KR101956805B1 - Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol - Google Patents

Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol Download PDF

Info

Publication number
KR101956805B1
KR101956805B1 KR1020190020723A KR20190020723A KR101956805B1 KR 101956805 B1 KR101956805 B1 KR 101956805B1 KR 1020190020723 A KR1020190020723 A KR 1020190020723A KR 20190020723 A KR20190020723 A KR 20190020723A KR 101956805 B1 KR101956805 B1 KR 101956805B1
Authority
KR
South Korea
Prior art keywords
lt
ldlr
gt
pcsk9
expression
Prior art date
Application number
KR1020190020723A
Other languages
Korean (ko)
Inventor
정민유
최효경
황진택
김효진
Original Assignee
한국식품연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국식품연구원 filed Critical 한국식품연구원
Priority to KR1020190020723A priority Critical patent/KR101956805B1/en
Application granted granted Critical
Publication of KR101956805B1 publication Critical patent/KR101956805B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; THEIR TREATMENT, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A23B - A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/01Hydrocarbons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/045Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/05Phenols
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; THEIR TREATMENT, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES
    • A23V2002/00Food compositions, function of food ingredients or processes for food or foodstuffs
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; THEIR TREATMENT, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES
    • A23V2200/00Function of food ingredients
    • A23V2200/30Foods, ingredients or supplements having a functional effect on health
    • A23V2200/3262Foods, ingredients or supplements having a functional effect on health having an effect on blood cholesterol

Abstract

본 발명은 부테인 또는 이소유제놀을 포함하는 PCSK9 유전자의 발현 감소 또는 저밀도 지단백 수용체(LDLR)를 증가용 식품 조성물에 관한 것이다. The present invention relates to a unit for the food heptane or iso eugenol decreased expression or low-density lipoprotein receptor (LDLR) of the PCSK9 gene comprising the composition increases.
본 발명의 조성물은 스타틴계 화합물에 의해 증가된 PCSK9 유전자의 발현을 억제시키고, 저밀도 지단백 수용체를 증가시키는 효과를 나타내 결과적으로 콜레스테롤의 혈중 수치를 낮추므로 비만, 제2형 당뇨병, 고혈압, 심장혈관 질환 또는 고지혈증 등의 대사성 질환의 예방 또는 개선 용도로 활용할 수 있다. The compositions of the present invention is to suppress the expression of the PCSK9 gene increase by a statin compound, indicate the effect of increasing LDL receptor as a result lowers the blood levels of cholesterol, obesity, type 2 diabetes, hypertension, cardiovascular diseases or it can be used to prevent or improve metabolic diseases such as hyperlipidemia purposes.

Description

부테인 또는 이소유제놀을 포함하는 PCSK9 유전자의 발현 감소 또는 저밀도 지단백 수용체 증가용 조성물{Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol} Heptane or iso portion for decreased expression of the PCSK9 gene containing eugenol or low-density lipoprotein receptor increased composition {Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol}

본 발명은 부테인 또는 이소유제놀을 포함하는 PCSK9 유전자의 발현 감소 또는 저밀도 지단백 수용체 증가용 조성물에 관한 것이다. The present invention relates to a PCSK9 gene expression or for the reduction of low-density lipoprotein receptor increases a composition comprising a sub-heptane or iso-eugenol.

혈중 과도로 축적된 저밀도 지단백(Low-density lipoprotein; LDL) 콜레스테롤은 동맥경화를 촉진시키거나 악화시키는 주요 요인이 된다. A low density lipoprotein accumulation by excessive blood (Low-density lipoprotein; LDL) cholesterol is a major factor in atherosclerosis, or to promote deterioration. 고 콜레스테롤 혈증은 동맥경화 외에도 협심증, 심근경색증 등 다양한 심장 관련 질환과 뇌졸중, 고혈압 등 뇌혈관 질환 유발의 원인으로 알려져 오랫동안 연구되어 왔다. Hypercholesterolemia, in addition to hardening of the arteries known as a cause of angina pectoris, myocardial infarction and various heart-related disease and stroke, high blood pressure, such as cerebrovascular disease causes have long been studied. 최근 혈중 고콜레스테롤로 인한 이러한 질병들은 우리나라뿐 아니라 여러 나라에서 주요 사망 원인으로 알려졌다. The disease caused by high blood cholesterol have recently announced a major cause of death in many countries as well as Korea. 고콜레스테롤 혈증은 운동과 식이요법을 통하여 콜레스테롤 수치를 정상 범위로 유지하는 것이 권고되지만, 이러한 생활 습관의 교정은 지속되기 어렵고, 결국 약물에 의존하게 되는 경우가 빈번하다. Hypercholesterolemia is a recommendation, but to keep your cholesterol through exercise and diet to a normal range, the correction of these habits are difficult to be sustained, it is frequently the case that ultimately dependent on the drug.

