KR102119875B1 - 한국형 중동호흡기증후군 코로나바이러스 감염성 변이 유전자 및 이의 용도 - Google Patents

한국형 중동호흡기증후군 코로나바이러스 감염성 변이 유전자 및 이의 용도 Download PDF

Info

Publication number
KR102119875B1
KR102119875B1 KR1020190031225A KR20190031225A KR102119875B1 KR 102119875 B1 KR102119875 B1 KR 102119875B1 KR 1020190031225 A KR1020190031225 A KR 1020190031225A KR 20190031225 A KR20190031225 A KR 20190031225A KR 102119875 B1 KR102119875 B1 KR 102119875B1
Authority
KR
South Korea
Prior art keywords
respiratory syndrome
gene
korean
east respiratory
syndrome coronavirus
Prior art date
Application number
KR1020190031225A
Other languages
English (en)
Inventor
김성준
김범태
명진종
이정윤
Original Assignee
한국화학연구원
전북대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국화학연구원, 전북대학교산학협력단 filed Critical 한국화학연구원
Priority to KR1020190031225A priority Critical patent/KR102119875B1/ko
Application granted granted Critical
Publication of KR102119875B1 publication Critical patent/KR102119875B1/ko

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/215Coronaviridae, e.g. avian infectious bronchitis virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense
    • C12N2770/00011MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense ssRNA Viruses positive-sense
    • C12N2770/20011Coronaviridae
    • C12N2770/20034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense
    • C12N2770/00011MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense ssRNA Viruses positive-sense
    • C12N2770/20011Coronaviridae
    • C12N2770/20051Methods of production or purification of viral material

Abstract

본 발명은 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자와 이의 용도에 관한 것으로, 보다 상세하게는 돌연변이 방법을 이용한, 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자와 이의 제조방법, 상기 유전자를 포함하는 재조합 벡터에 관한 것이다.
본 발명의 상기 돌연변이 방법을 이용하여 제작한 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자 및 이의 제조방법은 바이러스 증식 연구와 약독성 바이러스 개발에 유용하게 사용될 수 있다.
또한 상기 유전자를 포함하는 재조합 벡터는 한국형 중동호흡기증후군 코로나바이러스 백신 및 이의 제조방법 관련 기술로 유용하게 사용될 수 있다.
The present invention relates to an infectious mutant gene of Korean type Middle East Respiratory Syndrome coronavirus and its use, and more specifically, to a mutant method, an infectious mutation gene of Korean type Middle East Respiratory Syndrome Coronavirus and a method of manufacturing the same, and a recombinant comprising the gene It's about vectors.
The infectious mutant gene of the Korean type Middle East Respiratory Syndrome coronavirus produced using the mutagenesis method of the present invention and a method for manufacturing the same can be useful for virus proliferation studies and development of weakly toxic viruses.
In addition, the recombinant vector containing the gene can be usefully used as a technology related to the Korean type Middle East Respiratory Syndrome coronavirus vaccine and its manufacturing method.

Description

한국형 중동호흡기증후군 코로나바이러스 감염성 변이 유전자 및 이의 용도{South Korean strain Middle East Respiratory syndrome coronavirus Infectious mutated gene and use thereof}South Korean strain Middle East Respiratory syndrome coronavirus Infectious mutated gene and use thereof

본 발명은 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자와 이의 용도에 관한 것으로, 더욱 상세하게는 상기 유전자를 포함하는 재조합 벡터를 이용한 백신 및 이의 제조 방법에 관한 것이다. The present invention relates to an infectious mutant gene of Korean type Middle East Respiratory Syndrome and its use, and more particularly, to a vaccine using a recombinant vector containing the gene and a method of manufacturing the same.

중동호흡기증후군 코로나바이러스 (Middle East respiratory syndrome coronavirus, MERS-CoV)는 세계보건기구에서 선정한 전 세계적으로 감염을 일으키는 중요한 병원체중의 하나이다. 전 세계적으로 2017년 4월 기준으로, 1936건의 바이러스 감염과 690건의 사망 사건이 보고되었다. 중동호흡기증후군 코로나바이러스는 주로 낙타 간의 전이가 보고되었으며, 인간으로의 전이 가능성도 제기되어 왔다. 비록 사람 간의 전이 가능성은 작게 예상되어왔으나, 병원 관련 사망률은 최대 65%까지 보고되고 있다. 현재까지, 허가된 백신은 없으며, 인터페론 (interferon), 리바비린 (rivavirin), 코티코스테로이드 (corticosteroid) 치료만이 행해지고 있다. 현재까지 다른 코로나바이러스와 비교해서 중동호흡기증후군 코로나바이러스의 강한 이유는 아직 밝혀진 바가 없다. 하지만, 이미 발표된 연구에 의하면 중동호흡기증후군 코로나바이러스의 단백질 중 p4a, p4b, p5가 인터페론베타 (IFN-β와 같은 면역 관련 단백질의 발현을 저해하는 작용을 하는 것으로 알려졌다. 이에 역유전학시스템(reverse genetics system)을 이용한 연구는 바이러스의 증식과 병원성, 항바이러스 관련 연구, 백신 개발을 위한 중요한 도구로 사용되고 있다. 코로나바이러스 역유전학 기술은 코로나바이러스의 커다란 유전자 크기로 인해 어려움을 겪고 있으며 도전적인 영역이었다. The Middle East respiratory syndrome coronavirus (MERS-CoV) is one of the major pathogens of infection worldwide selected by the World Health Organization. As of April 2017, 1936 viral infections and 690 deaths were reported worldwide. The Middle East Respiratory Syndrome coronavirus has been reported to have metastases between camels, and the possibility of metastasis to humans has also been raised. Although the possibility of metastasis among humans has been expected to be small, hospital-related mortality rates have been reported up to 65%. To date, there are no licensed vaccines, and only interferon, rivavirin, and corticosteroid treatments have been performed. To date, the strong reason for the Middle East Respiratory Syndrome coronavirus compared to other coronaviruses has not been established. However, studies that have been published have shown that p4a, p4b, and p5 among the proteins of the Middle Eastern respiratory syndrome coronavirus act to inhibit the expression of immune-related proteins such as interferonbeta (IFN-β. The genetics system has been used as an important tool for virus proliferation and pathogenicity, antiviral research, and vaccine development.Coronavirus reverse genetics technology is challenging and challenging due to the large gene size of coronavirus. .

중동호흡기증후군 코로나바이러스 변이 및 백신 관련 선행연구로, 선행문헌 (비특허문헌1, Muth et al., Journal of General Virology 2017;98 : 2461 -2469) 에서는 중동호흡기증후군 코로나바이러스의 cDNA 만드는 방법이 개시되어 있으나, 한국형 중동호흡기증후군 코로나바이러스 염기서열이 아니고, 상기 cDNA 만드는 방법에서 구체적인 cDNA 서열에 대한 내용이 개시되지 않았다. 또한 선행문헌 (비특허문헌2, Yuri kim et al, MBio. 2016 Mar 1;7(2):e00019) 에서는 한국형 중동호흡기 증후군 코로나바이러스 유전자 변이에 대해서만 개시되었다. Middle East Respiratory Syndrome Coronavirus mutation and vaccine related prior studies, prior literature (Non-Patent Document 1, Muth et al., Journal of General Virology 2017; 98: 2461 -2469) discloses a method of making cDNA of the Middle East Respiratory Syndrome Coronavirus However, the Korean Middle East Respiratory Syndrome is not a coronavirus base sequence, and details of the specific cDNA sequence in the method of making the cDNA have not been disclosed. In addition, prior literature (Non-Patent Document 2, Yuri kim et al, MBio. 2016 Mar 1;7(2):e00019) discloses only the mutation of the Korean type Middle East Respiratory Syndrome coronavirus.

따라서, 본 발명자들은 코로나바이러스 역유전학 기술과 고전적인 유전학 기술을 이용하여, 효과적인 조작이 가능한 세균인공염색체 플라스미드 (BAC, bacterial artificial chromosome plasmid) 기반 한국형 중동호흡기증후군 코로나바이러스 유전자 기술을 제시하고, 돌연변이 생성(Mutagenesis) 방법을 이용하여, 원본 단백질 서열을 유지하면서 신규한 제한효소 FspA1과 Mlu1을 인식하는 염기서열을 한국형 중동호흡기 증후군 코로나바이러스 유전자 내에 생성하고, T7 리보뉴클레오타이드 폴리메라아제 프로모터 (T7 RNA Polymerase promoter) 염기서열 중 마지막 세 개의 구아닌을 결실함으로써, 신규 한국형 중동호흡기 증후군 코로나바이러스 감염성 cDNA 벡터를 제작하고, 본 발명을 완성하였다. Accordingly, the present inventors present a Korean-style Middle Eastern Respiratory Syndrome coronavirus gene technology based on bacterial artificial chromosome plasmid (BAC) that can be effectively manipulated using coronavirus reverse genetics technology and classical genetics technology, and generate mutants. Using the (Mutagenesis) method, while maintaining the original protein sequence, a new nucleotide sequence that recognizes the restriction enzymes FspA1 and Mlu1 is generated in the Korean Middle East Respiratory Syndrome coronavirus gene, and the T7 ribonucleotide polymerase promoter (T7 RNA Polymerase promoter) ) By deleting the last three guanines in the base sequence, a new Korean-style Middle East Respiratory Syndrome coronavirus infectious cDNA vector was prepared and the present invention was completed.

본 발명의 목적은 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자와 이의 용도에 관한 것으로, 상기 유전자 및 이의 제조방법을 제공하는 것이다. An object of the present invention is to provide an infectious mutant gene and its use of the Korean type Middle East Respiratory Syndrome Coronavirus, and to provide the gene and a method for manufacturing the same.

또한 본 발명의 다른 목적은 상기 유전자를 포함하는 재조합 벡터를 이용한 백신 및 이의 제조 방법을 제공하는 것이다. In addition, another object of the present invention is to provide a vaccine using the recombinant vector containing the gene and a method for producing the same.

본 발명의 목적을 달성하기 위하여,In order to achieve the object of the present invention,

한국형 중동호흡기증후군 코로나바이러스(Korean strain Middle East respiratory syndrome Coronavirus, MERS-CoV)의 감염성 변이 유전자로서, As an infectious mutation gene of Korean strain Middle East respiratory syndrome Coronavirus (MERS-CoV),

제한효소 FspAI를 인식하는 제 1부위(site), 제한효소 MluI를 인식하는 부위 및 T7 리보뉴클레오타이드 폴리메라아제(T7 RNA Polymerase) 일시중지 부위 중 어느 하나 이상을 치환, 제거 또는 삽입하여 제조된 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자를 제공한다. Korean Middle East manufactured by replacing, removing or inserting at least one of the first site recognizing the restriction enzyme FspAI, the site recognizing the restriction enzyme MluI, and the pause site of the T7 ribonomer polymerase (T7 RNA Polymerase) Provides infectious mutation genes for respiratory syndrome coronavirus.

상기 유전자에서 11267번째 뉴클레오타이드가 사이토신에서 티민으로 치환되어, 상기 제한효소 FspAI를 인식하는 제1부위가 결실;In the gene, the 11267th nucleotide is substituted with cytosine to thymine, and the first site for recognizing the restriction enzyme FspAI is deleted;

19198번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 상기 제한효소 MluI를 인식하는 부위가 삽입 ;19198th nucleotide is substituted from adenine to guanine to insert a site that recognizes the restriction enzyme MluI;

2849번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 상기 T7 리보뉴클레오타이드 폴리메라아제 일시중지 부위가 결실;된 것중 어느 하나 이상을 포함하는 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자를 제공한다. 상기 유전자는 서열 1인 것이다. The 2849th nucleotide is substituted by adenine to guanine to delete the T7 ribonucleotide polymerase pause site; and provides an infectious mutation gene of Korean type Middle East Respiratory Syndrome coronavirus containing any one or more of the above. The gene is SEQ ID NO:1.

또한 본 발명은 상기 유전자를 포함하는 재조합 벡터를 제공한다. 상기 벡터는 PCC1 벡터를 사용하는 재조합 벡터이며, T7 뉴클레오타이드 폴리메라이제 프로모터 염기서열 중 마지막 뉴클레오타이드 3개의 구아닌이 결실된 재조합 벡터이다. 또한 상기 벡터는 PCC1-Sall-SF-T7p-dGGG-MF인, 재조합 벡터이다. 상기 벡터는 깁슨 어셈블리 (Gibson assembly)를 사용하여 유전자 영역을 조립한 것을 특징으로 한다. In addition, the present invention provides a recombinant vector containing the gene. The vector is a recombinant vector using the PCC1 vector, and is a recombinant vector in which the guanine of the last 3 nucleotides of the T7 nucleotide polymerase promoter sequence is deleted. The vector is also a recombinant vector, PCC1-Sall-SF-T7p-dGGG-MF. The vector is characterized by assembling a genetic region using a Gibson assembly.

또한 본 발명은 상기 재조합 벡터가 도입된 형질전환체를 제공한다. In addition, the present invention provides a transformant introduced with the recombinant vector.

또한 상기 재조합 벡터를 유효성분으로 포함하는 한국형 중동호흡기증후군 코로나바이러스 백신 조성물을 제공한다. It also provides a Korean-style Middle Eastern Respiratory Syndrome coronavirus vaccine composition comprising the recombinant vector as an active ingredient.

또한 본 발명은 한국형 중동호흡기증후군 코로나바이러스(Korean strain Middle East respiratory syndrome Coronavirus, MERS-CoV)의 감염성 변이 유전자에서,In addition, the present invention is from the infectious mutant gene of Korean strain Middle East respiratory syndrome Coronavirus (MERS-CoV),

11267번째 뉴클레오타이드가 사이토신에서 티민으로 치환되어, 상기 제한효소 FspAI를 인식하는 제 1부위가 결실되는 단계;11267th nucleotide is substituted with thymine in cytosine, so that the first site for recognizing the restriction enzyme FspAI is deleted;

19198번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 상기 제한효소 MluI를 인식하는 부위가 삽입되는 단계 ;19198th nucleotide is substituted from adenine to guanine to insert a site that recognizes the restriction enzyme MluI;

2849번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 상기 T7 리보뉴클레오타이드 폴리메라아제 일시중지 부위가 결실되는 단계;2849th nucleotide substitution from adenine to guanine to delete the T7 ribonucleotide polymerase pause site;

를 포함하는 서열번호 1인 것인, 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자 제조방법를 제공한다. It provides a method for preparing an infectious mutant gene of Korean type Middle East Respiratory Syndrome coronavirus, which is SEQ ID NO: 1, comprising:

또한 본 발명은In addition, the present invention

(1) 상기 형질전환체에 한국형 중동호흡기증후군 코로나바이러스를 감염시켜 증식시키는 단계; 및 (1) infecting and proliferating the transformant by infecting the Korean type Middle East Respiratory Syndrome coronavirus; And

(2) 상기 (1) 단계에서 증식된 바이러스를 이용하여 불활성화 백신을 제조하는 단계;를 포함하는, 한국형 중동호흡기증후군 코로나바이러스 백신 조성물의 제조 방법을 제공한다. (2) preparing an inactivated vaccine using the virus propagated in the step (1); including, provides a method for producing a Korean-style Middle Eastern respiratory syndrome coronavirus vaccine composition.

본 발명은 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자와 이의 용도에 관한 것으로, 보다 상세하게는 돌연변이 방법을 이용한, 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자와 이의 제조방법, 상기 유전자를 포함하는 재조합 벡터를 제공한다.The present invention relates to an infectious mutant gene of Korean type Middle East Respiratory Syndrome coronavirus and its use, and more specifically, a mutant method, an infectious mutant gene of Korean type Middle East Respiratory Syndrome Coronavirus, a method of manufacturing the same, and a recombinant comprising the gene Provide a vector.

본 발명의 상기 돌연변이 방법을 이용하여 제작한 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자 및 이의 제조방법은 바이러스 증식 연구와 약독성 바이러스 개발에 유용하게 사용될 수 있다. The infectious mutant gene of the Korean type Middle East Respiratory Syndrome coronavirus produced using the mutagenesis method of the present invention and a method for manufacturing the same can be useful for virus proliferation studies and development of weakly toxic viruses.

또한 상기 유전자를 포함하는 재조합 벡터는 한국형 중동호흡기증후군 코로나바이러스 백신 및 이의 제조방법 관련 기술로 유용하게 사용될 수 있다. In addition, the recombinant vector containing the gene can be usefully used as a technology related to the Korean type Middle East Respiratory Syndrome coronavirus vaccine and its manufacturing method.

도1은 한국형 중동호흡기 증후군 코로나바이러스 유전자 서열과 (Original MERS-CoV genome)과 본 발명의 한국형 중동호흡기 증후군 코로나바이러스의 감염성 변이 유전자 서열(Full length MERS-CoV Infectious cDNA clone)과의 상이함을 나타낸 것이다.
도2는 한국형 중동호흡기증후군 코로나바이러스 감염성 변이 유전자에서 11267번째 뉴클레오타이드가 사이토신(C)에서 티민(T)으로 치환되어 제한효소 FSpAI 인식하는 제1부위가 결실된 것이다.
도3은 19198번째 뉴클레오타이드가 아데닌(a)에서 구아닌(G)으로 치환되어, 제한효소 MluI를 인식하는 부위가 삽입된 것이다.
도4는 2849번째 뉴클레오타이드가 아데닌(a)에서 구아닌(G)으로 치환되어, T7 리보뉴클레오타이드 폴리메라아제 일시중지 부위가 결실된 것이다.
도 5는 본 발명을 위한 pCCI-SalI-SF-T7p-dGGG-MF(MERS Full) 재조합 벡터의 구성을 개략적으로 나타낸 벡터맵이다.
도 6은 본 발명의 pCC1-SalI-SF 벡터의 제작을 개략적으로 나타낸 도식도이다.
도 7은 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자를 포함하는 재조합 벡터에서 T7 뉴클레오타이드 폴리메라이제 프로모터에서 중 마지막 뉴클레오타이드 3개의 구아닌(G)이 결실된, T7p-dGGG (GGG deleted)를 나타낸 것이다.
Figure 1 shows the difference between the Korean Middle East Respiratory Syndrome Coronavirus Gene Sequence and the infectious mutation gene sequence of the Korean Middle East Respiratory Syndrome Coronavirus (Full length MERS-CoV Infectious cDNA clone) of the present invention. will be.
FIG. 2 shows that the first site for recognizing the restriction enzyme FSpAI is deleted by replacing the 11267th nucleotide from cytosine (C) with thymine (T) in the Korean-type Middle East Respiratory Syndrome Coronavirus infectious mutant gene.
3, the 19198th nucleotide is substituted from adenine (a) to guanine (G), and a site for recognizing the restriction enzyme MluI is inserted.
FIG. 4 shows that the 2849th nucleotide is substituted from adenine (a) to guanine (G), and the T7 ribonucleotide polymerase pause site is deleted.
5 is a vector map schematically showing the construction of a pCCI-SalI-SF-T7p-dGGG-MF (MERS Full) recombinant vector for the present invention.
6 is a schematic view schematically showing the construction of the pCC1-SalI-SF vector of the present invention.
FIG. 7 shows T7p-dGGG (GGG deleted) in which the last three nucleotides of guanine (G) were deleted from the T7 nucleotide polymerase promoter in a recombinant vector containing an infectious mutation gene of the Korean Middle East Respiratory Syndrome Coronavirus.

이하 본 발명을 상세히 설명한다. Hereinafter, the present invention will be described in detail.

한국형 중동호흡기증후군 코로나바이러스(Korean strain Middle East respiratory syndrome Coronavirus, MERS-CoV)의 감염성 변이 유전자로서, As an infectious mutation gene of Korean strain Middle East respiratory syndrome Coronavirus (MERS-CoV),

제한효소 FspAI를 인식하는 제 1부위(site), 제한효소 MluI를 인식하는 부위 및 T7 리보뉴클레오타이드 폴리메라아제(T7 RNA Polymerase) 일시중지 부위 중 어느 하나 이상을 치환, 제거 또는 삽입하여 제조된 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자를 제공한다. Korean Middle East manufactured by replacing, removing or inserting at least one of the first site recognizing the restriction enzyme FspAI, the site recognizing the restriction enzyme MluI, and the pause site of the T7 ribonomer polymerase (T7 RNA Polymerase) Provides infectious mutation genes for respiratory syndrome coronavirus.

상기 유전자는 11267번째 뉴클레오타이드가 사이토신에서 티민으로 치환되어, 상기 제한효소 FspAI를 인식하는 제1부위가 결실;In the gene, the 11267th nucleotide is substituted for cytosine by thymine, and the first site for recognizing the restriction enzyme FspAI is deleted;

19198번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 상기 제한효소 MluI를 인식하는 부위가 삽입 ;19198th nucleotide is substituted from adenine to guanine to insert a site that recognizes the restriction enzyme MluI;

2849번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 상기 T7 리보뉴클레오타이드 폴리메라아제 일시중지 부위가 결실;된 것중 어느 하나 이상을 포함하는 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자이다. 2849th nucleotide is substituted with adenine to guanine, and the T7 ribonucleotide polymerase pause site is deleted; it is an infectious mutation gene of Korean type Middle East Respiratory Syndrome coronavirus containing any one or more of the above.

도1과 같이 한국형 중동호흡기증후군 코로나바이러스 유전자에는 FspAI를 인식하는 부위가 11311번째 염기서열인 제 1 부위와 13222번째 염기서열인 제 2 부위가 있다. 돌연변이 방법을 이용하여, 상기 FspAI를 인식하는 제1부위를 결실하였고, 또한 상기 한국형 중동호흡기 코로나바이러스에서 상기 제한효소 MluI를 인식하는 부위를 상기 돌연변이 방법을 사용하여 삽입하였다. 이는 상기 제한효소들을 사용하여 30Kb에 이르는 한국형 중동호흡기증후군 바이러스 (MERS-CoV) 유전자를 도5에서와 같이 6개의 영역으로 나눌 수 있고, 이를 이용하여, 각종 돌연변이 주 생성 조작이 수월하여, 향후 바이러스 증식 연구와 약독성 바이러스 개발에 용이하게 사용될 수 있다. As shown in FIG. 1, in the Korean type Middle East Respiratory Syndrome coronavirus gene, there are a site for recognizing FspAI, a first site for 11311 th sequence, and a second site for 13222 th sequence. Using the mutation method, the first site for recognizing the FspAI was deleted, and a site for recognizing the restriction enzyme MluI in the Korean type Middle East Respiratory Coronavirus was inserted using the mutation method. It is possible to divide the Korean Middle East Respiratory Syndrome Virus (MERS-CoV) gene up to 30Kb into six regions using the restriction enzymes as shown in FIG. 5, and by using this, various mutagen strain generation manipulations are easy, and future viruses It can be easily used for proliferation studies and development of weakly toxic viruses.

