KR102089088B1 - Composition for correcting blood coagulation factor Ⅷ and method using the same - Google Patents

Abstract

A composition for correcting blood coagulation factor Ⅷ (FⅧ) according to one aspect, a method for producing induced pluripotent stem cells using the same, induced pluripotent stem cells and endothelial cells produced thereby, including A type for preventing or treating hemophilia Provided are compositions and methods using the same. According to this, it is possible to knock-in the FⅧ gene in the genome of a cell or individual. In particular, it can be used to prevent or treat type A hemophilia as personalized or precision medicine.

Description

Composition for correcting blood coagulation factor Ⅷ and method using the same}

It relates to a guide RNA targeting blood coagulation factor 포함한, a vector containing the same, a composition for correcting a genome containing the same, a composition for preventing or treating hemophilia including the same, and a method using the same.

Hemophilia A (HA) is one of the most common hereditary bleeding disorders, with a prevalence of about 1 in 5,000 men in the world. HA is known to be caused by a variety of gene mutations, including large-scale deletions, insertions, inversions, and point mutations within the X-linked coagulation factor VII (FⅧ) gene. Currently, the HA treatment used in clinical practice is intravenous injection of recombinant F 'protein. However, these treatments are not only fundamental treatments, but also have high treatment costs and need to be treated for a lifetime, and there is a problem that FⅧ protein-inactivated antibodies are formed.

Genetic scissors refers to an enzyme used to cut a specific DNA site by binding to a gene or a genome editing technique using the same. Using genetic scissors, it can be used in various fields such as mutation correction that causes genetic diseases in stem cells or somatic cells, and anticancer cell therapy. The CRISPR / Cas 9 system, one of the genetic scissors, is a technique for cutting and inserting specific genes in the genome by delivering Cas9 nuclease and appropriate guide RNA into cells. Recently, the endogenous FⅧ locus in which inversion was induced in induced pluripotent stem cells (iPSCs) of HA patients was reversed to correct for normal gene orientation (KR 10-2016-0084958 (2016.07.15)), or FⅧ gene Methods of inserting exons into position-specific mutations have been reported (Yong Wu et al., Scientific Reports, vol. 6, Article No. 18865, 2016.01.08). However, this method is difficult to apply to all types of genetic mutations in HA, and a method for inducing differentiation of iPSC into liver sinusoidal endothelial cells (LSEC), which is the main production cell of FⅧ protein, has not been developed. There is a problem in that it is not.

Accordingly, there is a need to develop a method capable of universally correcting FⅧ gene regardless of genetic variation and cell type and fundamentally treating HA.

Provided is a composition for correcting blood coagulation factor VII.

It provides a method for producing induced pluripotent stem cells in which the F 'gene has been corrected.

Provided are induced pluripotent stem cells prepared by the above method or endothelial cells differentiated therefrom.

Provided is a pharmaceutical composition for preventing or treating hemophilia A.

It provides a method of preventing or treating hemophilia A.

One aspect is a guide RNA comprising two or more consecutive nucleotides identical or complementary to the nucleotide sequence of the human H11 locus, or a first polynucleotide encoding the same; And

A blood coagulation factor Ⅷ (FⅧ or F8), a blood coagulation factor 를 comprising a second polynucleotide encoding any one or more exons selected from the group consisting of the first exon to the 26th exon (Blood coagulation factor Ⅷ; FⅧ or F8) provides a composition for correction.

The term "locus" refers to a specific location on the chromosome. The locus may be a position occupied by a gene or an intergenic sequence.

The term "nucleotide" refers to a deoxyribonucleotide or ribonucleotide present in single-stranded or double-stranded form. The nucleotides can include analogs of nucleotides.

The term “complementary” refers to the ability of a polynucleotide to base-pair specifically to a target sequence to form a double-stranded structure under hybridization conditions, encompassing not only completely complementary cases but also substantially complementary cases.

The H11 locus may be an intergenic sequence present on human chromosome 22. The H11 locus may be located on chromosome 22q12.2. The H11 locus may be located between the DRG1 gene and the EIF4ENIF1 gene. The H11 locus may function as a so-called “sage harbor”. The safe harbor may be a nucleotide sequence capable of stably expressing a gene inserted in the safe harbor among genomes.

The first polynucleotide may include a protospacer adjacent motif (PAM). The PAM may include a nucleotide sequence selected from the group consisting of 5'-TGG-3 ', 5'-TAG-3', 5'-AGG-3 ', and 5'-CTG-3'.

The first polynucleotide has a length of about 10 nucleotides (nucleotide: nt) to about 100 nt, about 10 nt to about 90 nt, about 10 nt to about 80 nt, about 10 nt to about 70 nt, about 10 nt to about 60 nt, about 10 nt to about 50 nt, about 10 nt to about 40 nt, about 10 nt to about 30 nt, about 15 nt to about 30 nt, or about 20 nt to about 30 nt. The polynucleotide may be, for example, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nt in length.

The first polynucleotide may include a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 9. The first polynucleotide is 100%, about 99%, about 95%, about 90%, about 80%, about 70%, about 60%, about 50%, about 40%, about 30 with the nucleotide sequence of SEQ ID NO: 4 %, About 20%, or about 10% identity.

The first polynucleotide may include RNA, DNA, PNA, or a combination thereof. The polynucleotide may be chemically modified.

The guide RNA is RNA specific to the target nucleic acid sequence, and can bind to the RNA guide nuclease to guide the nuclease to the target nucleic acid sequence. The polynucleotide may be single-chain guide RNA (sgRNA).

The first polynucleotide may be a component of genetic scissors (programmable nuclease). Genetic scissors are all types of nucleases that can recognize and cleave specific locations on the genome. The gene scissors are, for example, transcription activator-like effector nuclease (TALEN), zinc-finger nuclease, meganuclease, RNA-guided engineered nuclease (RGEN), and agogo It is a homolog (Ago homolog, DNA-guided endonuclease). The first polynucleotide is, for example, a component of RGEN.

The first polynucleotide may cause non-homologous end-joining (NHEJ) in the cell's genome. By the non-homologous end-conjugation, a second polynucleotide can be inserted into the human H11 locus in the genome.

The blood coagulation factor Ⅷ (FⅧ or F8) is one of the components of the blood coagulation protein. The gene encoding F 'is located on the X chromosome in humans. The F 'may be encoded by the F8 gene. The FⅧ is Uniprot No. The amino acid sequence of P00451 or Uniprot No. in mice. Amino acid sequence of Q06194 may be included.