인체는 콜레스테롤 합성과 배출을 조절하여 생체 내 항상성을 이루려는 일련의 노력을 지속적으로 한다. The human body is a series of efforts to fulfill the in vivo synthesis and cholesterol homeostasis by regulating emissions continuously. 콜레스테롤 항상성 유지를 위하여 생체 내에서 주요하게 조절되는 인자 중 하나가 바로 SREBP2(sterol regulatory element-binding protein 2)이다. It is one of the factors that are mainly controlled in the body immediately SREBP2 (sterol regulatory element-binding protein 2) for cholesterol homeostasis. 콜레스테롤이 많은 환경에서 SREBPs는 SCAP(SREBP cleavage-activating protein)과 결합한 상태로 ER 멤브레인에 존재하고 있다. On a high cholesterol environment SREBPs are present in the ER membrane in a state combined with (SREBP cleavage-activating protein) SCAP. 반면, 콜레스테롤이 적은 환경(예를 들어, 스타틴 약물 복용에 의해 콜레스테롤 수치가 떨어진 경우)에서는 SREBP-SCAP 결합이 끊어지면서, SREBP는 ER에서 골지로 이동한다. On the other hand, (for e. G., Cholesterol fell by statin drugs), cholesterol is less environment, the SREBP-SCAP combined As cut, SREBP moves from the ER to the Golgi. SREBP의 단백질 분해 활성화(proteolytic activation)으로 골지에서 SREBP는 핵 안으로 이동한 후, 타겟 유전자의 SRE(sterol regulatory elements)와 결합하여 콜레스테롤 합성에 관여하는 유전자들인 LDLR(LDL receptor), HMGCR(HMG-CoA reductase)의 발현을 조절한다. From the Golgi to the proteolytic activation of SREBP (proteolytic activation) SREBP nuclear to move in and then, LDLR, which are genes involved in cholesterol synthesis in combination with the SRE (sterol regulatory elements) of the target gene (LDL receptor), HMGCR (HMG-CoA It regulates the expression of the reductase). 이를 통해 혈중 콜레스테롤 함량은 줄어들게 되고 세포 내 LDL 콜레스테롤의 양은 증가하게 된다. This plasma cholesterol level is reduced by the increased amount of the LDL cholesterol cells.

고콜레스테롤 치료제로 각광받아 온 스타틴은 HMG-CoA 환원효소 억제제로 콜레스테롤 생합성을 억제하여 콜레스테롤 수치를 낮추는 약물이다. On statin received attention as high cholesterol treatment is a medication to lower the cholesterol level by inhibiting cholesterol biosynthesis by HMG-CoA reductase inhibitor. LDL 콜레스테롤 저감 효능이 뛰어나지만 최근 스타틴 복용 환자 5명 중 한 명꼴로 콜레스테롤 저항성이 보고되었다. The LDL cholesterol reduction efficacy while very recent patients reported taking statin cholesterol-resistant as one out of five. Robinson 등(2015)과 Sabatine 등(2015)의 연구 결과, 고콜레스테롤 혈증 환자 중 스타틴 약물을 복용하고 있으나 LDL 콜레스테롤 저감 효능이 나타나지 않은 환자를 대상으로 PCSK9 억제제인 alirocumab와 elolocumab를 각각 투여한 결과, LDL 콜레스테롤 저감 효과가 60% 이상 증가하였다. Robinson et al. (2015) and Sabatine the like (2015) study, hypercholesterolemia, but is taking a statin drug in patients with the results of administration of the PCSK9 inhibitors alirocumab and elolocumab the patients have LDL cholesterol reduction efficacy does not appear in each, LDL the cholesterol-lowering effect was increased 60% or more. 이러한 연구 결과들은 PCSK9이 LDL 콜레스테롤 저감에 새로운 타겟으로 작용할 수 있다는 가능성을 보여 주고 있다. These studies have shown the possibility that this could serve as a new target PCSK9 on LDL cholesterol reduction.

PCSK9은 간에서 세포 표면에 존재하는 LDL 수용체와 결합하여 수용체를 분해시키며, 이는 혈중 LDL 콜레스테롤의 클리어런스(clearance)를 방해한다. PCSK9 is sikimyeo combination with LDL receptor on the cell surface receptors in the liver decomposition, which interferes with the clearance (clearance) of serum LDL cholesterol. Alirocumab와 elolocumab 등 PCSK9 억제제는 미국 FDA의 허가를 받았지만, 그 안정성 측면에 대한 연구는 현재까지도 진행 중이다. Alirocumab elolocumab such as PCSK9 inhibitors have received permission from the US FDA, studies on its safety aspects are underway today. 정신적인 문제(mental confusion)나 집중력 저하 등이 몇몇 환자에게서 관찰되었고, 반드시 주사로 제공되어야 하는 단점이 있으며, 기존 약물들보다 경제적인 측면에서도 부담이 매우 크다. Psychological problems (mental confusion) and include poor concentration was observed in some patients, there is a disadvantage that must be provided in the injection, so the burden is greater in economic terms than existing drugs. 따라서, PCSK9을 억제하는 식품 소재를 발굴한다면, 이러한 소재가 스타틴 복용과 함께 혹은 독립적으로 고콜레스테롤 혈증이나 콜레스테롤 저항성을 개선할 수 있는 안전한 소재로 제안될 수 있을 것이다. Therefore, if you dig the food material to inhibit PCSK9, such a material with high statin doses or independently, will be proposed as a safe material that can improve cholesterol and cholesterol resistance.

