KR102187795B1 - Preparing method of library for next generation sequencing using deoxyuridine - Google Patents

Abstract

It relates to a library preparation method for next-generation sequencing using deoxyuridine.

Description

A library preparation method for next-generation sequencing analysis using deoxyuridine {PREPARING METHOD OF LIBRARY FOR NEXT GENERATION SEQUENCING USING USING DEOXYURIDINE}

The present application relates to a method for preparing a library for next-generation sequencing using dioxyuridine.

The next-generation sequencing (NGS) method essentially includes the step of creating a library with oligos called adapters attached to both ends of the DNA to be analyzed. The adapter is usually attached to the DNA to be analyzed by a ligase enzyme, but the ligase enzyme is relatively expensive, and the process using a ligase has a disadvantage that requires a lot of time and effort.

In order to replace the process using the ligase, there is a method of pre-linking the adapter to the DNA to be analyzed and amplifying by PCR using a DNA primer, and this method has the disadvantage that the PCR reaction must be performed twice. . In addition, when the number of DNAs to be analyzed increases, there is a disadvantage in that a dimer composed of DNA oligonucleotides is generated due to interference between the DNA primers.

Accordingly, development is required for a method for manufacturing an NGS library that is simple and generates less dimers.

[Prior technical literature]

Republic of Korea Patent Publication 10-2013-0018575.

The present application is to provide a library preparation method for the next-generation sequencing analysis using dioxyuridine.

However, the problem to be solved by the present application is not limited to the problem mentioned above, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

The first aspect of the present application is to provide a first primer pair comprising an adapter sequence and deoxyuridine to the double-stranded DNA fragment to be analyzed; First amplifying the DNA fragment to generate an amplification product and a deoxyuridine dimer of each DNA fragment; And by providing a uracil-DNA glycosylation (UGD) and a second primer pair to the product for secondary amplification, thereby generating an amplification product from which the deoxyuridine dimer has been removed, for next-generation sequencing analysis Provides a library preparation method.

The second aspect of the present application is to perform a next-generation sequencing analysis on the library prepared by the method according to the first aspect of the present application; Removing the adapter complementary sequence from the product of the next-generation sequencing; And it provides a DNA sequence analysis method using next-generation sequencing analysis comprising performing sequence analysis on the remaining products from which the adapter complementary sequence has been removed.

According to the embodiments of the present disclosure, deoxyuridine dimer is formed in excess by amplification using an oligonucleotide containing deoxyuridine in a target nucleic acid, and uracil-DNA glycosylate (UDG, deoxyuridine degrading enzyme ) By secondary amplification, removing the excessively formed dioxyuridine dimer, it is possible to prepare a library having less dimer compared to the conventional method.

The library preparation method according to the embodiments of the present disclosure may simplify the experiment step by removing the wash step performed after the first PCR amplification. Specifically, unlike the conventional amplicon-based target capture method including the sequence of the first PCR, the first wash step, the second PCR, and the second wash step, uracil-DNA glycosylation It is possible to simplify the process by eliminating the first wash step by using.

The library preparation method according to the embodiments of the present disclosure may minimize the loss of the first PCR amplification product by removing the first wash step performed after the first PCR amplification. In the wash step, which is a process of separating DNA from other unnecessary elements using magnetic beads, the first PCR amplification product may be lost. However, in the case of using the library preparation method according to the embodiments of the present application, since the first wash step can be removed by using uracil-DNA glycosylation, it is possible to eliminate the loss of PCR amplification products that may occur in the wash step. .

The method for preparing a library according to the embodiments of the present application includes uracil-DNA glycosylation and a secondary in the primary PCR amplification product, rather than re-preparing and using a reagent during secondary PCR by removing the primary wash step. Since only the primer is added and used, the experiment step can be simplified and the time required for the experiment can be effectively reduced accordingly.

