGCAGCTAGTCCACGTTTCTCTGCAGCTAGTCCACGTTTC 2121 RR ACCCCATTCTTCTGCTTCAAACCCCATTCTTCTGCTTCAA 2222 GAPDHGAPDH FF CGTGCCGCCTGGAGAAACCGTGCCGCCTGGAGAAAC 2323 RR TGGGAGTTGCTGTTGAAGTCGTGGGAGTTGCTGTTGAAGTCG 2424 Myh1Myh1 FF GAGGGACAGTTCATCGATAGCAAGAGGGACAGTTCATCGATAGCAA 2525 RR GGGCCAACTTGTCATCTCTCATGGGCCAACTTGTCATCTCTCAT 2626 Myh2Myh2 FF CCGCAATGCAGAAGAGAAACCGCAATGCAGAAGAGAAA 2727 RR TTCACGGTCTGCTCCATGTTTCACGGTCTGCTCCATGT 2828 Myh4Myh4 FF CAGGACTTGGTGGACAAACTACACAGGACTTGGTGGACAAACTACA 2929 RR TTTAGTGTGAACCTCTCGGCTCTTTAGTGTGAACCTCTCGGCTC 3030 Myh7Myh7 FF CTCAAGCTGCTCAGCAATCTATTTCTCAAGCTGCTCAGCAATCTATTT 3131 RR GGAGCGCAAGTTTGTCATAAGTGGAGCGCAAGTTTGTCATAAGT 3232 MyoDMyoD FF AAACCCCAATGCGATTTATCAGGAAACCCCAATGCGATTTATCAGG 3333 RR TAAGCTTCATCTTTTGGGCGTGATAAGCTTCATCTTTTGGGCGTGA 3434 MyogeninMyogenin FF ACAGCATCACGGTGGAGGATATGTACAGCATCACGGTGGAGGATATGT 3535 RR CCCTGCTACAGAAGTGATGGCTTTCCCTGCTACAGAAGTGATGGCTTT 3636 SDHASDHA FF CAGAAGTCGATGCAGAACCACAGAAGTCGATGCAGAACCA 3737 RR CGACCCGCACTTTGTAATCTCGACCCGCACTTTGTAATCT 3838

그 결과, 근원세포 분화 초기단계 지표 MyoD 및 중기단계 지표 myogenin의 발현량이 대조군에 비해 크레오사이드 Ⅳ을 1, 10, 100 ng/ml의 농도로 처리한 군에서 모두 유의적으로 증가하였다(도 11). 근원세포 분화 말기 마커이자 근육의 수축 속도 및 기능과 관련 있는 MHC isoforms의 발현량을 측정한 결과, Myh1, Myh2, Myh4, Myh7의 유전자 발현량이 대조군 대비 크레오사이드 Ⅳ을 1, 10, 100 ng/ml의 농도로 처리한 모든 군에서 유의하게 증가하였다(도 14). 이상의 결과는 크레오사이드 Ⅳ가 C2C12 근원세포의 분화 촉진 효과를 지님을 보여준다. As a result, the expression levels of MyoD, an early stage marker of myogenic cell differentiation, and myogenin, an intermediate stage marker, were significantly increased in all groups treated with Creoside IV at concentrations of 1, 10, and 100 ng/ml compared to the control group (Fig. 11). The expression levels of MHC isoforms, which are late stage markers of myogenic cell differentiation and are related to muscle contraction speed and function, were measured, and the gene expression levels of Myh1, Myh2, Myh4, and Myh7 were significantly increased in all groups treated with Creoside IV at concentrations of 1, 10, and 100 ng/ml compared to the control group (Fig. 14). These results demonstrate that Creoside IV has a differentiation-promoting effect on C2C12 myogenic cells.

5-2: 크레오사이드 IV의 근관세포 형성 촉진 효과5-2: Creoside IV's effect on promoting myotube formation