The second polynucleotide encodes any one or more exons selected from the group consisting of the first exon to the 26th exon of the F8 gene. The second polynucleotide may encode an open reading frame (ORF) of the F8 gene.

The first polynucleotide, the second polynucleotide, or a combination thereof may be included in a vector. The vector may be an episomal vector. The vector may be an expression vector. The vector can be a constitutive or inducible expression vector. The vector may include a promoter, antibiotic resistance gene, 5'-left arm (LA), 3'-right arm (RA), or combinations thereof. The promoter may include an elongation factor 1 alpha (EF1α) promoter, a U6 polymerase III promoter, an H1 promoter, a cytomegalovirus promoter, or a combination thereof. The antibiotic resistance gene may include a puromycin resistance gene, a blasticidin resistance gene, or a combination thereof.

The term “correction” targets the nucleotide sequence of a particular gene in the genome to induce cleavage, deletion, substitution, inversion (or relocation of the inversion), or insertion to induce the target gene into a normal gene. Say things. The calibration can also be called genome editing.

The composition may be a composition for knock-in of the F 'gene. Knock-in refers to inserting a polynucleotide by targeting a specific gene in the genome.

The composition may be for in vitro, ex vivo, or in vivo administration.

The composition may further include an RNA-guided nuclease (RGN) or a third polynucleotide comprising a nucleotide sequence encoding it. The RNA guide nuclease may be a Cas polypeptide. The Cas polypeptide is one of the protein components of the CRISPR / Cas system, and may be an activated endonuclease or a nick forming enzyme. The Cas polypeptide may exhibit its activity by forming a complex with crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). The Cas polypeptide may be, for example, the genus Streptococcus (eg Streptococcus pyogens), the genus Neisseria (eg Neisseria meningitidis), the genus Pasteurella (eg Pasteurella multocida), the genus Francisella (eg Francisella novicida), or It may be a polypeptide derived from bacteria of the genus Campylobacter (eg, Campylobacter jejuni). The Cas polypeptide may be a Cas9 polypeptide or a Cpf1 polypeptide.

The composition can be a single composition or a separate composition.

Another aspect is obtaining a differentiated induced pluripotent stem cell (iPSC) from somatic cells of a patient with Hemophilia A (HA);

Provided is a method of manufacturing induced pluripotent stem cells with FⅧ gene correction, comprising the step of transforming induced pluripotent stem cells by contacting the induced pluripotent stem cells with a composition for correcting FⅧ according to one aspect.

The hemophilia A refers to a genetic disease in which FⅧ expression level or activity is reduced or almost absent from normal. The hemophilia A may be severe hemophilia A. Severe type A hemophilia may have FⅧ activity of less than 1% of normal subjects.

The somatic cells refer to cells selected from the group consisting of muscle cells, nerve cells, epithelial cells, blood cells, mast cells, bone cells, and stem cells. The somatic cells may be, for example, adipocytes, fibroblasts, epithelial cells, blood cells, or hematopoietic stem cells. The fibroblast may be a skin-derived fibroblast. The epithelial cells may be urinary-derived urinary (uninary) epithelial cells. The stem cells may be adipose tissue-derived mesenchymal stem cells (MSC).

The term "re-differentiation" refers to an epigenetic retrograde process that allows existing differentiated cells to return to an undifferentiated state to form new differentiated tissue. The "reverse differentiation" includes all of the processes of returning differentiated cells having a differentiation capacity of 0% or more to less than 100% to an undifferentiated state. For example, a process of undifferentiating differentiated cells having a differentiation capacity of 0% into differentiated cells having a differentiation capacity of 1% may be included in this.

The term "induced pluripotent stem cell (iPSC)" refers to cells induced to have pluripotency through artificial dedifferentiation processes from differentiated cells. The induced pluripotent stem cells have a similar cell appearance, gene, or protein expression pattern to embryonic stem cells, have starch differentiation ability in vitro and in vivo, form teratomas, and germline transmission of genes. Is possible. The induced pluripotent stem cells may include dedifferentiated induced pluripotent stem cells derived from all mammals such as humans, cows, horses, pigs, dogs, sheep, goats, or cats. The induced pluripotent stem cells may be human-derived induced pluripotent stem cells. The induced pluripotent stem cells may be induced pluripotent stem cells derived from a patient with hemophilia A.

The transformation can be performed using any known gene delivery system used for animal transformation. The transformation can be performed, for example, by electroporation.

The FⅧ gene-corrected induced pluripotent stem cells may have one or more exons selected from the group consisting of the first exon to the 26th exon of the FⅧ gene inserted into the H11 locus in its genome.

Another aspect provides induced pluripotent stem cells prepared according to one aspect.

Another aspect provides endothelial cells differentiated from induced pluripotent stem cells prepared according to one aspect.

The induced pluripotent stem cells or endothelial cells may be included in the composition for cell therapy for hemophilia A.

Another aspect provides a pharmaceutical composition for preventing or treating hemophilia A, comprising a composition according to one aspect, induced pluripotent stem cells, or endothelial cells.

The term "prevention" refers to any action that inhibits or delays the onset of hemophilia A by administration of the pharmaceutical composition. The term "treatment" refers to any act of improving or beneficially altering the symptoms of hemophilia A by administration of the pharmaceutical composition.

The pharmaceutical composition can be a single composition or a separate composition.

The pharmaceutical composition may include a pharmaceutically acceptable carrier. The carrier is used in the sense to include excipients, diluents or adjuvants. Such carriers are, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pi It may be selected from the group consisting of lollydon, water, saline, buffer such as PBS, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, and mineral oil. The composition may include fillers, anti-coagulants, lubricants, wetting agents, flavoring agents, emulsifying agents, preservatives, or combinations thereof.

The pharmaceutical composition may be prepared in any formulation according to conventional methods. The composition can be formulated, for example, in oral dosage forms (eg, powders, tablets, capsules, syrups, pills, or granules), or parenteral dosage forms (eg, injections). In addition, the compositions can be prepared in systemic or topical formulations. The pharmaceutical composition may be administered orally, intravenously, intramuscularly, orally, transdermal, mucosal, intranasal, intratracheal, subcutaneous, or a combination thereof.

The pharmaceutical composition may include an effective amount of a polynucleotide, vector, or combination thereof according to one aspect. The term “effective amount” refers to an amount sufficient to exhibit the effect of prevention or treatment when administered to an individual in need of prevention or treatment. The effective amount can be appropriately selected depending on the cell or individual selected by those skilled in the art. The severity of the disease, the patient's age, weight, health, sex, patient's sensitivity to the drug, the time of administration, the route of administration and rate of discharge, the duration of treatment, the factors including the drug used in combination with or used concurrently with the composition used and other medical fields. Can be determined according to well-known factors. The effective amount may be about 0.1 μg to about 2 g, about 0.5 μg to about 1 g, about 1 μg to about 500 mg, about 10 μg to about 100 mg, or about 100 μg to about 50 mg per pharmaceutical composition have.