In the case of the conventional library manufacturing method, since the wash step is included twice, the experiment time may rapidly increase as the number of samples increases when performing an experiment with a plurality of samples. However, in the case of using the library preparation method according to the embodiments of the present application, it is possible to effectively reduce the time spent by the experimenter in the experiment regardless of the number of samples by removing the wash step performed after the first PCR. It has the advantage of performing secondary PCR amplification immediately after PCR amplification.

1 is, in one embodiment of the present application, by providing a first primer pair, including an adapter sequence and deoxyuridine, to the double-stranded DNA fragment to be analyzed, and amplifying the amplification product and deoxy of each DNA fragment It is a schematic diagram showing the production process of a product containing a uridine dimer.
Figure 2 is, in one embodiment of the present application, by providing a pair of uracil-DNA glycosylate (UDG) and a second primer to the first amplification product to generate a second amplification product from which the deoxyuridine dimer is removed It is a schematic diagram showing the process of doing.
3 is a flow chart showing a DNA sequence analysis process using next-generation sequencing in one embodiment of the present application.
4A and 4B illustrate a DNA sequence analysis process using next-generation sequencing in one embodiment of the present application.
5 is a graph showing the length of the product after the first PCR amplification reaction when a pair of primers is used in an embodiment of the present application.
6 is a graph showing the analysis of the length of the final product after the first and second PCR amplification reactions when a pair of primers is used in an embodiment of the present application.
7 is a graph showing the results of DNA sequence analysis in the case of using a multiplex primer pair and subjected to uracil-DNA glycosylation treatment on a DNA sample to be analyzed in an example of the present application.
8 is a graph showing the results of DNA sequence analysis when a multiplex primer pair is used and a DNA sample to be analyzed is not subjected to uracil-DNA glycosylation treatment in an example of the present application.
9 is a graph showing the DNA sequence analysis results when a uracil-DNA glycosylation treatment is performed on a blank DNA sample using a multiplex primer pair in an example of the present application.
FIG. 10 is a graph showing DNA sequence analysis results when a multiplex primer pair is used and a blank DNA sample is not treated with uracil-DNA glycosylation in an example of the present application.

Hereinafter, exemplary embodiments of the present application will be described in detail with reference to the accompanying drawings so that those of ordinary skill in the art may easily implement the present application. However, the present application may be implemented in various different forms and is not limited to the embodiments described herein. In addition, in the drawings, parts not related to the description are omitted in order to clearly describe the present application, and similar reference numerals are attached to similar parts throughout the specification.

Throughout this specification, when a part is said to be “connected” to another part, this includes not only the case that it is “directly connected”, but also the case that it is “electrically connected” with another element interposed therebetween. do.

Throughout this specification, when a member is positioned “on” another member, this includes not only the case where a member is in contact with another member, but also the case where another member exists between the two members.

Throughout the specification of the present application, when a certain part "includes" a certain constituent element, it means that other constituent elements may be further included rather than excluding other constituent elements unless otherwise specified. The terms "about", "substantially", etc. of the degree used throughout the present specification are used at or close to the numerical value when manufacturing and material tolerances specific to the stated meaning are presented. To assist, accurate or absolute figures are used to prevent unfair use of the stated disclosure by unscrupulous infringers. As used throughout the specification of the present application, the term "step (to)" or "step of" does not mean "step for".

Throughout the present specification, the term “combination(s) thereof” included in the expression of the Makushi format refers to one or more mixtures or combinations selected from the group consisting of components described in the expression of the Makushi format, It means to include at least one selected from the group consisting of the above components.

Throughout this specification, the description of “A and/or B” means “A or B, or A and B”.

Hereinafter, embodiments and examples of the present application will be described in detail with reference to the accompanying drawings. However, the present application may not be limited to these embodiments and examples and drawings.

The first aspect of the present application is to provide a first primer pair comprising an adapter sequence and deoxyuridine to the double-stranded DNA fragment to be analyzed; First amplifying the DNA fragment to generate an amplification product and a deoxyuridine dimer of each DNA fragment; And by providing a uracil-DNA glycosylation (UGD) and a second primer pair to the product for secondary amplification, thereby generating an amplification product from which the deoxyuridine dimer is removed, for next-generation sequencing analysis Provides a library preparation method.