면역형광 염색(immunofluorescence staining)을 통해 크레오사이드 Ⅳ에 의한 MHC-양성 근관세포 형성 정도를 확인하고자 하였다. 이를 위해 상기 기재된 동일한 조건에서 분화된 세포에 DM을 제거한 후 인산완충생리식염수(phosphate buffered saline; PBS)로 세척하고 4% 파라포름알데하이드(paraformaldehyde)로 30분간 고정하였다. 다시 PBS로 세척하고 0.1% Triton X-100으로 30분간 투과시킨 후 PBS로 세척하였다. 5% horse serum 용액에서 블로킹한 후 항-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA)로 염색하였다. PBS로 세척한 후 Alexa Fluor 568-접합 2차 항체와 DAPI (D9542, Sigma, St. Louis, MO, USA)로 처리하였다. 이미지는 형광현미경(Logos Biosystem, Anyang, South Korea)으로 촬영하였다. 촬영한 이미지 내 무작위로 선택된 부위에서 다핵성 근관세포(multinucleated MHC-expressing myotubes)를 산출하였다(Scale bar = 100 μm). MHC-양성이며, 다핵성(multinucleated)인 근관세포수를 분석한 후, 총 세포 수(total cells)를 적용하여 multinucleated-MHC-양성 근관세포수(MHC-positive myotubes)를 백분율로 나타내었다. To determine the extent of MHC-positive myotube formation by Creoside IV, immunofluorescence staining was used. For this purpose, cells differentiated under the same conditions described above were washed with phosphate-buffered saline (PBS) after removing DM, fixed with 4% paraformaldehyde for 30 minutes, washed again with PBS, permeabilized with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum, the cells were stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were captured with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were counted from randomly selected areas within the captured images (Scale bar = 100 μm). After analyzing the number of MHC-positive, multinucleated myotubes, the number of multinucleated-MHC-positive myotubes was expressed as a percentage by applying the total cell number.

그 결과, 적색 형광으로 발현되는 MHC-양성 근관세포 이미지와 DAPI 염색을 통해 관찰한 다핵성 MHC-양성 근관세포 분포를 도 17A와 도 17B에 각각 나타내었다. 크레오사이드 Ⅳ 처리에 의해 대조군 대비 MHC-양성 근관세포 형성이 촉진됨을 확인하였다(도 17A). 크레오사이드 Ⅳ를 1, 10, 100 ng/ml 처리한 실험군에서 다핵의 MHC-양성 근관세포의 형성이 증가하여 특히 2~4개의 핵을 가진 MHC-양성 근관세포의 수가 100 ng/ml 농도에서 유의적으로 증가하였고, 5개 이상의 핵을 가진 MHC-양성 근관세포의 수는 대조군 대비 크레오사이드 Ⅳ를 1, 10 ng/ml의 농도로 처리한 군에서 유의적으로 증가함을 확인하였다(도 17B). 이상의 결과는 크레오사이드 Ⅳ이 C2C12 근원세포의 분화 유도 및 근관세포 형성 촉진 효과를 가짐을 보여준다. As a result, the images of MHC-positive myotube cells expressed by red fluorescence and the distribution of multinucleated MHC-positive myotube cells observed through DAPI staining are shown in Fig. 17A and Fig. 17B, respectively. It was confirmed that the formation of MHC-positive myotube cells was promoted by Creoside IV treatment compared to the control group (Fig. 17A). In the experimental groups treated with 1, 10, and 100 ng/ml of Creoside IV, the formation of multinucleated MHC-positive myotube cells increased, and in particular, the number of MHC-positive myotube cells with 2 to 4 nuclei significantly increased at a concentration of 100 ng/ml, and the number of MHC-positive myotube cells with 5 or more nuclei significantly increased in the groups treated with 1 and 10 ng/ml of Creoside IV compared to the control group (Fig. 17B). The above results show that Creoside IV has the effect of inducing differentiation of C2C12 myoblasts and promoting myotube formation.

5-3: 크레오사이드 Ⅳ의 미토콘드리아 기능 관련 유전자 발현 조절 확인5-3: Confirmation of regulation of gene expression related to mitochondrial function by Creoside IV

크레오사이드 Ⅳ의 C2C12 근원세포 분화 및 근관세포 형성 촉진 효과가 미토콘드리아의 기능과 관련이 있는지 확인하기 위하여, 근원세포의 미토콘드리아 내막에 존재하는 전자전달계 복합체 Ⅱ를 구성하는 SDHA와 미토콘드리아 분열(mitochondrial fission)을 조절하는 DRP1의 유전자 발현량을 RT-qPCR로 측정하였다. 사용된 프라이머 서열(primer sequence)은 표 2에 나타내었다. 그 결과, 특히 10, 100 ng/ml 처리군에서 SDHA는 대조군보다 그 발현량이 유의적으로 증가하고 반대로 미토콘드리아 분열에 관여하는 DRP1 유전자 발현은 유의하게 감소하였다(도 20). 이러한 결과는 크레오사이드 Ⅳ의 C2C12 근원세포 분화 및 근관세포 형성 촉진 효과가 미토콘드리아의 에너지 대사 활성화 및 미토콘드리아 손상 완화를 통한 미토콘드리아의 기능 개선과 관련이 있음을 보여준다.To determine whether the effects of Creoside IV on promoting C2C12 myoblast differentiation and myotube formation are related to mitochondrial function, the gene expression levels of SDHA, which constitutes electron transport chain complex II in the mitochondrial inner membrane of myoblasts, and DRP1, which regulates mitochondrial fission, were measured by RT-qPCR. The primer sequences used are shown in Table 2. As a result, the expression level of SDHA was significantly increased compared to the control group, especially in the 10 and 100 ng/ml treatment groups, while conversely, the expression of DRP1, which is involved in mitochondrial fission, was significantly decreased (Fig. 20). These results indicate that the effects of Creoside IV on promoting C2C12 myoblast differentiation and myotube formation are related to the improvement of mitochondrial function through the activation of mitochondrial energy metabolism and the alleviation of mitochondrial damage.