The dosage of the pharmaceutical composition may be, for example, from about 0.001 mg / kg to about 100 mg / kg, from about 0.01 mg / kg to about 10 mg / kg, or from about 0.1 mg / kg to about 1 mg / day on an adult basis. It can be in the range of kg. The administration can be administered once a day, multiple times a day, or once a week, once every two weeks, once every three weeks, or once every four weeks to once a year.

Another aspect provides a method of preventing or treating hemophilia A, comprising administering to a subject a composition according to one aspect, induced pluripotent stem cells, or endothelial cells.

The method can be performed in vitro, ex vivo, or in vivo.

The method may further include incubating the cell with an RNA-guided nuclease (RGN) or a third polynucleotide comprising a nucleotide sequence encoding the same. The step may be performed simultaneously or sequentially with the step of administering a composition according to one aspect, induced pluripotent stem cells, or endothelial cells to the individual.

The individual may be an individual having a genome having a mutation in the murine gene. The individual may be an individual with or at risk of contracting hemophilia A. The subject can be a mammal, for example, a human, cow, horse, pig, dog, sheep, goat or cat.

The composition, induced pluripotent stem cells, or endothelial cells may be administered orally, intravenously, intramuscularly, oral, transdermal, mucosal, nasal, intratracheal or subcutaneous. The preferred dosage of the composition, induced pluripotent stem cells, or endothelial cells depends on the patient's condition and body weight, the degree of disease, drug form, route and duration of administration, but may be appropriately selected by those skilled in the art. The dosage is, for example, in the range of about 0.001 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 10 mg / kg, or about 0.1 mg / kg to about 1 mg / kg on an adult basis. Can be The administration can be administered once a day, multiple times a day, or once a week, once every two weeks, once every three weeks, or once every four weeks to once a year.

A composition for correcting blood coagulation factor Ⅷ (FⅧ) according to one aspect, a method for producing induced pluripotent stem cells using the same, induced pluripotent stem cells and endothelial cells produced thereby, including A type for preventing or treating hemophilia According to the compositions and methods using them, genotype editing techniques are generally used to cure hemophilia A regardless of the mutation type of the FⅧ gene by knocking-in the FⅧ gene in the human H11 locus of a cell or individual. It can be used to prevent or treat.

Figure 1a is an image obtained by performing the T7 endonuclease I (T7E1) assay to confirm the nuclease activity of the designed sgRNA, Figure 1b is an image verifying the indel efficiency of sgRNA4 by T7E1 assay, Figure 1c And Figure 1d shows the indel frequency of sgRNA4 and the nucleotide sequence of the indel site.
2 is a schematic diagram of a donor plasmid prepared according to one aspect.
Figure 3a shows the schematic diagram of the knock-in allele on chromosome 22 and the PCR results to identify targeted knock-in of the donor DNA, Figure 3b shows the puromycin selection cassette excision through PCR-based genotyping 3c shows the results of verifying recombination between two loxP sites by Sanger sequencing.
Figure 4a is a graph showing the expression pattern of OCT4, SOX2, and LIN28 in selected iPSC clones, Figure 4b is an immunostaining image of OCT4 and NANOG, Figure 4c is NESTIN, α-SMA, and HNF- of the corrected clone 3β immunostaining image, FIG. 4D is a karyotype analysis image of the corrected clone, and FIG. 4E is a graph confirming an off-target site by targeted deep sequencing.
Figure 5a is a result of amplifying the F 의 of the H11 locus in the genome of iPSC corrected in vitro by PCR, Figure 5b is a post-excision clone (inv-K1e1 to inv-K1e3, or del-K1e1 and del-K1e2) is the result of qPCR analysis of the expression of FⅧ gene, and FIG. 5c is a graph showing the FⅧ activity (%) measured in iPSC calibrated in vitro.
Figure 6a is an immunostaining image of CD31 and von Willebrand factor in iPSCs differentiated into endothelial cells, Figure 6b is a graph showing the level of mRNA of vWF, CD31, and FV in iPSCs differentiated into endothelial cells, Figure 6c It is a graph showing the FⅧ activity level (%) of iPSC differentiated into endothelial cells, and FIG. 6D is a graph showing the FⅧ activity (%) of plasma samples obtained from HA mice implanted with endothelial cells.

It will be described in more detail through the following examples. However, these examples are intended to illustrate one or more embodiments by way of example, and the scope of the present invention is not limited to these examples.

Example  1. Guide RNA  Screening and verification

1. FⅧ Derived patient Induced pluripotent stem cells  Produce

The production and analysis of induced pluripotent stem cells (iPSC) in patients with hemophilia A (HA) was approved by the Yonsei University Institutional Review Board (IRB # 4-2012-0028). All volunteers participating in this study signed a written consent form before donating cells for iPSC production.

First, adipose tissue-derived mesenchymal stem cells (MSC) obtained from a patient clinically diagnosed as severe HA at the Korea Hemophilia Foundation Hospital and confirmed to have FⅧ deletion (exon 8-22 deletion) ) Was prepared. The prepared MSCs were cultured in DMEM (low concentration glucose) supplemented with 1% (w / v) antibiotic in 10% (v / v) FBS, 0.0145 g / L ascorbic acid and type I collagen-coated plates. Human wild type iPSC (WT-iPSC), iPSC from FⅧ-inverted patients (intron 22 inverted iPSC), iPSC from FⅧ-deleted patients in iPSC culture medium (4 ng / mL basic fibroblast growth factor (bFGF; PeproTech), 20 % Knockout serum replacement (Invitrogen), 1% (w / v) non-essential amino acid (Invitrogen), and DMEM / F12 medium containing 0.1 mM 2-mercapto ethanol (Sigma).