본 발명자들은 부테인 또는 이소유제놀이 PCSK9 유전자의 발현을 감소시키거나, 저밀도 지단백 수용체(LDLR)를 증가시킨다는 사실을 규명하고, 본 발명을 완성하였다. The inventors have identified the fact that the portions retain or iso emulsion play to reduce the expression of the PCSK9 gene or increase the low density lipoprotein receptor (LDLR), and completed the present invention.

따라서 본 발명의 목적은 부테인을 포함하는 PCSK9 유전자의 발현 감소용 식품 조성물을 제공하는 데 있다. It is therefore an object of this invention to provide a food composition for decreasing the expression of the PCSK9 gene, including part octane.

본 발명의 다른 목적은 부테인을 포함하는 저밀도 지단백 수용체 증가용 식품 조성물을 제공하는 데 있다. Another object of the present invention to provide a food composition for a low-density lipoprotein receptor, including increased parts heptane.

본 발명의 다른 목적은 부테인을 포함하는 스타틴에 대하여 내성을 갖는 고콜레스테롤 혈증의 예방 또는 치료용 약제학적 조성물을 제공하는 데 있다. It is another object of this invention to having a high resistance to statins, including portions retain provide prevention or treatment a pharmaceutical composition of the hypercholesterolemia.

본 발명의 다른 목적은 이소유제놀을 포함하는 PCSK9 유전자의 발현 감소용 식품 조성물을 제공하는 데 있다. Another object of the present invention to provide a food composition for decreasing the expression of the PCSK9 gene, including iso eugenol.

본 발명의 다른 목적은 이소유제놀을 포함하는 저밀도 지단백 수용체 증가용 식품 조성물을 제공하는 데 있다. Another object of the present invention to provide a food composition for a low-density lipoprotein receptor, including increased iso eugenol.

본 발명의 다른 목적은 이소유제놀을 포함하는 스타틴에 대하여 내성을 갖는 고콜레스테롤 혈증의 예방 또는 치료용 약제학적 조성물을 제공하는 데 있다. Another object of the present invention is to provide a preventive or therapeutic pharmaceutical composition for hypercholesterolemia having a resistance to statins, including iso eugenol.

본 발명의 일 양태는 부테인을 포함하는 PCSK9 유전자의 발현 감소용 식품 조성물에 관한 것이다. One aspect of the invention relates to a food composition for decreasing the expression of the PCSK9 gene, including part octane.

본 발명의 다른 양태는 부테인을 포함하는 저밀도 지단백 수용체(LDLR) 증가용 식품 조성물에 관한 것이다. Another aspect of the invention relates to increasing food composition for a low-density lipoprotein receptor (LDLR), including portions retain.

본 발명의 다른 양태는 이소유제놀을 포함하는 PCSK9 유전자의 발현 감소용 식품 조성물에 관한 것이다. Another aspect of the invention relates to a food composition for decreasing the expression of the PCSK9 gene, including iso eugenol.

본 발명의 다른 양태는 이소유제놀을 포함하는 저밀도 지단백 수용체(LDLR) 증가용 식품 조성물에 관한 것이다. Another aspect of the invention relates to a food composition for increasing LDL receptor (LDLR), including iso-eugenol.

본 발명은 부테인 또는 이소유제놀을 포함하며, PCSK9 유전자의 발현을 감소시키거나, 저밀도 지단백 수용체를 증가시키기 위한 식품 조성물에 관한 것으로 상기 조성물은 PCSK9 발현량의 감소시키고 저밀도 지단백 수용체(LDLR)의 발현을 증가시켜 결과적으로 혈중의 콜레스테롤 수치를 낮추는 것이므로, 비만, 제2형 당뇨병, 고혈압, 심장혈관 질환 또는 고지혈증 등의 대사성 질환의 예방 또는 개선 용도로 활용할 수 있다. The invention unit comprises octane or iso-eugenol, decrease the expression of the PCSK9 gene, or to the composition of the food composition for increasing LDL receptor reduces the PCSK9 expression level of low-density lipoprotein receptor (LDLR) as a result, the increased expression can be used to lower blood cholesterol levels because, prevention or improvement of metabolic diseases such as obesity, type 2 diabetes, hypertension, cardiovascular disease or hyperlipidemia purposes.

본 발명의 식품 조성물에서 식품은 특별히 제한되지 않으며, 건강기능식품, 영양보조제, 영양제, 파머푸드(pharmafood), 건강식품, 뉴트라슈티칼(nutraceutical), 디자이너 푸드, 식품 첨가제 등의 모든 형태의 식품을 포함할 수 있다. In the food composition of the present invention, the food is not particularly limited, a functional food, nutritional supplements, nutrients, Palmer Food (pharmafood), Health Food, Nutra shoe Tikal all types of foods, such as (nutraceutical), designer foods, food additives It can be included. 예를 들어, 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 될 수 있다. For example, meat, sausages, breads, chocolates, candies, seunekryu, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, teas, drinks, alcoholic drinks and vitamin complex, etc It can be.