실험예 6: 쿠라리디놀의 근원세포 분화 유도 및 근관세포 형성 촉진 효과 확인Experimental Example 6: Confirmation of the effects of curaridinol on inducing myogenic differentiation and promoting myotube formation.

상기 실험예 3 결과를 기반으로 쿠라리디놀이 근원세포 분화(myoblast differentiation) 및 근관세포(myotube) 형성에 미치는 영향을 확인하고자 C2C12 근원세포(myoblast)를 이용하여 다음과 같은 세포실험을 진행하였다. C2C12 근원세포는 American Type Culture Collection (Manassas, VA, USA)에서 구입하여 15% fetal bovine serum (Gibco, Grand Island, NY, USA)을 함유한 Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA)로 6-웰 플레이트에 2 x 105 cells/ml 농도로 seeding 하였다. 24시간 배양 후 cell의 confluency가 약 90% 되었을 때, 2% horse serum (HyClone, Logan, UT, USA)을 함유한 분화 배지(differentiation medium, DM)로 교환하여 약 72시간 동안 분화를 유도하였다. 실험군은 DM에 고삼 뿌리 추출물 및 이에 분리된 쿠라리디놀을 0.01, 0.1, 1 ng/ml의 농도로 함께 처리하였고, 대조군은 DM에 vehicle인 DMSO를 처리하여 동일한 조건으로 배양하였다.Based on the results of Experimental Example 3 above, the following cell experiment was conducted using C2C12 myoblasts to confirm the effect of curaridinol on myoblast differentiation and myotube formation. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and seeded at a concentration of 2 x 10 5 cells/ml in 6-well plates with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). After 24 hours of culture, when the cell confluency reached approximately 90 %, the medium was replaced with differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for approximately 72 hours. The experimental group was treated with DM together with the extract of the root of Gosam and the curaridinol isolated from it at concentrations of 0.01, 0.1, and 1 ng/ml, and the control group was treated with DMSO as a vehicle in DM and cultured under the same conditions.

6-1: 쿠라리디놀의 근원세포 분화 촉진 효과6-1: Curaridinol's effect on promoting myogenic cell differentiation

쿠라리디놀이 근원세포 분화에 미치는 효과를 확인하고자, C2C12 근원세포의 근관세포로의 분화 유도 과정과 관련된 지표들인 MyoD, myogenin 및 MHC (myosin heavy chain) isoforms의 mRNA 발현을 RT-qPCR로 측정하였다. 이를 위해 상기 기재된 동일한 방법으로 C2C12에 쿠라리디놀을 처리하고 배양하여 분화를 유도한 후, Trizol 용액을 첨가해 세포를 용해시키고 원심분리하였다. 그 상층액에 클로로포름(chloroform)과 이소프로파놀(isopropanol)을 각각 첨가하고 원심분리를 한 후 상층액을 제거하였다. 남은 용액을 다 제거한 후 RNA 펠렛(pellet)을 nuclease free water를 사용하여 용해시켰다. 추출된 RNA의 농도를 측정하고 순도를 확인한 후 qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK)를 이용하여 cDNA를 합성하였다. 합성된 cDNA는 qPCRBIO SyGreen Mix (PCR Biosystem Ltd.)를 이용하여 정량적 PCR을 수행하였다. 사용된 프라이머 서열(primer sequence)은 표 3에 나타내었다. To determine the effect of curaridinol on myogenic cell differentiation, The mRNA expression of MyoD, myogenin, and MHC (myosin heavy chain) isoforms, which are markers associated with the differentiation of C2C12 myoblasts into myotubes, was measured by RT-qPCR. To this end, C2C12 cells were treated with curaridinol and cultured to induce differentiation using the same method described above. Trizol solution was added to lyse the cells and centrifuge them. Chloroform and isopropanol were added to the supernatant, centrifuged, and the supernatant was removed. After removing all remaining solutions, the RNA pellet was dissolved in nuclease-free water. The concentration of the extracted RNA was measured, the purity was confirmed, and cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). The synthesized cDNA was subjected to quantitative PCR using the qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 3.