Episomal reprogramming vectors, pCXLE-hOCT3 / 4-shp53-F (addgene, no. 27077), pCXLE-hSK (addgene, no. 27078), and pCXLE-hUL (addgene, no. 27080). Using, F-deleted patient-derived iPSCs from the prepared MSCs were generated. Briefly, the propagated MSC was electroporated with a reprogramming vector (1 μg each, 3 μg each) using the Neon Transfection System (Life Technologies). After 3 pulses at 1,650 V for 10 ms, the cells were further cultured in low concentration glucose DMEM supplemented with 10% (v / v) FBS on a plate coated with type I collagen. One week after electroporation, cells were transferred to the mouse SIM thioguanine / Ouabain-resistant mouse fibroblast cell line (SIM Thioguanine / Ouabain: STO) fibroblasts (ATCC) as a feeder layer. Human ESC-like iPSC colonies were mechanically picked and further cultured for characterization. Thereafter, iPSCs were cultured in StemMACSTM iPS-Brew XF medium (Miltenyi Biotec) for use in FⅧ knock-in experiments and adapted in feeder free culture conditions.

A total of 9 embryonic stem cell (ESC) -like clones were selected. After 7 passages, it was confirmed by PCR that the episomal vector was missing from the clones except one. In addition, it was confirmed by PCR that the selected clone does not contain the EBNA-1 sequence encoded in the vector, and SSEA4, TRA-1-60, and OCT4, which are markers of pluripotency using immunostaining and RRT-PCR methods. , NANOG, SOX2, and 1 clone expressing Lin28 were selected. It was confirmed that the selected clones had differentiation capacity in vitro and a normal karyotype. FⅧ knock-in clones derived from the final selected FⅧ inverted-iPSC (inv-Pa) cells or FⅧ deleted-iPSC (del-Pa) cells were maintained in iPSC culture medium.

2. Construction of single-chain guide RNA and validation of nuclease activity

(One) sgRNA Production and screening

Single-chain guided RNA (single-chain) that recognizes the target site using a web-based in silico tool (crispr.mit.edu) to knock-in the FⅧ gene to the H11 locus of chromosome 22 guide RNA: sgRNA) was designed. The sequence of the designed sgRNA is shown in Table 1 below.

name sgRNA sequence / PAM sequence sgRNA-1 5'-CAGTATAAACTGACCTGTTG GGG -3 '(SEQ ID NO: 1) sgRNA-2 5'-CACAAGGCTATGCTATCTAT AGG -3 '(SEQ ID NO: 2) sgRNA-3 5'-CCCAACAGGTCAGTTTATAC TGG -3 '(SEQ ID NO: 3) sgRNA-4 5'-ATAGCCTTGTGGCTAATACC AGG -3 '(SEQ ID NO: 4) sgRNA-5 5'-CTATAGATAGCATAGCCTTG TGG -3 '(SEQ ID NO: 5) sgRNA-6 5'-ACAAGGCTATGCTATCTATA GGG -3 '(SEQ ID NO: 6) sgRNA-7 5'-TGAGCTTTAAAGACCCCAAC AGG -3 '(SEQ ID NO: 7) sgRNA-8 5'-CCAGTATAAACTGACCTGTT GGG -3 '(SEQ ID NO: 8) sgRNA-9 5'-CAGTATAAACTGACCTGTTG GGG -3 '(SEQ ID NO: 9)

In Table 1, protospacer adjacent motif (PAM) sequences are indicated in bold and underlined.

Nuclease activity was confirmed for the sequences of sgRNA-1 to sgRNA-4 in the designed sgRNA.

HEK-293T (ATCC) cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% (v / v) fetal bovine serum (FBS) and 1% (w / v) antibiotic. HEK-293T cells (ATCC) were transfected with Cas9 and sgRNA vectors. To confirm the nuclease activity, T7 endonuclease I (T7E1) assay was performed.

Specifically, in order to confirm the activity of CRISPR / Cas9 designed for the target site, T7E1 analysis was performed as described above. Briefly, HEK-293T cells were co-transfected with 1 μg SpCas9 plasmid (Tulsen) and 2 μg sgRNA plasmid (Tulsen) using Lipofectamine 2000 (Invitrogen). On the 4th day after co-transfection, a high-fidelity PrimeSTAR®Max DNA polymerase (Takara Bio) and the following primer pairs were used to amplify genomic DNA fragments containing nuclease target sequences.

T7E1 forward primer: 5'-GTGAGCTAAGGAATGTGATACAG-3 '(SEQ ID NO: 10)

T7E1 reverse primer: 5'-ACCCATGGAAATTGGGCACTG-3 '(SEQ ID NO: 11)

Mismatch DNA was cut by treating PCR amplicon with T7E1 nuclease. The nucleic acid amplification sample was subjected to electrophoresis, and the obtained image is shown in FIG. 1A (←: band by non-specific cleavage, *: band by specific cleavage). The band strength of uncut or cut fragments was measured.

As shown in FIG. 1A, sgRNA1 and sgRNA3 appear to have no nuclease activity, and sgRNA2 was confirmed to have lower nuclease activity compared to sgRNA4. Therefore, sgRNA4 was used as a guide RNA in future experiments.

(2) Selected sgRNA of indel  frequency

The efficiency of insertions and deletion (indel) of sgRNA4 was verified by the T7E1 assay, and the T7E1 forward primer of SEQ ID NO: 10 and the reverse primer of the following nucleotide sequence were used for the T7E1 assay.

T7E1 Reverse Primer 2: 5'-AGGCTGAGACAGAAGAATCGCCT-3 '(SEQ ID NO: 12)

The results of the indel efficiency analysis are shown in Fig. 1B (*: band by specific cleavage). The image in FIG. 1B was analyzed to calculate the indel frequency of sgRNA4. The calculated indel frequency is about 15%, confirming that the nuclease activity of sgRNA4 is quite high.

(3) Selected sgRNA Verification

Ten potential off-target positions within the 4nt range at the target site were searched using a web-based in silico tool (crispr.mit.edu). For deep sequencing analysis, PCR amplicons for each off-target site and target site were obtained from genomic DNA using high-accuracy PrimeSTAR®Max DNA polymerase (Takara Bio) and primer pairs in Table 2 below. It was prepared.