상기 형태의 식품 조성물은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다. Food composition of this type can be prepared in various forms in accordance with conventional methods known in the art. 예를 들어, 건강식품으로는 부테인 또는 이소유네놀을 차, 쥬스 및 드링크의 형태로 제조하여 음용하도록 하거나, 과립화, 캡슐화 및 분말화하여 섭취할 수 있으며 파우더, 캅셀, 연질캅셀, 정제, 껌 및 점착 타입 액제 조성물의 형태로 제조하여 섭취할 수도 있다. For example, the health food as the portions retain or iso oil nenol tea, juice, or to produce the drink in the form of drinks, granulation, encapsulation and powdered to be ingested, and powders, capsules, soft capsules, tablets, It may be taken to manufacture in the form of chewing gum and adhesive type liquid preparation.

또한, 식품으로는 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예를 들어, 과일 통조림, 병조림, 잼, 마멀레이드 등), 어류, 육류 및 그 가공식품(예를 들어, 햄, 소시지 콘비프 등), 빵류 및 면류(예를 들어, 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예를 들어, 버터, 치즈 등), 식용식물유지, 마가린, 식물성 단백질, 레토르트 식품, 냉동식품 및 각종 조미료(예를 들어, 된장, 간장, 소스 등) 등에 본 발명의 부테인 또는 이소유네놀을 첨가하여 제조할 수 있다. In addition, foods with drinks (including alcoholic beverages), fruit, and his processed foods (eg, canned fruits, bottled, jams, marmalade, etc.), fish, meat and its processed products (for example, ham, sausage corned beef etc.), breads and noodles (for example, udon, soba, ramen, spaghetti, macaroni etc.), fruit juice, various drinks, cookies, peeking, dairy products (eg, butter, cheese, etc.), edible vegetable oil, margarine , plant proteins, retort foods, frozen foods and other seasonings can be prepared by the addition of heptane or iso portion nenol oil of the present invention or the like (for example, soybean paste, soy sauce, sauce, etc.).

본 발명의 식품 조성물은 부테인 또는 이소유네놀 이외에도 다양한 성분을 추가로 포함할 수 있다. Food compositions of the present invention in addition to part or iso-octane oil nenol may further comprise a variety of components.

상기 성분은 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 미네랄, 인지질, 말톨, 올리고당, 아미노산, 알코올 또는 탄산음료에 사용되는 탄산화제를 포함할 수 있다. The ingredients are nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acid, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, mineral, phospholipids, maltol, oligosaccharide, used for the amino acid, alcohol or a carbonated beverage can include a carbonation reagents.

본 발명의 다른 양태는 부테인을 포함하는 스타틴에 대하여 내성을 갖는 고콜레스테롤 혈증의 예방 또는 치료용 약제학적 조성물에 관한 것이다. Another aspect of the invention having a high resistance to statins, including portions of heptane in the prevention or treatment a pharmaceutical composition of the hypercholesterolemia.

본 발명의 다른 양태는 이소유제놀을 포함하는 스타틴에 대하여 내성을 갖는 고콜레스테롤 혈증의 예방 또는 치료용 약제학적 조성물에 관한 것이다. Another aspect of the invention relates to the prevention or treatment a pharmaceutical composition for hypercholesterolemia having a resistance to statins, including iso eugenol.

상기 스타틴은 로바스타틴(lovastatin), 심바스타틴(simvastatin), 프라바스타틴(pravastatin), 플루바스타틴(fluvastatin), 아토르바스타틴(atorvastatin), 로수바스타틴(rosuvastatin), 이타바스타틴(itavastatin), 세리바스타틴(cerivastatin), 피타바스타틴(pitavastatin), 메바스타틴(mevastatin) 및 리바스타틴(rivastatin)으로 이루어진 군으로부터 선택되는 스타틴일 수 있다. The statin is lovastatin (lovastatin), simvastatin (simvastatin), pravastatin (pravastatin), fluvastatin (fluvastatin), atorvastatin (atorvastatin), rosuvastatin (rosuvastatin), itavastatin (itavastatin), cerivastatin (cerivastatin), may be a pitavastatin (pitavastatin), mevastatin statin is selected from the group consisting of (mevastatin) and Riva statin (rivastatin).

스타틴을 일정 기간 복용한 후 고콜레스테롤 혈증 환자에서 스타틴 복용에 의해 혈중 콜레스테롤이 감소되지 않는다는 임상 연구 결과들이 발표되었다. After taking a statin period of clinical studies and the results were published in blood cholesterol it is not reduced by taking a statin in hypercholesterolemic patients. 스타틴은 LDL 수용체 증진으로 LDL 콜레스테롤 흡수를 증진시키는 동시에 PCSK9이라는 단백질 발현을 함께 증가시키게 되는데, PCSK9은 LDL 수용체를 분해하므로 결과적으로 LDL 수용체의 발현이 낮아져, LDL 콜레스테롤의 흡수가 줄어들게 되고, 혈중 LDL 콜레스테롤 클리어런스가 효과적으로 일어나지 못한다. Statins there is increases with the protein expression of PCSK9 at the same time to promote LDL cholesterol absorption by enhancing LDL receptor and PCSK9 are low, resulting in the expression of LDL receptors so decompose the LDL receptor, and reduce the absorption of LDL cholesterol, blood LDL cholesterol the clearance does not occur effectively.

본 발명의 조성물은 우수한 PCSK9 유전자 발현 감소 효과를 나타내므로 스타틴 복용에 따른 스타틴 내성을 나타내는 고콜레스테롤 혈증에 대하여 예방 또는 치료 효과를 나타낸다. The compositions of the present invention exhibit a preventing or treating effect against and exhibits an excellent effect of PCSK9 gene expression decreased indicating a statin according to the resistance to taking a statin cholesterol.