본 발명은 상기 도5와 같이 한국형 중동호흡기증후군 코로나바이러스 (Korean strain Middle East respiratory syndrome Corona virus, MERS-CoV) 염기서열을 이용하여, 상기 한국형 중동호흡기증후군 코로나바이러스 전체 cDNA를 5'UTR (untranslated region) 영역이며, 제한효소 BamHI이 인식하는 806번째 영역 MERS-0, BamH1이 인식하는 806번째 염기서열 내지 제한효소 StuI가 인식하는 7620 번째 영역 MERS2, 제한효소 StuI가 인식하는 7620째 염기서열 내지 9072 염기서열 영역 MERS2, 제한효소 StuI가 인식하는 9072번째 염기서열 내지 FSpA1 13222번째 염기서열 영역 MERS3, 제한효소 FspAI이 인식하는 13222번째 염기서열 내지 제한효소 Mlul가 인식하는 19196 염기서열 유전자 영역 MERS4, 제한효소 Mlul가 인식하는 19196번째 염기서열 내지 제한효소 PacI가 인식하는 25840 번째 염기서열 유전자 영역 MERS5, 3'UTR (untranslated region)의 영역에 포함되며, 제한효소 PacI가 인식하는 25840번째 염기서열 내지 염기서열 말단까지의 유전자 영역 MERS6로 나눈 벡터 맵 (map)으로 나타낼 수 있다.According to the present invention, the entire cDNA of the Korean type Middle East respiratory syndrome coronavirus is 5'UTR (untranslated region) using the Korean strain Middle East respiratory syndrome Corona virus (MERS-CoV) base sequence as shown in FIG. 5. ) Region, the 806th region MERS-0 recognized by the restriction enzyme BamHI, the 806th base sequence recognized by BamH1 to the 7620th region recognized by the restriction enzyme StuI MERS2, the 7620th base sequence recognized by the restriction enzyme StuI to 9072 bases Sequence region MERS2, restriction sequence StuI recognized by 9072th base sequence to FSpA1 13222th sequence region MERS3, restriction enzyme FspAI recognized by 13222th sequence to restriction enzyme Mlul recognized 19196 sequence gene region MERS4, restriction enzyme Mlul It is included in the region of the 19196th nucleotide sequence recognized by the restriction enzyme PacI, and the 25840th nucleotide sequence recognized by the restriction region PERS, 3'UTR (untranslated region). It can be represented by a vector map divided by the genetic region of MERS6.

본 발명에서는 한국형 중동호흡기증후군 코로나바이러스 전장 감염성 cDNA 기술을 이용한 유전자 제조방법 또는 백신 관련 기술 개발을 위하여 역유전학 (Reverse genetic systems) 기술을 사용하였다. 상기 역유전학 기술은 바이러스의 전체 유전체 서열을 확인하여 재조합된 인공바이러스를 만들어내는 것으로, 최대 장점은 인공적으로 바이러스를 재조합 발현, 조작하여, 합성하기 때문에 바이러스 유전자에 원하는 대로 여러 조작을 가해줄 수 있다는 점이다. 키메라 바이러스 (Chimeric virus), 코돈 최적화 (codon pair deoptimization), 돌연변이 (Mutagenesis) 등 여러 기전을 바이러스의 유전자에 탑재하여 조작된 새로운 바이러스를 만들어 낼 수 있다. 고전적인 유전학 접근법은 주로 주어진 생명체의 유전체에 대해 무작위적으로 변위를 유도한 후 관심대상 형질을 나타내는 상기 돌연변이에서 유전자를 발굴하는 방법으로, 시간과 노력을 많이 소모하고 변이에 의한 형질 효과가 강하지 않는 유전자들은 분리하기가 쉽지 않은 단점을 가졌다. 그 후 기능 유전체발달로 효모를 비롯한 몇몇 모델 생물체에서 유전체 수준의 상기 돌연변이가 가용하게 되었다. 반면 상기 역유전학에서는 여러 기전 중 상기 돌연변이를 이용해 각 유전자의 변이가 일으킬 수 있는 가능한 형질변이를 직접적으로 탐색함으로써 유전학적 탐색의 식별을 증가시킬 수 있다. 상기 역유전학은 인공적으로 원하는 대로 바이러스를 조작할 수 있고, 그 특성을 극대화할 수 있는 장점이 있어 백신 개발에 있어서 필요한 기술이다. In the present invention, the reverse genetic systems technology was used to develop a method for producing a gene or a vaccine-related technology using the Korean-style Middle Eastern Respiratory Syndrome Coronavirus full-length infectious cDNA technology. The reverse genetics technique is to create a recombinant artificial virus by checking the entire genome sequence of the virus, and the greatest advantage is that the virus gene can be artificially recombined by expressing, manipulating, and synthesizing the virus gene, thereby adding various manipulations to the virus gene as desired. It is a point. Various mechanisms, such as chimeric virus, codon pair deoptimization, and mutagenesis, can be loaded into the virus's genes to create a new, engineered virus. The classical genetics approach is mainly a method of extracting genes from the mutants representing the trait of interest after randomly inducing displacement for the genome of a given organism, which is time-consuming and labor-intensive and does not have strong trait effects due to mutation. Genes had the disadvantage that they were not easy to separate. Functional genome development has then made the mutation at the genomic level available in several model organisms, including yeast. On the other hand, in the reverse genetics, it is possible to increase the identification of genetic search by directly searching for possible transmutation that each gene variation can cause by using the mutation among various mechanisms. The reverse genetics is a technique required for vaccine development because it has the advantage of being able to artificially manipulate the virus as desired and maximizing its properties.

본 발명은 상기 한국형 중동호흡기증후군 코로나바이러스 (Korean strain Middle East respiratory syndrome Corona virus MERS-CoV) 의 감염성 변이 유전자를 제조합 벡터를 제공한다. 상기 벡터는 PCC1 벡터를 사용하는 재조합 벡터이며, T7 뉴클레오타이드 폴리메라아제 프로모터 염기서열 중 마지막 뉴클레오타이드 3개의 구아닌이 결실된 재조합 벡터이다. The present invention provides a vector for preparing an infectious mutant gene of the Korean strain Middle East respiratory syndrome Corona virus MERS-CoV. The vector is a recombinant vector using the PCC1 vector, and is a recombinant vector in which the guanine of the last 3 nucleotides of the T7 nucleotide polymerase promoter base sequence is deleted.

상기 T7 뉴클레오타이드 폴리메라아제 프로모터 염기서열에서 마지막 구아닌이 결실되는 돌연변이 방법을 이용함으로써, 추가 뉴클레오타이드 (Extra nucleotide)의 생성 없이 바이러스 유전자를 정확히 제작할 수 있다. By using the mutation method in which the last guanine is deleted from the T7 nucleotide polymerase promoter base sequence, a viral gene can be accurately produced without generating additional nucleotides.

본 발명에 있어서 용어, “돌연변이 (Mutagenesis)” 또는 “변이”는 유전자 또는 유전물질 예컨대, DNA, RNA, cDNA 또는 임의 프로세스 기전에서의 검출 가능한 변화, 또는 상기 변화의 결과를 의미한다. 상기 돌연변이 또는 변이는 일부 염기서열이 결실(deletion), 치환(substitution) 또는 삽입(insertion)에 의해 변형되었지만, 변화되기 전의 염기서열과 기능적으로 동일한 작용을 할 수 있는 변이체(variants)를 포함하는 개념이다.In the present invention, the term “mutation (Mutagenesis)” or “mutation” refers to a detectable change in a gene or genetic material such as DNA, RNA, cDNA or any process mechanism, or the result of the change. The mutation or mutation is a concept in which some sequences have been modified by deletion, substitution, or insertion, but include variants capable of functionally identical to the sequence before the change. to be.

본 발명 및 명세서에 있어서 용어 “핵산”, “뉴클레오타이드”는, 상호 교환적으로 사용되며, RNA, DNA, cDNA 또는 cRNA 및 이의 유도체 예컨대 개질된 백본을 함유하는 것을 지칭한다.The terms "nucleic acid" and "nucleotide" in the present invention and specification are used interchangeably and refer to containing RNA, DNA, cDNA or cRNA and derivatives thereof such as a modified backbone.

본 발명 및 명세서에 있어서, “유전자”는 광범위하게 생물학적 기능과 관련된 폴리뉴클레오티드의 임의 분절이다. 유전자 또는 폴리뉴클레오티드는 숙주 유기체의 유전 가능한 유전 정보를 지칭하는 게놈의 서열과 같은 인트론 및 엑손 또는 cDNA와 같은 코딩 서열을 포함한다. 유전자 및 폴리뉴클레오티드는 발현을 조절하는 영역을 포함할 수 있다. In the present invention and specification, “gene” is any segment of a polynucleotide that is broadly related to biological function. Genes or polynucleotides include introns such as sequences of genomes that refer to the genetic information of the host organism, and coding sequences such as exons or cDNA. Genes and polynucleotides can include regions that regulate expression.

따라서 본 발명에 있어서 상기 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자는 돌연변이 (Mutagenesis)를 이용하여 염기서열, 뉴클레오타이드 (Nucleotide), 또는 핵산 서열이 치환, 삽입, 결실된 한국형 중동호흡기증후군 코로나바이러스의 전장 감염성 cDNA를 의미한다. Therefore, in the present invention, the infectious mutant gene of the Korean type Middle East Respiratory Syndrome coronavirus uses mutation (Mutagenesis) to replace, insert, or delete the nucleotide sequence, nucleotide (Nucleotide), or nucleic acid sequence, the full length of the Korean Middle East Respiratory Syndrome coronavirus. Means infectious cDNA.

본 발명에 있어서 용어 “벡터 (vector)”는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동 가능하게 연결된 DNA 연결을 보유하는 DNA 제조물을 의미하며, 숙주세포에서 목적 유전자를 발현시키기 위한 모든 수단과, 유전자 삽입물이 발현되도록 작동 가능하게 연결된 필수적인 목적 유전자 발현을 위한 요소 및 DNA 분자를 포함하는 유전자 제조물을 뜻하기도 한다. 상기 벡터는 플라스미드, 파지 입자, 또는 간단하게 게놈 삽입물일 수 있다. 적당한 숙주로 형질전환되면 상기 벡터는 숙주 게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부 경우 게놈 그 자체에 통합될 수 있다. 상기 플라스미드가 현재 벡터의 가장 통상적으로 사용될 수 있는 형태이므로, 본 발명에 있어서 용어, 플라스미드(Plasmid) 및 벡터 (vector)는 때로는 상호 교환적으로 사용된다. 그러나 본 발명은 당업계에 알려진 또는 알려지게 되는 바와 동등한 기능을 갖는 벡터의 다른 형태를 포함한다. In the present invention, the term "vector (vector)" refers to a DNA preparation having a DNA link operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host, for expressing a target gene in a host cell It also refers to a gene preparation comprising DNA molecules and elements for expressing all necessary means and essential target genes operably linked to express the gene insert. The vector can be a plasmid, phage particle, or simply a genomic insert. When transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since the plasmid is currently the most commonly used form of vector, the terms plasmid and vector are sometimes used interchangeably in the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or known in the art.

상기 벡터는 목적 유전자 발현을 위한 요소 (element) 및 DNA 분자를 포함하는 것으로, 복제원점 (Replication, ori), 프로모터 (promotor), 작동 유전자(operator), 전자 종결 서열 (terminator), 전사조절서열, 신호 서열 등을 포함할 수 있고, 숙주 세포의 게놈 내로의 도입을 위한 적절한 효소 부위 (예: 제한효소부위) 및 또는 숙주 세포 내로의 성공적인 도입을 확인하기 위한 선별 마커 및 또는 단백질의 번역을 위한 리보솜 결합 부위 (Ribosome binding site: RBS) 등을 추가로 포함할 수 있으며, 전사 종결 서열을 추가 포함 할 수 있다. 상기 전자 종결 서열은 폴리아데닐화 서열 (pA) 등일 수 있고, 상기 복제 원점은 f1 복제원점, SV40 복제원점, 아데노 복제원점 등일 수 있다. The vector includes an element and a DNA molecule for expression of a target gene, a replication origin (or replication), a promoter (promotor), an operator gene (operator), an electron termination sequence (terminator), transcription control sequence, Signal sequences, etc., suitable enzyme sites for introduction of the host cell into the genome (e.g. restriction sites) and/or ribosomes for the translation of proteins and/or selection markers to confirm successful introduction into the host cell A binding site (Ribosome binding site: RBS) may be additionally included, and may further include a transcription termination sequence. The electron termination sequence may be a polyadenylation sequence (pA) or the like, and the origin of replication may be an origin of f1 replication, an origin of SV40 replication, an origin of adeno replication, and the like.

상기 벡터는 하나 이상의 선별 마커를 포함할 수 있다. 상기 선별 마커는 재조합 벡터가 숙주 세포 내에 성공적으로 도입되었는지 여부를 확인하거나, 안정적인 세포주 구축을 위한 유전자로서, 예컨대 항생제와 같은 약물 저항 유전자, 대사 관련 유전자, 유전자 증폭 유전자 등으로 이루어진 군에서 선택될 수 있다. 상기 선별 마커는 본 발명의 핵심적 기술인 벡터의 최적 조합에 따른 발현 효율에 크게 영향을 미치는 요소가 아니므로, 상기 선별 마커로서 일반적으로 사용되는 모든 유전자 (예컨대, 항생제 저항 유전자, 및/또는 대사 관련 효소 유전자 등)를 제한 없이 사용할 수 있다. 예로는 카나마이신 (kanamycin), 클로람페니콜 (chloramphenicol), 암피실린 (Ampicilin), 에리트로마이신 (erythromycin), 스트렙토마이신 (streptomycin), 하이그로마이신 (Hygromycin), 네오마이신 (neomycin), 디하이드로폴레이트 환원효소 (Dihydrofolate reductase, DHFR) 유전자, 글루타민 합성효소 (Glutamine synthetase, GS)와 같은 항생제 내성 유전자가 있으나, 이에 한정되는 것은 아니며, 적절히 선택할 수 있다. The vector may include one or more selection markers. The selection marker is a gene for confirming whether a recombinant vector has been successfully introduced into a host cell, or for constructing a stable cell line, for example, a drug resistance gene such as an antibiotic, a metabolic related gene, a gene amplification gene, etc. have. Since the selection marker is not a factor that greatly affects the expression efficiency according to the optimal combination of vectors, which is the core technology of the present invention, all genes commonly used as the selection marker (eg, antibiotic resistance genes, and/or metabolic related enzymes) Gene, etc.) can be used without limitation. Examples include kanamycin, chloramphenicol, ampicillin, erythromycin, streptomycin, hygromycin, neomycin, dihydrofolate reductase (Dihydrofolate Reductase (Dihydrofolate Reductase) There are antibiotic resistance genes such as reductase (DHFR) gene and glutamine synthetase (GS), but are not limited thereto, and may be appropriately selected.

본 발명의 벡터는 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있다. 또한, 본 발명의 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 본 발명의 벡터가 발현 벡터이고, 원핵 세포를 숙주로 하는 경우, 전사를 진행시킬 수 있는 강력한 프로모터(예컨대, tac 프로모터, lac 프로모터, lacUV5 프로모터, lpp 프로모터, pLλ프로모터, pRλ프로모터, rac5 프로모터, amp 프로모터, recA 프로모터, SP6 프로모터, trp 프로모터 및 T7 프로모터 등), 해독의 개시를 위한 라이보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 숙주 세포로서 E. coli(예컨대, HB101, BL21, DH5α 등)가 이용되는 경우, E. coli 트립토판 생합성 경로의 프로모터 및 오퍼레이터 부위(Yanofsky, C. (1984), J. Bacteriol., 158:1018-1024) 그리고 파아지 λ의 좌향 프로모터 (pLλ프로모터, Herskowitz, I. and Hagen, D.(1980), Ann. Rev. Genet., 14:399-445)가 조절 부위로서 이용될 수 있다.The vectors of the present invention can typically be constructed as vectors for cloning or vectors for expression. In addition, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as hosts. When the vector of the present invention is an expression vector and a prokaryotic cell is a host, a strong promoter capable of progressing transcription (eg, tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 promoter, amp It is common to include a promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), a ribosome binding site for initiation of translation, and a transcription/detox termination sequence. When E. coli (eg, HB101, BL21, DH5α, etc.) is used as a host cell, the promoter and operator site of the E. coli tryptophan biosynthetic pathway (Yanofsky, C. (1984), J. Bacteriol., 158:1018- 1024) and the leftward promoter of phage λ (pLλ promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet., 14:399-445) can be used as a regulatory site.

한편, 본 발명의 벡터가 발현 벡터이고, 진핵 세포를 숙주로 하는 경우에는, 포유동물 세포의 유전체로부터 유래된 프로모터(예: 메탈로티오닌 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터(예: 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스 프로모터 및 HSV의 사 프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 일반적으로 갖는다.On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is a host, a promoter derived from the genome of a mammalian cell (eg, a metallothionine promoter) or a promoter derived from a mammalian virus (eg, adeno) A late virus promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and HSV's four promoters) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

본 발명에서는 효과적인 조작이 가능한 세균인공염색체 플라스미드 (BAC, bacterial artificial chromosome plasmid) 기반 중동호흡기증후군 코로나바이러스 유전자 기술을 제시하고, 상기 유전자 기술을 이용하여 한국형 중동호흡기증후군 코로나바이러스 감염성 전장 유전자(예컨대 cDNA)를 완성하였다. BAC로 지칭되는 상기 세균인공염색체 플라스미드 또는 박테리아성 인공 염색체 플라스미드는 DNA 증폭을 위해 사용되는 개개의 세포에서 세포 분화 동안 복제 및 보존을 위해 필요한 복제 개시 서열 (Replication origin sequence)을 포함하고, 박테리아 유래 복제 개시점을 가진다. BAC 경우 50내지 350kb 범위로 커다란 크기의 DNA 단편을 안정적으로 유지할 수 있다. 또한 본 발명에서는 BAC 벡터의 하나인 PCC1 플라스미드 (plasmid)를 사용하였는데, 상기 PCC1 plasmid는 lac promoter를 포함하며, 단일 복사 (single copy)가 가능하고 1 세포당 10 내지 20 카피 (copy)가 가능하며, 크기 (size)가 4.2 내지 4.3kb 이며, 두개의 복제원점 (F factor single copy origin과 high copy ori V origin)을 포함하는 것이 특징이다. The present invention proposes a bacterial artificial chromosome plasmid (BAC)-based Middle East Respiratory Syndrome coronavirus gene technology capable of effective manipulation, and uses the gene technology to provide a Korean-style Middle East Respiratory Syndrome coronavirus infectious full-length gene (eg cDNA). Was completed. The bacterial artificial chromosome plasmid, or bacterial artificial chromosome plasmid, referred to as BAC, contains replication origin sequences required for replication and preservation during cell differentiation in individual cells used for DNA amplification, and bacterial derived replication. It has a starting point. In the case of BAC, DNA fragments of a large size in the range of 50 to 350 kb can be stably maintained. In addition, in the present invention, a PCC1 plasmid, one of the BAC vectors, was used. The PCC1 plasmid contains a lac promoter, single copy is possible, and 10 to 20 copies per cell are possible. , Size (size) is 4.2 to 4.3kb, it is characterized by including two replication origin (F factor single copy origin and high copy ori V origin).

본 발명은 상기 재조합 벡터가 도입된 형질전환체를 제공한다. The present invention provides a transformant introduced with the recombinant vector.

본 발명에서 용어 "형질전환(transformation)"이란 외부로부터 주어진 유전물질인 DNA에 의해 개체 또는 세포의 형질이 유전적으로 변화하는 것을 의미한다.In the present invention, the term "transformation (transformation)" means that the trait of an individual or cell is genetically altered by DNA, a genetic material given from the outside.

본 발명에서 본 발명의 재조합 발현 벡터로 형질전환하는 것은 당업자에게 공지된 형질전환기술에 의해 수행될 수 있다. 예를 들어, 미세사출법(microprojectile bombardment), 입자 총 충격법(particle gun bombardment), 실리콘 탄화물 위스커(Silicon carbide whiskers), 초음파 처리(sonication), 일렉트로포레이션(electroporation), PEG-매개 융합법(PEG-mediated fusion), 미세주입법(microinjection), 리포좀 매개법(liposome-mediated method), 인-플란타 형질전환법(In planta transformation), 진공 침윤법(Vacuum infiltration method), 화아침지법(floral meristem dipping method), 또는 아그로박테리움(Agrobacteriumsp.) 매개에 의한 방법 등을 사용할 수 있으며, 이에 한정되는 것은 아니다.Transformation with the recombinant expression vector of the present invention in the present invention can be performed by transformation techniques known to those skilled in the art. For example, microprojectile bombardment, particle gun bombardment, silicon carbide whiskers, sonication, electroporation, PEG-mediated fusion ( PEG-mediated fusion, microinjection, liposome-mediated method, in planta transformation, vacuum infiltration method, floral meristem dipping method), or an Agrobacterium sp. method, and the like, but is not limited thereto.

본 발명에서는 어셈블리 (Assembly) 방법을 이용하여 한국형 중동호흡기증후군 코로나바이러스 (Korean strain Middle East respiratory syndrome Corona virus, MERS-CoV) 유전자 영역을 벡터에 조합하였다. 본 명세서에서, 어셈블리 (Assembly)는 유전자 영역, 유전자 단편 및 핵산 단편을 상보적(Complementary)인 염기서열을 이용하여, 정렬 (aligning) 하고 병합 (Merging) 하여, 더 긴 유전자 영역 및 핵산 단편으로 연결하는 것을 의미한다.In the present invention, the assembly (Assembly) method using the Korean Middle East respiratory syndrome coronavirus (Korean strain Middle East respiratory syndrome Corona virus, MERS-CoV) gene region was combined into a vector. In the present specification, assembly (Assembly), using a complementary (Complementary) nucleotide sequence, the genetic region, gene fragments and nucleic acid fragments are aligned (aligning) and merging (Merging), linking to a longer gene region and nucleic acid fragments It means to do.

본 발명은 MERS-CoV의 감염성 변이 유전자를 포함하는 재조합 벡터가 도입된 형질전환체 및 상기 재조합 벡터를 유효성분으로 포함하는 한국형 중동호흡기증후군 코로나바이러스 백신 조성물을 제공한다. The present invention provides a transformant in which a recombinant vector containing an infectious mutant gene of MERS-CoV is introduced, and a Korean-style Middle East Respiratory Syndrome Coronavirus vaccine composition comprising the recombinant vector as an active ingredient.

또한 본 발명은 (1) 상기 형질전환체에 한국형 중동호흡기증후군 코로나바이러스를 감염시켜 증식시키는 단계; 및 (2) 상기 (1) 단계에서 증식된 바이러스를 이용하여 불활성화 백신을 제조하는 단계;를 포함하는, 한국형 중동호흡기증후군 백신 조성물 제조방법을 제공한다. In addition, the present invention comprises the steps of (1) infecting and proliferating the transformant by infecting the Korean type of Middle Eastern respiratory syndrome coronavirus; And (2) preparing an inactivated vaccine using the virus propagated in the step (1); providing a method for preparing a vaccine composition for Korean Middle East respiratory syndrome.