Gene descriptionGene description PrimersPrimers Sequences (5' →3')Sequences (5' →3') 서열번호Sequence number GAPDHGAPDH FF CGTGCCGCCTGGAGAAACCGTGCCGCCTGGAGAAAC 3939 RR TGGGAGTTGCTGTTGAAGTCGTGGGAGTTGCTGTTGAAGTCG 4040 Myh1Myh1 FF GAGGGACAGTTCATCGATAGCAAGAGGGACAGTTCATCGATAGCAA 4141 RR GGGCCAACTTGTCATCTCTCATGGGCCAACTTGTCATCTCTCAT 4242 Myh2Myh2 FF CCGCAATGCAGAAGAGAAACCGCAATGCAGAAGAGAAA 4343 RR TTCACGGTCTGCTCCATGTTTCACGGTCTGCTCCATGT 4444 Myh4Myh4 FF CAGGACTTGGTGGACAAACTACACAGGACTTGGTGGACAAACTACA 4545 RR TTTAGTGTGAACCTCTCGGCTCTTTAGTGTGAACCTCTCGGCTC 4646 Myh7Myh7 FF CTCAAGCTGCTCAGCAATCTATTTCTCAAGCTGCTCAGCAATCTATTT 4747 RR GGAGCGCAAGTTTGTCATAAGTGGAGCGCAAGTTTGTCATAAGT 4848 MyoDMyoD FF AAACCCCAATGCGATTTATCAGGAAACCCCAATGCGATTTATCAGG 4949 RR TAAGCTTCATCTTTTGGGCGTGATAAGCTTCATCTTTTGGGCGTGA 5050 MyogeninMyogenin FF ACAGCATCACGGTGGAGGATATGTACAGCATCACGGTGGAGGATATGT 5151 RR CCCTGCTACAGAAGTGATGGCTTTCCCTGCTACAGAAGTGATGGCTTT 5252

그 결과, 근원세포 분화 초기단계 지표 MyoD 및 중기단계 지표 myogenin의 발현량이 대조군에 비해 쿠라리디놀을 0.01, 0.1, 1 ng/ml의 농도로 처리한 군에서 모두 유의적으로 증가하였으며, 특히 1 ng/ml 처리군에서는 다른 농도에서보다 유의적으로 그 발현량이 높았다(도 12). As a result, the expression levels of MyoD, an early stage marker of myogenic cell differentiation, and myogenin, an intermediate stage marker, significantly increased in the groups treated with curaridinol at concentrations of 0.01, 0.1, and 1 ng/ml compared to the control group, and in particular, the expression level was significantly higher in the 1 ng/ml treatment group than in the other concentrations (Fig. 12).

또한, 근원세포 분화 말기 마커이자 근육의 수축 속도 및 기능과 관련 있는 MHC isoforms의 발현량을 측정한 결과, 대조군과 비교했을 때 Myh1, Myh2, Myh4의 mRNA 발현량 역시 쿠라리디놀 처리군 (0.01, 0.1, 1 ng/ml)에서 모두 유의적으로 증가하였고, slow muscle fiber 관련 유전자인 Myh7 역시 대조군 대비 모든 농도에서 유의적으로 그 발현량이 증가하였다(도 15). 이상의 결과는 쿠라리디놀이 C2C12 근원세포의 분화 촉진 효과를 가짐을 보여준다. In addition, when we measured the expression levels of MHC isoforms, which are terminal markers of myoblast differentiation and are related to muscle contraction speed and function, the mRNA expression levels of Myh1, Myh2, and Myh4 were all significantly increased in the curaridinol-treated group (0.01, 0.1, 1 ng/ml) compared to the control group, and the expression level of Myh7, a slow muscle fiber-related gene, was also significantly increased at all concentrations compared to the control group (Fig. 15). The above results show that curaridinol has an effect of promoting differentiation of C2C12 myoblasts.

6-2: 쿠라리디놀의 근관세포 형성 촉진 효과6-2: Curaridinol's effect on promoting myotube formation

면역형광 염색(immunofluorescence staining)을 통해 쿠라리디놀에 의한 MHC-양성 근관세포 형성 정도를 확인하고자 하였다. 이를 위해 상기 기재된 동일한 조건에서 분화된 세포에 DM을 제거한 후 인산완충생리식염수(phosphate buffered saline; PBS)로 세척하고 4% 파라포름알데하이드(paraformaldehyde)로 30분간 고정하였다. 다시 PBS로 세척하고 0.1% Triton X-100으로 30분간 투과시킨 후 PBS로 세척하였다. 5% horse serum 용액에서 블로킹한 후 항-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA)로 염색하였다. PBS로 세척한 후 Alexa Fluor 568-접합 2차 항체와 DAPI (D9542, Sigma, St. Louis, MO, USA)로 처리하였다. 이미지는 형광현미경(Logos Biosystem, Anyang, South Korea)으로 촬영하였다. 촬영한 이미지 내 무작위로 선택된 부위에서 다핵성 근관세포(multinucleated MHC-expressing myotubes)를 산출하였다(Scale bar = 100 μm). MHC-양성이며, 다핵성(multinucleated)인 근관세포수를 분석한 후, 총 세포 수(total cells)를 적용하여 multinucleated-MHC-양성 근관세포수(MHC-positive myotubes)를 백분율로 나타내었다. To determine the extent of MHC-positive myotube formation by curaridinol, immunofluorescence staining was used. For this purpose, cells differentiated under the same conditions described above were washed with phosphate-buffered saline (PBS) after removing DM, fixed with 4% paraformaldehyde for 30 minutes, washed again with PBS, permeabilized with 0.1% Triton X-100 for 30 minutes, and then washed again with PBS. After blocking in 5% horse serum, the cells were stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were captured with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were counted from randomly selected areas within the captured images (Scale bar = 100 μm). After analyzing the number of MHC-positive, multinucleated myotubes, the number of multinucleated-MHC-positive myotubes was expressed as a percentage by applying the total cell number.