본 발명의 약제학적 조성물은 약학적으로 허용되는 담체를 포함할 수 있다. The pharmaceutical compositions of this invention may include a carrier that is pharmaceutically acceptable. 본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제 시에 통상적으로 이용되는 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. As a pharmaceutically acceptable carrier contained in the pharmaceutical compositions of this invention are commonly used at the time of preparation, saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, and the like, including, magnesium stearate, and mineral oils, and the like.

본 발명의 약제학적 조성물은 상기 성분들 이외에 항산화제, 완충액, 정균제, 희석제, 계면활성제, 결합제, 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제 또는 보존제 등을 추가로 포함할 수 있다. The pharmaceutical composition according to the present invention may further comprise antioxidants, buffers, bacteriostatic agents, diluents, surfactants, binders, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents or preservatives in addition to the above components.

본 발명의 약제학적 조성물은 경구 또는 비경구 투여할 수 있으며, 예를 들어, 경구 투여할 수 있다. The pharmaceutical compositions of this invention may be administered orally or parenterally, for example, can be administered orally.

본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. A suitable dose of the pharmaceutical composition of the invention may vary depending on pharmaceutical formulation methods, various prescribed by the patient's age, body weight, sex, diseased condition, food, administration time, administration route, excretion rate and response sensitivity factors such as It can be.

본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 다용량 용기 내에 내입시켜 제조될 수 있다. The pharmaceutical compositions of this invention is are prepared in unit dosage form by formulating with a carrier or excipient that is pharmaceutically acceptable according to methods self can be easily implemented by those of ordinary skill in the art the instant invention to intergranular in the dose container can be made. 이때 제형은 오일 또는 수성 매질 중의 용액, 현탁액, 시럽제 또는 유화액 형태이거나 엑스제, 산제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가로 포함할 수 있다. The formulations are oil or a solution in an aqueous medium, suspension, syrup or emulsion form, or may be a X, powders, powders, granules, tablets or capsule form and may further comprise a dispersion agent or a stabilizer.

본 발명은 부테인 또는 이소유제놀을 포함하는 PCSK9 유전자의 발현 감소 또는 저밀도 지단백 수용체(LDLR)를 증가용 식품 조성물에 관한 것이다. The present invention relates to a unit for the food heptane or iso eugenol decreased expression or low-density lipoprotein receptor (LDLR) of the PCSK9 gene comprising the composition increases.

본 발명의 조성물은 스타틴계 화합물에 의해 증가된 PCSK9 유전자의 발현을 억제시키고, 저밀도 지단백 수용체를 증가시키는 효과를 나타내 결과적으로 콜레스테롤의 혈중 수치를 낮추므로 비만, 제2형 당뇨병, 고혈압, 심장혈관 질환 또는 고지혈증 등의 대사성 질환의 예방 또는 개선 용도로 활용할 수 있다. The compositions of the present invention is to suppress the expression of the PCSK9 gene increase by a statin compound, indicate the effect of increasing LDL receptor as a result lowers the blood levels of cholesterol, obesity, type 2 diabetes, hypertension, cardiovascular diseases or it can be used to prevent or improve metabolic diseases such as hyperlipidemia purposes.