본 발명에서의 용어 “불활성화된 백신”은 복제 또는 성장할 수 없는 감염성 유기체 또는 병원체를 함유하는 백신 조성물을 의미한다. 병원체는 박테리아, 바이러스, 원충 또는 진균 기원일 수 있다. 불활성화는 동결-해동, 화학적 처리 (예를 들어 티메로살, 포르말린, BRL (베타프로피오락톤) 또는 BEI (바이너리 에틸렌이민)으로의 처리 음파처리, 방사선 열 또는 이의 면역원성을 유지하면서 유기체의 복제 또는 성장을 방지하기에 충분한 임의의 기타 통상적인 수단을 비롯한, 각종 방법에 의해 달성 될 수 있다. The term “inactivated vaccine” in the present invention means a vaccine composition containing an infectious organism or pathogen that cannot replicate or grow. Pathogens can be of bacterial, viral, protozoan or fungal origin. Inactivation can be achieved by freeze-thaw, chemical treatment (e.g. thimerosal, formalin, treatment with BRL (betapropiolactone) or BEI (binary ethyleneimine)) sonication, radiation heat or maintaining the immunogenicity of the organism while maintaining its immunogenicity. It can be achieved by various methods, including any other conventional means sufficient to prevent replication or growth.

이하, 본 발명의 이해를 돕기 위하여, 실시예를 들어 상세하게 설명하기로 한다. 다만 하기 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 완전하게 설명하기 위해 제공되는 것이다. Hereinafter, examples will be described in detail to help understanding of the present invention. However, the following examples are merely illustrative of the contents of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to fully describe the present invention to those skilled in the art.

한국형 중동호흡기증후군 코로나바이러스 염기서열Korean Middle Eastern Respiratory Syndrome Coronavirus Sequence

서열번호 1로 표시되는 한국형 중동호흡기증후군 코로나바이러스 전장 감염성 유전자 (cDNA) 염기서열정보는 NCBI에 보고된 중동호흡기증후군 코로나바이러스 유전자 염기서열 중에서, 2015년 국립보건원 (Korea National Institute of Health)에서 보고 된 염기서열 (accession number: KT029139.1, 30,108 bp genomic sequence)을 이용하고, 이를 통해 유전자 합성을 설계하였다.The nucleotide sequence information of the Korean type Middle East Respiratory Syndrome Coronavirus full length infectious gene (cDNA) represented by SEQ ID NO: 1 was reported by the National National Institute of Health in 2015 among the Middle East Respiratory Syndrome Coronavirus gene sequence reported to NCBI. Using the nucleotide sequence (accession number: KT029139.1, 30,108 bp genomic sequence), gene synthesis was designed through this.

한국형 중동호흡기증후군 코로나바이러스 감염성 변이 유전자 제작 Korean type Middle East Respiratory Syndrome Coronavirus infectious mutation gene production

11267번째 뉴클레오타이드가 사이토신에서 티민으로 치환되어, 제한효소 FspAI를 인식하는 제 1 부위가 결실되는 단계;11267th nucleotide is substituted with thymine in cytosine, thereby deleting the first site that recognizes the restriction enzyme FspAI;

19198번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 제한효소 MluI를 인식하는 부위가 삽입되는 단계 ;19198th nucleotide is substituted from adenine to guanine to insert a site that recognizes the restriction enzyme MluI;

2849번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 T7 리보뉴클레오타이드 폴리메라아제 일시중지 부위가 결실되는 단계로 2849 nucleotide substitution from adenine to guanine to remove the T7 ribonucleotide polymerase pause site

한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자를 제조하였다. An infectious mutant gene of Korean type Middle East Respiratory Syndrome coronavirus was prepared.

(도1,2,3,4)(Figures 1, 2, 3, 4)

전장 감염성 cDNA 제작을 위한 벡터 맵 (map) 및 재조합 벡터 제작 Construction of vector maps and recombinant vectors for the production of full-length infectious cDNA

한국형 중동호흡기증후군 코로나바이러스 (Korean strain Middle East respiratory syndrome Corona virus, MERS-CoV) 염기서열(accession number:KT029139.1)를 이용하여, 상기 한국형 중동호흡기증후군 코로나바이러스 전체 cDNA를 5'UTR (untranslated region)영역이며, 제한효소 BamHI이 인식하는 806번째 영역 MERS0, BamH1이 인식하는 806번째 염기서열 내지 제한효소 Stul가 인식하는 7620 번째 영역 MERS2, 제한효소 Stul가 인식하는 7620째 염기서열 내지 9072 염기서열 영역 MERS2, 제한효소 Stul가 인식하는 9072번째 염기서열 내지 FSpA1 13222번째 염기서열 영역 MERS3, 제한효소 FspAI이 인식하는 13222번째 염기서열 내지 제한효소 Mlul가 인식하는 19196 영역 MERS4, 제한효소 Mlul가 인식하는 19196번째 염기서열 내지 제한효소 PacI가 인식하는 25840 번째 영역 MERS5, 3'UTR (untranslated region)의 영역에 포함되며 제한효소 PacI가 인식하는 25840번째 염기서열 내지 염기서열 말단까지의 영역 MERS6로 나눈 벡터 맵 (map)을 만들었다.(도5)Using the Korean strain Middle East respiratory syndrome Corona virus (MERS-CoV) sequence (accession number: KT029139.1), the entire cDNA of the Korean Middle East respiratory syndrome coronavirus was 5'UTR (untranslated region) ) Region, the 806th region MERS0 recognized by the restriction enzyme BamHI, the 806th base sequence recognized by BamH1 to the 7620th region recognized by the restriction enzyme Stul MERS2, the 7620th base sequence recognized by the restriction enzyme Stul to the 9072 sequence region MERS2, the 9072th base sequence recognized by the restriction enzyme Stul to the FSpA1 13222th sequence region MERS3, the 13222th base sequence recognized by the restriction enzyme FspAI to the 19196 region recognized by the restriction enzyme Mlul, the 19196th region recognized by the restriction enzyme Mlul A vector map (map) divided by the region of the 25840 th region recognized by the base sequence to the restriction enzyme PacI, and the region of the 3'UTR (untranslated region), and the region from the 25840 th base sequence recognized by the restriction enzyme PacI to the end of the sequence sequence MERS6 ) (Fig. 5)

상기 MERS0 영역과 상기 MERS6 영역을 pUC57S-T7p-M06 (pUC57-simple plasmid)으로 구축한 유전자 재조합 벡터, 상기 MERS1 영역과 상기 MERS2 영역을 각각 pUC57S-MERS1, pUC57S-MERS2로 합성된 유전자 재조합 벡터, 세균인공염색체기반 (BAC, Bacterial artificial chromosome) 벡터 중 하나인 PCCI 벡터 (vector)를 이용하여, 상기 MERS3, MERS4, MERS5의 영역을 각각 pCC1-MERS3과 pCC1 MERS4, 카나마이신이 포함된 pUC57-kanamycin plasmid (pUC57K-MERS5)로 합성된 유전자 재조합 벡터를 미국의 Genescript 사에 합성 의뢰하였다. Gene recombination vector constructed by constructing the MERS0 region and the MERS6 region with pUC57S-T7p-M06 (pUC57-simple plasmid), the gene recombination vector synthesized with the MERS1 region and the MERS2 region by pUC57S-MERS1, pUC57S-MERS2, and bacteria Using the PCCI vector (vector), one of the artificial chromosome-based (BAC, Bacterial artificial chromosome) vectors, the regions of the MERS3, MERS4, and MERS5 are respectively pCC1-MERS3, pCC1 MERS4, and pUC57-kanamycin plasmid containing kanamycin (pUC57K Gene recombination vector synthesized with -MERS5) was synthesized by Genescript, USA.

PCC1 plasmid 조작 PCC1 plasmid manipulation

우선 커다란 유전자를 보존, 복제할 수 있는 BAC 벡터의 하나인 pCCI plasmid (Epibio)의 필요 없는 부분을 없애기 위한 조작을 시행하였다. pCC1을 제한효소 SalI으로 처리한 후. 총 7005bp의 필요한 부분만을 얻어내었다 (pCC1-SalI). 이후 유전자 합성 시 사용될 제한효소 StuI과 FspAI 인식 염기서열을 돌연변이생성 (Mutagenesis) 방법을 이용하여 pCCI-SalI 벡터로부터 결실하였다. 제한효소 StuI 염기서열은 AGGCCT에서 AAGCTT로 변형하였으며, 제한효소 FspAI 염기서열 은 GTGCGCAC에서 GTGTGCCC로 변형하였다. 이러한 조작을 통해 pCC1-SalI-SF 벡터를 제작하였으며, 이를 이용해 이후 유전자 조합을 시행하였다. (도6)First, an operation was performed to eliminate unnecessary parts of the pCCI plasmid (Epibio), which is one of the BAC vectors capable of preserving and replicating large genes. After treatment with pCC1 restriction enzyme SalI. Only the necessary portion of the total 7005bp was obtained (pCC1-SalI). Subsequently, the restriction sequences StuI and FspAI recognition sequences to be used in gene synthesis were deleted from the pCCI-SalI vector using a mutagenesis method. The restriction enzyme StuI sequence was modified from AGGCCT to AAGCTT, and the restriction enzyme FspAI sequence was modified from GTGCGCAC to GTGTGCCC. Through this manipulation, a pCC1-SalI-SF vector was produced, and gene combination was subsequently performed using this. (Fig. 6)

전장 감염성 cDNA 유전자 조합Full length infectious cDNA gene combination

첫번째, 우선 T7p-M06 영역만을 제한효소 SalI을 이용해서 pUC57S-T7p-M06으로부터 pCC1-SalI-SF 벡터로 옮겨주어 pCC1-SalI-SF-T7p-M06 벡터를 만들었다.First, first, only the T7p-M06 region was transferred from pUC57S-T7p-M06 to the pCC1-SalI-SF vector using the restriction enzyme SalI to make the pCC1-SalI-SF-T7p-M06 vector.

두번째, MERS5 영역을 제한효소 MluI과 PacI을 이용하여 pUC57Kan-MERS5 벡터로부터 pUC57S-MERS1 벡터로 옮겨주어 pUC57S-MERS15 벡터를 제작하였다.Second, the pUC57S-MERS15 vector was constructed by transferring the MERS5 region from the pUC57Kan-MERS5 vector to the pUC57S-MERS1 vector using restriction enzymes MluI and PacI.

세번째, MERS15 영역을 제한효소 BamHI과 PacI을 이용하여, pUC57S-MERS15 벡터로부터 pCC1-SalI-SF-T7p-M06으로 옮겨주어, pCC1-SalI-SF-T7p-M0156을 제작하였다.Third, the MERS15 region was transferred from pUC57S-MERS15 vector to pCC1-SalI-SF-T7p-M06 using restriction enzymes BamHI and PacI, thereby constructing pCC1-SalI-SF-T7p-M0156.

네번째, MERS2, MERS3, MERS4 영역을 Toyobo사의 KOD-Plus-Neo high fidelity Taq DNA 중합효소(polymerase)를 이용하여 중합효소연쇄반응 (Polymerase Chain Reaction)을 통해 증폭하였으며, NEB사의 깁슨 어셈블리믹스 (Gibson assembly master mix)를 이용하여 MERS2, MERS3, MERS4 각 영역을 동시에 pCC1-SalI-SF-T7p-M0156 벡터 안에 조합하였다. MERS234 영역은 마크로젠에서 실시 된 생어 염기서열 분석 (Sanger Sequencing)을 통해 염기서열의 변화가 없음을 확인하였다.Fourth, MERS2, MERS3, and MERS4 regions were amplified by polymerase chain reaction using Toyobo's KOD-Plus-Neo high fidelity Taq DNA polymerase, and NEB's Gibson assembly mix (Gibson assembly) master mix), each region of MERS2, MERS3, and MERS4 was simultaneously combined into a pCC1-SalI-SF-T7p-M0156 vector. The MERS234 region was confirmed to have no change in base sequence through Sanger Sequencing performed in Macrogen.

이에 최종적으로, 중동호흡기증후군 코로나바이러스 전장 cDNA (pCC1-SalI-SF-T7p-MERS-Full(MF)) 벡터를 제작하였다. (도6)Finally, the Middle Eastern Respiratory Syndrome Coronavirus full length cDNA (pCC1-SalI-SF-T7p-MERS-Full(MF)) vector was constructed. (Fig. 6)

T7 리보뉴클레오타이드 폴리메라아제 (T7 RNA Polymerase) 프로모터 (Promoter) T7 ribonucleotide polymerase (T7 RNA Polymerase) promoter

염기서열 조작Sequence manipulation

자연계에 존재하는 중동호흡기증후군 코로나바이러스는 5'-UTR에 항상 하나의 구아닌(Guanine)으로 시작한다. T7 리보뉴클레오타이드 폴리메라아제 (T7 RNA Polymerase)는 RNA 생성 시 인식 염기서열 (5‘-TAATACGACTCACTATAGGG-3´)의 마지막 세 개의 구아닌(Guanine) 중에서 첫 번째 구아닌으로부터 RNA를 합성을 시작한다. 이에 상기 T7 RNA polymerase에 의해 제작된 RNA 유전자는 항상 5'-UTR에 부가적으로 세 개의 구아닌 (Guanine, G)을 부가적으로 포함하게 된다. 이는 하나의 구아닌 (G)만을 포함하는 중동호흡기증후군 코로나바이러스와는 다른 특성을 포함하게 된다. 이에 돌연변이생성 (Mutagenesis) 방법을 이용하여, 상기 T7 리보뉴클레오타이드 폴리메라아제 프로모터 (T7 RNA Polymerase promotor, T7 promoter) 염기서열 중 마지막 세 개의 구아닌을 pUC57S-T7p-M06 벡터 상에서 결실하였으며(5´- TAATACGACTCACTATA - 3´), 이를 통해 pUC57S-T7p-dGGG-M06 벡터를 제작하였다. T7p-dGGG를 포함하는 영역을 제한효소 SfiI과 BamHI을 이용하여, pUC57S-T7p-dGGG-M06으로부터 pCC1-SalI-SF-T7p-MF 벡터로 이동하였으며. 최종적으로 pCC1-SalI-SF-T7p-dGGG-MF 벡터를 제작하였다. The Middle East Respiratory Syndrome Coronavirus, which exists in nature, always starts with one guanine in the 5'-UTR. T7 ribonucleotide polymerase (T7 RNA Polymerase) starts the synthesis of RNA from the first guanine of the last three guanines of the recognition base sequence (5'-TAATACGACTCACTATAGGG-3') when generating RNA. Accordingly, the RNA gene produced by the T7 RNA polymerase always includes three guanines (G) in addition to 5'-UTR. It will contain different characteristics from the Middle Eastern Respiratory Syndrome Coronavirus, which contains only one guanine (G). Thus, using the mutagenesis method, the last three guanines of the T7 RNA Polymerase promotor (T7 promoter) sequence were deleted on the pUC57S-T7p-M06 vector (5´- TAATACGACTCACTATA -3´), through which the pUC57S-T7p-dGGG-M06 vector was produced. The region containing T7p-dGGG was transferred from pUC57S-T7p-dGGG-M06 to pCC1-SalI-SF-T7p-MF vector using restriction enzymes SfiI and BamHI. Finally, pCC1-SalI-SF-T7p-dGGG-MF vector was constructed.

일반적으로 상기 T7 리보뉴클레오타이드 폴리메라아제 프로모터 (T7 RNA Polymerase promotor) 염기서열은 상기 서열 (5´- TAATACGACTCACTATAGGG - 3´)로, 강력한 전사능 (transcription capacitiy)를 보이는 것으로 알려져있다. 이것은 전사되는 RNA가 항상 GGG로 시작되하게 되어, 바이러스 유전자 외에 서열의 맨 앞에 항상 상기 GGG로 시작하게 되는데, 상기 GGG를 가지는 바이러스 유전자에서 바이러스가 만들어지나, 바이러스의 증식에는 부정적 영향을 미친다는 단점이 있어, 본 발명에서는 도6 또는 도7과 같이 상기 GGG, 즉 구아닌 3개가 결실된 상기 T7p-dGGG를 제작하였다. 상기 T7-dGGG (GGG deleted)로부터 생성되는 바이러스 RNA는 GGG가 없는 바이러스 유전자 서열을 갖게되어, 바이러스 증식이 정상적으로 일어나게 된다. 또한 추가 뉴클레오타이드 (extra nucleotide) 생성 없이, 바이러스 유전자를 정확하게 제작할 수 있다. In general, the T7 ribonucleotide polymerase promoter (T7 RNA Polymerase promotor) base sequence is said sequence (5'-TAATACGACTCACTATAGGG-3'), and it is known to exhibit strong transcription capacitiy. This is because the RNA to be transcribed always starts with GGG, and always starts with the GGG at the beginning of the sequence in addition to the viral gene. A virus is produced from the viral gene having the GGG, but negatively affects the proliferation of the virus. Thus, in the present invention, as shown in FIG. 6 or 7, the GGG, that is, the T7p-dGGG in which three guanines were deleted was prepared. The viral RNA generated from the T7-dGGG (GGG deleted) has a viral gene sequence without GGG, and virus propagation normally occurs. In addition, it is possible to accurately construct viral genes without generating additional nucleotides.

상기와 같은 실시예의 방법으로 제작된 pCCI-SalI-SF-T7p-dGGG-MF 벡터는 상기 돌연변이생성 (Mutagenesis) 방법을 통해, 원본 단백질 서열을 유지하면서 새로이 제한효소 FspAI과 MluI 인식 염기서열을 한국형 중동호흡기증후군 코로나바이러스 유전자 (MERS-CoV 감염성 변이 유전자)를 생성함으로써, 이 염기서열들은 차후 유전자 조작을 통해 중동호흡기증후군 코로나바이러스 돌연변이체를 제작할 때, 작은 조각에서 작업이 가능하게 만들어 주어, 돌연변이체 생성을 더욱 쉽고, 빠르고, 효율적이게 만들어 주었다. 이는 향후 바이러스 증식 연구와 약독성 바이러스 개발에 용이하게 사용할 수 있다. The pCCI-SalI-SF-T7p-dGGG-MF vector produced by the method of the above example is a Korean-Middle East region that newly recognizes the restriction enzymes FspAI and MluI, while maintaining the original protein sequence through the mutagenesis method. By generating the respiratory syndrome coronavirus gene (MERS-CoV infectious mutant gene), these sequences make it possible to work in small pieces when constructing the Middle Eastern Respiratory Syndrome Coronavirus mutant through subsequent genetic manipulation, creating mutants Made it easier, faster, and more efficient. It can be easily used for future virus proliferation studies and development of weakly toxic viruses.

또한, 상기 T7 RNA polymerase promoter 염기서열에서 마지막 세 개의 구아닌을 제거함으로써 (T7p-dGGG promoter) 바이러스의 5'-UTR (RNA 유전자 바이러스의 유전체 구조, 기능, 안정성에 있어 가장 중요한 부위 중 하나)의 인위적인 변화 가능성을 제거하였다. 상기 T7p-dGGG promoter를 사용하여, 정확한 MERS-CoV genomic RNA 생산이 가능하여, 정상적인 바이러스를 생산할 수 있다. In addition, by removing the last three guanines from the T7 RNA polymerase promoter base sequence (T7p-dGGG promoter), the artificial 5'-UTR of the virus (one of the most important sites for genomic structure, function, and stability of RNA gene virus) The possibility of change was eliminated. By using the T7p-dGGG promoter, accurate MERS-CoV genomic RNA production is possible, and a normal virus can be produced.

이상, 본 발명을 예시적으로 설명하였으며, 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자라면 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 다양한 변형이 가능할 것이다. 따라서, 본 명세서에 개시된 실시예들은 본 발명을 한정하기 위한 것이 아니라 설명하기 위한 것이고, 이러한 실시예에 의하여 본 발명의 사상과 범위가 한정되는 것은 아니다. 본 발명의 보호범위는 아래의 청구범위에 의해서 해석되어야 하며, 그와 동등한 범위 내에 있는 모든 기술은 본 발명의 권리범위에 포함하는 것으로 해석되어야 할 것이다.Above, the present invention has been described by way of example, and those skilled in the art to which the present invention pertains will be capable of various modifications without departing from the essential characteristics of the present invention. Therefore, the embodiments disclosed in the present specification are not intended to limit the present invention, but to explain the present invention, and the spirit and scope of the present invention are not limited by these embodiments. The scope of protection of the present invention should be interpreted by the claims below, and all technologies within the equivalent range should be interpreted as being included in the scope of the present invention.