In one embodiment of the present application, the double-stranded DNA to be analyzed may be derived from nature or synthesized. For example, the DNA derived from nature may be cell-derived DNA or cell-free DNA, but may not be limited thereto.

In one embodiment of the present application, the double-stranded DNA to be analyzed may be derived from nature or synthesized, and the length may be 20 bp to 150 bp. For example, the length of the double-stranded DNA to be analyzed is 20 bp to 150 bp, 20 bp to 100 bp, 20 bp to 80 bp, 20 bp to 60 bp, 60 bp to 150 bp, 60 bp to 100 bp, or It may be 60 bp to 80 bp, but may not be limited thereto.

In one embodiment of the present application, connecting adapter sequences to both ends of the double-stranded DNA fragment to be analyzed may include a method using a PCR assembly.

In one embodiment of the present application, uracil-DNA glycosylation (UDG) is an enzyme that selectively removes deoxyuridine, and deoxyuridine dimers that are excessively amplified by the enzyme may be removed. For example, the uracil-DNA glycosylate removes all deoxyuridines contained in the primary amplification products and by-products, and specifically, the deoxyuridine dimer is fragmented into a length of 5 bp to 10 bp. It may be to take out and remove.

1 and 2, a method of preparing a library of the present application may be described. First, an adapter sequence containing deoxyuridine and a primary primer pair containing deoxyuridine are provided in the double-stranded DNA fragment to be analyzed. The primary primer pair includes a forward primer and a reverse primer, each of the primers having a nucleotide sequence complementary to the adapter, and a half sequence length adapter complementary sequence including two deoxyuridines, each of the DNA fragments It may include a specific region binding sequence, and deoxyuridine, which have a nucleotide sequence that is unique to.

In one embodiment of the present application, each of the primers included in the first primer pair has a nucleotide sequence complementary to the adapter and an adapter complementary sequence comprising deoxyuridine, and is unique for each DNA fragment. It may include a specific region binding sequence having a nucleotide sequence.

In one embodiment of the present application, in the first primer pair, the specific region binding sequence is assigned a sequence according to a target region, and a specific sequence does not exist.

In one embodiment of the present application, the specific region binding sequence is a portion that binds to a target region, and the specific region binding sequence specifically binds to a target region to amplify only a specific region. For example, the length of the specific region binding sequence may be about 10 bp to about 30 bp, and preferably about 10 bp to about 30 bp.

In one embodiment of the present application, thymine of the first primer pair may be changed to dioxyuridine. For example, about 3 thymines of the first primer pair including the complementary sequence of the double-stranded DNA fragment to be analyzed or all thymines present in the sequence may be changed to deoxyuridine, but is not limited thereto. I can.

In one embodiment of the present application, the position changed to the deoxyuridine may be different for each of the primary primer pairs. For example, the first primer pair may be prepared such that deoxyuridine is present once every about 10 sequences, and preferably, deoxyuridine is present every about 5, about 10, or about 15 sequences. The primary primer pair may be prepared to exist, but may not be limited thereto.

Next, the DNA fragment is first amplified to produce a first amplification product containing deoxyuridine and a first amplification product containing deoxyuridine as a by-product. Through the first amplification, in addition to the deoxyuridine, deoxyuridine dimer, which is a by-product, may be produced in excess.

In one embodiment of the present application, the amplification product using the first primer pair may include an adapter complementary sequence and a specific region binding sequence, respectively, in both flanking regions of the DNA fragment.

In one embodiment of the present application, the secondary primer pair used in the secondary amplification may not include dioxyuridine. For example, the uracil-DNA glycosylase was used to remove the deoxyuridine dimer, which was excessively produced in the first amplification, to a length within 5 bp to 10 bp, so that the second amplification was performed by the uracil-DNA glycosylation. In order to prevent silase from being affected, it may be performed using a secondary primer pair in which deoxyuridine does not exist.