도 1a는 본 발명의 일 실시예에 따라 부테인 처리에 따른 세포 생존능력을 측정한 결과이다. Figure 1a shows the results of measurement of cell viability according to the sub-ylmethyl processing according to one embodiment of the invention.
도 1b는 본 발명의 일 실시예에 따라 부테인 처리에 따른 PCSK9의 발현량 변화를 ELISA로 측정한 결과이다. Figure 1b shows the result of measuring the expression level change in the PCSK9 according to retain processing unit in accordance with one embodiment of the present invention by ELISA.
도 2a는 본 발명의 일 실시예에 따라 부테인 처리에 따른 PCSK9 발현량 변화를 측정한 결과이다. 2a is a result of measuring the PCSK9 expression level changes in part retain processing according to one embodiment of the invention.
도 2b는 본 발명의 일 실시예에 따라 부테인 처리에 따른 LDLR의 발현량 변화를 측정한 결과이다. Figure 2b is a result of measuring the expression level change in the LDLR portion of the heptane treated according to one embodiment of the invention.
도 2c는 본 발명의 일 실시예에 따라 부테인 처리에 따른 SREBP2 의 발현량 변화를 측정한 결과이다. Figure 2c shows the results of measuring the expression level change of SREBP2 according to retain processing unit in accordance with one embodiment of the present invention.
도 2d는 본 발명의 일 실시예에 따라 부테인 처리에 따른 HMGCR의 발현량 변화를 측정한 결과이다. Figure 2d shows the result of measuring the expression level change of HMGCR according to retain processing unit in accordance with one embodiment of the present invention.
도 2e는 본 발명의 일 실시예에 따라 부테인 처리에 따른 HNF1α의 발현량 변화를 측정한 결과이다. Figure 2e shows the results of measuring the expression level change of the HNF1α according to retain processing unit in accordance with one embodiment of the present invention.
도 3은 본 발명의 일 실시예에 따라 부테인 처리에 따른 LDLR, PCSK9, HNF1α 및 SREBP2 발현량 변화를 측정한 결과이다. 3 is a result of measuring the LDLR, PCSK9, and HNF1α SREBP2 expression level changes in part retain processing according to one embodiment of the invention.
도 4는 본 발명의 일 실시예에 따라 부테인 및 로수바스타틴 처리에 따른 LDLR 및 PCSK9 발현량 변화를 측정한 결과이다. Figure 4 is a result of measuring the LDLR and PCSK9 expression level changes in rosuvastatin treated with heptane and the portion in accordance with an embodiment of the invention.
도 5a는 본 발명의 일 실시예에 따라 단백질 합성 억제제인 CHX 및 부테인 처리에 따른 LDLR 단백질의 합성 및 리보좀 분해 정도를 측정한 결과이다. Figure 5a is a result of measuring the ribosomal synthesis and the decomposition degree of the LDLR protein according to the protein synthesis inhibitor CHX and retain processing unit in accordance with one embodiment of the present invention.
도 5b는 본 발명의 일 실시예에 따라 리보좀 억제제인 BA1 및 부테인 처리에 따른 LDLR 단백질의 합성 및 리보좀 분해 정도를 측정한 결과이다. Figure 5b is a result of measuring the ribosomal synthesis and the decomposition degree of the LDLR protein according to the ribosomal inhibitor BA1 and retain processing unit in accordance with one embodiment of the present invention.
도 6a는 본 발명의 일 실시예에 따라 유제놀 처리에 따른 LDLR 및 PCSK9 발현량 변화를 측정한 결과이다. Figure 6a shows the result of measuring the LDLR and PCSK9 expression level changes in eugenol process according to one embodiment of the invention.
도 6b는 본 발명의 일 실시예에 따라 이소유제놀 처리에 따른 LDLR 및 PCSK9 발현량 변화를 측정한 결과이다. Figure 6b shows the result of measuring the iso emulsion LDLR and PCSK9 expression level changes in accordance with the play process in accordance with one embodiment of the present invention.
도 7은 본 발명의 일 실시예에 따라 이소유제놀 처리에 따른 SREBP2 및 HNF1α 발현량 변화를 측정한 결과이다. 7 is a result of measuring the iso emulsion SREBP2 and HNF1α expression level changes in accordance with the play process in accordance with one embodiment of the present invention.
도 8a는 본 발명의 일 실시예에 따라 이소유제놀 처리에 따른 PCSK9 발현량 변화를 측정한 결과이다. Figure 8a shows the results of measuring the expression level of PCSK9 change in iso eugenol process in accordance with one embodiment of the present invention.
도 8b는 본 발명의 일 실시예에 따라 이소유제놀 처리에 따른 LDLR의 발현량 변화를 측정한 결과이다. Figure 8b shows the results of measuring the expression level changes in accordance with the LDLR iso eugenol process in accordance with one embodiment of the present invention.
도 8c는 본 발명의 일 실시예에 따라 이소유제놀 처리에 따른 SREBP2의 발현량 변화를 측정한 결과이다. Figure 8c is a result of measuring the expression level change of SREBP2 in accordance with iso eugenol process in accordance with one embodiment of the present invention.
도 8d는 본 발명의 일 실시예에 따라 이소유제놀 처리에 따른 HNF1α의 발현량 변화를 측정한 결과이다. Figure 8d shows the results of measuring the expression level changes in accordance with the HNF1α iso eugenol process in accordance with one embodiment of the present invention.
도 9는 본 발명의 일 실시예에 따라 리보좀 억제제인 BA1 및 이소유제놀 처리에 따른 LDLR 단백질의 합성 및 리보좀 분해 정도를 측정한 결과이다. 9 is a result of measuring the ribosomal synthesis and the decomposition degree of the LDLR protein according to the ribosomal inhibitor BA1 and iso eugenol process in accordance with one embodiment of the present invention.
도 10은 본 발명의 일 실시예에 따라 이소유제놀 및 스타틴 처리에 따른 LDLR 및 PCSK9 발현량 변화를 측정한 결과이다. 10 is a result of measuring the LDLR and PCSK9 expression level changes in iso eugenol and statin treatment, according to one embodiment of the invention.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. The present invention will be described in further detail with reference to the following examples. 이들 실시 예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시 예에 의해 제한되지 않는다는 것은 당 업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다. These embodiments will be evident in the person of ordinary skill that for illustrating only the present invention in more detail, the scope of the present invention according to the aspects of the present invention is not limited by these Examples in the art .

본 명세서 전체에 거쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 “%"는 별도의 언급이 없는 한 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다. Through throughout this specification, is used to indicate the concentration of a specific substance, "%" is a solid / solid, unless otherwise mentioned, (wt / wt)%, solid / liquid (w / v)%, and the liquid / is a liquid (v / v)%.