그 결과, 적색 형광으로 발현되는 MHC-양성 근관세포 이미지와 DAPI 염색을 통해 관찰한 다핵성 MHC-양성 근관세포 분포를 도 18A와 도 18B에 각각 나타내었다. 쿠라리디놀 처리에 의해 대조군 대비 MHC-양성 근관세포 형성이 촉진됨을 확인하였다(도 18A). 또한 쿠라리디놀을 0.01, 0.1, 1 ng/ml 처리한 실험군에서 단핵의 MHC-양성 근관세포는 대조군보다 유의하게 감소한 반면, 다핵의 MHC-양성 근관세포의 형성은 증가하였다. 특히 6개 이상의 핵을 가진 MHC-양성 근관세포의 비율은 쿠라리디놀을 처리한 모든 농도에서 대조군 대비 농도 의존적으로 유의하게 증가하였다(도 18B). 이상의 결과는 쿠라리디놀이 C2C12 근원세포의 분화 유도 및 근관세포 형성 촉진 효과를 가짐을 보여준다. As a result, the images of MHC-positive myotubes expressed by red fluorescence and the distribution of multinucleated MHC-positive myotubes observed through DAPI staining are shown in Figures 18A and 18B, respectively. It was confirmed that the formation of MHC-positive myotubes was promoted by curaridinol treatment compared to the control group (Figure 18A). In addition, in the experimental groups treated with 0.01, 0.1, and 1 ng/ml of curaridinol, the number of mononuclear MHC-positive myotubes significantly decreased compared to the control group, whereas the formation of multinucleated MHC-positive myotubes increased. In particular, the proportion of MHC-positive myotubes with six or more nuclei significantly increased in a concentration-dependent manner compared to the control group at all concentrations of curaridinol (Figure 18B). These results demonstrate that curaridinol has the effect of inducing differentiation of C2C12 myotubes and promoting myotube formation.

본 명세서에서 설명되는 실험예와 첨부된 도면은 이카리사이드 비2, 크레오사이드 IV 또는 쿠라리디놀의 유효물질의 효과를 나타내며, 상기 유효물질을 분리한 추출물 또한 그 효과를 내는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 자명하다.The experimental examples described in this specification and the attached drawings demonstrate the effects of the active substances of Icariside B2, Creoside IV or Curaridinol, and it is obvious to a person skilled in the art that an extract obtained by separating the active substances also exhibits the effects.

이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

서열목록 전자파일 첨부Attach an electronic file of the sequence list

Claims (13)