Target site Target sequence (5 '-> 3') Forward primer (5 '-> 3') Reverse primer (5 '-> 3') On-target
(On, Chr. 22) ATAGCCTTGTGGCTAATACC (SEQ ID NO: 13) GATTTGTTTGAGAGAAACTACC (SEQ ID NO: 14) CCTTGAGCTTTAAAGACCCC (SEQ ID NO: 15) Off-target 1
(OT1, Chr. 17) ACAGCCCTGTGGCTAACACT (SEQ ID NO: 16) ATGGTTAGCAGTCAACCGTG (SEQ ID NO: 17) CCACAAACAAGAGGTCATCC (SEQ ID NO: 18) Off-target 2
(OT2, Chr. 9) AAAGCCTGGTGGCTGATAAC (SEQ ID NO: 19) CTTCACTACCATCCCCCACT (SEQ ID NO: 20) ACTTTTGACATCCATCGCCG (SEQ ID NO: 21) Off-target 3
(OT3, Chr. 6) TTAGCCTAGTGGTTAATCCC (SEQ ID NO: 22) TTAGCACTAAGATGGACCAC (SEQ ID NO: 23) TACCTGCTTGGCACCATGTC (SEQ ID NO: 24) Off-target 4
(OT4, Chr. 20) CCAACCTAGTGGCTAATACC (SEQ ID NO: 25) GTAGTTTTAAAATAGGAGTCAGGG (SEQ ID NO: 26) GGTTCAATAACCATTGTTCCC (SEQ ID NO: 27) Off-target 5 (OT5, Chr. 5) ACACCCTTGTGGCTAAAACC (SEQ ID NO: 28) AGTGGACAGAATTCCCTCTG (SEQ ID NO: 29) TACACTAGGGGTCATTGAGC (SEQ ID NO: 30) Off-target 6
(OT6, Chr. 14) AGAGCCTTGTGACTAATACT (SEQ ID NO: 31) AGGAAAGCGTCTACTGTTAG (SEQ ID NO: 32) GTGTTAAATCTAGTGTGTTGC (SEQ ID NO: 33) Off-target 7
(OT7, Chr. X) TTAGTCTGGTGGCTAATACA (SEQ ID NO: 34) CCTTCAGAGTGGAATGCTAT (SEQ ID NO: 35) ATTAGAAGCGTCCTGGTAGG (SEQ ID NO: 36) Off-target 8
(OT8, Chr. 4) ATATCCATGTGGCTAATAGC (SEQ ID NO: 37) CAGGCCAGACTATAGAAGTT (SEQ ID NO: 38) AAGTTCAAATGCCCAATGGG (SEQ ID NO: 39) Off-target 9
(OT9, Chr. 7) ATGTCCTTGTGGCTAATCCC (SEQ ID NO: 40) TCTCTGGGGCTGAAACCCAA (SEQ ID NO: 41) GGAGGTCTTTGTGTCTTAGC (SEQ ID NO: 42) Off-target 10
(OT10, Chr. X) GGGGCCTTGTGGCTAACACC (SEQ ID NO: 43) AGACCTATCAGAGAGCCTAG (SEQ ID NO: 44) TAAGTTCCCCACAGCATCTC (SEQ ID NO: 45)

The PCR product obtained was purified using AccuPrep®PCR purification kit (Bionica Co., Ltd.). The purified PCR amplicon was paired-end sequencing using the MiSeq system (Illumina). The Indel located around the nuclease cleavage site was considered a mutation due to a mutation by Cas9.

In addition, in-depth sequencing was performed, and the calculated sgRNA4 indel frequency and base sequence of the indel site are shown in FIGS. 1C and 1D. As shown in FIG. 1C, the indel frequency of sgRNA4 was about 25.8%, and an off-target mutation was not identified in 8 homology sites. As shown in Figure 1D, various indels were identified at the target site.

3. Human H11 To the left  Gene modification by knock-in of F 'gene

(1) Preparation of knock-in donor vector

To construct the knock-in donor plasmid, the pCDNA4 / BDD-F 'plasmid (addgene, no. 41035) was used as a backbone. Using the MfeI and MauBI restriction sites of the backbone, 5'-homologous arms (LA) and 3'-homologous arms (RA) were inserted by In-Fusion cloning, respectively. Next, the human elongation factor 1 alpha (EF1α) promoter sequence was cloned between LA and F 'open reading frame (ORF). Subsequently, the puromycin expression cassette with loxP sites flanked was inserted between the F 'gene cassette and RA by In-Fusion cloning.

After constructing the donor plasmid, the sequence of the DNA cloned by Sanger sequencing was confirmed by Solgent, Inc. (Korea). The schematic diagram of the produced donor plasmid is shown in FIG. 2.

(2) iPSC's  Transfection, selection, and harvesting of successfully edited cells

Recombinant Cas9 protein (SpCas9) derived from Streptococcus pyogenes was purchased from ToolGen, Inc. The 5'-GGX ₂₀ sgRNA for SpCas9 (5'-ATAGCCTTGTGGCTAATACC-3 ': SEQ ID NO: 14) was transcribed in vitro under the control of the T7 promoter using the MEGAshortscriptTM kit (Ambion). Purification as described in Kim, S. et al., Genome Res., Vol. 24, p. 1012-1019 (2014) gave sgRNA.

Cas9 ribonucleoprotein (RNP) was prepared by mixing 15 μg of SpCas9 protein with 20 μg of in vitro transcribed sgRNA and incubating for 10 minutes at room temperature.

IPSCs prepared as described in Example 1.1 were pretreated with 10 μM ROCK inhibitor (Y-27632, Sigma) for at least 2 hours prior to electroporation. After washing with PBS, cells were treated with 1X Versene solution (Life Technologies) for 3 minutes. Thereafter, the cells were scraped off and separated into almost single cells.

After centrifugation, 5 × 10 ⁵ cells were electroporated with Cas9 RNP and 3 μg of donor DNA using Neon Transfection System (Life Technologies). After pulsed once for 10 ms at a voltage of 850, cells were cultured in StemMACS ™ iPS-Brew XF medium (Miltenyi Biotec) with 10 μM Y-27632 for 1 day. Four days after transfection, cells were selected using 0.5 μg / mL puromycin. Clone populations of targeted cells were passaged three times to isolate.

PCR-based genotyping was performed to identify colonies containing the knock-in gene as a target site.

Genomic DNA was isolated from cells using DNeasy Blood & Tissue kit (Qiagen). To identify targeted knock-in of donor DNA at the H11 locus, DNA fragments containing each knock-in junction were amplified using EmeraldAmp®GT PCR Master Mix (Takara Bio). After PCR purification, the sequence of each DNA amplicon was confirmed by Sanger sequencing at Solgent, Inc. (Korea).

Nine out of 14 colonies (64.3% for Inv-Pa) and 18 out of 27 colonies (66.7%) showed positive PCR bands for inv-Pa and del-Pa knock-in junctions on agarose gels. .

After 3 passages, 2 clones (inv-K1 and inv-K2) from inv-Pa iPSC and 3 clones (del-K1 to del-K3) from del-Pa iPSC were obtained, and all clones were single alleles. It was confirmed to be a trait (allele) knock-in clone (FIG. 3A, blue and underline: sgRNA target site, red: PAM sequence, arrow: primer position used for genotyping). Additionally, the PCR amplicon was analyzed by Sanger sequencing to verify that all clones were knocked-in to the target site.