<110> KRICT <120> South Korean strain Middle East Respiratory syndrome coronavirus Infectious mutated gene and use thereof <130> M19-5962-v0307 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 30287 <212> DNA <213> Artificial Sequence <220> <223> South Korean strain Middle East Respiratory syndrome coronavirus Infectious mutated gene <400> 1 taatacgact cactatagat ttaagtgaat agcttggcta tctcacttcc cctcgttctc 60 ttgcagaact ttgattttaa cgaacttaaa taaaagccct gttgtttagc gtattgttgc 120 acttgtctgg tgggattgtg gcattaattt gcctgctcat ctaggcagtg gacatatgct 180 caacactggg tataattcta attgaatact atttttcagt tagagcgtcg tgtctcttgt 240 acgtctcggt cacaatatac ggtttcgtcc ggtgcgtggc aattcggggc acatcatgtc 300 tttcgtggct ggtgtgatcg cgcaaggtgc gcgcggtacg tatcgagcag cgctcaactc 360 tgaaaaacat caagaccatg tgtctctaac tgtgccactc tgtggttcag gaaacctggt 420 tgaaaaactt tcaccatggt tcatggatgg cgaaaatgcc tatgaagtgg tgaaggccat 480 gttacttaaa aaagagccac ttctctatgt gcccatccgg ctggctggac acactagaca 540 cctcccaggt cctcgtgtgt acctggttga gaggctcatt gcttgtgaaa atccattcat 600 ggttaaccaa ttggcttata gctctagtgc aaatggcagc ctggttggca caactttgca 660 gggcaagcct attggtatgt tcttccctta tgacatcgaa cttgtcacag gaaagcaaaa 720 tattctcctg cgcaagtatg gccgtggtgg ttatcactac accccagtcc actatgagcg 780 agacaacacc tcttgccctg agtggatgga cgattttgag gcggatccta aaggcaaata 840 tgcccagaat ctgcttaaga agttgattgg cggtgatgtc actccagttg accaatacat 900 gtgtggcgtt gatggaaaac ccattagtgc ctacgcattt ttaatggcca aggatggaat 960 aaccaaactg gctgatgttg aagcggacgt cgcagcacgt gctgatgacg aaggcttcat 1020 cacattaaag aacaatctat atagattggt ttggcatgtt gagcgtaaag acgttccata 1080 tcctaagcaa tctattttta ctattaatag tgtggtccaa aaggatggtg ttgaaaacac 1140 tcctcctcac tattttactc ttggatgcaa aattttaacg ctcaccccac gcaacaagtg 1200 gagtggcgtt tctgacttgt ccctcaaaca aaaactcctt tacaccttct atggtaagga 1260 gtcacttgag aacccaacct acatttacca ctccgcattc attgagtgtg gaagttgtgg 1320 taatgattcc tggcttacag ggaatgctat ccaagggttt gcctgtggat gtggggcatc 1380 atatacagct aatgatgtcg aagtccaatc atctggcatg attaagccaa atgctcttct 1440 ttgtgctact tgcccctttg ctaagggtga cagctgttct tctaattgca aacattcagt 1500 tgctcagttg gttagttacc tttctgaacg ctgtaatgtt attgctgatt ctaagtcctt 1560 cacacttatc tttggtggcg tagcttacgc ctactttgga tgtgaggaag gtactatgta 1620 ctttgtgcct agagctaagt ctgttgtctc aaggattgga gactccatct ttacaggctg 1680 tactggctct tggaacaagg tcactcaaat tgctaacatg ttcttggaac agactcagca 1740 ttcccttaac tttgtgggag agttcgttgt caacgatgtt gtcctcgcaa ttctctctgg 1800 aaccacaact aatgttgaca aaatacgcca gcttctcaaa ggtgtcacca ttgacaagtt 1860 gcgtgattat ttagctgact atgacgtagc agtcactgcc ggcccattca tggataatgc 1920 tattaatgtt ggtggtacag gattacagta tgccgccatt actgcacctt atgtagttct 1980 cactggctta ggtgagtcct ttaagaaagt tgcaaccata ccgtacaagg tttgcaactc 2040 tgttaaggat actctgactt attatgctca cagcgtgttg tacagagttt ttccttatga 2100 catggattct ggtgtgtcat cctttagtga actacttttt gattgcgttg atctttcagt 2160 agcttctacc tattttttag tccgcctctt gcaagataag actggcgact ttatgtctac 2220 aattattact tcctgccaaa ctgctgttag taagcttcta gatacatgtt ttgaagctac 2280 agaagcaaca tttaacttct tgttagattt ggcaggattg ttcagaatct ttcttcgcaa 2340 tgcctatgtg tacacttcac aagggtttgt ggtggtcaat ggcaaagttt ctacacttgt 2400 caaacaagtg ttagacttgc ttaataaggg tatgcaactt ttgcatacaa aggtctcctg 2460 ggctggttct aatatcagtg ctgttatcta cagcggcagg gagtctctaa tattcccatc 2520 gggaacctat tactgtgtca ccactaaggc taagtccgtt caacaagatc ttgacgttat 2580 tttgcctggt gagttttcca agaagcagtt aggactgctc caacctactg acaattctac 2640 aactgttagt gttactgtat ccagtaacat ggttgaaact gttgtgggtc aacttgagca 2700 aactaatatg catagtcctg atgttatagt aggtgactat gtcattatta gtgaaaaatt 2760 gtttgtgcgt agtaaggaag aagacggatt cgccttctac cctgcttgca ctaatggtca 2820 tgctgtaccg actctcttta gacttaaggg aggtgcacct gtaaagaaag tagcctttgg 2880 cggtgatcaa gtacatgagg ttgctgctgt aagaagtgtt actgtcgagt acaacattca 2940 tgctgtatta gacacactac ttgcttcttc tagtcttaga acctttgttg tagataagtc 3000 tttgtcaatt gaggagtttg ctgacgtagt aaaggaacaa gtctcagact tgcttgttaa 3060 attactgcgt ggaatgccga ttccagattt tgatttagac gattttattg acgcaccatg 3120 ctattgcttt aacgctgagg gtgatgcatc ttggtcttct actatgatct tctctcttca 3180 ccccgtcgag tgtgacgagg agtgttctga agtagaggct tcaggtttag aagaaggtga 3240 atcagagtgc atttctgaga cttcaactga acaagttgac gtttctcatg aggtttctga 3300 cgacgagtgg gctgctgcag ttgatgaagc gttccccctc gatgaagcag aagatgttac 3360 tgaatctgtg caagaagaag cacaaccagt agaagtacct gttgaagata ttgcgcaggt 3420 tgtcatagct gacaccttac aggaaactcc tgttgtgtct gatactgttg aagtcccacc 3480 gcaagtggtg aaacttccgt ctgaacctca gactatccag cccgaggtaa aagaagttgc 3540 acctgtctat gaggctgata ccgaacagac acagagtgtt actgttaaac ctaagaggtt 3600 acgcaaaaag cgtaatgttg accctttgtc caattttgaa cataaggtta ttacagagtg 3660 cgttaccata gttttaggtg acgcaattca agtagccaag tgctatgggg agtctgtgtt 3720 agttaatgct gctaacacac atcttaagca tggcggtggt atcgctggtg ctattaatgc 3780 ggcttcaaaa ggggctgtcc aaaaagagtc agatgagtat attctggcta aagggccgtt 3840 acaagtagga gattcagttc tcttgcaagg ccattctcta gctaagaata tcctgcatgt 3900 cgtaggccca gatgcccgcg ctaaacagga tgtttctctc cttagtaagt gctataaggc 3960 tatgaatgca tatcctcttg tagtcactcc tcttgtttca acaggcatat ttggtgtaaa 4020 accagctgtg tcttttgatt atcttattag agaggctaag actagagttt tagtcgtcgt 4080 taattcccaa gatgtctata agagtcttac catagttgac attccacaga gtttgacttt 4140 ttcatatgat gggttacgtg gcgcaatacg taaagctaaa gattatggtt ttactgtttt 4200 tgtgtgcaca gacaactctg ctaacactaa agttcttagg aacaagggtg ttgattatac 4260 taagaagttt cttacagttg acggtgtgca atattattgc tacacgtcta aggacacttt 4320 agatgatatc ttacaacagg ctaataagtc tgttggtatt atatctatgc ctttgggata 4380 tgtgtctcat ggtttagact taattcaagc agggagtgtc gtgcgtagag ttaacgtgcc 4440 ctacgtgtgt ctcctagcta ataaagagca agaagctatt ttgatgtctg aagacgttaa 4500 gttaaaccct tcagaagatt ttataaagca cgtccgcact aatggtggtt acaattcttg 4560 gcatttagtc gagggtgaac tattggtgca agacttacgc ttaaataagc tcctgcattg 4620 gtctgatcaa accatatgct acaaggatag tgtgttttat gttgtaaaga atagtacagc 4680 ttttccattt gaaacacttt cagcatgtcg tgcgtatttg gattcacgca cgacacagca 4740 gttaacaatc gaagtcttag tgactgtcga tggtgtaaat tttagaacag tcgttctaaa 4800 taataagaac acttatagat cacagcttgg atgcgttttc tttaatggtg ctgatatttc 4860 tgataccatt cctgatgaga aacagaatgg tcacagttta tatctagcag acaatttgac 4920 tgctgatgaa acaaaggcgc ttaaagagtt atatggcccc gttgatccta ctttcttaca 4980 cagattctat tcacttaagg ctgcagtcca taagtggaag atggttgtgt gtgataaggt 5040 acgttctctc aaattgagtg ataataattg ttatcttaat gcagttatta tgacacttga 5100 tttattgaag gacattaaat ttgttatacc tgctctacag catgcattta tgaaacataa 5160 gggcggtgat tcaactgact tcatagccct cattatggct tatggcaatt gcacatttgg 5220 tgctccagat gatgcctctc ggttacttca taccgtgctt gcaaaggctg agttatgctg 5280 ttctgcacgc atggtttgga gagagtggtg caatgtctgt ggcataaaag atgttgttct 5340 acaaggctta aaagcttgtt gttacgtggg tgtgcaaact gttgaagatc tgcgtgctcg 5400 catgacatat gtatgccagt gtggtggtga acgtcatcgg caaatagtcg aacacaccac 5460 cccctggttg ctgctctcag gcacaccaaa tgaaaaattg gtgacaacct ccacggcgcc 5520 tgattttgta gcgtttaatg tctttcaggg cattgaaacg gctgttggcc attatgttca 5580 tgcttgcctg aagggtggtc ttattttaaa gtttgactct ggcaccgtta gcaagacttc 5640 agactggaag tgcaaggtga cagatgtact tttccccggc caaaaataca gtagcgattg 5700 taatgtcgta cggtattctt tggacggtaa tttcagaaca gaggttgatc ccgacctatc 5760 tgctttctat gttaaggatg gtaaatactt tacaagtgaa ccacccgtaa catattcacc 5820 agctacaatt ttagctggta gtgtctacac taatagctgc cttgtatcgt ctgatggaca 5880 acctggcggt gatgctatta gtttgagttt taataacctt ttagggtttg attctagtaa 5940 accagtcact aagaaataca cttactcctt cttgcctaaa gaagacggcg atgtgttgtt 6000 ggctgagttt gacacttatg accctattta taagaatggt gccatgtata aaggcaaacc 6060 aattctttgg gtcaacaaag catcttatga tactaatctt aataagttca atagagctag 6120 tttgcgtcaa atttttgacg tagcccccat tgaactcgaa aataaattca cacctttgag 6180 tgtggcgtcc acaccagttg aacctccaac tgtagatgtg gtagcacttc aacaggaaat 6240 gacaattgtc aaatgtaagg gtttaaataa acctttcgtg aaggacaatg tcagtttcgt 6300 tgctgatgac tcaggtactc ccgttgttga gtatctgtct aaagaagatc tacatacatt 6360 gtatgtagac cctaagtatc aagtcattgt cttaaaagac aatgtacttt cttctatgct 6420 tagattgcac accgttgagt caggtgatat taacgttgtt gcagcttccg gatctttgac 6480 acgtaaagtg aagttactat ttagggcttc attttatttc aaagaatttg ctacccgcac 6540 tttcactgct accactgctg taggtagttg tataaagagt gtagtgcggc atctaggtgt 6600 tactaaaggc atattgacag gctgttttag ttttgtcaag atgttattta ttcttccact 6660 agcttacttt agtgattcaa aactcggcac cacagaggtt aaagtgagtg ctttgaaaac 6720 agctggcgtt gtgacaggta atgttgtaaa acagtgttgc actgctgctg ttgatttaag 6780 tatggataag ttgcgccgtg tggattggaa atcaacccta cggttgttac ttatgttatg 6840 cacaactatg gtattgttgt cttctgtgta tcacttgtat gtcttcaatc aggtcttatc 6900 aagtgatgtt atgtttgaag atgcccaagg tttgaaaaag ttctacaaag aagttagagc 6960 ttacctagga atctcttctg cttgtgacgg tcttgcttca gcttataggg cgaattcatt 7020 tgatgtacct acattctgcg caaaccgttc tgcaatgtgt aattggtgct tgattagcca 7080 agattccata actcactacc cagctcttaa gatggttcaa acacatctta gccactatgt 7140 tcttaacata gattggttgt ggtttgcatt cgagactggt ttggcataca tgctctatac 7200 ctcggccttc aactggttgt tgttggcagg tacattgcat tatttctttg cacagacttc 7260 catatttgta gactggcggt catacaatta tgctgtgtct agtgccttct ggttatttac 7320 ccacattcca atggcgggtt tggtacgaat gtataatttg ttagcatgcc tttggctttt 7380 acgcaagttt tatcagcatg taatcaatgg ttgcaaagat acggcatgct tgctctgcta 7440 taagaggaac cgacttacta gagttgaagc ttctaccgtt gtctgtggtg gaaaacgtac 7500 gttttatatc acagcaaatg gcggtatttc attctgtcgt aggcataatt ggaattgtgt 7560 ggattgtgac attgcaggtg tggggaatac cttcatctgt gaagaagtcg caaatgacct 7620 cactaccgcc ctacgcaggc ctattaacgc tacggataga tcacattatt atgtggattc 7680 cgttacagtt aaagagactg ttgttcagtt taattatcgt agagacggtc aaccattcta 7740 cgagcggttt cccctctgcg cttttacaaa tctagataag ttgaagttca aagaggtctg 7800 taaaactact actggtatac ctgaatacaa ctttatcatc tacgactcat cagatcgtgg 7860 ccaggaaagt ttagctaggt ctgcatgtgt ttattattct caagtcttgt gtaaatcaat 7920 tcttttggtt gactcaagtt tggttacttc tgttggtgat tctagtgaaa tcgccactaa 7980 aatgtttgat tcctttgtta atagtttcgt ctcgctgtat aatgtcacac gcgataagtt 8040 ggaaaaactt atctctactg ctcgtgatgg cgtaaggcga ggcgataact tccatagtgt 8100 cttaacaaca ttcattgacg cagcacgagg ccccgcaggt gtggagtctg atgttgagac 8160 caatgaaatt gttgactctg tgcagtatgc tcataaacat gacatacaaa ttactaatga 8220 gagttacaat aattatgtac cctcatatgt taaacctgat agtgtgtcta ccagtgattt 8280 aggtagtctc attgattgta atgcggcttc agttaaccaa attgtcttgc gtaattctaa 8340 tggtgcttgt atttggaacg ctgctgcata tatgaaactc tcggatgcac ttaaacgaca 8400 gattcgcatt gcatgccgta agtgtaattt agctttccgg ttaaccacct caaagctacg 8460 cgctaatgat aatatcttat cagttagatt cactgctaac aaaattgttg gtggtgctcc 8520 tacatggttt aatgtgttgc gtgactttac gttaaagggt tacgttcttg ctaccattat 8580 tgtgtttctg tgtgctgtac tgatgtattt gtgtttacct acattttcta tggtacctgt 8640 tgaattttat gaagaccgca tcttggactt taaagttctt gataatggta tcattaggga 8700 tgtaaatcct gatgataagt gctttgctaa taagcaccgg tccttcacac aatggtatca 8760 tgagcatgtt ggtggtgtct atgacaactc tatcacatgc ccattgacag ttgcagtaat 8820 tgctggagtt gctggtgctc gcattccaga cgtacctact acattggctt gggtgaacaa 8880 tcagataatt ttctttgttt ctcgagtctt tgctaataca ggcagtgttt gctacactcc 8940 tatagatgag ataccctata agagtttctc tgatagtggt tgcattcttc catctgagtg 9000 cactatgttt agggatgcag agggccgtat gacaccatac tgccatgatc ctactgtttt 9060 gcctggggct tttgcgtaca gtcagatgag gcctcatgtt cgttacgact tgtatgatgg 9120 taacatgttt attaaatttc ctgaagtagt atttgaaagt acacttagga ttactagaac 9180 tctgtcaact cagtactgcc ggttcggtag ttgtgagtat gcacaagagg gtgtttgtat 9240 taccacaaat ggctcgtggg ccatttttaa tgaccaccat cttaatagac ctggtgtcta 9300 ttgtggctct gattttattg acattgtcag gcggttagca gtatcactgt tccagcctat 9360 tacttatttc caattgacta cctcattggt cttgggtata ggtttgtgtg cattcctgac 9420 tttgctcttc tattatatta ataaagtaaa acgtgctttt gcagattaca cccagtgtgc 9480 tgtaattgct gttgttgctg ctgttcttaa tagcttgtgc atctgctttg ttgcctctat 9540 accattgtgt atagtacctt acactgcatt gtactattat gctacattct attttactaa 9600 tgagcctgca tttattatgc atgtttcttg gtacattatg ttcgggccta tcgttcccat 9660 atggatgacc tgcgtctata cagttgcaat gtgctttaga cacttcttct gggttttagc 9720 ttattttagt aagaaacatg tagaagtttt tactgatggt aagcttaatt gtagtttcca 9780 ggacgctgcc tctaatatct ttgttattaa caaggacact tatgcagctc ttagaaactc 9840 tttaactaat gatgcctatt cacgattttt ggggttgttt aacaagtata agtacttctc 9900 tggtgctatg gaaacagccg cttatcgtga agctgcagca tgtcatcttg ctaaagcctt 9960 acaaacatac agtgagactg gtagtgatct tctttaccaa ccacccaact gtagcataac 10020 ctctggcgtg ttgcaaagcg gtttggtgaa aatgtcacat cccagtggag atgttgaggc 10080 ttgtatggtt caggttacct gcggtagcat gactcttaat ggtctttggc ttgacaacac 10140 agtctggtgc ccacgacacg taatgtgccc ggctgaccag ttgtctgatc ctaattatga 10200 tgccttgttg atttctatga ctaatcatag tttcagtgtg caaaaacaca ttggcgctcc 10260 agcaaacttg cgtgttgttg gtcatgccat gcaaggcact cttttgaagt tgactgtcga 10320 tgttgctaac cctagcactc cagcctacac ttttacaaca gtgaaacctg gcgcagcatt 10380 tagtgtgtta gcatgctata atggtcgtcc gactggtaca ttcactgttg taatgcgccc 10440 taactacaca attaagggtt cctttctgtg tggttcttgt ggtagtgttg gttacaccaa 10500 ggagggtagt gtgatcaatt tttgttacat gcatcaaatg gaacttgcta atggtacaca 10560 taccggttca gcatttgatg gtactatgta tggtgccttt atggataaac aagtgcacca 10620 agttcagtta acagacaaat actgcagtgt taatgtagta gcttggcttt acgcagcaat 10680 acttaatggt tgcgcttggt ttgtaaaacc taatcgcact agtgttgttt cttttaatga 10740 atgggctctt gccaaccaat tcactgaatt tgttggcact caatccgttg acatgttagc 10800 tgtcaaaaca ggcgttgcta ttgaacagct gctttatgcg atccaacaac tttatactgg 10860 gttccaggga aagcaaatcc ttggcagtac tatgttggaa gatgaattca cacctgagga 10920 tgttaatatg cagattatgg gtgtggttat gcagagtggt gtgagaaaag ttacatatgg 10980 tactgcgcat tggttgttcg cgacccttgt ttcaacctat gtgataatct tacaagccac 11040 taaatttact ttgtggaact acttgtttga gactattccc acacagttgt tcccactctt 11100 atttgtgact atggccttcg ttatgttgtt ggttaaacac aaacacacct ttttgacact 11160 tttcttgttg cctgtggcta tttgtttgac ttatgcaaac atagtctacg agcccactac 11220 tcccatttcg tcagcgctga ttgcagttgc aaattggctt gcccccacta atgcttatat 11280 gcgtactaca catactgata ttggtgtcta cattagtatg tcacttgtat tagtcattgt 11340 agtgaagaga ttgtacaacc catcactttc taactttgcg ttagcattgt gcagtggtgt 11400 aatgtggttg tacacttata gcattggaga agcctcaagc cccattgcct atctggtttt 11460 tgtcactaca ctcactagtg attatacgat tacagtcttt gttactgtca accttgcaaa 11520 agtttgcact tatgccatct ttgcttactc accacagctt acacttgtgt ttccggaagt 11580 gaagatgata cttttattat acacatgttt aggtttcatg tgtacttgct attttggtgt 11640 cttctctttt ttgaacctta agcttagagc acctatgggt gtctatgact ttaaggtctc 11700 aacacaagag ttcagattca tgactgctaa caatctaact gcacctagaa attcttggga 11760 ggctatggct ctgaacttta agttaatagg tattggcggt acaccttgta taaaggttgc 11820 tgctatgcag tctaaactta cagatcttaa atgcacatct gtggttctcc tctctgtgct 11880 ccaacagtta cacttagagg ctaatagtag ggcctgggct ttctgtgtta aatgccataa 11940 tgacatattg gcagcaacag accccagtga ggctttcgag aaattcgtaa gtctctttgc 12000 cactttaatg actttttctg gtaatgtaga tcttgatgcg ttagctagtg atatttttga 12060 cactcctagc gtacttcaag ctactctttc tgagttttca cacttagcta cctttgctga 12120 gttggaagct gcgcagaaag cctatcagga agctatggac tctggtgaca cctcaccaca 12180 agttcttaag gctttgcaga aggctgttaa tatagctaaa aacgcctatg agaaggataa 12240 ggcagtggcc cgtaagttag aacgtatggc tgatcaggct atgacttcta tgtataagca 12300 agcacgtgct gaagacaaga aagcaaaaat tgtcagtgct atgcaaacta tgttgtttgg 12360 tatgattaag aagctcgaca acgatgttct taatggtatc atttctaacg ctaggaatgg 12420 ttgtatacct cttagtgtca ttccactgtg tgcttcaaat aaacttcgcg ttgtaattcc 12480 tgacttcacc gtctggaatc aggtagtcac atatccctcg cttaactacg ctggggcttt 12540 gtgggacatt acagttataa acaatgtgga caatgaaatt gttaagtctt cagatgttgt 12600 agacagcaat gaaaatttaa catggccact tgttttagaa tgcactaggg catccacttc 12660 tgccgttaag ttgcaaaata atgagatcaa accttcaggt ttaaaaacca tggttgtgtc 12720 tgcaggtcaa gagcaaacta actgtaatac tagttcctta gcttattacg aacctgtgca 12780 gggtcgtaaa atgctgatgg ctcttctttc tgataatgcc tatctcaaat gggcgcgtgt 12840 tgaaggtaag gacggatttg ttagtgtaga gctacaacct ccttgcaaat tcttgattgc 12900 gggaccaaaa ggacctgaaa tccgatatct ctattttgtt aaaaatctta acaaccttca 12960 tcgcgggcaa gtgttagggc acattgctgc gactgttaga ttgcaagctg gttctaacac 13020 agcttatctc gatttcgtca atgcgggagg tgccccattg acaaattgtg ttaagatgct 13080 tactcctaaa actggtacag gtatagctat atctgttaaa ccagagagta cagctgatca 13140 agagacttat ggtggagctt cagtgtgtct ctattgccgt gcgcatatag aacatcctga 13200 tgtctctggt gtttgtaaat ataagggtaa gtttgtccaa atccctgctc agtgtgtccg 13260 tgaccctgtg ggattttgtt tgtcaaatac cccctgtaat gtctgtcaat attggattgg 13320 atatgggtgc aattgtgact cgcttaggca agtagcactg ccccaatcta aagattccaa 13380 ttttttaaac gagtccgggg ttctattgta aatgcccgaa tagaaccctg ttcaagtggt 13440 ttgtccactg atgtcgtctt tagggcattt gacatctgca actataaggc taaggttgct 13500 ggtattggaa aatactacaa gactaatact tgtaggtttg tagaattaga tgaccaaggg 13560 catcatttag actcctattt tgtcgttaag aggcatacta tggagaatta tgaactagag 13620 aagcactgtt acgatttgtt acgtgactgt gatgctgtag ctccccatga tttcttcatc 13680 tttgatgtag acaaagttaa aacacctcat attgtacgtc agcgtttaac tgagtacact 13740 atgatggatc ttgtatatgc cctgaggcac tttgatcaaa atagcgaagt gcttaaggct 13800 atcttagtga agtatggttg ctgtgatgtt acctactttg aaaataaact ctggtttgat 13860 tttgttgaaa atcccagtgt tattggtgtt tatcataaac ttggagaacg tgtacgccaa 13920 gctatcttaa acactgttaa attttgtgac cacatggtca aggctggttt agtcggtgtg 13980 ctcacactag acaaccagga ccttaatggc aagtggtatg attttggtga cttcgtaatc 14040 actcaacctg gttcaggagt agctatagtt gatagctact attcttattt gatgcctgtg 14100 ctctcaatga ccgattgtct ggccgctgag acacataggg attgtgattt taataaacca 14160 ctcattgagt ggccacttac tgagtatgat tttactgatt ataaggtaca actctttgag 14220 aagtacttta aatattggga tcagacgtat cacgcaaatt gcgttaattg tactgatgac 14280 cgttgtgtgt tacattgtgc taatttcaat gtattgtttg ctatgaccat gcctaagact 14340 tgtttcggac ccatagtccg aaagatcttt gttgatggcg tgccatttgt agtatcttgt 14400 ggttatcact acaaagaatt aggtttagtc atgaatatgg atgttagtct ccatagacat 14460 aggctctctc ttaaggagtt gatgatgtat gccgctgatc cagccatgca cattgcctcc 14520 tctaacgctt ttcttgattt gaggacatca tgttttagtg tcgctgcact tacaactggt 14580 ttgacttttc aaactgtgcg gcctggcaat tttaaccaag acttctatga tttcgtggta 14640 tctaaaggtt tctttaagga gggctcttca gttacgctca aacatttttt ctttgctcaa 14700 gatggtaatg ctgctattac agattataat tactattctt ataatctgcc tactatgtgt 14760 gacatcaaac aaatgttgtt ctgcatggaa gttgtaaaca agtacttcga aatctatgac 14820 ggtggttgtc ttaatgcttc tgaagtggtt gttaataatt tagacaagag tgctggccat 14880 ccttttaata agtttggcaa agctcgtgtc tattatgaga gcatgtctta ccaggagcaa 14940 gatgaactct ttgccatgac aaagcgtaac gtcattccta ccatgactca aatgaatcta 15000 aaatatgcta ttagtgctaa gaatagagct cgcactgttg caggcgtgtc catacttagc 15060 acaatgacta atcgccagta ccatcagaaa atgcttaagt ccatggctgc aactcgtgga 15120 gcgacttgcg tcattggtac tacaaagttc tatggtggct gggatttcat gcttaaaaca 15180 ttgtacaaag atgttgataa tccgcatctt atgggttggg attaccctaa gtgtgataga 15240 gctatgccta atatgtgtag aatcttcgct tcactcatat tagctcgtaa acatggcact 15300 tgttgtacta caagggacag attttatcgc ttggcaaatg agtgtgctca ggtgctaagc 15360 gaatatgttc tatgtggtgg tggttactac gtcaaacctg gaggtaccag tagcggagat 15420 gccaccactg catatgccaa tagtgtcttt aacattttgc aggcgacaac tgctaatgtc 15480 agtgcactta tgggtgctaa tggcaacaag attgttgaca aagaagttaa agacatgcag 15540 tttgatttgt atgtcaatgt ttacaggagc actagcccag accccaaatt tgttgataaa 15600 tactatgctt ttcttaataa gcacttttct atgatgatac tgtctgatga cggtgtcgtt 15660 tgctataata gtgattatgc agctaagggt tacattgctg gaatacagaa ttttaaggaa 15720 acgctgtatt atcagaacaa tgtctttatg tctgaagcta aatgctgggt ggaaaccgat 15780 ctgaagaaag ggccacatga attctgttca cagcatacgc tttatattaa ggatggcgac 15840 gatggttact tccttcctta tccagaccct tcaagaattt tgtctgccgg ttgctttgta 15900 gatgatatcg ttaagactga cggtacactc atggtagagc ggtttgtgtc tttggctata 15960 gatgcttacc ctctcacaaa gcatgaagat atagaatacc agaatgtatt ctgggtctac 16020 ttacagtata tagaaaaact gtataaagac cttacaggac acatgcttga cagttattct 16080 gtcatgctat gtggtgataa ttctgctaag ttttgggaag aggcattcta cagagatctc 16140 tatagttcgc ctaccacttt gcaggctgtc ggttcatgcg ttgtatgcca ttcacagact 16200 tccctacgct gtgggacatg catccgtaga ccatttctct gctgtaaatg ctgctatgat 16260 catgttatag caactccaca taagatggtt ttgtctgttt ctccttacgt ttgtaatgcc 16320 cctggttgtg gcgtttcaga cgttactaag ctatatttag gtggtatgag ctacttttgt 16380 gtagatcata gacctgtgtg tagttttcca ctttgcgcta atggtcttgt attcggctta 16440 tacaagaata tgtgcacagg tagtccttct atagttgaat ttaataggtt ggctacctgt 16500 gactggactg aaagtggtga ttacaccctt gccaatacta caacagaacc actcaaactt 16560 tttgctgctg agactttacg tgccactgaa gaggcgtcta agcagtctta tgctattgcc 16620 accatcaaag aaattgttgg tgagcgccaa ctattacttg tgtgggaggc tggcaagtcc 16680 aaaccaccac tcaatcgtaa ttatgttttt actggttatc atataaccaa aaatagtaaa 16740 gtgcagctcg gtgagtacat cttcgagcgc attgattata gtgatgctgt atcctacaag 16800 tctagtacaa cgtataaact gactgtaggt gacatcttcg tacttacctc tcactctgtg 16860 gctaccttga cggcgcccac aattgtgaat caagagaggt atgttaaaat tactgggttg 16920 tacccaacca ttacggtacc tgaagagttc gcaagtcatg ttgccaactt ccaaaaatca 16980 ggttatagta aatatgtcac tgttcaggga ccacctggca ctggcaaaag tcattttgct 17040 atagggttag cgatttacta ccctacagca cgtgttgttt atacagcatg ttcacacgca 17100 gctgttgatg ctttgtgtga aaaagctttt aaatatttga acattgctaa atgttcccgt 17160 atcattcctg caaaggcacg tgttgagtgc tatgacaggt ttaaagttaa tgagacaaat 17220 tctcaatatt tgtttagtac tattaatgct ctaccagaaa cttctgccga tattctggtg 17280 gttgatgagg ttagtatgtg cactaattat gatctttcaa ttattaatgc acgtattaaa 17340 gctaagcaca ttgtctatgt aggagatcca gcacagttgc cagctcctag gactttgttg 17400 actagaggca cattggaacc agaaaatttc aatagtgtca ctagattgat gtgtaactta 17460 ggtcctgaca tatttttaag tatgtgctac aggtgtccta aggaaatagt aagcactgtg 17520 agcgctcttg tctacaataa taaattgtta gccaagaagg agctttcagg ccagtgcttt 17580 aaaatactct ataagggcaa tgtgacgcat gatgctagct ctgccattaa tagaccacaa 17640 ctcacatttg tgaagaattt tattactgcc aatccggcat ggagtaaggc agtctttatt 17700 tcgccttata attcacagaa tgctgtggct cgttcaatgc tgggtcttac tactcagact 17760 gttgattcct cacagggttc agaataccag tacgttatct tctgtcaaac agcagatacg 17820 gcacatgcta acaacattaa cagatttaat gttgcaatca ctcgtgccca aaaaggtatt 17880 ctttgtgtta tgacatctca ggcactcttt gagtccttag agtttactga attgtctttt 17940 actaattaca agctccagtc tcagattgta actggccttt ttaaagattg ctctagagaa 18000 acttctggcc tctcacctgc ttatgcacca acatacgtta gtgttgatga caagtataag 18060 acgagtgatg agctttgcgt gaatcttaat ttacccgcaa atatcccata ctctcgtgtt 18120 atttccagga tgggctttaa actcgatgca acagttcctg gatatcctaa gcttttcatt 18180 actcgtgaag aggctgtaag gcaagttcga agctggatag gcttcgatgt tgagggtgct 18240 catgcttccc gtaatgcatg tggcaccaat gtgcctctac aattaggatt ttcaactggt 18300 gtgaactttg ttgttcagcc agttggtgtt gtagacactg agtggggtaa catgttaacg 18360 ggcattgctg cccgtcctcc accaggtgaa cagtttaagc acctcgtgcc tcttatgcat 18420 aagggggctg cgtggcctat tgttagacga cgtatagtgc aaatgttgtc agacacttta 18480 gacaaattgt ctgattactg tacgtttgtt tgttgggctc atggctttga attaacgtct 18540 gcatcatact tttgcaagat aggtaaggaa cagaagtgtt gcatgtgcaa tagacgcgct 18600 gcagcgtact cttcacctct gcaatcttat gcctgctgga ctcattcctg cggttatgat 18660 tatgtctaca accctttctt tgtcgatgtt caacagtggg gttatgtagg caatcttgct 18720 actaatcacg atcgttattg ctctgtccat caaggagctc atgtggcttc taatgatgca 18780 ataatgactc gttgtttagc tattcattct tgttttatag aacgtgtgga ttgggatata 18840 gagtatcctt atatctcaca tgaaaagaaa ttgaattcct gttgtagaat cgttgagcgc 18900 aacgtcgtac gtgctgctct tcttgccggt tcatttgaca aagtctatga tattggcaat 18960 cctaaaggaa ttcctattgt tgatgaccct gtggttgatt ggcattattt tgatgcacag 19020 cccttgacca ggaaggtaca acagcttttc tatacagagg acatggcctc aagatttgct 19080 gatgggctct gcttattttg gaactgtaat gtaccaaaat atcctaataa tgcaattgta 19140 tgcaggtttg acacgcgtgt gcattctgag ttcaatttgc caggttgtga tggcggtagt 19200 ttgtatgtta acaagcacgc ttttcataca ccagcatatg atgtgagtgc attccgtgat 19260 ctgaaacctt taccattctt ttattattct actacaccat gtgaagtgca tggtaatggt 19320 agtatgatag aggatattga ttatgtaccc ctaaaatctg cagtctgtat tacagcttgt 19380 aatttagggg gcgctgtttg taggaagcat gctacagagt acagagagta tatggaagca 19440 tataatcttg tctctgcatc aggtttccgc ctttggtgtt ataagacctt tgatatttat 19500 aatctctggt ctacttttac aaaagttcaa ggtttggaaa acattgcttt taatgttgtt 19560 aaacaaggcc attttattgg tgttgagggt gaactacctg tagctgtagt caatgataag 19620 atcttcacca agagtggcgt taatgacatt tgtatgtttg agaataaaac cactttgcct 19680 actaatatag cttttgaact ctatgctaag cgtgctgtac gctcgcatcc cgatttcaaa 19740 ttgctacaca atttacaagc agacatttgc tacaagttcg tcctttggga ttatgaacgt 19800 agcaatattt atggtactgc tactattggt gtatgtaagt acactgatat tgatgttaat 19860 tcagctttga atatatgttt tgacatacgc gataatggtt cattggagaa gttcatgtct 19920 actcccaatg ccatctttat ttctgataga aaaattaaga aatacccttg tattgtaggt 19980 cctgattatg cttacttcaa tggtgctatc atccgtgata gtgatgttgt taaacaacca 20040 gtgaagttct acttgtataa gaaagtcaat aatgagttta ttgatcctac tgagtgtatt 20100 tacactcaga gtcgctcttg tagtgacttc ctacccctgt ctgacatgga