Next, uracil-DNA glycosylation and a second common primer pair are provided to the first amplification product. The second common primer pair does not contain deoxyuridine, contains a forward primer and a reverse primer, each of the primers having a nucleotide sequence complementary to the adapter, an adapter complementary sequence of intact sequence length, and each of the Each DNA fragment contains sample-specific sequences having the same nucleotide sequence.

In one embodiment of the present application, each of the primers included in the secondary primer pair includes an adapter complementary sequence having a nucleotide sequence complementary to the adapter, and a sample unique sequence having the same nucleotide sequence for each DNA fragment. It can be.

In one embodiment of the present application, in the second amplification, since deoxyuridine of the first primer pair including the deoxyuridine is removed by the uracil-DNA glycosylation, the first primer pair Since the length is shortened, the second amplification may not operate. Therefore, according to one embodiment of the present application, since the second amplification can be performed immediately without performing the wash step that must be performed after the first amplification, the library manufacturing process is simplified and the time required for the manufacturing process is shortened. can do.

In one embodiment of the present application, since the wash step that had to be performed after the first amplification by the uracil-DNA glycosylation can be removed, the risk of loss of the amplification product generated by the wash step can be reduced, and the sample Regardless of the number, the time spent on experiments can be effectively reduced, and the process can be simplified.

In one embodiment of the present application, the first amplification reaction and the second amplification reaction may be performed separately.

In one embodiment of the present application, the first amplification reaction may be a PCR reaction using the first primer pair. For example, the cycle of the amplification reaction is 1 to 50 times, 1 to 30 times, 1 to 20 times, 1 to 16 times, 1 to 12 times, 1 to 10 times, 1 to 4 Times, 4 to 50 times, 4 to 30 times, 4 to 20 times, 4 to 16 times, 4 to 12 times, 4 to 10 times, 10 to 50 times, 10 to 30 times, It may be 10 to 20 times, 10 to 16 times, 10 to 12 times, 12 to 20 times, 12 to 16 times, or 16 to 20 times, but may not be limited thereto.

In one embodiment of the present application, the secondary amplification reaction may be a PCR reaction using the secondary primer pair. For example, the cycle of the amplification reaction is 1 to 50 times, 1 to 30 times, 1 to 20 times, 1 to 16 times, 1 to 12 times, 1 to 10 times, 1 to 4 Times, 4 to 50 times, 4 to 30 times, 4 to 20 times, 4 to 16 times, 4 to 12 times, 4 to 10 times, 10 to 50 times, 10 to 30 times, It may be 10 to 20 times, 10 to 16 times, 10 to 12 times, 12 to 20 times, 12 to 16 times, or 16 to 20 times, but may not be limited thereto.

In one embodiment of the present application, the specific region binding sequence may be composed of 10 to 20 nucleotides, but may not be limited thereto. For example, the specific region binding sequence may be composed of 10 to 20, 10 to 16, 10 to 12, 12 to 20, 12 to 16 or 16 to 20 nucleotides. However, it may not be limited thereto.

In one embodiment of the present application, the concentrations of the first primer pair and the second primer pair may be the same or different, respectively.

In one embodiment of the present application, when the concentrations of the first primer pair and the second primer pair are each less than 1 pmole, PCR may not proceed normally, and when the concentration exceeds 30 pmole, respectively, deoxyuridine dimer Is formed in an excessive amount so that it may be difficult to perform PCR, the concentration of the first primer pair and the second primer pair may be about 1 pmole to about 30 pmole, respectively. For example, the concentration of the first primer pair and the second primer pair is about 1 pmole to about 30 pmole, about 1 pmole to about 20 pmole, about 1 pmole to about 10 pmole, about 10 pmole to about 30 pmole, respectively. , About 10 pmole to about 20 pmole, about 20 pmole to about 30 pmole, or about 10 pmole to about 18 pmole, but may not be limited thereto.