쿠라리디놀을 유효성분으로 포함하는 근육질환 예방 또는 치료용 또는 근기능 개선용 약학적 조성물로서,
상기 근육질환은 골격근의 근육질환인 것이며,
상기 근기능은 골격근의 근기능인 것이며,
상기 근육질환은 근손실, 근감소, 근위축증(muscular atrophy), 근육 퇴화, 악액질(cachexia) 및 근육감소증(sarcopenia)으로 이루어진 군으로부터 선택되는 하나 이상인 것인, 조성물.
A pharmaceutical composition for preventing or treating muscle disease or improving muscle function, comprising curaridinol as an active ingredient.
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A composition, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia.
쿠라리디놀을 유효성분으로 포함하는 근육질환 예방 또는 개선용 또는 근기능 개선용 의약외품 조성물로서,
상기 근육질환은 골격근의 근육질환인 것이며,
상기 근기능은 골격근의 근기능인 것이며,
상기 근육질환은 근손실, 근감소, 근위축증(muscular atrophy), 근육 퇴화, 악액질(cachexia) 및 근육감소증(sarcopenia)으로 이루어진 군으로부터 선택되는 하나 이상인 것인, 조성물.
A pharmaceutical composition for preventing or improving muscle disease or improving muscle function, containing curaridinol as an active ingredient.
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A composition, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia.
쿠라리디놀을 유효성분으로 포함하는 근육질환 예방 또는 개선용 또는 근기능 개선용 식품 조성물로서,
상기 근육질환은 골격근의 근육질환인 것이며,
상기 근기능은 골격근의 근기능인 것이며,
상기 근육질환은 근손실, 근감소, 근위축증(muscular atrophy), 근육 퇴화, 악액질(cachexia) 및 근육감소증(sarcopenia)으로 이루어진 군으로부터 선택되는 하나 이상인 것인, 조성물.
A food composition for preventing or improving muscle disease or improving muscle function, containing curaridinol as an active ingredient.
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A composition, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia.
쿠라리디놀을 유효성분으로 포함하는 근육질환 예방 또는 개선용 또는 근기능 개선용 사료 조성물로서,
상기 근육질환은 골격근의 근육질환인 것이며,
상기 근기능은 골격근의 근기능인 것이며,
상기 근육질환은 근손실, 근감소, 근위축증(muscular atrophy), 근육 퇴화, 악액질(cachexia) 및 근육감소증(sarcopenia)으로 이루어진 군으로부터 선택되는 하나 이상인 것인, 조성물.
A feed composition for preventing or improving muscle disease or improving muscle function, containing curaridinol as an active ingredient,
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A composition, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia.
제1항 내지 제4항 중 어느 한 항에 있어서,
상기 쿠라리디놀은 고삼 추출물로부터 분리된 것인, 조성물.
In any one of the first to fourth paragraphs,
A composition wherein the above curaridinol is isolated from a ginseng extract.
제5항에 있어서,
상기 고삼 추출물은 냉침, 가열, 초음파 및 환류 추출로 구성된 군에서 하나 이상 선택되는 방법에 의해 추출된 것인, 조성물.
In paragraph 5,
A composition wherein the above-mentioned ginseng extract is extracted by at least one method selected from the group consisting of cold extraction, heating, ultrasonic extraction, and reflux extraction.
제1항 내지 제4항 중 어느 한 항에 있어서,
상기 근육질환은 근기능 저하, 근육 소모 또는 근육 퇴화로 인하여 유발된 근육 질환인 것인, 조성물.
In any one of the first to fourth paragraphs,
A composition wherein the above muscle disease is a muscle disease caused by decreased muscle function, muscle wasting or muscle degeneration.
삭제delete 제1항 내지 제4항 중 어느 한 항에 있어서,
상기 쿠라리디놀은 미토콘드리아 손상 완화, 근원세포 분화 유도 또는 근관세포 형성 촉진 활성을 갖는 것인, 조성물.
In any one of the first to fourth paragraphs,
A composition wherein the above curaridinol has an activity of alleviating mitochondrial damage, inducing myoblast differentiation, or promoting myotube formation.
제1항 내지 제4항 중 어느 한 항에 있어서,
상기 쿠라리디놀은 MyoD, myogenin, Myh1, Myh2, Myh4 및 Myh7으로 이루어진 군으로부터 선택된 하나 이상의 발현을 증가시키는 것인, 조성물.
In any one of the first to fourth paragraphs,
A composition wherein the curaridinol increases the expression of at least one selected from the group consisting of MyoD, myogenin, Myh1, Myh2, Myh4 and Myh7.
제3항에 따른 식품 조성물을 포함하는 근육질환 예방 또는 개선용 또는 근기능 개선용 건강기능식품.A health functional food for preventing or improving muscle disease or improving muscle function, comprising a food composition according to Article 3. 삭제delete 고삼 추출물로부터 쿠라리디놀을 분리하는 단계를 포함하는, 쿠라리디놀을 유효성분으로 포함하는 근육질환 예방 또는 치료용 또는 근기능 개선용 조성물 제조방법으로서,
상기 근육질환은 골격근의 근육질환인 것이며,
상기 근기능은 골격근의 근기능인 것이며,
상기 근육질환은 근손실, 근감소, 근위축증(muscular atrophy), 근육 퇴화, 악액질(cachexia) 및 근육감소증(sarcopenia)으로 이루어진 군으로부터 선택되는 하나 이상인 것인, 제조방법.
A method for producing a composition for preventing or treating muscle disease or improving muscle function, comprising curaridinol as an active ingredient, comprising a step of isolating curaridinol from a ginseng extract.
The above muscle disease is a muscle disease of the skeletal muscles.
The above muscle function is the muscle function of skeletal muscles.
A manufacturing method, wherein the above muscle disease is at least one selected from the group consisting of muscle loss, sarcopenia, muscular atrophy, muscle degeneration, cachexia, and sarcopenia.
KR1020220163367A 2021-01-29 2022-11-29 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Sophora flavescens extract or active component separated therefrom as an active ingredient Active KR102843136B1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
KR20210013316 2021-01-29
KR1020210013316 2021-01-29
KR1020220013586A KR102803831B1 (en) 2021-01-29 2022-01-28 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Rhododendron brachycarpum extract or active component separated therefrom as an active ingredient