gaaagacttt 20160 ctatcttttg atagtgatgt tttcattaag aagtatggct tggaaaacta tgcttttgag 20220 cacgtagtct atggagactt ctctcatact acgttaggcg gtcttcactt gcttattggt 20280 cacgtagtct atggagactt ctctcatact acgttaggcg gtcttcactt gcttattggt 20340 ttatacaaga agcaacagga aggtcatatt attatggaag aaatgctaaa aggtagctca 20400 actattcata actattttat tactgagact aacacagcgg cttttaaggc ggtgtgttct 20460 gttatagatt taaagcttga cgactttgtt atgattttaa agagtcaaga ccttggcgta 20520 gtatccaagg ttgtcaaggt tcctattgac ttaacaatga ttgagtttat gttatggtgt 20580 aaggatggac aggttcaaac cttctaccct cgactccagg cttctgcaga ttggaaacct 20640 ggtcatgcaa tgccatccct ctttaaagtt caaaatgtaa accttgaacg ttgtgagctt 20700 gctaattaca agcaatctat tcctatgcct cgcggtgtgc acatgaacat cgctaaatat 20760 atgcaattgt gccagtattt aaatacttgc acattagccg tgcctgccaa tatgcgtgtt 20820 atacattttg gcgctggttc tgataaaggt atcgctcctg gtacatcagt tttacgacag 20880 tggcttccta cagatgccat tattatagat aatgatttaa atgagttcgt gtcagatgct 20940 gacataactt tatttggaga ttgtgtaact gtacgtgtca gccaacaagt ggatcttgtt 21000 atttccgaca tgtatgatcc tactactaag aatgtaacag gtagtaatga gtcaaaggct 21060 ttattcttta cttacctgtg taacctcatt aataataatc ttgctcttgg tgggtctgtt 21120 gctattaaaa taacagaaca ctcttggagc gttgaacttt atgaacttat gggaaaattt 21180 gcttggtgga ctgttttctg caccaatgca aatgcatcct catctgaagg attcctctta 21240 ggtattaatt acttgggtac tattaaagaa aatatagatg gtggtgctat gcacgccaac 21300 tatatatttt ggagaaattc cactcctatg aatctgagta cttactcact ttttgattta 21360 tccaagtttc aattaaaatt aaaaggaaca ccagttcttc aattaaagga gagtcaaatt 21420 aacgaactcg taatatctct cctgtcgcag ggtaagttac ttatccgtga caatgataca 21480 ctcagtgttt ctactgatgt tcttgttaac acctacagaa agttacgttg atgtagggcc 21540 agattctgtt aagtctgctt gtattgaggt tgatatacaa cagactttct ttgataaaac 21600 ttggcctagg ccaattgatg tttctaaggc tgacggtatt atataccctc aaggccgtac 21660 atattctaac ataactatca cttatcaagg tctttttccc tatcagggag accatggtga 21720 tatgtatgtc tactctgcag gacatgctac aggcacaact ccacaaaagt tgtttgtagc 21780 taactattct caggacgtca aacagtttgc taatgggttt gtcgtccgta taggagcagc 21840 tgccaattcc actggcactg ttattattag cccatctacc cgcgctacta tacgaaaaat 21900 ttaccctgct tttatgctgg gttcttcagt tggtaatttc tcagatggta aaatgggccg 21960 cttcttcaat catactctag ttcttttgcc cgatggatgt ggcactttac ttagagcttt 22020 ttattgtatt ctagagcctc gctctggaaa tcattgtcct gctggcaatt cctatacttc 22080 ttttgccact tatcacactc ctgcaacaga ttgttctgat ggcaattaca atcgtaatgc 22140 cagtctgaac tcttttaagg agtattttaa tttacgtaac tgcaccttta tgtacactta 22200 taacattacc gaagatgaga ttttagagtg gtttggcatt acacaaactg ctcaaggtgt 22260 tcacctcttc tcatctcggt atgttgattt gtacggcggc aatatgtttc aatttgccac 22320 cttgcctgtt tatgatacta ttaagtatta ttctatcatt cctcacagta ttcgttctat 22380 ccaaagtgat agaaaagctt gggctgcctt ctacgtatat aaacttcaac cgttaacttt 22440 cctgttggat ttttctgttg atggttatat acgcagagct atagactgtg gttttaatga 22500 tttgtcacaa ctccactgct catatgaatc cttcgatgtt gaatctggag tttattcagt 22560 ttcgtctttc gaagcaaaac cttctggctc agttgtggaa caggctgaag gtgttgaatg 22620 tgatttttca cctcttctgt ctggcacacc tcctcaggtt tataatttca agcgtttggt 22680 ttttaccaat tgcaattata atcttaccaa attgctttca cttttttctg tgaatgattt 22740 tacttgtagt caaatatctc cagcagcaat tgctagcaac tgttattctt cactgatttt 22800 ggattatttt tcatacccac ttagtatgaa atccgatctc agtgttagtt ctgctggtcc 22860 aatatcccag tttaattata aacagtcctt ttctaatccc acatgtttga ttttagcgac 22920 tgttcctcat aaccttacta ctattactaa gcctcttaag tacagctata ttaacaagtg 22980 ctctcgtctt ctttctgatg atcgtactga agtacctcag ttagtgaacg ctaatcaata 23040 ctcaccctgt gtatccattc tcccatccac tgtgtgggaa gacggtgatt attataggaa 23100 acaactatct ccacttgaag gtggtggctg gcttgttgct agtggctcaa ctgttgccat 23160 gactgagcaa ttacagatgg gctttggtat tacagttcaa tatggtacag acaccaatag 23220 tgtttgcccc aagcttgaat ttgctaatga cacaaaaatt gcctctcaat taggcaattg 23280 cgtggaatat tccctctatg gtgtttcggg ccgtggtgtt tttcagaatt gcacagctgt 23340 aggtgttcga cagcagcgct ttgtttatga tgcgtaccag aatttagttg gctattattc 23400 tgatgatggc aactactact gtttgcgtgc ttgtgttagt gttcctgttt ctgtcatcta 23460 tgataaagaa actaaaaccc acgctactct atttggtagt gttgcatgtg aacacatttc 23520 ctctaccatg tctcaatact cccgttctac gcgatcaatg cttaaacggc gagattctac 23580 atatggtccc cttcagacac ctgttggttg tgtcctagga cttgttaatt cctctttgtt 23640 cgtagaggac tgcaagttgc ctcttggtca atctctctgt gctcttcctg acacacctag 23700 tactctcaca cctcgcagtg tgcgctctgt tccaggtgaa atgcgcttgg catccattgc 23760 ttttaatcat cctattcagg ttgatcaact taatagtagt tattttaaat taagtatacc 23820 tactaatttt tcctttggtg tgactcagga gtacattcag acaaccattc agaaagttac 23880 tgttgattgt aaacagtacg tttgcaatgg tttccagaag tgtgagcaat tactgcgcga 23940 gtatggccag ttttgttcca aaataaacca ggctctccat ggtgccaatt tacgccagga 24000 tgattctgta cgtaatttgt ttgcgagcgt gaaaagctct caatcatctc ctatcatacc 24060 aggttttgga ggtgacttta atttgacact tctagaacct gtttctatat ctactggcag 24120 tcgtagtgca cgtagtgcta ttgaggattt gctatttgac aaagtcacta tagctgatcc 24180 tggttatatg caaggttacg atgattgtat gcagcaaggt ccagcatcag ctcgtgatct 24240 tatttgtgct caatatgtgg ctggttataa agtattacct cctcttatgg atgttaatat 24300 ggaagccgcg tacacttcat ctttgcttgg cagcatagca ggtgttggct ggactgctgg 24360 cttatcctcc tttgctgcta ttccatttgc acagagtatc ttttataggt taaacggtgt 24420 tggcattact caacaggttc tttcagagaa ccaaaagctt attgccaata agtttaatca 24480 ggctctggga gctatgcaaa caggcttcac tacaactaat gaagcttttc ggaaggttca 24540 ggatgctgtg aacaacaatg cacaggctct atccaaatta gctagcgagc tatctaatac 24600 ttttggtgct atttccgcct ctattggaga catcatacaa cgtcttgacg ttctcgaaca 24660 ggacgcccaa atagacagac ttattaatgg ccgtttgaca acactaaatg cttttgttgc 24720 acagcagctt gttcgttctg aatcagctgc tctttccgct caattggcta aagataaagt 24780 caatgagtgt gtcaaggcac aatccaagcg ttctggattt tgcggtcaag gcacacatat 24840 agtgtccttt gttgtaaatg cccctaatgg cctttacttt atgcatgttg gttattaccc 24900 tagcaaccac attgaggttg tttctgctta tggtctttgc gatgcagcta accctactaa 24960 ttgtatagcc cctgttaatg gctactttat taaaactaat aacactagga ttgttgatga 25020 gtggtcatat actggctcgt ccttctatgc acctgagccc atcacctctc ttaatactaa 25080 gtatgttgca ccacaggtga cataccaaaa catttctact aacctccctc ctcctcttct 25140 cggcaattcc accgggattg acttccaaga tgagttggat gagtttttca aaaatgttag 25200 caccagtata cctaattttg gttctctaac acagattaat actacattac tcgatcttac 25260 ctacgagatg ttgtctcttc aacaagttgt taaagccctt aatgagtctt acatagacct 25320 taaagagctt ggcaattata cttattacaa caaatggccg tggtacattt ggcttggttt 25380 cattgctggg cttgttgcct tagctctatg cgtcttcttc atactgtgct gcactggttg 25440 tggcacaaac tgtatgggaa aacttaagtg taatcgttgt tgtgatagat acgaggaata 25500 cgacctcgag ccgcataagg ttcatgttca ctaattaacg aactatcaat gagagttcaa 25560 agaccaccca ctctcttgtt agtgttctca ctctcttttt tggtcactgc attttcaaaa 25620 cctctctatg tacctgagca ttgtcagaat tattctggtt gcatgcttag ggcttgtatt 25680 aaaactgccc aagctgatac agctggtctt tatacaaatt ttcgaattga tgtcccatct 25740 gcagaatcaa ctggtactca atcagtttct gtcgatcgtg agtctacttc aactcatgat 25800 ggtcttaccg aacatgttac tagtgtgaat ctttttgacg ttggttactc agttaattaa 25860 cgaactctat ggattacgtg tctctgctta atcaaatttg gcagaagtac cttaattcac 25920 cgtatactac ttgtttgtat atccctaaac ccacagctaa gtatacacct ttagttggca 25980 cttctttgca ccctgtgctg tggaactgtc agctatcctt tgctggttat actgaatctg 26040 ctgttaattc tacaaaagct ttggccaaac aggacgcagc tcagcgaatc gcttggttgc 26100 tacataagga tggaggaatc cctgatggat gttccctcta cctccggcac tcaagtttat 26160 tcgcgcaaag cgaggaagag gagtcattct ccaactaaga aactgcgcta cgttaagcgt 26220 agattttctc ttctgcgccc tgaagacctt agtgttattg tccaaccaac acactatgtc 26280 agggttacat tttcagaccc caacatgtgg tatctacgtt cgggtcatca tttacactca 26340 gttcacaatt ggcttaaacc ttatggcggc caacctgttt ctgagtacca tattactcta 26400 gctttgctaa atctcactga tgaagattta gctagagatt tttcacccat tgcgctcttt 26460 ttgcgcaatg tcagatttga gctacatgag ttcgccttgc tgcgcaaaac tcttgttctt 26520 aatgcatcag agatctactg tgctaacata catagattta agcctgtgta tagagttaac 26580 acggcaatcc ctactattaa ggattggctt ctcgttcagg gattttccct ttaccatagt 26640 ggcctccctt tacatatgtc aatctctaaa ttgcatgcac tggatgatgt tactcgcaat 26700 tacatcatta caatgccatg ctttagaact tatcctcaac aaatgtttgt tactcctttg 26760 gccgtagatg ttgtctccat acggtcttcc aatcagggta ataaacaaat tgttcattct 26820 taccccattt tacatcatcc aggattttaa cgaactatgg ctttctcggc gtctttattt 26880 aaacccgtcc agctagtccc agtttctcct gcatttcatc gcattgagtc tactgactct 26940 attgttttca catacattcc tgctagcggc tatgtagctg ctttagctgt caatgtgtgt 27000 ctcattcccc tattattact gctacgtcaa gatacttgtc gtcgcagcat tatcagaact 27060 atggttctct atttccttgt tctttataac tttttattag ccattgtact agtcaatggt 27120 gtacattatc caactggaag ttgcctgata gccttcttag ttatcctcat aatactttgg 27180 tttgtagata gaattcgttt ctgtctcatg ctgaattcct acattccact gtttgacatg 27240 cgttctcact ttattcgtgt tagtacagtt tcttctcatg gtatggtccc tgtcatacac 27300 accaaaccat tatttattag aaacttcgat cagcgttgca gctgttctcg ttgtttttat 27360 ttgcactctt ctacttatat agagtgcact tatattagcc gttttagtaa gattagccta 27420 gtttctgtaa ctgacttctc cttaaacggc aatgtttcca ctgttttcgt gcctgcaacg 27480 cgcgattcag ttcctcttca cataatcgcc ccgagctcgc ttatcgttta agcagctctg 27540 cgctactatg ggtcccgtgt agaggctaat ccattagtct ctctttggac atatggaaaa 27600 cgaactatgt taccctttgt ccaagaacga atagggttgt tcatagtaaa ctttttcatt 27660 tttaccgtag tatgtgctat aacactcttg gtgtgtatgg ctttccttac ggctactaga 27720 ttatgtgtgc aatgtatgac aggcttcaat accctgttag ttcagcccgc attatacttg 27780 tataatactg gacgttcagt ctatgtaaaa ttccaggata gtaaaccccc tctaccacct 27840 gacgagtggg tttaacgaac tccttcataa tgtctaatat gacgcaactc actgaggcgc 27900 agattattgc cattattaaa gactggaact ttgcatggtc cctgatcttt ctcttaatta 27960 ctatcgtact acagtatgga tacccatccc gtagtatgac tgtctatgtc tttaaaatgt 28020 ttgttttatg gctcctatgg ccatcttcca tggcgctatc aatatttagc gccatttatc 28080 caattgatct agcttcccag ataatctctg gcattgtagc agctgtttca gctatgatgt 28140 ggatttccta ctttgtgcag agtatccggc tgtttatgag aactggatca tggtggtcat 28200 tcaatcctga gactaattgc cttttgaatg ttccaattgg tggtacaact gtcgtacgtc 28260 cactcgtaga ggactctacc agtgtaactg ctgttgtaac caatggtcac ctcaaaatgg 28320 ctggcatgca tttcggtgct tgtgactacg acagacttcc taatgaagtc accgtggcca 28380 aacccaatgt gctgattgct ttaaaaatgg tgaagcggca aagctacgga actaattccg 28440 gcgttgccat ttaccataga tataaggcag gtaattacag gagtccgcct attacggcgg 28500 atattgaact tgcattgctt cgagcttagg ctctttagta agagtatctt aattgatttt 28560 aacgaatctc aatttcattg ttatggcatc ccctgctgca cctcgtgctg tttcctttgc 28620 cgataacaat gatataacaa atacaaacct gtctcgaggt agaggacgta atccaaaacc 28680 acgagctgca ccaaataaca ctgtctcttg gtacactggg cttacccaac acgggaaagt 28740 ccctcttacc tttccacctg ggcagggtgt acctcttaat gccaattcca cccctgcgca 28800 aaatgctggg tattggcgga gacaggacag aaaaattaat accgggaatg gaattaagca 28860 actggctccc aggtggtact tctactacac tggaactgga cccgaagcag cactcccatt 28920 ccgggctgtt aaggatggca tcgtttgggt ccatgaagat ggcgccactg atgctccttc 28980 aacttttggg acgcggaacc ctaacaatga ttcagctatt gttacacaat tcgcgcccgg 29040 tactaagctt cctaaaaact tccacattga ggggactgga ggcaatagtc aatcatcttc 29100 aagagcctct agcgtaagca gaaactcttc cagatctagt tcacaaggtt caagatcagg 29160 aaactctacc cgcggcactt ctccaggtcc atctggaatc ggagcagtag gaggtgatct 29220 actttacctt gatcttctga acagactaca agcccttgag tctggcaaag taaagcaatc 29280 gcagccaaaa gtaatcacta agaaagatgc tgctgctgct aaaaataaga tgcgccacaa 29340 gcgcacttcc accaaaagtt tcaacatggt gcaagctttt ggtcttcgcg gaccaggaga 29400 cctccaggga aactttggtg atcttcaatt gaataaactc ggcactgagg acccacgttg 29460 gccccaaatt gctgagcttg ctcctacagc cagtgctttt atgggtatgt cgcaatttaa 29520 acttacccat cagaacaatg atgatcatgg caaccctgtg tacttccttc ggtacagtgg 29580 agccattaaa cttgacccaa agaatcccaa ctacaataag tggttggagc ttcttgagca 29640 aaatattgat gcctacaaaa ccttccctaa gaaggaaaag aaacaaaagg caccaaaaga 29700 agaatcaaca gaccaaatgt ctgaacctcc aaaggagcag cgtgtgcaag gtagcatcac 29760 tcagcgcact cgcacccgtc caagtgttca gcctggtcca atgattgatg ttaacactga 29820 ttagtgtcac tcaaagtaac aagatcgcgg caatcgtttg tgtttggtaa ccccatctca 29880 ccatcgcttg tccactcttg cacagaatgg aatcatgttg taattacagt gcaataaggt 29940 aattataacc catttaattg atagctatgc tttattaaag tgtgtagctg tagagagaat 30000 gttaaagact gtcacctctg cgtgattgca agtgaacagt gccccccggg aagagctcta 30060 cagtgtgaaa tgtaaataaa aaatagctat tattcaatta gattaggcta attagatgat 30120 ttgcaaaaaa aaaaaaaaaa aaaaaaaaaa atggccggca tggtcccagc ctcctcgctg 30180 gcgccggctg ggcaacattc cgaggggacc gtcccctcgg taatggcgaa tgggacccat 30240 aactagcata accccttggg gcctctaaac gggtcttgag gggtttt 30287 <110> KRICT <120> South Korean strain Middle East Respiratory syndrome coronavirus Infectious mutated gene and use thereof <130> M19-5962-v0307 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 30287 <212> DNA <213> Artificial Sequence <220> <223> South Korean strain Middle East Respiratory syndrome coronavirus Infectious mutated gene <400> 1 taatacgact cactatagat ttaagtgaat agcttggcta tctcacttcc cctcgttctc 60 ttgcagaact ttgattttaa cgaacttaaa taaaagccct gttgtttagc gtattgttgc 120 acttgtctgg tgggattgtg gcattaattt gcctgctcat ctaggcagtg gacatatgct 180 caacactggg tataattcta attgaatact atttttcagt tagagcgtcg tgtctcttgt 240 acgtctcggt cacaatatac ggtttcgtcc ggtgcgtggc aattcggggc acatcatgtc 300 tttcgtggct ggtgtgatcg cgcaaggtgc gcgcggtacg tatcgagcag cgctcaactc 360 tgaaaaacat caagaccatg tgtctctaac tgtgccactc tgtggttcag gaaacctggt 420 tgaaaaactt tcaccatggt tcatggatgg cgaaaatgcc tatgaagtgg tgaaggccat 480 gttacttaaa aaagagccac ttctctatgt gcccatccgg ctggctggac acactagaca 540 cctcccaggt cctcgtgtgt acctggttga gaggctcatt gcttgtgaaa atccattcat 600 ggttaaccaa ttggcttata gctctagtgc aaatggcagc ctggttggca caactttgca 660 gggcaagcct attggtatgt tcttccctta tgacatcgaa cttgtcacag gaaagcaaaa 720 tattctcctg cgcaagtatg gccgtggtgg ttatcactac accccagtcc actatgagcg 780 agacaacacc tcttgccctg agtggatgga cgattttgag gcggatccta aaggcaaata 840 tgcccagaat ctgcttaaga agttgattgg cggtgatgtc actccagttg accaatacat 900 gtgtggcgtt gatggaaaac ccattagtgc ctacgcattt ttaatggcca aggatggaat 960 aaccaaactg gctgatgttg aagcggacgt cgcagcacgt gctgatgacg aaggcttcat 1020 cacattaaag aacaatctat atagattggt ttggcatgtt gagcgtaaag acgttccata 1080 tcctaagcaa tctattttta ctattaatag tgtggtccaa aaggatggtg ttgaaaacac 1140 tcctcctcac tattttactc ttggatgcaa aattttaacg ctcaccccac gcaacaagtg 1200 gagtggcgtt tctgacttgt ccctcaaaca aaaactcctt tacaccttct atggtaagga 1260 gtcacttgag aacccaacct acatttacca ctccgcattc attgagtgtg gaagttgtgg 1320 taatgattcc tggcttacag ggaatgctat ccaagggttt gcctgtggat gtggggcatc 1380 atatacagct aatgatgtcg aagtccaatc atctggcatg attaagccaa atgctcttct 1440 ttgtgctact tgcccctttg ctaagggtga cagctgttct tctaattgca aacattcagt 1500 tgctcagttg gttagttacc tttctgaacg ctgtaatgtt attgctgatt ctaagtcctt 1560 cacacttatc tttggtggcg tagcttacgc ctactttgga tgtgaggaag gtactatgta 1620 ctttgtgcct agagctaagt ctgttgtctc aaggattgga gactccatct ttacaggctg 1680 tactggctct tggaacaagg tcactcaaat tgctaacatg ttcttggaac agactcagca 1740 ttcccttaac tttgtgggag agttcgttgt caacgatgtt gtcctcgcaa ttctctctgg 1800 aaccacaact aatgttgaca aaatacgcca gcttctcaaa ggtgtcacca ttgacaagtt 1860 gcgtgattat ttagctgact atgacgtagc agtcactgcc ggcccattca tggataatgc 1920 tattaatgtt ggtggtacag gattacagta tgccgccatt actgcacctt atgtagttct 1980 cactggctta ggtgagtcct ttaagaaagt tgcaaccata ccgtacaagg tttgcaactc 2040 tgttaaggat actctgactt attatgctca cagcgtgttg tacagagttt ttccttatga 2100 catggattct ggtgtgtcat cctttagtga actacttttt gattgcgttg atctttcagt 2160 agcttctacc tattttttag tccgcctctt gcaagataag actggcgact ttatgtctac 2220 aattattact tcctgccaaa ctgctgttag taagcttcta gatacatgtt ttgaagctac 2280 agaagcaaca tttaacttct tgttagattt ggcaggattg ttcagaatct ttcttcgcaa 2340 tgcctatgtg tacacttcac aagggtttgt ggtggtcaat ggcaaagttt ctacacttgt 2400 caaacaagtg ttagacttgc ttaataaggg tatgcaactt ttgcatacaa aggtctcctg 2460 ggctggttct aatatcagtg ctgttatcta cagcggcagg gagtctctaa tattcccatc 2520 gggaacctat tactgtgtca ccactaaggc taagtccgtt caacaagatc ttgacgttat 2580 tttgcctggt gagttttcca agaagcagtt aggactgctc caacctactg acaattctac 2640 aactgttagt gttactgtat ccagtaacat ggttgaaact gttgtgggtc aacttgagca 2700 aactaatatg catagtcctg atgttatagt aggtgactat gtcattatta gtgaaaaatt 2760 gtttgtgcgt agtaaggaag aagacggatt cgccttctac cctgcttgca ctaatggtca 2820 tgctgtaccg actctcttta gacttaaggg aggtgcacct gtaaagaaag tagcctttgg 2880 cggtgatcaa gtacatgagg ttgctgctgt aagaagtgtt actgtcgagt acaacattca 2940 tgctgtatta gacacactac ttgcttcttc tagtcttaga acctttgttg tagataagtc 3000 tttgtcaatt gaggagtttg ctgacgtagt aaaggaacaa gtctcagact tgcttgttaa 3060 attactgcgt ggaatgccga ttccagattt tgatttagac gattttattg acgcaccatg 3120 ctattgcttt aacgctgagg gtgatgcatc ttggtcttct actatgatct tctctcttca 3180 ccccgtcgag tgtgacgagg agtgttctga agtagaggct tcaggtttag aagaaggtga 3240 atcagagtgc atttctgaga cttcaactga acaagttgac gtttctcatg aggtttctga 3300 cgacgagtgg gctgctgcag ttgatgaagc gttccccctc gatgaagcag aagatgttac 3360 tgaatctgtg caagaagaag cacaaccagt agaagtacct gttgaagata ttgcgcaggt 3420 tgtcatagct gacaccttac aggaaactcc tgttgtgtct gatactgttg aagtcccacc 3480 gcaagtggtg aaacttccgt ctgaacctca gactatccag cccgaggtaa aagaagttgc 3540 acctgtctat gaggctgata ccgaacagac acagagtgtt actgttaaac ctaagaggtt 3600 acgcaaaaag cgtaatgttg accctttgtc caattttgaa cataaggtta ttacagagtg 3660 cgttaccata gttttaggtg acgcaattca agtagccaag tgctatgggg agtctgtgtt 3720 agttaatgct gctaacacac atcttaagca tggcggtggt atcgctggtg ctattaatgc 3780 ggcttcaaaa ggggctgtcc aaaaagagtc agatgagtat attctggcta aagggccgtt 3840 acaagtagga gattcagttc tcttgcaagg ccattctcta gctaagaata tcctgcatgt 3900 cgtaggccca gatgcccgcg ctaaacagga tgtttctctc cttagtaagt gctataaggc 3960 tatgaatgca tatcctcttg tagtcactcc tcttgtttca acaggcatat ttggtgtaaa 4020 accagctgtg tcttttgatt atcttattag agaggctaag actagagttt tagtcgtcgt 4080 taattcccaa gatgtctata agagtcttac catagttgac attccacaga gtttgacttt 4140 ttcatatgat gggttacgtg gcgcaatacg taaagctaaa gattatggtt ttactgtttt 4200 tgtgtgcaca gacaactctg ctaacactaa agttcttagg aacaagggtg ttgattatac 4260 taagaagttt cttacagttg acggtgtgca atattattgc tacacgtcta aggacacttt 4320 agatgatatc ttacaacagg ctaataagtc tgttggtatt atatctatgc ctttgggata 4380 tgtgtctcat ggtttagact taattcaagc agggagtgtc gtgcgtagag ttaacgtgcc 4440 ctacgtgtgt ctcctagcta ataaagagca agaagctatt ttgatgtctg aagacgttaa 4500 gttaaaccct tcagaagatt ttataaagca cgtccgcact aatggtggtt acaattcttg 4560 gcatttagtc gagggtgaac tattggtgca agacttacgc ttaaataagc tcctgcattg 4620 gtctgatcaa accatatgct acaaggatag tgtgttttat gttgtaaaga atagtacagc 4680 ttttccattt gaaacacttt cagcatgtcg tgcgtatttg gattcacgca cgacacagca 4740 gttaacaatc gaagtcttag tgactgtcga tggtgtaaat tttagaacag tcgttctaaa 4800 taataagaac acttatagat cacagcttgg atgcgttttc tttaatggtg ctgatatttc 4860 tgataccatt cctgatgaga aacagaatgg tcacagttta tatctagcag acaatttgac 4920 tgctgatgaa acaaaggcgc ttaaagagtt atatggcccc gttgatccta ctttcttaca 4980 cagattctat tcacttaagg ctgcagtcca taagtggaag atggttgtgt gtgataaggt 5040 acgttctctc aaattgagtg ataataattg ttatcttaat gcagttatta tgacacttga 5100 tttattgaag gacattaaat ttgttatacc tgctctacag catgcattta tgaaacataa 5160 gggcggtgat tcaactgact tcatagccct cattatggct tatggcaatt gcacatttgg 5220 tgctccagat gatgcctctc ggttacttca taccgtgctt gcaaaggctg agttatgctg 5280 ttctgcacgc atggtttgga gagagtggtg caatgtctgt ggcataaaag atgttgttct 5340 acaaggctta aaagcttgtt gttacgtggg tgtgcaaact gttgaagatc tgcgtgctcg 5400 catgacatat gtatgccagt gtggtggtga acgtcatcgg caaatagtcg aacacaccac 5460 cccctggttg ctgctctcag gcacaccaaa tgaaaaattg gtgacaacct ccacggcgcc 5520 tgattttgta gcgtttaatg tctttcaggg cattgaaacg gctgttggcc attatgttca 5580 tgcttgcctg aagggtggtc ttattttaaa gtttgactct ggcaccgtta gcaagacttc 5640 agactggaag tgcaaggtga cagatgtact tttccccggc caaaaataca gtagcgattg 5700 taatgtcgta cggtattctt tggacggtaa tttcagaaca gaggttgatc ccgacctatc 5760 tgctttctat gttaaggatg gtaaatactt tacaagtgaa ccacccgtaa catattcacc 5820 agctacaatt ttagctggta gtgtctacac taatagctgc cttgtatcgt ctgatggaca 5880 acctggcggt gatgctatta gtttgagttt taataacctt ttagggtttg attctagtaa 5940 accagtcact aagaaataca cttactcctt cttgcctaaa gaagacggcg atgtgttgtt 6000 ggctgagttt gacacttatg accctattta taagaatggt gccatgtata aaggcaaacc 6060 aattctttgg gtcaacaaag catcttatga tactaatctt aataagttca atagagctag 6120 tttgcgtcaa atttttgacg tagcccccat tgaactcgaa aataaattca cacctttgag 6180 tgtggcgtcc acaccagttg aacctccaac tgtagatgtg gtagcacttc aacaggaaat 6240 gacaattgtc aaatgtaagg gtttaaataa acctttcgtg aaggacaatg tcagtttcgt 6300 tgctgatgac tcaggtactc ccgttgttga gtatctgtct aaagaagatc tacatacatt 6360 gtatgtagac cctaagtatc aagtcattgt cttaaaagac aatgtacttt cttctatgct 6420 tagattgcac accgttgagt caggtgatat taacgttgtt gcagcttccg gatctttgac 6480 acgtaaagtg aagttactat ttagggcttc attttatttc aaagaatttg ctacccgcac 6540 tttcactgct accactgctg taggtagttg tataaagagt gtagtgcggc atctaggtgt 6600 tactaaaggc atattgacag gctgttttag ttttgtcaag atgttattta ttcttccact 6660 agcttacttt agtgattcaa aactcggcac cacagaggtt aaagtgagtg ctttgaaaac 6720 agctggcgtt gtgacaggta atgttgtaaa acagtgttgc actgctgctg ttgatttaag 6780 tatggataag ttgcgccgtg tggattggaa atcaacccta cggttgttac ttatgttatg 6840 cacaactatg gtattgttgt cttctgtgta tcacttgtat gtcttcaatc aggtcttatc 6900 aagtgatgtt atgtttgaag atgcccaagg tttgaaaaag ttctacaaag aagttagagc 6960 ttacctagga atctcttctg cttgtgacgg tcttgcttca gcttataggg cgaattcatt 7020 tgatgtacct acattctgcg caaaccgttc tgcaatgtgt aattggtgct tgattagcca 7080 agattccata actcactacc cagctcttaa gatggttcaa acacatctta gccactatgt 7140 tcttaacata gattggttgt ggtttgcatt cgagactggt ttggcataca tgctctatac 7200 ctcggccttc aactggttgt tgttggcagg tacattgcat tatttctttg cacagacttc 7260 catatttgta gactggcggt catacaatta tgctgtgtct agtgccttct ggttatttac 7320 ccacattcca atggcgggtt tggtacgaat gtataatttg ttagcatgcc tttggctttt 7380 acgcaagttt tatcagcatg taatcaatgg ttgcaaagat acggcatgct tgctctgcta 7440 taagaggaac cgacttacta gagttgaagc ttctaccgtt gtctgtggtg gaaaacgtac 7500 gttttatatc acagcaaatg gcggtatttc attctgtcgt aggcataatt ggaattgtgt 7560 ggattgtgac attgcaggtg tggggaatac cttcatctgt gaagaagtcg caaatgacct 7620 cactaccgcc ctacgcaggc ctattaacgc tacggataga tcacattatt atgtggattc 7680 cgttacagtt aaagagactg ttgttcagtt taattatcgt agagacggtc aaccattcta 7740 cgagcggttt cccctctgcg cttttacaaa tctagataag ttgaagttca aagaggtctg 7800 taaaactact actggtatac ctgaatacaa ctttatcatc tacgactcat cagatcgtgg 7860 ccaggaaagt ttagctaggt ctgcatgtgt ttattattct caagtcttgt gtaaatcaat 7920 tcttttggtt gactcaagtt tggttacttc tgttggtgat tctagtgaaa tcgccactaa 7980 aatgtttgat tcctttgtta atagtttcgt ctcgctgtat aatgtcacac gcgataagtt 8040 ggaaaaactt atctctactg ctcgtgatgg cgtaaggcga ggcgataact tccatagtgt 8100 cttaacaaca ttcattgacg cagcacgagg ccccgcaggt gtggagtctg atgttgagac 8160 caatgaaatt gttgactctg tgcagtatgc tcataaacat gacatacaaa ttactaatga 8220 gagttacaat aattatgtac cctcatatgt taaacctgat agtgtgtcta ccagtgattt 8280 aggtagtctc attgattgta atgcggcttc agttaaccaa attgtcttgc gtaattctaa 8340 tggtgcttgt atttggaacg ctgctgcata tatgaaactc tcggatgcac ttaaacgaca 8400 gattcgcatt gcatgccgta agtgtaattt agctttccgg ttaaccacct caaagctacg 8460 cgctaatgat aatatcttat cagttagatt cactgctaac aaaattgttg gtggtgctcc 8520 tacatggttt aatgtgttgc gtgactttac gttaaagggt tacgttcttg ctaccattat 8580 tgtgtttctg tgtgctgtac tgatgtattt gtgtttacct acattttcta tggtacctgt 8640 tgaattttat gaagaccgca tcttggactt taaagttctt gataatggta tcattaggga 8700 tgtaaatcct gatgataagt gctttgctaa taagcaccgg tccttcacac aatggtatca 8760 tgagcatgtt ggtggtgtct atgacaactc tatcacatgc ccattgacag ttgcagtaat 8820 tgctggagtt gctggtgctc gcattccaga cgtacctact acattggctt gggtgaacaa 8880 tcagataatt ttctttgttt ctcgagtctt tgctaataca ggcagtgttt gctacactcc 8940 tatagatgag ataccctata agagtttctc tgatagtggt tgcattcttc catctgagtg 9000 cactatgttt agggatgcag agggccgtat gacaccatac tgccatgatc ctactgtttt 9060 gcctggggct tttgcgtaca gtcagatgag gcctcatgtt cgttacgact tgtatgatgg 9120 taacatgttt attaaatttc ctgaagtagt atttgaaagt acacttagga ttactagaac 9180 tctgtcaact cagtactgcc ggttcggtag ttgtgagtat gcacaagagg gtgtttgtat 9240 taccacaaat ggctcgtggg ccatttttaa tgaccaccat cttaatagac ctggtgtcta 9300 ttgtggctct gattttattg acattgtcag gcggttagca gtatcactgt tccagcctat 9360 tacttatttc caattgacta cctcattggt cttgggtata ggtttgtgtg cattcctgac 9420 tttgctcttc tattatatta ataaagtaaa acgtgctttt gcagattaca cccagtgtgc 9480 tgtaattgct gttgttgctg ctgttcttaa tagcttgtgc atctgctttg ttgcctctat 9540 accattgtgt atagtacctt acactgcatt gtactattat gctacattct attttactaa 9600 tgagcctgca tttattatgc atgtttcttg gtacattatg ttcgggccta tcgttcccat 9660 atggatgacc tgcgtctata cagttgcaat gtgctttaga cacttcttct gggttttagc 9720 ttattttagt aagaaacatg tagaagtttt tactgatggt aagcttaatt gtagtttcca 9780 ggacgctgcc tctaatatct ttgttattaa caaggacact tatgcagctc ttagaaactc 9840 tttaactaat gatgcctatt cacgattttt ggggttgttt aacaagtata agtacttctc 9900 tggtgctatg gaaacagccg cttatcgtga agctgcagca tgtcatcttg ctaaagcctt 9960 acaaacatac agtgagactg gtagtgatct tctttaccaa ccacccaact