Next, in order to remove the puromycin expression cassette from the FⅧ knock-in clone, inv-K1 and del-K1 clones having no indel at both the target site and alleles thereof were selected. 1 μg of Cre expression plasmid (pCAG-Cre: GFP, addgene) was electroporated in 2 × 10 ⁵ knock-in iPSC to express Cre recombinase transiently. Clones were isolated by single cell passage culture. Seven colonies were screened by PCR-based genotyping using F3 and R2 primer pairs.

In addition, it was confirmed that the puromycin selection cassette was excisioned through PCR-based genotyping using a specific primer pair (FIG. 3B, black arrow: DNA band including the puromycin cassette in inv-K1 and del-K1 clones). ).

F1 primer: 5'-CAACCCAGTCCTCCTTACCTTGC-3 '(SEQ ID NO: 46)

F2 primer: 5'-GCCTGAGGGGATCAATTCTCTAG-3 '(SEQ ID NO: 47)

F3 primer: 5'-GGCCCTTTCGTCTTCAAGAATTCCG-3 '(SEQ ID NO: 48)

R1 primer: 5'-CCGTTGCGAAAAAGAACGTTCAC-3 '(SEQ ID NO: 49)

R2 primer: 5'-GTTAGGCCTGTGTCAACAGTTTGG-3 '(SEQ ID NO: 50)

Recombination between two loxP sites was verified by Sanger sequencing (FIG. 3C). Three puromycin-ablation clones (inv-K1e1 to inv-K1e3) were obtained from the inv-K1 clone, and two clones (del-K1e1 and del-K1e2) were obtained from the del-K1 clone. These results indicate that the targeted knock-in method genetically corrected the F 'gene at the H11 locus.

4. In the calibrated clone Starch  Check and Off-target  analysis

(One) Starch potency  Confirmation of gene expression

It was investigated whether the clones obtained as described in Example 1.3 retain starch differentiation characteristics compared to parent clones.

Total RNA was purified from cells using the Easy-SpinTM Total RNA Extraction Kit (iNtRON Biotech). CDNA was synthesized from 1 μg of total RNA using PrimeScriptTM RT Master Mix (Takara Bio). qPCR was performed using SYBR Premix Ex-Taq (Takara Bio) and CFX96 Real-Time System (Bio-Rad) for quantification of mRNA levels. The Ct value for each gene was normalized to the Ct value for GAPDH. Semiquantitative RT-PCR was performed using EmeraldAmp®GT PCR Master Mix (Takara Bio). The following primer pairs were used to amplify F 'mRNA in a knock-in clone.

Forward primers complementary to the nucleotide sequence of exon 21:

5'-CCGGATCAATCAATGCCTGGAG-3 '(SEQ ID NO: 51)

Reverse primer complementary to the nucleotide sequence of exon 23:

5'-ATGAGTTGGGTGCAAACGGATG-3 '(SEQ ID NO: 52)

All calibrated clones actively transcribed the pluripotent genes, including OCT4, SOX2, and LIN28 (FIG. 4A), similar to proteolytic marker proteins such as SSEA4, TRA-1-60, OCT4 and NANOG compared to parent iPSC clones Levels were maintained (Figure 4b).

(2) Tricot  Confirmation of eruption

iPSC was partially separated into chunks using collagenase type IV (Invitrogen). The mass was transferred to a low-adhesive tissue plate to form an embryonic body (EB) and cultured for one week in iPSC culture medium without bFGF and containing 5% (v / v) FBS. Next, EB was attached to a matrigel-coated cover slip, and further cultured for 10 days to induce spontaneous differentiation into cells showing the layer of the three germ layers of EB.

Cells were fixed for 10 min in a 4% (v / v) paraformaldehyde solution containing 0.2% (v / v) Triton X-100 at room temperature and washed 3 times with PBS. To the washed cells, a blocking solution containing 5% normal goat serum (v / v) and 2% bovine serum albumin (v / v) was added and incubated at room temperature for 1 hour.

Anti-NEXTIN antibody (Millipore), α-smooth muscle actin (SMA) antibody (Sigma), and hepatocyte nuclear factor (HNF) -3β antibody (Santa Cruz) were added to the cells, and at room temperature, 2 Incubated for hours. Cells were then washed twice with PBS and incubated with a fluorescent-bound secondary antibody (Alexa Fluor® 488 or 594; Invitrogen) for 1 hour at room temperature. Cells were then washed again with PBS containing 0.1% (v / v) Tween 20 and mounted on the coverslip using a mounting solution. For the visualization of the nucleus, 4 ', 6-diamidino-2-phenylindole (DAPI, Vector Laboratories) was used. Images were captured and analyzed using an Olympus IX71 fluorescence microscope. The captured image is shown in FIG. 4C (bar scale: 100 μm).

As shown in Fig. 4c, the corrected clone showed positive immunostaining results for NESTIN (ectoderm), α-SMA (mesoderm), and HNF-3β (endoderm). Thus, the corrected clone successfully differentiated into three germ layers.

(3) Karyotype analysis

For karyotype analysis of the corrected clones, chromosomes isolated from each iPSC clone were stained with Giemsa for G-band analysis and analyzed using a Chromosome Image Processing System from GenDix Inc. (Korea).

The results of the karyotype analysis are shown in Fig. 4D. As shown in Figure 4d, the corrected clone showed normal 46, XY karyotype.

(4) off - target  Analysis of mutation

It was investigated whether the off-target mutation was induced by nuclease in the corrected clone. Ten potential off-target sites were examined by targeted deep sequencing in 4 calibrated clones and 2 parent clones, and the results are shown in FIG. 4E (OT: off target, blue: mismatch nucleotide, red Color: PAM sequence (5'-NRG-3 ', R = A or G).

As shown in Figure 4e, it was confirmed that no significant off-target mutation was induced in the corrected clone.

5. Correct phenotype of F 의 deficiency in vitro

After successfully targeting the F 'gene at the locus, the in vitro culture system was used to confirm the phenotype of the corrected clone. Using semi-quantitative RT-PCR, the FⅧ mRNA expression level of the H11 locus was measured in the undifferentiated step.

As expected, the PCR bands corresponding to F ′ exons 21 and 23 were not amplified in both types of patient iPSCs due to incorrect splicing (inv-Pa) or deletion of the corresponding site (del-Pa) (FIG. 5A). In contrast, PCR bands corresponding to exons 21 and 23 were amplified in calibrated iPSC and detected with or without a selection cassette (FIG. 5A).