재료 및 방법 Materials and methods

1. HepG2 세포 배양 1. HepG2 cell cultures

HepG2(human hepatoblastoma)는 ATCC(HB-8065; Manassas, VA, USA)에서 구매하여 DMEM(DMEM-high glucose; Corning, Manassas, VA, USA)에 10% FBS(fetal bovine serum)(Welgene Inc., Gyeongsan, Republic of Korea), 1% 항생제/항진균제를 첨가하여 37, 5% CO 2 조건의 배양기에서 배양하였다. HepG2 (human hepatoblastoma) is ATCC (HB-8065; Manassas, VA, USA) purchased from DMEM; 10% FBS (fetal bovine serum) to (DMEM-high glucose Corning, Manassas, VA, USA) (Welgene Inc., was added to Gyeongsan, Republic of Korea), 1% antibiotic / antifungal agents were incubated at 37, an incubator of 5% CO 2 condition.

2. MTT 어세이 2. MTT Assay

HepG2 세포가 약 70% 밀집 상태(confluence)에 도달하였을 때, 트립신-EDTA(Welgene Inc.)를 이용하여 세포를 떼어 내고, 96-웰 플레이트에 시딩하였다(day 0). When the HepG2 cells reached approximately 70% dense state (confluence), Remove the cells using trypsin -EDTA (Welgene Inc.), were seeded in 96-well plates (day 0). 24시간 이후, 세포를 차가운 DPBS(Welgene Inc.)로 2회 세척한 후, 새 DMEM 배지로 교체하였다. After 24 hours, the cells were washed twice with cold DPBS (Welgene Inc.), it was replaced with a new DMEM medium. 이 때, 음성 대조군은 DMEM+10% FBS를 처리하고, 양성 대조군에는 DMEM에 지방이 제거된 FBS(delipidated serum, DLPS, 10%)와 1% 항생제/항진균제[DMEM+10% DLPS]를 첨가하여 24시간 동안 배양하였다(day 1). At this time, the negative control group was added to process the DMEM + 10% FBS, and the positive control is a fat is removed in DMEM FBS (delipidated serum, DLPS, 10%) and 1% antibiotic / antifungal [DMEM + 10% DLPS] and incubated for 24 hours (day 1).

배지를 제거하고, 차가운 DPBS로 2회 세척한 후, DMEM+10% FBS 혹은 DMEM+10% DLPS로 각각 교환하였다. After removing the culture medium, washed twice with cold DPBS, was respectively replaced with DMEM + 10% FBS or DMEM + 10% DLPS. 이 때, 실험군에는 DMEM+10% DLPS에 부테인을 농도별(5, 10, 20, 40, 80, 100 μM)로 처리하였다(day 2). At this time, the test group is treated with the specific octane (5, 10, 20, 40, 80, 100 μM) concentration unit in DMEM + 10% DLPS (day 2). 18시간 배양 후(day 3), 차가운 DPBS로 2회 세척하고 FBS가 포함되지 않은 배지로 교체한 후 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide(MTT, Sigma-Aldrich; St. Louis, MO, USA) 용액을 배지에 첨가하여 2시간 동안 배양하고 형성된 블루 포르마잔(blue formazan)을 DMSO에 용해하여 570 nm와 630 nm에서 마이크로플레이트 리더를 사용하여 세포 생존률을 측정하였다. After 18 hours the culture (day 3), washed twice with cold DPBS, and then replaced by a medium that does not contain FBS 3- (4,5-dimethylthiazol-2-yl) -2, 5-diphenyltetrazolium bromide (MTT, Sigma -Aldrich; the cell viability by using the St. Louis, MO, USA) microplate reader and the solution to a blue formazan (blue formazan) is added to the medium and incubated for 2 hours and formed in 570 nm and 630 nm was dissolved in DMSO It was measured.

3. 웨스턴 블롯 3. Western Blot

HepG2 세포가 약 70% 밀집 상태에 도달하였을 때, 6-웰 플레이트에 세포를 시딩하였다(day 0). When the HepG2 cells reached approximately 70% dense state, they seeded the cells in 6-well plates (day 0). 24시간 이후, 세포를 차가운 DPBS로 2회 세척한 후, 새 DMEM 배지로 교체하였다. After 24 hours, the cells were washed twice with cold DPBS, it was replaced with a new DMEM medium. 이 때, 음성 대조군에는 DMEM+10% FBS를 처리하였고, 양성 대조군에는 DMEM+10% DLPS를 첨가하여 24시간 동안 배양하였다(day 1). At this time, the process was the DMEM + 10% FBS negative control group, there was added to DMEM + 10% DLPS positive control was incubated for 24 hours (day 1).

배지를 제거하고, 차가운 DPBS로 2회 세척한 후, DMEM+10% FBS, DMEM+10% DLPS 또는 DMEM+10% DLPS+ 로수바스타틴(0.2 μM)으로 각각 교환하였다. Removing the medium, and were each replaced with cold DPBS and then washed twice with rosuvastatin in DMEM + 10% FBS, DMEM + 10% DLPS or DMEM + 10% DLPS + (0.2 μM). 이 때, 실험군에는 부테인(Sigma-Aldrich, #B178)(2.5, 5, 10, 20 μM), 유제놀(Sigma-Aldrich, #51971)(50, 100 μM) 또는 이소유제놀(Sigma-Aldrich, #I17206)(50, 100 μM)을 각각 처리하였다(day 2). At this time, the group is part octane (Sigma-Aldrich, # B178) (2.5, 5, 10, 20 μM), eugenol (Sigma-Aldrich, # 51971) (50, 100 μM) or iso eugenol (Sigma-Aldrich , # I17206) (50, 100 μM) was each treatment (day 2).