gtagcataac 10020 ctctggcgtg ttgcaaagcg gtttggtgaa aatgtcacat cccagtggag atgttgaggc 10080 ttgtatggtt caggttacct gcggtagcat gactcttaat ggtctttggc ttgacaacac 10140 agtctggtgc ccacgacacg taatgtgccc ggctgaccag ttgtctgatc ctaattatga 10200 tgccttgttg atttctatga ctaatcatag tttcagtgtg caaaaacaca ttggcgctcc 10260 agcaaacttg cgtgttgttg gtcatgccat gcaaggcact cttttgaagt tgactgtcga 10320 tgttgctaac cctagcactc cagcctacac ttttacaaca gtgaaacctg gcgcagcatt 10380 tagtgtgtta gcatgctata atggtcgtcc gactggtaca ttcactgttg taatgcgccc 10440 taactacaca attaagggtt cctttctgtg tggttcttgt ggtagtgttg gttacaccaa 10500 ggagggtagt gtgatcaatt tttgttacat gcatcaaatg gaacttgcta atggtacaca 10560 taccggttca gcatttgatg gtactatgta tggtgccttt atggataaac aagtgcacca 10620 agttcagtta acagacaaat actgcagtgt taatgtagta gcttggcttt acgcagcaat 10680 acttaatggt tgcgcttggt ttgtaaaacc taatcgcact agtgttgttt cttttaatga 10740 atgggctctt gccaaccaat tcactgaatt tgttggcact caatccgttg acatgttagc 10800 tgtcaaaaca ggcgttgcta ttgaacagct gctttatgcg atccaacaac tttatactgg 10860 gttccaggga aagcaaatcc ttggcagtac tatgttggaa gatgaattca cacctgagga 10920 tgttaatatg cagattatgg gtgtggttat gcagagtggt gtgagaaaag ttacatatgg 10980 tactgcgcat tggttgttcg cgacccttgt ttcaacctat gtgataatct tacaagccac 11040 taaatttact ttgtggaact acttgtttga gactattccc acacagttgt tcccactctt 11100 atttgtgact atggccttcg ttatgttgtt ggttaaacac aaacacacct ttttgacact 11160 tttcttgttg cctgtggcta tttgtttgac ttatgcaaac atagtctacg agcccactac 11220 tcccatttcg tcagcgctga ttgcagttgc aaattggctt gcccccacta atgcttatat 11280 gcgtactaca catactgata ttggtgtcta cattagtatg tcacttgtat tagtcattgt 11340 agtgaagaga ttgtacaacc catcactttc taactttgcg ttagcattgt gcagtggtgt 11400 aatgtggttg tacacttata gcattggaga agcctcaagc cccattgcct atctggtttt 11460 tgtcactaca ctcactagtg attatacgat tacagtcttt gttactgtca accttgcaaa 11520 agtttgcact tatgccatct ttgcttactc accacagctt acacttgtgt ttccggaagt 11580 gaagatgata cttttattat acacatgttt aggtttcatg tgtacttgct attttggtgt 11640 cttctctttt ttgaacctta agcttagagc acctatgggt gtctatgact ttaaggtctc 11700 aacacaagag ttcagattca tgactgctaa caatctaact gcacctagaa attcttggga 11760 ggctatggct ctgaacttta agttaatagg tattggcggt acaccttgta taaaggttgc 11820 tgctatgcag tctaaactta cagatcttaa atgcacatct gtggttctcc tctctgtgct 11880 ccaacagtta cacttagagg ctaatagtag ggcctgggct ttctgtgtta aatgccataa 11940 tgacatattg gcagcaacag accccagtga ggctttcgag aaattcgtaa gtctctttgc 12000 cactttaatg actttttctg gtaatgtaga tcttgatgcg ttagctagtg atatttttga 12060 cactcctagc gtacttcaag ctactctttc tgagttttca cacttagcta cctttgctga 12120 gttggaagct gcgcagaaag cctatcagga agctatggac tctggtgaca cctcaccaca 12180 agttcttaag gctttgcaga aggctgttaa tatagctaaa aacgcctatg agaaggataa 12240 ggcagtggcc cgtaagttag aacgtatggc tgatcaggct atgacttcta tgtataagca 12300 agcacgtgct gaagacaaga aagcaaaaat tgtcagtgct atgcaaacta tgttgtttgg 12360 tatgattaag aagctcgaca acgatgttct taatggtatc atttctaacg ctaggaatgg 12420 ttgtatacct cttagtgtca ttccactgtg tgcttcaaat aaacttcgcg ttgtaattcc 12480 tgacttcacc gtctggaatc aggtagtcac atatccctcg cttaactacg ctggggcttt 12540 gtgggacatt acagttataa acaatgtgga caatgaaatt gttaagtctt cagatgttgt 12600 agacagcaat gaaaatttaa catggccact tgttttagaa tgcactaggg catccacttc 12660 tgccgttaag ttgcaaaata atgagatcaa accttcaggt ttaaaaacca tggttgtgtc 12720 tgcaggtcaa gagcaaacta actgtaatac tagttcctta gcttattacg aacctgtgca 12780 gggtcgtaaa atgctgatgg ctcttctttc tgataatgcc tatctcaaat gggcgcgtgt 12840 tgaaggtaag gacggatttg ttagtgtaga gctacaacct ccttgcaaat tcttgattgc 12900 gggaccaaaa ggacctgaaa tccgatatct ctattttgtt aaaaatctta acaaccttca 12960 tcgcgggcaa gtgttagggc acattgctgc gactgttaga ttgcaagctg gttctaacac 13020 agcttatctc gatttcgtca atgcgggagg tgccccattg acaaattgtg ttaagatgct 13080 tactcctaaa actggtacag gtatagctat atctgttaaa ccagagagta cagctgatca 13140 agagacttat ggtggagctt cagtgtgtct ctattgccgt gcgcatatag aacatcctga 13200 tgtctctggt gtttgtaaat ataagggtaa gtttgtccaa atccctgctc agtgtgtccg 13260 tgaccctgtg ggattttgtt tgtcaaatac cccctgtaat gtctgtcaat attggattgg 13320 atatgggtgc aattgtgact cgcttaggca agtagcactg ccccaatcta aagattccaa 13380 ttttttaaac gagtccgggg ttctattgta aatgcccgaa tagaaccctg ttcaagtggt 13440 ttgtccactg atgtcgtctt tagggcattt gacatctgca actataaggc taaggttgct 13500 ggtattggaa aatactacaa gactaatact tgtaggtttg tagaattaga tgaccaaggg 13560 catcatttag actcctattt tgtcgttaag aggcatacta tggagaatta tgaactagag 13620 aagcactgtt acgatttgtt acgtgactgt gatgctgtag ctccccatga tttcttcatc 13680 tttgatgtag acaaagttaa aacacctcat attgtacgtc agcgtttaac tgagtacact 13740 atgatggatc ttgtatatgc cctgaggcac tttgatcaaa atagcgaagt gcttaaggct 13800 atcttagtga agtatggttg ctgtgatgtt acctactttg aaaataaact ctggtttgat 13860 tttgttgaaa atcccagtgt tattggtgtt tatcataaac ttggagaacg tgtacgccaa 13920 gctatcttaa acactgttaa attttgtgac cacatggtca aggctggttt agtcggtgtg 13980 ctcacactag acaaccagga ccttaatggc aagtggtatg attttggtga cttcgtaatc 14040 actcaacctg gttcaggagt agctatagtt gatagctact attcttattt gatgcctgtg 14100 ctctcaatga ccgattgtct ggccgctgag acacataggg attgtgattt taataaacca 14160 ctcattgagt ggccacttac tgagtatgat tttactgatt ataaggtaca actctttgag 14220 aagtacttta aatattggga tcagacgtat cacgcaaatt gcgttaattg tactgatgac 14280 cgttgtgtgt tacattgtgc taatttcaat gtattgtttg ctatgaccat gcctaagact 14340 tgtttcggac ccatagtccg aaagatcttt gttgatggcg tgccatttgt agtatcttgt 14400 ggttatcact acaaagaatt aggtttagtc atgaatatgg atgttagtct ccatagacat 14460 aggctctctc ttaaggagtt gatgatgtat gccgctgatc cagccatgca cattgcctcc 14520 tctaacgctt ttcttgattt gaggacatca tgttttagtg tcgctgcact tacaactggt 14580 ttgacttttc aaactgtgcg gcctggcaat tttaaccaag acttctatga tttcgtggta 14640 tctaaaggtt tctttaagga gggctcttca gttacgctca aacatttttt ctttgctcaa 14700 gatggtaatg ctgctattac agattataat tactattctt ataatctgcc tactatgtgt 14760 gacatcaaac aaatgttgtt ctgcatggaa gttgtaaaca agtacttcga aatctatgac 14820 ggtggttgtc ttaatgcttc tgaagtggtt gttaataatt tagacaagag tgctggccat 14880 ccttttaata agtttggcaa agctcgtgtc tattatgaga gcatgtctta ccaggagcaa 14940 gatgaactct ttgccatgac aaagcgtaac gtcattccta ccatgactca aatgaatcta 15000 aaatatgcta ttagtgctaa gaatagagct cgcactgttg caggcgtgtc catacttagc 15060 acaatgacta atcgccagta ccatcagaaa atgcttaagt ccatggctgc aactcgtgga 15120 gcgacttgcg tcattggtac tacaaagttc tatggtggct gggatttcat gcttaaaaca 15180 ttgtacaaag atgttgataa tccgcatctt atgggttggg attaccctaa gtgtgataga 15240 gctatgccta atatgtgtag aatcttcgct tcactcatat tagctcgtaa acatggcact 15300 tgttgtacta caagggacag attttatcgc ttggcaaatg agtgtgctca ggtgctaagc 15360 gaatatgttc tatgtggtgg tggttactac gtcaaacctg gaggtaccag tagcggagat 15420 gccaccactg catatgccaa tagtgtcttt aacattttgc aggcgacaac tgctaatgtc 15480 agtgcactta tgggtgctaa tggcaacaag attgttgaca aagaagttaa agacatgcag 15540 tttgatttgt atgtcaatgt ttacaggagc actagcccag accccaaatt tgttgataaa 15600 tactatgctt ttcttaataa gcacttttct atgatgatac tgtctgatga cggtgtcgtt 15660 tgctataata gtgattatgc agctaagggt tacattgctg gaatacagaa ttttaaggaa 15720 acgctgtatt atcagaacaa tgtctttatg tctgaagcta aatgctgggt ggaaaccgat 15780 ctgaagaaag ggccacatga attctgttca cagcatacgc tttatattaa ggatggcgac 15840 gatggttact tccttcctta tccagaccct tcaagaattt tgtctgccgg ttgctttgta 15900 gatgatatcg ttaagactga cggtacactc atggtagagc ggtttgtgtc tttggctata 15960 gatgcttacc ctctcacaaa gcatgaagat atagaatacc agaatgtatt ctgggtctac 16020 ttacagtata tagaaaaact gtataaagac cttacaggac acatgcttga cagttattct 16080 gtcatgctat gtggtgataa ttctgctaag ttttgggaag aggcattcta cagagatctc 16140 tatagttcgc ctaccacttt gcaggctgtc ggttcatgcg ttgtatgcca ttcacagact 16200 tccctacgct gtgggacatg catccgtaga ccatttctct gctgtaaatg ctgctatgat 16260 catgttatag caactccaca taagatggtt ttgtctgttt ctccttacgt ttgtaatgcc 16320 cctggttgtg gcgtttcaga cgttactaag ctatatttag gtggtatgag ctacttttgt 16380 gtagatcata gacctgtgtg tagttttcca ctttgcgcta atggtcttgt attcggctta 16440 tacaagaata tgtgcacagg tagtccttct atagttgaat ttaataggtt ggctacctgt 16500 gactggactg aaagtggtga ttacaccctt gccaatacta caacagaacc actcaaactt 16560 tttgctgctg agactttacg tgccactgaa gaggcgtcta agcagtctta tgctattgcc 16620 accatcaaag aaattgttgg tgagcgccaa ctattacttg tgtgggaggc tggcaagtcc 16680 aaaccaccac tcaatcgtaa ttatgttttt actggttatc atataaccaa aaatagtaaa 16740 gtgcagctcg gtgagtacat cttcgagcgc attgattata gtgatgctgt atcctacaag 16800 tctagtacaa cgtataaact gactgtaggt gacatcttcg tacttacctc tcactctgtg 16860 gctaccttga cggcgcccac aattgtgaat caagagaggt atgttaaaat tactgggttg 16920 tacccaacca ttacggtacc tgaagagttc gcaagtcatg ttgccaactt ccaaaaatca 16980 ggttatagta aatatgtcac tgttcaggga ccacctggca ctggcaaaag tcattttgct 17040 atagggttag cgatttacta ccctacagca cgtgttgttt atacagcatg ttcacacgca 17100 gctgttgatg ctttgtgtga aaaagctttt aaatatttga acattgctaa atgttcccgt 17160 atcattcctg caaaggcacg tgttgagtgc tatgacaggt ttaaagttaa tgagacaaat 17220 tctcaatatt tgtttagtac tattaatgct ctaccagaaa cttctgccga tattctggtg 17280 gttgatgagg ttagtatgtg cactaattat gatctttcaa ttattaatgc acgtattaaa 17340 gctaagcaca ttgtctatgt aggagatcca gcacagttgc cagctcctag gactttgttg 17400 actagaggca cattggaacc agaaaatttc aatagtgtca ctagattgat gtgtaactta 17460 ggtcctgaca tatttttaag tatgtgctac aggtgtccta aggaaatagt aagcactgtg 17520 agcgctcttg tctacaataa taaattgtta gccaagaagg agctttcagg ccagtgcttt 17580 aaaatactct ataagggcaa tgtgacgcat gatgctagct ctgccattaa tagaccacaa 17640 ctcacatttg tgaagaattt tattactgcc aatccggcat ggagtaaggc agtctttatt 17700 tcgccttata attcacagaa tgctgtggct cgttcaatgc tgggtcttac tactcagact 17760 gttgattcct cacagggttc agaataccag tacgttatct tctgtcaaac agcagatacg 17820 gcacatgcta acaacattaa cagatttaat gttgcaatca ctcgtgccca aaaaggtatt 17880 ctttgtgtta tgacatctca ggcactcttt gagtccttag agtttactga attgtctttt 17940 actaattaca agctccagtc tcagattgta actggccttt ttaaagattg ctctagagaa 18000 acttctggcc tctcacctgc ttatgcacca acatacgtta gtgttgatga caagtataag 18060 acgagtgatg agctttgcgt gaatcttaat ttacccgcaa atatcccata ctctcgtgtt 18120 atttccagga tgggctttaa actcgatgca acagttcctg gatatcctaa gcttttcatt 18180 actcgtgaag aggctgtaag gcaagttcga agctggatag gcttcgatgt tgagggtgct 18240 catgcttccc gtaatgcatg tggcaccaat gtgcctctac aattaggatt ttcaactggt 18300 gtgaactttg ttgttcagcc agttggtgtt gtagacactg agtggggtaa catgttaacg 18360 ggcattgctg cccgtcctcc accaggtgaa cagtttaagc acctcgtgcc tcttatgcat 18420 aagggggctg cgtggcctat tgttagacga cgtatagtgc aaatgttgtc agacacttta 18480 gacaaattgt ctgattactg tacgtttgtt tgttgggctc atggctttga attaacgtct 18540 gcatcatact tttgcaagat aggtaaggaa cagaagtgtt gcatgtgcaa tagacgcgct 18600 gcagcgtact cttcacctct gcaatcttat gcctgctgga ctcattcctg cggttatgat 18660 tatgtctaca accctttctt tgtcgatgtt caacagtggg gttatgtagg caatcttgct 18720 actaatcacg atcgttattg ctctgtccat caaggagctc atgtggcttc taatgatgca 18780 ataatgactc gttgtttagc tattcattct tgttttatag aacgtgtgga ttgggatata 18840 gagtatcctt atatctcaca tgaaaagaaa ttgaattcct gttgtagaat cgttgagcgc 18900 aacgtcgtac gtgctgctct tcttgccggt tcatttgaca aagtctatga tattggcaat 18960 cctaaaggaa ttcctattgt tgatgaccct gtggttgatt ggcattattt tgatgcacag 19020 cccttgacca ggaaggtaca acagcttttc tatacagagg acatggcctc aagatttgct 19080 gatgggctct gcttattttg gaactgtaat gtaccaaaat atcctaataa tgcaattgta 19140 tgcaggtttg acacgcgtgt gcattctgag ttcaatttgc caggttgtga tggcggtagt 19200 ttgtatgtta acaagcacgc ttttcataca ccagcatatg atgtgagtgc attccgtgat 19260 ctgaaacctt taccattctt ttattattct actacaccat gtgaagtgca tggtaatggt 19320 agtatgatag aggatattga ttatgtaccc ctaaaatctg cagtctgtat tacagcttgt 19380 aatttagggg gcgctgtttg taggaagcat gctacagagt acagagagta tatggaagca 19440 tataatcttg tctctgcatc aggtttccgc ctttggtgtt ataagacctt tgatatttat 19500 aatctctggt ctacttttac aaaagttcaa ggtttggaaa acattgcttt taatgttgtt 19560 aaacaaggcc attttattgg tgttgagggt gaactacctg tagctgtagt caatgataag 19620 atcttcacca agagtggcgt taatgacatt tgtatgtttg agaataaaac cactttgcct 19680 actaatatag cttttgaact ctatgctaag cgtgctgtac gctcgcatcc cgatttcaaa 19740 ttgctacaca atttacaagc agacatttgc tacaagttcg tcctttggga ttatgaacgt 19800 agcaatattt atggtactgc tactattggt gtatgtaagt acactgatat tgatgttaat 19860 tcagctttga atatatgttt tgacatacgc gataatggtt cattggagaa gttcatgtct 19920 actcccaatg ccatctttat ttctgataga aaaattaaga aatacccttg tattgtaggt 19980 cctgattatg cttacttcaa tggtgctatc atccgtgata gtgatgttgt taaacaacca 20040 gtgaagttct acttgtataa gaaagtcaat aatgagttta ttgatcctac tgagtgtatt 20100 tacactcaga gtcgctcttg tagtgacttc ctacccctgt ctgacatgga gaaagacttt 20160 ctatcttttg atagtgatgt tttcattaag aagtatggct tggaaaacta tgcttttgag 20220 cacgtagtct atggagactt ctctcatact acgttaggcg gtcttcactt gcttattggt 20280 cacgtagtct atggagactt ctctcatact acgttaggcg gtcttcactt gcttattggt 20340 ttatacaaga agcaacagga aggtcatatt attatggaag aaatgctaaa aggtagctca 20400 actattcata actattttat tactgagact aacacagcgg cttttaaggc ggtgtgttct 20460 gttatagatt taaagcttga cgactttgtt atgattttaa agagtcaaga ccttggcgta 20520 gtatccaagg ttgtcaaggt tcctattgac ttaacaatga ttgagtttat gttatggtgt 20580 aaggatggac aggttcaaac cttctaccct cgactccagg cttctgcaga ttggaaacct 20640 ggtcatgcaa tgccatccct ctttaaagtt caaaatgtaa accttgaacg ttgtgagctt 20700 gctaattaca agcaatctat tcctatgcct cgcggtgtgc acatgaacat cgctaaatat 20760 atgcaattgt gccagtattt aaatacttgc acattagccg tgcctgccaa tatgcgtgtt 20820 atacattttg gcgctggttc tgataaaggt atcgctcctg gtacatcagt tttacgacag 20880 tggcttccta cagatgccat tattatagat aatgatttaa atgagttcgt gtcagatgct 20940 gacataactt tatttggaga ttgtgtaact gtacgtgtca gccaacaagt ggatcttgtt 21000 atttccgaca tgtatgatcc tactactaag aatgtaacag gtagtaatga gtcaaaggct 21060 ttattcttta cttacctgtg taacctcatt aataataatc ttgctcttgg tgggtctgtt 21120 gctattaaaa taacagaaca ctcttggagc gttgaacttt atgaacttat gggaaaattt 21180 gcttggtgga ctgttttctg caccaatgca aatgcatcct catctgaagg attcctctta 21240 ggtattaatt acttgggtac tattaaagaa aatatagatg gtggtgctat gcacgccaac 21300 tatatatttt ggagaaattc cactcctatg aatctgagta cttactcact ttttgattta 21360 tccaagtttc aattaaaatt aaaaggaaca ccagttcttc aattaaagga gagtcaaatt 21420 aacgaactcg taatatctct cctgtcgcag ggtaagttac ttatccgtga caatgataca 21480 ctcagtgttt ctactgatgt tcttgttaac acctacagaa agttacgttg atgtagggcc 21540 agattctgtt aagtctgctt gtattgaggt tgatatacaa cagactttct ttgataaaac 21600 ttggcctagg ccaattgatg tttctaaggc tgacggtatt atataccctc aaggccgtac 21660 atattctaac ataactatca cttatcaagg tctttttccc tatcagggag accatggtga 21720 tatgtatgtc tactctgcag gacatgctac aggcacaact ccacaaaagt tgtttgtagc 21780 taactattct caggacgtca aacagtttgc taatgggttt gtcgtccgta taggagcagc 21840 tgccaattcc actggcactg ttattattag cccatctacc cgcgctacta tacgaaaaat 21900 ttaccctgct tttatgctgg gttcttcagt tggtaatttc tcagatggta aaatgggccg 21960 cttcttcaat catactctag ttcttttgcc cgatggatgt ggcactttac ttagagcttt 22020 ttattgtatt ctagagcctc gctctggaaa tcattgtcct gctggcaatt cctatacttc 22080 ttttgccact tatcacactc ctgcaacaga ttgttctgat ggcaattaca atcgtaatgc 22140 cagtctgaac tcttttaagg agtattttaa tttacgtaac tgcaccttta tgtacactta 22200 taacattacc gaagatgaga ttttagagtg gtttggcatt acacaaactg ctcaaggtgt 22260 tcacctcttc tcatctcggt atgttgattt gtacggcggc aatatgtttc aatttgccac 22320 cttgcctgtt tatgatacta ttaagtatta ttctatcatt cctcacagta ttcgttctat 22380 ccaaagtgat agaaaagctt gggctgcctt ctacgtatat aaacttcaac cgttaacttt 22440 cctgttggat ttttctgttg atggttatat acgcagagct atagactgtg gttttaatga 22500 tttgtcacaa ctccactgct catatgaatc cttcgatgtt gaatctggag tttattcagt 22560 ttcgtctttc gaagcaaaac cttctggctc agttgtggaa caggctgaag gtgttgaatg 22620 tgatttttca cctcttctgt ctggcacacc tcctcaggtt tataatttca agcgtttggt 22680 ttttaccaat tgcaattata atcttaccaa attgctttca cttttttctg tgaatgattt 22740 tacttgtagt caaatatctc cagcagcaat tgctagcaac tgttattctt cactgatttt 22800 ggattatttt tcatacccac ttagtatgaa atccgatctc agtgttagtt ctgctggtcc 22860 aatatcccag tttaattata aacagtcctt ttctaatccc acatgtttga ttttagcgac 22920 tgttcctcat aaccttacta ctattactaa gcctcttaag tacagctata ttaacaagtg 22980 ctctcgtctt ctttctgatg atcgtactga agtacctcag ttagtgaacg ctaatcaata 23040 ctcaccctgt gtatccattc tcccatccac tgtgtgggaa gacggtgatt attataggaa 23100 acaactatct ccacttgaag gtggtggctg gcttgttgct agtggctcaa ctgttgccat 23160 gactgagcaa ttacagatgg gctttggtat tacagttcaa tatggtacag acaccaatag 23220 tgtttgcccc aagcttgaat ttgctaatga cacaaaaatt gcctctcaat taggcaattg 23280 cgtggaatat tccctctatg gtgtttcggg ccgtggtgtt tttcagaatt gcacagctgt 23340 aggtgttcga cagcagcgct ttgtttatga tgcgtaccag aatttagttg gctattattc 23400 tgatgatggc aactactact gtttgcgtgc ttgtgttagt gttcctgttt ctgtcatcta 23460 tgataaagaa actaaaaccc acgctactct atttggtagt gttgcatgtg aacacatttc 23520 ctctaccatg tctcaatact cccgttctac gcgatcaatg cttaaacggc gagattctac 23580 atatggtccc cttcagacac ctgttggttg tgtcctagga cttgttaatt cctctttgtt 23640 cgtagaggac tgcaagttgc ctcttggtca atctctctgt gctcttcctg acacacctag 23700 tactctcaca cctcgcagtg tgcgctctgt tccaggtgaa atgcgcttgg catccattgc 23760 ttttaatcat cctattcagg ttgatcaact taatagtagt tattttaaat taagtatacc 23820 tactaatttt tcctttggtg tgactcagga gtacattcag acaaccattc agaaagttac 23880 tgttgattgt aaacagtacg tttgcaatgg tttccagaag tgtgagcaat tactgcgcga 23940 gtatggccag ttttgttcca aaataaacca ggctctccat ggtgccaatt tacgccagga 24000 tgattctgta cgtaatttgt ttgcgagcgt gaaaagctct caatcatctc ctatcatacc 24060 aggttttgga ggtgacttta atttgacact tctagaacct gtttctatat ctactggcag 24120 tcgtagtgca cgtagtgcta ttgaggattt gctatttgac aaagtcacta tagctgatcc 24180 tggttatatg caaggttacg atgattgtat gcagcaaggt ccagcatcag ctcgtgatct 24240 tatttgtgct caatatgtgg ctggttataa agtattacct cctcttatgg atgttaatat 24300 ggaagccgcg tacacttcat ctttgcttgg cagcatagca ggtgttggct ggactgctgg 24360 cttatcctcc tttgctgcta ttccatttgc acagagtatc ttttataggt taaacggtgt 24420 tggcattact caacaggttc tttcagagaa ccaaaagctt attgccaata agtttaatca 24480 ggctctggga gctatgcaaa caggcttcac tacaactaat gaagcttttc ggaaggttca 24540 ggatgctgtg aacaacaatg cacaggctct atccaaatta gctagcgagc tatctaatac 24600 ttttggtgct atttccgcct ctattggaga catcatacaa cgtcttgacg ttctcgaaca 24660 ggacgcccaa atagacagac ttattaatgg ccgtttgaca acactaaatg cttttgttgc 24720 acagcagctt gttcgttctg aatcagctgc tctttccgct caattggcta aagataaagt 24780 caatgagtgt gtcaaggcac aatccaagcg ttctggattt tgcggtcaag gcacacatat 24840 agtgtccttt gttgtaaatg cccctaatgg cctttacttt atgcatgttg gttattaccc 24900 tagcaaccac attgaggttg tttctgctta tggtctttgc gatgcagcta accctactaa 24960 ttgtatagcc cctgttaatg gctactttat taaaactaat aacactagga ttgttgatga 25020 gtggtcatat actggctcgt ccttctatgc acctgagccc atcacctctc ttaatactaa 25080 gtatgttgca ccacaggtga cataccaaaa catttctact aacctccctc ctcctcttct 25140 cggcaattcc accgggattg acttccaaga tgagttggat gagtttttca aaaatgttag 25200 caccagtata cctaattttg gttctctaac acagattaat actacattac tcgatcttac 25260 ctacgagatg ttgtctcttc aacaagttgt taaagccctt aatgagtctt acatagacct 25320 taaagagctt ggcaattata cttattacaa caaatggccg tggtacattt ggcttggttt 25380 cattgctggg cttgttgcct tagctctatg cgtcttcttc atactgtgct gcactggttg 25440 tggcacaaac tgtatgggaa aacttaagtg taatcgttgt tgtgatagat acgaggaata 25500 cgacctcgag ccgcataagg ttcatgttca ctaattaacg aactatcaat gagagttcaa 25560 agaccaccca ctctcttgtt agtgttctca ctctcttttt tggtcactgc attttcaaaa 25620 cctctctatg tacctgagca ttgtcagaat tattctggtt gcatgcttag ggcttgtatt 25680 aaaactgccc aagctgatac agctggtctt tatacaaatt ttcgaattga tgtcccatct 25740 gcagaatcaa ctggtactca atcagtttct gtcgatcgtg agtctacttc aactcatgat 25800 ggtcttaccg aacatgttac tagtgtgaat ctttttgacg ttggttactc agttaattaa 25860 cgaactctat ggattacgtg tctctgctta atcaaatttg gcagaagtac cttaattcac 25920 cgtatactac ttgtttgtat atccctaaac ccacagctaa gtatacacct ttagttggca 25980 cttctttgca ccctgtgctg tggaactgtc agctatcctt tgctggttat actgaatctg 26040 ctgttaattc tacaaaagct ttggccaaac aggacgcagc tcagcgaatc gcttggttgc 26100 tacataagga tggaggaatc cctgatggat gttccctcta cctccggcac tcaagtttat 26160 tcgcgcaaag cgaggaagag gagtcattct ccaactaaga aactgcgcta cgttaagcgt 26220 agattttctc ttctgcgccc tgaagacctt agtgttattg tccaaccaac acactatgtc 26280 agggttacat tttcagaccc caacatgtgg tatctacgtt cgggtcatca tttacactca 26340 gttcacaatt ggcttaaacc ttatggcggc caacctgttt ctgagtacca tattactcta 26400 gctttgctaa atctcactga tgaagattta gctagagatt tttcacccat tgcgctcttt 26460 ttgcgcaatg tcagatttga gctacatgag ttcgccttgc tgcgcaaaac tcttgttctt 26520 aatgcatcag agatctactg tgctaacata catagattta agcctgtgta tagagttaac 26580 acggcaatcc ctactattaa ggattggctt ctcgttcagg gattttccct ttaccatagt 26640 ggcctccctt tacatatgtc aatctctaaa ttgcatgcac tggatgatgt tactcgcaat 26700 tacatcatta caatgccatg ctttagaact tatcctcaac aaatgtttgt tactcctttg 26760 gccgtagatg ttgtctccat acggtcttcc aatcagggta ataaacaaat tgttcattct 26820 taccccattt tacatcatcc aggattttaa cgaactatgg ctttctcggc gtctttattt 26880 aaacccgtcc agctagtccc agtttctcct gcatttcatc gcattgagtc tactgactct 26940 attgttttca catacattcc tgctagcggc tatgtagctg ctttagctgt caatgtgtgt 27000 ctcattcccc tattattact gctacgtcaa gatacttgtc gtcgcagcat tatcagaact 27060 atggttctct atttccttgt tctttataac tttttattag ccattgtact agtcaatggt 27120 gtacattatc caactggaag ttgcctgata gccttcttag ttatcctcat aatactttgg 27180 tttgtagata gaattcgttt ctgtctcatg ctgaattcct acattccact gtttgacatg 27240 cgttctcact ttattcgtgt tagtacagtt tcttctcatg gtatggtccc tgtcatacac 27300 accaaaccat tatttattag aaacttcgat cagcgttgca gctgttctcg ttgtttttat 27360 ttgcactctt ctacttatat agagtgcact tatattagcc gttttagtaa gattagccta 27420 gtttctgtaa ctgacttctc cttaaacggc aatgtttcca ctgttttcgt gcctgcaacg 27480 cgcgattcag ttcctcttca cataatcgcc ccgagctcgc ttatcgttta agcagctctg 27540 cgctactatg ggtcccgtgt agaggctaat ccattagtct ctctttggac atatggaaaa 27600 cgaactatgt taccctttgt ccaagaacga atagggttgt tcatagtaaa ctttttcatt 27660 tttaccgtag tatgtgctat aacactcttg gtgtgtatgg ctttccttac ggctactaga 27720 ttatgtgtgc aatgtatgac aggcttcaat accctgttag ttcagcccgc attatacttg 27780 tataatactg gacgttcagt ctatgtaaaa ttccaggata gtaaaccccc tctaccacct 27840 gacgagtggg tttaacgaac tccttcataa tgtctaatat gacgcaactc actgaggcgc 27900 agattattgc cattattaaa gactggaact ttgcatggtc cctgatcttt ctcttaatta 27960 ctatcgtact acagtatgga tacccatccc gtagtatgac tgtctatgtc tttaaaatgt 28020 ttgttttatg gctcctatgg ccatcttcca tggcgctatc aatatttagc gccatttatc 28080 caattgatct agcttcccag ataatctctg gcattgtagc agctgtttca gctatgatgt 28140 ggatttccta ctttgtgcag agtatccggc tgtttatgag aactggatca tggtggtcat 28200 tcaatcctga gactaattgc cttttgaatg ttccaattgg tggtacaact gtcgtacgtc 28260 cactcgtaga ggactctacc agtgtaactg ctgttgtaac caatggtcac ctcaaaatgg 28320 ctggcatgca tttcggtgct tgtgactacg acagacttcc taatgaagtc accgtggcca 28380 aacccaatgt gctgattgct ttaaaaatgg tgaagcggca aagctacgga actaattccg 28440 gcgttgccat ttaccataga tataaggcag gtaattacag gagtccgcct attacggcgg 28500 atattgaact tgcattgctt cgagcttagg ctctttagta agagtatctt aattgatttt 28560 aacgaatctc aatttcattg ttatggcatc ccctgctgca cctcgtgctg tttcctttgc 28620 cgataacaat gatataacaa atacaaacct gtctcgaggt agaggacgta atccaaaacc 28680 acgagctgca ccaaataaca ctgtctcttg gtacactggg cttacccaac acgggaaagt 28740 ccctcttacc tttccacctg ggcagggtgt acctcttaat gccaattcca cccctgcgca 28800 aaatgctggg tattggcgga gacaggacag aaaaattaat accgggaatg gaattaagca 28860 actggctccc aggtggtact tctactacac tggaactgga cccgaagcag cactcccatt 28920 ccgggctgtt aaggatggca tcgtttgggt ccatgaagat ggcgccactg atgctccttc 28980 aacttttggg acgcggaacc ctaacaatga ttcagctatt gttacacaat tcgcgcccgg 29040 tactaagctt cctaaaaact tccacattga ggggactgga ggcaatagtc aatcatcttc 29100 aagagcctct agcgtaagca gaaactcttc cagatctagt tcacaaggtt caagatcagg 29160 aaactctacc cgcggcactt ctccaggtcc atctggaatc ggagcagtag gaggtgatct 29220 actttacctt gatcttctga acagactaca agcccttgag tctggcaaag taaagcaatc 29280 gcagccaaaa gtaatcacta agaaagatgc tgctgctgct aaaaataaga tgcgccacaa 29340 gcgcacttcc accaaaagtt tcaacatggt gcaagctttt ggtcttcgcg gaccaggaga 29400 cctccaggga aactttggtg atcttcaatt gaataaactc ggcactgagg acccacgttg 29460 gccccaaatt gctgagcttg ctcctacagc cagtgctttt atgggtatgt cgcaatttaa 29520 acttacccat cagaacaatg atgatcatgg caaccctgtg tacttccttc ggtacagtgg 29580 agccattaaa cttgacccaa agaatcccaa ctacaataag tggttggagc ttcttgagca 29640 aaatattgat gcctacaaaa ccttccctaa gaaggaaaag aaacaaaagg caccaaaaga 29700 agaatcaaca gaccaaatgt ctgaacctcc aaaggagcag cgtgtgcaag gtagcatcac 29760 tcagcgcact cgcacccgtc caagtgttca gcctggtcca atgattgatg ttaacactga 29820 ttagtgtcac tcaaagtaac aagatcgcgg caatcgtttg tgtttggtaa ccccatctca 29880 ccatcgcttg tccactcttg cacagaatgg aatcatgttg taattacagt gcaataaggt 29940 aattataacc catttaattg atagctatgc tttattaaag tgtgtagctg tagagagaat 30000 gttaaagact gtcacctctg cgtgattgca agtgaacagt gccccccggg aagagctcta 30060 cagtgtgaaa tgtaaataaa aaatagctat tattcaatta gattaggcta attagatgat 30120 ttgcaaaaaa aaaaaaaaaa aaaaaaaaaa atggccggca tggtcccagc ctcctcgctg 30180 gcgccggctg ggcaacattc cgaggggacc gtcccctcgg taatggcgaa tgggacccat 30240 aactagcata accccttggg gcctctaaac gggtcttgag gggtttt 30287