The second aspect of the present application is to perform a next-generation sequencing analysis on the library prepared by the method according to the first aspect of the present application; Removing the adapter complementary sequence from the product of the next-generation sequencing; And it provides a DNA sequence analysis method using next-generation sequencing analysis comprising performing sequence analysis on the remaining products from which the adapter complementary sequence has been removed.

With respect to the analysis method according to the second aspect of the present application, detailed descriptions of parts that overlap with the first aspect of the present application have been omitted, but even if the description is omitted, the content described in the first aspect of the present application refers to the second aspect of the present application. The same can be applied.

3 and 4, the DNA sequence analysis method can be described. First, next-generation sequencing is performed on the library prepared by the library preparation method. In one embodiment of the present application, the next-generation sequencing is a group consisting of sequencing by synthesis, ion torrent sequencing, pyrosequencing, sequencing by ligation, nanopore sequencing, single-molecule real-time sequencing, and combinations thereof It may be selected from. After next-generation sequencing, the adapter complementary sequence is removed from the data file generated by the next-generation sequencing in the FASTQ Filtration process.

Thereafter, the sequence from which the adapter sequence has been removed is aligned with the reference sequence. The reference sequence may be sequence information stored in a sequence database available in the art. The alignment of the reads may be performed using a sequence alignment tool known in the art or a tool developed for alignment of the reads. The sequence alignment tool may be, for example, BWA, BarraCUDA, BBMap, BLASTN, Bowtie, NextGENe, or UGENE, but may not be limited thereto.

After alignment, nucleotide sequence mutation information extraction (variant calling), which is a task of confirming the type and ratio of mutations present in each DNA sequence, is performed. Depending on the purpose to analyze the nucleic acid sequence, the result can be derived using the type and ratio of the required mutation.

Hereinafter, the present invention will be described in more detail through examples of the present application, but the following examples are merely illustrative to aid understanding of the present application, and the contents of the present application are not limited to the following examples.

[Example]

Library creation

In this example, the DNA to be analyzed is a minimum of similar samples such as Genomic DNA (using Qiagen's QIAamp DNA Mini and QIAamp DNA Blood Mini Kit), cell-free DNA (cell-free DNA, using Qiagen's QIAamp Circulating Nucleic Acid Kit). Experiments were conducted using 10 ng.

The amplicon library was constructed through a total of 2 PCRs. Each PCR was amplified by attaching a sample unique sequence for sequencing and an adapter that binds to the primer of the flowcell in the NGS equipment at both ends of the DNA sequence through a pair of primers (forward primer and reverse primer).

First, a first PCR was performed using a first PCR primer mixture containing a specific region binding sequence of the target region. The first PCR reaction mixture solution was a total of 20 uL, and premix 2X, DNA (10 ng), and the first primer mixture (total 16 pmole) were mixed to perform the first amplification. The primary primer has a half-sequence adapter (adapter complementary sequence) and a specific region binding sequence, and deoxyuridine is included in the primer. The sequence of the primary PCR forward primer (SEQ ID NO: 1) and the sequence of the reverse primer (SEQ ID NO: 2) used in this Example are shown in Table 1 below.

direction primer Sequence (5'->3 ') Forward direction CACGACGCUCTTCCGATCUNNNNNNNNNUNNNNNNNNNN Reverse GACGTGTGCUCTTCCGATCUNNNNNNNNNUNNNNNNNNNN

Since the specific region binding sequence of the primary PCR primer is assigned a sequence according to the target region, there is no specific sequence.

The length of the specific region binding sequence is about 20 bp on average, and from 15 bp to 30 bp as long as possible. In the primary PCR primer, deoxyuridine (dU) is replaced with thymine (T), and as few as 3, all thymines present in the sequence are changed to deoxyuridine. The position to be changed to the deoxyuridine is different for each primary primer, but on average, a primer is prepared so that deoxyuridine is present once every 10 sequences, depending on the sequence, as short as every 5 to 15 sequences. Uridine was made to exist.