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020220013586A Division KR102803831B1 (en) 2021-01-29 2022-01-28 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Rhododendron brachycarpum extract or active component separated therefrom as an active ingredient

Publications (2)

Publication Number Publication Date
KR20220166246A KR20220166246A (en) 2022-12-16
KR102843136B1 true KR102843136B1 (en) 2025-08-07

Family

ID=82845451

Family Applications (3)

Application Number Title Priority Date Filing Date
KR1020220013586A Active KR102803831B1 (en) 2021-01-29 2022-01-28 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Rhododendron brachycarpum extract or active component separated therefrom as an active ingredient
KR1020220163367A Active KR102843136B1 (en) 2021-01-29 2022-11-29 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Sophora flavescens extract or active component separated therefrom as an active ingredient
KR1020220163358A Active KR102793592B1 (en) 2021-01-29 2022-11-29 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Codonopsis Pilosulae Radix extract or active component separated therefrom as an active ingredient

Family Applications Before (1)

Application Number Title Priority Date Filing Date
KR1020220013586A Active KR102803831B1 (en) 2021-01-29 2022-01-28 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Rhododendron brachycarpum extract or active component separated therefrom as an active ingredient

Family Applications After (1)

Application Number Title Priority Date Filing Date
KR1020220163358A Active KR102793592B1 (en) 2021-01-29 2022-11-29 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Codonopsis Pilosulae Radix extract or active component separated therefrom as an active ingredient

Country Status (1)

Country Link
KR (3) KR102803831B1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102803831B1 (en) * 2021-01-29 2025-05-09 숙명여자대학교산학협력단 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Rhododendron brachycarpum extract or active component separated therefrom as an active ingredient
WO2024162528A1 (en) * 2023-01-30 2024-08-08 주식회사 닥터오레고닌 Composition for treating or improving muscle loss and muscular dystrophy comprising oregonin compound derived from alder plant as active ingredient
CN116585301B (en) * 2023-07-18 2023-09-22 青岛瑞源细胞生物科技开发有限公司 Preparation for improving stem cell therapeutic capacity
CN119868339A (en) * 2025-01-23 2025-04-25 北京珺泰科技有限公司 Application of icaritin in medicine for treating tumor cachexia

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160066253A (en) 2014-12-02 2016-06-10 (주)아모레퍼시픽 Composition for preventing or improving metabolic syndrome containing icariside B2
KR20160081162A (en) * 2014-12-31 2016-07-08 (주)아모레퍼시픽 Skin external composition for anti-anging comprising compound K and icariside B2
KR102803831B1 (en) * 2021-01-29 2025-05-09 숙명여자대학교산학협력단 Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Rhododendron brachycarpum extract or active component separated therefrom as an active ingredient

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Sojung Lee 외, "Direct Activation of the Large-Conductance Calcium-Activated Potassium Channel by Flavonoids Isolated from Sophora flavescens", Biol. Pharm. Bull., 제41권, 제8호, 제1295-1298면 (2018년)*

Also Published As

Publication number Publication date
KR20220166246A (en) 2022-12-16
KR20220110443A (en) 2022-08-08
KR102803831B1 (en) 2025-05-09
KR20220166245A (en) 2022-12-16
KR102793592B1 (en) 2025-04-14