Claims (12)

  1. 한국형 중동호흡기증후군 코로나바이러스(Korean strain Middle East respiratory syndrome Coronavirus, MERS-Cov)의 감염성 변이 유전자로서,
    한국형 중동호흡기증후군 코로나바이러스(GeneBank Accession Number: KT029139.1) 유전자에서 11267번째 뉴클레오타이드가 사이토신에서 티민으로 치환되어 제한효소 FspAI를 인식하는 부위가 결실되는 단계;
    19198번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 제한효소 MluI를 인식하는 부위가 삽입되는 단계; 및
    2849번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 T7 리보뉴클레오타이드 폴리메라아제 (T7 RNA Polymerase) 일시중지 부위가 결실되는 단계;를 포함하여 제조된 서열번호 1인 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자
    As an infectious mutation gene of Korean strain Middle East respiratory syndrome Coronavirus (MERS-Cov),
    A step in which the 11267th nucleotide in the Korean Middle East Respiratory Syndrome Coronavirus (GeneBank Accession Number: KT029139.1) gene is replaced with cytosine by thymine, thereby deleting a site that recognizes the restriction enzyme FspAI;
    19198th nucleotide is substituted from adenine to guanine to insert a site that recognizes the restriction enzyme MluI; And
    2849th nucleotide is replaced by adenine to guanine and T7 ribonucleotide polymerase (T7 RNA Polymerase) pause site is deleted; including SEQ ID NO: 1 prepared in the Korean Middle East Respiratory Syndrome coronavirus infectious mutation gene
  2. 삭제delete
  3. 삭제delete
  4. 제1항에 따른 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자를 포함하는 재조합 벡터
    Recombinant vector containing the infectious mutation gene of the Korean type Middle East Respiratory Syndrome according to claim 1
  5. 삭제delete
  6. 삭제delete
  7. 삭제delete
  8. 삭제delete
  9. 제4항에 따른 재조합 벡터가 도입된 형질전환체
    A transformant introduced with the recombinant vector according to claim 4
  10. 제4항에 따른 재조합 벡터를 유효성분으로 포함하는 한국형 중동호흡기증후군 코로나바이러스 백신 조성물
    Korean type Middle East Respiratory Syndrome coronavirus vaccine composition comprising the recombinant vector according to claim 4 as an active ingredient
  11. 한국형 중동호흡기증후군 코로나바이러스(Korean strain Middle East respiratory syndrome Coronavirus, MERS-Cov)의 감염성 변이 유전자의 제조방법으로서,
    한국형 중동호흡기증후군 코로나바이러스(GeneBank Accession Number: KT029139.1) 유전자에서 11267번째 뉴클레오타이드가 사이토신에서 티민으로 치환되어 제한효소 FspAI를 인식하는 부위가 결실되는 단계;
    19198번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 제한효소 MluI를 인식하는 부위가 삽입되는 단계; 및
    2849번째 뉴클레오타이드가 아데닌에서 구아닌으로 치환되어 T7 리보뉴클레오타이드 폴리메라아제 (T7 RNA Polymerase) 일시중지 부위가 결실되는 단계;를 포함하는 서열번호 1인 한국형 중동호흡기증후군 코로나바이러스의 감염성 변이 유전자 제조방법
    As a method for producing an infectious mutant gene of Korean strain Middle East respiratory syndrome Coronavirus (MERS-Cov),
    A step in which the 11267th nucleotide in the Korean Middle East Respiratory Syndrome Coronavirus (GeneBank Accession Number: KT029139.1) gene is replaced with cytosine by thymine, thereby deleting a site that recognizes the restriction enzyme FspAI;
    19198th nucleotide is substituted from adenine to guanine to insert a site that recognizes the restriction enzyme MluI; And
    2849th nucleotide substitution from adenine to guanine, T7 ribonucleotide polymerase (T7 RNA Polymerase) pause site is deleted; including SEQ ID NO: 1 containing the Korean Middle East Respiratory Syndrome coronavirus infectious mutation gene production method
  12. (1) 제9항에 따른 형질전환체에 한국형 중동호흡기증후군 코로나바이러스를 감염시켜 증식시키는 단계; 및
    (2) 상기 (1) 단계에서 증식된 바이러스를 이용하여 불활성화 백신을 제조하는 단계;를 포함하는, 한국형 중동호흡기증후군 코로나바이러스 백신 조성물의 제조 방법