In the first amplification, PCR reaction conditions were 1 minute at 95°C, 2 minutes at 60°C, and 30 seconds at 72°C, and a total of 20 times were performed. Preliminary denaturation and final elongation were performed at 95°C for 10 minutes and 72°C for 10 minutes, respectively. The primary primer mixture consists of at least one pair (forward and reverse primers), and at most 84 pairs (forward and reverse primers) of primary PCR primers, and in this example, for a single nucleotide polymorphism (SNP) position It consists of 39 pairs. Regardless of the number of primers, the final primer amount was 16 pmole, and the final concentration was 0.8 μM (16 pmole/20 μL).

After that, a second amplification reaction was performed by adding a second primer containing an Illumina adapter and not containing deoxyuridine, and uracil-DNA glycosylation (UDG) to the first PCR product. The mixed solution of the second PCR reaction of the second amplification reaction was 21.5 uL in total. The first PCR product, the second primer (10 pmole), and UDG (1 unit) were mixed to perform the second PCR. The secondary primer contains the intact adapter sequence (including the adapter complementary sequence, p5 sequence and p7 sequence in Fig. 2) and sample-specific sequences. The sequence of the secondary PCR forward primer (SEQ ID NO: 3) and the reverse primer sequence (SEQ ID NO: 4) used in this example are shown in Table 2 below.

direction primer Sequence (5'->3 ') Forward direction AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATC Reverse CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

The PCR reaction conditions for the secondary amplification were 1 minute at 95°C, 1 minute at 65°C, and 1 minute at 72°C, and a total of 15 times were performed. Preliminary denaturation and final elongation were performed at 95°C for 10 minutes and 72°C for 10 minutes, respectively.

Finally, after purification of the secondary PCR product, it was confirmed that a DNA library having an average size of about 220 bp was obtained using TapeStation 4200.

Nucleic acid sequence analysis

After sequencing the final product of PCR according to the amplicon-based target capture method using the Illumina MiSeq equipment, a FASTQ data file that is raw data with nucleotide sequence information Was created. The FASTQ data file included all the DNA molecule sequences and adapter sequence information included in the final product.

Next, of all the sequences present in the FASTQ, after removing the adapter sequence, DNA molecular sequences were aligned to a human reference genome. After alignment, nucleotide sequence mutation information extraction (variant calling), which is an operation to check the type and ratio of mutations present in each DNA sequence, was performed (FIGS. 3 and 4). According to the purpose of analyzing the nucleic acid sequence, the result was derived using the type and ratio of the required mutation.

5 is a graph showing the length of the product after the first PCR amplification reaction when only one pair of primers is used to confirm the length of the product. As shown in FIG. 5, the average length of the first PCR product was 120 bp. This is the length including the adapter sequence and the specific region sequence of the half sequence present in the forward and reverse primers, and the length of the primary PCR product is at least 105 bp and at most 130 bp.

6 is a graph showing the analysis of the length of the final product after the first and second PCR amplification reactions when only one pair of primers is used to check the length of the product. In the case of the final product length of the second PCR, the average was 220 bp. This is the length including the intact adapter sequence, sample specific sequence and specific region sequence present in the forward and reverse primers, and the final product length of the secondary PCR is 205 bp and maximum 230 bp.

7 and 8 show the DNA sequence analysis results in the case where the DNA sample to be analyzed was subjected to uracil-DNA glycosylation treatment (FIG. 7) and the case where the uracil-DNA glycosylation treatment was not performed (FIG. 8). It is a graph.

9 and 10 are graphs showing the results of DNA sequence analysis when a blank DNA sample was subjected to uracil-DNA glycosylation treatment (FIG. 9) and no uracil-DNA glycosylation treatment (FIG. 10). to be.

As shown in FIGS. 7 and 9, a true PCR band (~ 220 bp) was observed only when UDG treatment was performed after using a primer containing deoxyuridine (dU) (FIG. 7), and DNA was not added. It can be seen that only the dimer band was observed in the blank sample (FIG. 9).