Similar Documents

Publication Publication Date Title
KR102843136B1 (en) Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Sophora flavescens extract or active component separated therefrom as an active ingredient
CN110237104B (en) Health product composition suitable for adult women, the elderly and sub-health people
CA2715704A1 (en) Leaves extract of panax sp., a process of making the same and uses thereof
EP3017821A1 (en) Composition having a function for alleviating premenstrual syndrome and menstrual pain
KR101785495B1 (en) Composition comprising Chrisanthemum indicum extract or fraction for treating, improving or preventing obesity or obesity-related disease
KR102732079B1 (en) Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Euphorbiae Lathyridis Semen extract, or active component separated therefrom as an active ingredient
KR20120001283A (en) Composition for preventing or treating osteoporosis comprising herbal extract or fermented product thereof
KR20110139472A (en) Osteoporosis prevention or treatment composition comprising wind-breaking acid or lactic acid bacteria fermentation thereof
KR20160123130A (en) Composition comprising Chrisanthemum indicum extract or fraction for treating, improving or preventing obesity or obesity-related disease
KR20170109703A (en) A pharmaceutical composition for preventing or treating cancer comprising fractions of herbal mixture extract
KR101749967B1 (en) A pharmaceutical composition comprising extract from germinated gemmule of bean for preventing or treating obesity
KR102764407B1 (en) Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Hedyotis diffusa Willdenow extract or active component separated therefrom as an active ingredient
KR101989603B1 (en) Composition for increase of muscular functions or exercise capacity comprising Vigna unguiculata (L.) Walp., Vicia faba L., or Dolichos lablab L.
KR102217264B1 (en) Composition for Preventing, Improving or Treating of muscular disease containing Codium SPP. algae extract
KR101972657B1 (en) Composition comprising extract of Angelica decursiva Franchet et Savatieras or compounds isolated therefrom for preventing or treating osteoporosis
KR20240013823A (en) Composition for improvement, prevention or treatment of muscular disorders, or improvement of muscular functions comprising tilianin
KR102851550B1 (en) Composition for preventing, improving or treating of muscular disease containing Aralia cordata extract
KR102725586B1 (en) Composition for prevention, improvement or treatment of muscular disorders, or enhancement of exercise performance comprising Osmanthus fragrans extracts as an active ingredient
KR102561751B1 (en) Composition for prevention, treatment or improvement of muscle disease comprising BLB301, complex extract of black raspberry and Phlomis umbrosa
WO2020122373A1 (en) Composition comprising glycyrrhiza uralensis extract as active ingredient for prevention, alleviation, or treatment of late-onset hypogonadism syndrome
KR20140145666A (en) Composition comprising natural complex of fucoxanthin, salix babylonica and low molecular weight alginate for preventing or treating of obesity
CN110404029B (en) Composition with blood sugar reducing effect and preparation method and application thereof
KR20250097662A (en) Composition for prevention, improvement or treatment of muscular disorders comprising extract of Prunella vulgaris as an active ingredient
KR20180032765A (en) A composition for improving, preventing and treating of fatty liver diseases comprising leek extract
KR20190036338A (en) Hepatoprotective composition containing youngia sonchifolia extract

Legal Events

Date Code Title Description
A107 Divisional application of patent
PA0107 Divisional application

St.27 status event code: A-0-1-A10-A18-div-PA0107

St.27 status event code: A-0-1-A10-A16-div-PA0107

PA0201 Request for examination

St.27 status event code: A-1-2-D10-D11-exm-PA0201

PG1501 Laying open of application

St.27 status event code: A-1-1-Q10-Q12-nap-PG1501

P11-X000 Amendment of application requested

St.27 status event code: A-2-2-P10-P11-nap-X000

P13-X000 Application amended

St.27 status event code: A-2-2-P10-P13-nap-X000

R18-X000 Changes to party contact information recorded

St.27 status event code: A-3-3-R10-R18-oth-X000

R18-X000 Changes to party contact information recorded

St.27 status event code: A-3-3-R10-R18-oth-X000

E902 Notification of reason for refusal
PE0902 Notice of grounds for rejection

St.27 status event code: A-1-2-D10-D21-exm-PE0902

E13-X000 Pre-grant limitation requested

St.27 status event code: A-2-3-E10-E13-lim-X000

P11-X000 Amendment of application requested

St.27 status event code: A-2-2-P10-P11-nap-X000

P13-X000 Application amended

St.27 status event code: A-2-2-P10-P13-nap-X000

E902 Notification of reason for refusal
PE0902 Notice of grounds for rejection

St.27 status event code: A-1-2-D10-D21-exm-PE0902

PN2301 Change of applicant

St.27 status event code: A-3-3-R10-R13-asn-PN2301

St.27 status event code: A-3-3-R10-R11-asn-PN2301

P11-X000 Amendment of application requested

St.27 status event code: A-2-2-P10-P11-nap-X000

D22 Grant of ip right intended

Free format text: ST27 STATUS EVENT CODE: A-1-2-D10-D22-EXM-PE0701 (AS PROVIDED BY THE NATIONAL OFFICE)

PE0701 Decision of registration

St.27 status event code: A-1-2-D10-D22-exm-PE0701

PR1002 Payment of registration fee

St.27 status event code: A-2-2-U10-U11-oth-PR1002

Fee payment year number: 1

U11 Full renewal or maintenance fee paid

Free format text: ST27 STATUS EVENT CODE: A-2-2-U10-U11-OTH-PR1002 (AS PROVIDED BY THE NATIONAL OFFICE)

Year of fee payment: 1

PG1601 Publication of registration

St.27 status event code: A-4-4-Q10-Q13-nap-PG1601

Q13 Ip right document published

Free format text: ST27 STATUS EVENT CODE: A-4-4-Q10-Q13-NAP-PG1601 (AS PROVIDED BY THE NATIONAL OFFICE)

R18 Changes to party contact information recorded

Free format text: ST27 STATUS EVENT CODE: A-5-5-R10-R18-OTH-X000 (AS PROVIDED BY THE NATIONAL OFFICE)

R18-X000 Changes to party contact information recorded

St.27 status event code: A-5-5-R10-R18-oth-X000