    (1) infecting and proliferating the transformant according to claim 9 by infecting the Korean type Middle East Respiratory Syndrome coronavirus; And
    (2) a step of preparing an inactivated vaccine using the virus propagated in step (1); including, Korean Middle East Respiratory Syndrome coronavirus vaccine composition production method

KR1020190031225A 2019-03-19 2019-03-19 한국형 중동호흡기증후군 코로나바이러스 감염성 변이 유전자 및 이의 용도 KR102119875B1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190031225A KR102119875B1 (ko) 2019-03-19 2019-03-19 한국형 중동호흡기증후군 코로나바이러스 감염성 변이 유전자 및 이의 용도

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190031225A KR102119875B1 (ko) 2019-03-19 2019-03-19 한국형 중동호흡기증후군 코로나바이러스 감염성 변이 유전자 및 이의 용도

Publications (1)

Publication Number Publication Date
KR102119875B1 true KR102119875B1 (ko) 2020-06-05

Family

ID=71089260

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190031225A KR102119875B1 (ko) 2019-03-19 2019-03-19 한국형 중동호흡기증후군 코로나바이러스 감염성 변이 유전자 및 이의 용도

Country Status (1)

Country Link
KR (1) KR102119875B1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020060251A (ko) * 1999-12-03 2002-07-16 콘세호수페리오르데인베스티가시오네스시엔티피카스 감염성 클론
KR20060004576A (ko) * 2004-07-09 2006-01-12 (주)씨아이디 돼지생식기호흡기증후군 바이러스에 대한 전체-길이의감염성이 있는 cDNA 클론 및 이의 용도
KR100710519B1 (ko) * 2002-10-09 2007-04-24 (주)씨아이디 일본뇌염 바이러스의 신규한 전체-길이의 게놈 RNA 및상기 JEV 게놈 RNA에 대한 감염성이 있는 JEVcDNA 및 이것의 용도
JP2017522907A (ja) * 2014-07-23 2017-08-17 ザ パーブライト インスティチュート Coronavirus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020060251A (ko) * 1999-12-03 2002-07-16 콘세호수페리오르데인베스티가시오네스시엔티피카스 감염성 클론
KR100710519B1 (ko) * 2002-10-09 2007-04-24 (주)씨아이디 일본뇌염 바이러스의 신규한 전체-길이의 게놈 RNA 및상기 JEV 게놈 RNA에 대한 감염성이 있는 JEVcDNA 및 이것의 용도
KR20060004576A (ko) * 2004-07-09 2006-01-12 (주)씨아이디 돼지생식기호흡기증후군 바이러스에 대한 전체-길이의감염성이 있는 cDNA 클론 및 이의 용도
JP2017522907A (ja) * 2014-07-23 2017-08-17 ザ パーブライト インスティチュート Coronavirus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Spread of Mutant Middle East Respiratory Syndrome Coronavirus with Reduced Afnity to Human CD26 during the South Korean Outbreak MBio. 2016 Mar 1;7(2):e00019
Transgene expression in the genome of Middle East respiratory syndrome coronavirus based on a novel reverse genetics system utilizing Red-mediated recombination cloning., Journal of General Virology 2017;98 : 2461 -2469

Similar Documents

Publication Publication Date Title
US10364442B2 (en) CRISPR enabled multiplexed genome engineering
Bock Engineering plastid genomes: methods, tools, and applications in basic research and biotechnology
Peyret et al. When plant virology met Agrobacterium: the rise of the deconstructed clones
Blanvillain‐Baufumé et al. Targeted promoter editing for rice resistance to Xanthomonas oryzae pv. oryzae reveals differential activities for SWEET 14‐inducing TAL effectors
Wang et al. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew
Peng et al. Engineering canker‐resistant plants through CRISPR/Cas9‐targeted editing of the susceptibility gene Cs LOB 1 promoter in citrus
Marton et al. Nontransgenic genome modification in plant cells
Li et al. Multiplexed, targeted gene editing in Nicotiana benthamiana for glyco‐engineering and monoclonal antibody production
US10612043B2 (en) Methods of in vivo engineering of large sequences using multiple CRISPR/cas selections of recombineering events
KR20160147844A (ko) 표적화된 돌연변이
Archambault et al. Genetics of eukaryotic RNA polymerases I, II, and III.
Lindbo TRBO: a high-efficiency tobacco mosaic virus RNA-based overexpression vector
Voinnet et al. Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants
Zong et al. Precise base editing in rice, wheat and maize with a Cas9-cytidine deaminase fusion
US5889191A (en) Viral amplification of recombinant messenger RNA in transgenic plants
Ndowora et al. Evidence that badnavirus infection in Musa can originate from integrated pararetroviral sequences
US6482647B1 (en) Evolving susceptibility of cellular receptors to viral infection by recursive recombination
ES2384296T3 (es) Plásmidos vectores de clonación de ADN y procedimientos para su uso
US5811653A (en) Viral amplification of recombinant messenger RNA in transgenic plants
EP0131623B1 (en) Chimeric genes suitable for expression in plant cells
Shibata et al. Technical Focus-Agrobacterium-mediated plant transformation with large DNA fragments
JP4264703B2 (ja) 合成遺伝子、およびCpGを欠く細菌プラスミド
AU2003207776B2 (en) Mismatch endonucleases and methods of use
Veillet et al. Transgene-free genome editing in tomato and potato plants using agrobacterium-mediated delivery of a CRISPR/Cas9 cytidine base editor
US7138267B1 (en) Methods and compositions for amplifying DNA clone copy number

Legal Events

Date Code Title Description
AMND Amendment
AMND Amendment
E601 Decision to refuse application
X091 Application refused [patent]
AMND Amendment
X701 Decision to grant (after re-examination)
GRNT Written decision to grant