In addition, qPCR analysis demonstrated that there was no difference in the expression of the FⅧ gene between post-excision clones (inv-K1e1 to inv-K1e3, or del-K1e1 and del-K1e2) (FIG. 5B).

It was investigated whether the induction of FⅧ expression corresponds to the increased FⅧ activity in the corrected clone. To measure F 'activity, the culture supernatant was concentrated 20-fold using an Amicon® Ultra-4 centrifugal filter (Millipore). FⅧ activity was measured for the concentrated culture supernatant using a Coamatic® Factor 색 Coloration Assay Kit (Instrumentation Laboratory). FⅧ activity measurements were performed in 96-well microplates and absorbance at 405 nm was determined as endpoint readings using a microplate reader (Molecular Devices). A standard curve was made by diluting the human Calibration Plasma. The measured F 'activity (%) is shown in Figure 5c.

As shown in Figure 5c, regardless of whether all of the corrected clones had a selection cassette, they showed very high F 'activity levels compared to the level of parent patient-iPSC. These results indicated that the phenotype of patient iPSCs can be corrected in vitro by expression of the F 'gene via the knock-in targeted at the H11 locus.

6. Functional Healing of FⅧ Deficiency in Hemophilia Mice

(1) Differentiation into endothelial cells

To induce differentiation of iPSCs into endothelial cells (ECs), iPSCs were pretreated with 10 μM ROCK inhibitor (Y-27632, Sigma) for at least 2 hours prior to passage. After washing with PBS, cells were treated with 1X Versene solution (Life Technologies) for 3 minutes. Cells were scraped off and separated into small chunks. After centrifugation, the mass was inoculated into a Matrigel-coated culture dish and incubated for 1 day in StemMACS ™ iPS-Brew XF medium (Miltenyi Biotec) containing 10 μM Y-27632. After 2 days, the culture medium was replaced with STEMdiff ™ APEL ™ medium (STEMCELL Technologies) containing 6 μM CHIR99012 (Tocris Bioscience) to induce mesoderm. Cells were then treated with 25 ng / mL bone morphogenetic protein 4 (BMP4, R & D Systems), 10 ng / mL bFGF (PeproTech), and 50 ng / mL vascular endothelial cell growth factor (VEGF, R & D Systems). Vascular progenitor cells were induced by incubation for 2 days in STEMdiff ™ APEL ™ medium with. Finally, the cells were cultured in EC growth medium MV2 (ECGM-MV2, PromoCell) with 50 ng / mL VEGF to generate endothelial progenitor cells, and then the medium was changed every 2 days.

The cells inducing differentiation were subjected to immunostaining for the endothelial cell markers CD31 and von Willebrand factor (vWF), and the results are shown in FIG. 6A. As shown in FIG. 6A, all clones showed cobblestone-like morphology on the 4th day of differentiation, and staining of CD31 and vWF was positive at the end of differentiation. Thus, no problems were found in the differentiation of clones into endothelial cells.

The level of mRNA of vWF, CD31, and F 'was further evaluated by qPCR analysis. The following primer pairs were used for the detection of vWF and CD31, and the primer pairs of SEQ ID NOs: 51 and 52 were used for the detection of F '.

vWF forward primer: 5'-TCGGGCTTCACTTACGTTCT-3 '(SEQ ID NO: 53)

vWF reverse primer: 5'-CCTTCACTCGGACACACTCA-3 '(SEQ ID NO: 54)

CD31 forward primer: 5'-GGTCAGCAGCATCGTGGTCAACATAAC-3 '(SEQ ID NO: 55)

CD31 reverse primer: 5'-TGGAGCAGGACAGGTTCAGTCTTTCA-3 '(SEQ ID NO: 56)

The mRNA levels of vWF, CD31, and F 'are shown in FIG. 6B (ND: not detected). As shown in FIG. 6B, markers of endothelial cells, CD31 and vWF, were amplified in all endothelial cells. In endothelial cells differentiated from inv-Pa and del-Pa clones, PCR bands corresponding to FⅧ exons 21 and 23 were not detected, whereas FⅧ mRNA was amplified in endothelial cells differentiated from the corrected iPSC clone.

FⅧ activity was measured, and the results are shown in FIG. 6C (*: p <0.001 compared to the parent cell). As shown in Fig. 6c, the endothelial cells differentiated from the corrected iPSC clone had a significant increase in FⅧ activity level (%) compared to the endothelial cells differentiated from the parent patient iPSC clone.

(2) In vivo transplantation of endothelial cells

To investigate the level of functional recovery, endothelial cells derived from parent patient iPSCs (inv-Pa and del-Pa) and calibrated iPSCs (inv-K1e1 and del-K1e1) were implanted intravenously into FⅧ deficient HA mice.

Specifically, HA mice (Jackson Laboratory, B6; 129S4-F8tm1Kaz / J) were used. 8-week-old mice were injected with 1 × 10 ⁶ endothelial cells (in 100 μl of PBS) from the patient iPSC or FⅧ knock-in iPSC through the tail vein. For immunosuppression, 20 mg / kg of anti-LFA-1 and CTLA4-Ig (BioXCell) were injected intraperitoneally prior to implantation of endothelial cells. Three days after transplantation, blood samples were collected through a tail snip. Plasma was obtained by mixing a blood sample and a 3.8% (w / v) sodium citrate solution (citrate volume: blood volume = 1: 9) and centrifuging at 1,500 xg for 10 minutes at 20 ° C. FⅧ activity was calculated using the obtained plasma sample. HA mice that were not transplanted as negative controls were used. All animal experiments were approved by the Yonsei University Animal Experiment Ethics Committee (IACUC-2017-0138).