In addition, as shown in FIGS. 8 and 10, when the UDG treatment was not performed, it can be confirmed that a nonspecific PCR dimer band was observed even when a DNA sample was added.

The foregoing description of the present application is for illustrative purposes only, and those of ordinary skill in the art to which the present application pertains will be able to understand that it is possible to easily transform it into other specific forms without changing the technical spirit or essential features of the present application. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not limiting. For example, each component described as a single type may be implemented in a distributed manner, and similarly, components described as being distributed may also be implemented in a combined form.

The scope of the present application is indicated by the claims to be described later rather than the detailed description, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts should be interpreted as being included in the scope of the present application.

<110> DXOME CO., LTD. <120> PREPARING METHOD OF LIBRARY FOR NEXT GENERATION SEQUENCING USING DEOXYURIDINE <130> DP20190080KR <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Artificial first PCR forward primer <400> 1 cacgacgcuc ttccgatcun nnnnnnnnun nnnnnnnnn 39 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Artificial first PCR reverse primer <400> 2 gacgtgtgcu cttccgatcu nnnnnnnnnu nnnnnnnnnn 40 <210> 3 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Artificial second PCR forward primer <400> 3 aatgatacgg cgaccaccga gatctacact atagcctaca ctctttccct acacgacgct 60 cttccgatc 69 <210> 4 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Artificial second PCR reverse primer <400> 4 caagcagaag acggcatacg agatcgagta atgtgactgg agttcagacg tgtgctcttc 60 cgatct 66

Claims (11)

Providing a pair of primary primers comprising an adapter sequence and deoxyuridine to the double-stranded DNA fragment to be analyzed;
First amplifying the DNA fragment to generate an amplification product and a deoxyuridine dimer of each DNA fragment; And
Providing a uracil-DNA glycosylate and a second primer pair to the product for secondary amplification, thereby producing an amplification product from which the deoxyuridine dimer has been removed
As a method for preparing a library for next-generation sequencing, including,
Each of the primers included in the secondary primer pair does not contain deoxyuridine, a method for preparing a library for next-generation sequencing.
The method of claim 1,
Linking the adapter sequence will include a method using a PCR assembly or a method using ligation, a method for preparing a library for next-generation sequencing.
The method of claim 1,
Each of the primers included in the primary primer pair,
An adapter complementary sequence having a nucleotide sequence complementary to the adapter; And
A method for preparing a library for next-generation sequencing analysis, comprising a specific region binding sequence having a unique nucleotide sequence for each of the DNA fragments.
delete The method of claim 1,
Each of the primers included in the secondary primer pair,
An adapter complementary sequence having a nucleotide sequence complementary to the adapter; And
A method for preparing a library for next-generation sequencing analysis, comprising a sample unique sequence having the same nucleotide sequence for each of the DNA fragments.
The method of claim 1,
The length of the double-stranded DNA fragments to be analyzed is 20 bp to 150 bp,
Library preparation method for next-generation sequencing.
The method of claim 3,
The specific region binding sequence is composed of 10 to 30 nucleotides, a method for preparing a library for next-generation sequencing.
The method of claim 1,
The cycle of the first amplification reaction and the second amplification reaction are each performed for 1 to 20 times, a method for preparing a library for next-generation sequencing.
Performing next-generation sequencing on the library prepared by the method according to any one of claims 1 to 3 and 5 to 8;
Removing the adapter complementary sequence from the product of the next-generation sequencing; And
DNA sequence analysis method using next-generation sequencing, comprising performing sequence analysis on the remaining products from which the adapter complementary sequence has been removed.
The method of claim 9,
The next-generation sequencing is selected from the group consisting of sequencing by synthesis, ion torrent sequencing, pyrosequencing, sequencing by ligation, nanopore sequencing, single-molecule real-time sequencing, and combinations thereof,
DNA sequence analysis method using next-generation sequencing.
The method of claim 9,
The sequence analysis comprises aligning the remaining products from which the adapter complementary sequence has been removed to a reference sequence. DNA sequence analysis method using next-generation sequencing.

Images