The calculated FⅧ activity (%) is shown in FIG. 6D (HA: unimplanted mouse, ns: not significant, *: p <0.05 compared to inv-Pa, **: p <compared to del-Pa 0.01). As shown in FIG. 6D, it was significantly increased compared to unimplanted mice (0.8%) and patient iPSC-derived cells (1.1% in inv-Pa and 1.2% in del-Pa). These results indicate that the transplantation of corrected iPSC-derived endothelial cells functionally restored FⅧ deficiency in vivo.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Composition for correcting blood coagulation factor VIII and          method using the same <130> PN123130KR <160> 56 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> single-chain guide RNA 1 <400> 1 cagtataaac tgacctgttg ggg 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> single-chain guide RNA 2 <400> 2 cacaaggcta tgctatctat agg 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> single-chain guide RNA 3 <400> 3 cccaacaggt cagtttatac tgg 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> single-chain guide RNA 4 <400> 4 atagccttgt ggctaatacc agg 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> single-chain guide RNA 5 <400> 5 ctatagatag catagccttg tgg 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> single-chain guide RNA 6 <400> 6 acaaggctat gctatctata ggg 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> single-chain guide RNA 7 <400> 7 tgagctttaa agaccccaac agg 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> single-chain guide RNA 8 <400> 8 ccagtataaa ctgacctgtt ggg 23 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> single-chain guide RNA 9 <400> 9 cagtataaac tgacctgttg ggg 23 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> T7E1 Forward primer <400> 10 gtgagctaag gaatgtgata cag 23 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> T7E1 Reverse primer <400> 11 acccatggaa attgggcact g 21 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> T7E1 Reverse primer 2 <400> 12 aggctgagac agaagaatcg cct 23 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of on-target <400> 13 atagccttgt ggctaatacc 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for on-target <400> 14 gatttgtttg agagaaacta cc 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for on-target <400> 15 ccttgagctt taaagacccc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of off-target 1 <400> 16 acagccctgt ggctaacact 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 1 <400> 17 atggttagca gtcaaccgtg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 1 <400> 18 ccacaaacaa gaggtcatcc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequenc of off-target 2 <400> 19 aaagcctggt ggctgataac 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 2 <400> 20 cttcactacc atcccccact 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 2 <400> 21 acttttgaca tccatcgccg 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of off-target 3 <400> 22 ttagcctagt ggttaatccc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 3 <400> 23 ttagcactaa gatggaccac 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 3 <400> 24 tacctgcttg gcaccatgtc 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of off-target 4 <400> 25 ccaacctagt ggctaatacc 20 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 4 <400> 26 gtagttttaa aataggagtc aggg 24 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 4 <400> 27 ggttcaataa ccattgttcc c 21 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of off-target 5 <400> 28 acacccttgt ggctaaaacc 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 5 <400> 29 agtggacaga attccctctg 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 5 <400> 30 tacactaggg gtcattgagc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of off-target 6 <400> 31 agagccttgt gactaatact 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 6 <400> 32 aggaaagcgt ctactgttag 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 6 <400> 33 gtgttaaatc tagtgtgttg c 21 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of off-target 7 <400> 34 ttagtctggt ggctaataca 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 7 <400> 35 ccttcagagt ggaatgctat 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 7 <400> 36 attagaagcg tcctggtagg 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of off-target 8 <400> 37 atatccatgt ggctaatagc 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 8 <400> 38 caggccagac tatagaagtt 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 8 <400> 39 aagttcaaat gcccaatggg 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of off-target 9 <400> 40 atgtccttgt ggctaatccc 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 9 <400> 41 tctctggggc tgaaacccaa 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 9 <400> 42 ggaggtcttt gtgtcttagc 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Target sequence of off-target 10 <400> 43 ggggccttgt ggctaacacc 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for off-target 10 <400> 44 agacctatca gagagcctag 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for off-target 10 <400> 45 taagttcccc acagcatctc 20 <210> 46 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F1 primer <400> 46 caacccagtc ctccttacct tgc 23 <210> 47 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F2 primer <400> 47 gcctgagggg atcaattctc tag 23 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> F3 primer <400> 48 ggccctttcg tcttcaagaa ttccg 25 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> R1 primer <400> 49 ccgttgcgaa aaagaacgtt cac 23 <210> 50 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> R2 primer <400> 50 gttaggcctg tgtcaacagt ttgg 24 <210> 51 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer complementary to nucleotide sequence of exon 21 <400> 51 ccggatcaat caatg cctgg ag 22 <210> 52 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer complementary to nucleotide sequence of exon 23 <400> 52 atgagttggg tgcaaacgga tg 22 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> vWF Forward primer <400> 53 tcgggcttca cttacgttct 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> vWF Reverse primer <400> 54 ccttcactcg gacacactca 20 <210> 55 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CD31 Forward primer <400> 55 ggtcagcagc atcgtggtca acataac 27 <210> 56 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CD31 Reverse primer <400> 56 tggagcagga caggttcagt ctttca 26

Claims (18)

A guide RNA consisting of the sequence of SEQ ID NO: 4 or a first polynucleotide encoding the same; And
A second polynucleotide encoding an open reading frame (ORF) of a B-domain deleted blood coagulation fateor VIII (BDD-VIII) gene lacking a B domain,
A composition for correcting blood coagulation factor Ⅷ (FⅧ or F8). The composition of claim 1, wherein the first polynucleotide comprises a protospacer adjacent motif (PAM). The method according to claim 2, wherein the PAM comprises a nucleotide sequence selected from the group consisting of 5'-TGG-3 ', 5'-TAG-3', 5'-AGG-3 ', and 5'-CTG-3' Composition. The method according to claim 1, wherein the first polynucleotide is 10 nucleotides to 100 nucleotides in length. delete The composition according to claim 1, wherein the first polynucleotide, the second polynucleotide, or a combination thereof is included in a vector. The composition according to claim 6, wherein the vector is an episomal vector. The composition according to claim 1, which is for knock-in of the F 'gene. The composition according to claim 1, wherein the composition is for in vitro, ex vivo, or in vivo administration. The method according to claim 1, RNA guide nuclease (RNA-guided nuclease: RGN) or a composition further comprising a third polynucleotide comprising a nucleotide sequence encoding the same. The composition of claim 10, wherein the RNA guide nuclease is a Cas polypeptide. The composition according to claim 11, wherein the Cas polypeptide is a Cas9 polypeptide or a Cpf1 polypeptide. Obtaining dedifferentiated induced pluripotent stem cells (iPSCs) from isolated somatic cells of Hemophilia A (HA) patients;
Comprising the step of transforming the induced pluripotent stem cells by contacting the induced pluripotent stem cells and the composition of claim 1,
Method for producing induced pluripotent stem cells with FⅧ gene correction. The method according to claim 13, wherein the FⅧ gene-corrected induced pluripotent stem cell has a B-domain deleted blood coagulation fateor VIII (BDD-VIII) lacking a B domain at the locus of H11 in its genome. How the gene is inserted. Induced pluripotent stem cells prepared by the method of claim 13. An endothelial cell differentiated from induced pluripotent stem cells of claim 15. A pharmaceutical composition for preventing or treating hemophilia A, comprising the composition of claim 1, the induced pluripotent stem cell of claim 15, or the endothelial cell of claim 16. A method of preventing or treating hemophilia A, comprising administering to a subject other than a human, the composition of claim 1, the induced pluripotent stem cell of claim 15, or the endothelial cell of claim 16.

Images