18시간 배양 후(day 3), 차가운 DPBS로 2회 세척하고 세포를 회수하였다. After 18 hours the culture (day 3), washed twice with cold DPBS, and the cells were collected. 원심분리(1,200 rpm, 3분)하여 얻은 펠렛을 세포 용해 버퍼(Cell Signaling Technology, Inc., Danvers, MA, USA)로 용해하고, 브래드포드 어세이 법으로 단백질을 정량하였다(Bio-Rad Laboratories). Was determined by centrifugation (1,200 rpm, 3 minutes) to pellet the protein obtained by the cell lysis buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) was dissolved, and the Bradford assay method as (Bio-Rad Laboratories) .

전체 15 ㎍의 단백질을 8% SDS 겔에 전기영동하고, 항체[PCSK9(Circulex, Medical & Biological Laboratories. Co., Ltc, Woburn, MA, USA), LDLR(BioVision Incorporated, Milpitas, CA, USA), hepatic nuclear factor 1α(HNF1α; Cell Signaling Technology), SREBP2(Cayman Chemical, Ann Arbor, MI, USA), Actin(Bethyl Laboratories, Montgomery, TX, USA)]를 이용하여 웨스턴 블롯팅을 하였다. Electrical proteins of all 15 ㎍ to 8% SDS gel electrophoresis, and the antibody [PCSK9 (Circulex, Medical & Biological Laboratories. Co., Ltc, Woburn, MA, USA), LDLR (BioVision Incorporated, Milpitas, CA, USA), hepatic nuclear factor 1α; using (HNF1α Cell Signaling Technology), SREBP2 (Cayman Chemical, Ann Arbor, MI, USA), Actin (Bethyl Laboratories, Montgomery, TX, USA)] was the Western blotting. ECL 용액(Pierce Biotechnology, Rockford, IL, USA)에 배양한 후, 표적 단백질의 밴드를 검출하였다(Bio-Rad Laboratories). ECL solution and incubated in (Pierce Biotechnology, Rockford, IL, USA), was detected a band of the target protein (Bio-Rad Laboratories).

4. 총 RNA의 추출 및 qRT-PCR 4. extraction and qRT-PCR of total RNA

세포 내 콜레스테롤 수용체 조절 관련 유전자의 발현을 측정하기 위하여 qRT-PCR을 수행하였다. In order to measure the cholesterol receptor modulating the expression of cellular genes was carried out qRT-PCR. HepG2 세포가 약 70% 밀집 상태에 도달하였을 때, 6-웰 플레이트에 세포를 시딩하였다(day 0). When the HepG2 cells reached approximately 70% dense state, they seeded the cells in 6-well plates (day 0). 24시간 이후, 세포를 차가운 DPBS로 2회 세척한 후, 새 DMEM 배지로 교체하였다. After 24 hours, the cells were washed twice with cold DPBS, it was replaced with a new DMEM medium. 이 때, 음성 대조군에는 DMEM+10% FBS를 처리하였고, 양성 대조군에는 DMEM+10% DLPS를 첨가하여 24시간 동안 배양하였다(day 1). At this time, the process was the DMEM + 10% FBS negative control group, there was added to DMEM + 10% DLPS positive control was incubated for 24 hours (day 1).

배지를 제거하고, 차가운 DPBS로 2회 세척한 후, DMEM+10% FBS 혹은 DMEM+10% DLPS로 각각 교환하였다. After removing the culture medium, washed twice with cold DPBS, was respectively replaced with DMEM + 10% FBS or DMEM + 10% DLPS. 이 때, 실험군에는 DMEM+10% DLPS에 부테인(2.5, 5, 10, 20 μM) 또는 이소유제놀(2.5, 25, 50, 100 μM)을 동시 처리하였다(day 2). At this time, the group has been simultaneously handle portion heptane (2.5, 5, 10, 20 μM) or iso eugenol (2.5, 25, 50, 100 μM) in DMEM + 10% DLPS (day 2). 18시간 배양 후(day 3), 차가운 DPBS로 2회 세척하고, 세포를 수집하고 총 RNA를 추출하고 cDNA를 합성하였다. After 18 hours the culture (day 3), washed twice with cold DPBS, and collecting the cells, extracting the total RNA, and cDNA was synthesized.

qRT-PCR 분석은 SYBR Green PCR Master mix reagent(Thermo Fisher Scientific)을 이용하여 다음과 같은 조건으로 시행하였다(Bio-Rad CFX Connect Real-Time PCR Detection System, Bio-Rad Laboratories). qRT-PCR analysis SYBR Green PCR Master mix reagent (Thermo Fisher Scientific) was performed by the use of the following conditions (Bio-Rad CFX Connect Real-Time PCR Detection System, Bio-Rad Laboratories). 모든 결과는 GAPDH를 기준으로 하여 상대적으로 정량화되었다. All results were quantified relative to the basis of GAPDH.

PCR은 95℃에서 30초, 56℃에서 30초, 72℃에서 30초에서 40 사이클로 시행되었으며, 마지막 72℃에서 10분간 추가적으로 반응하여 안정화시켰다. PCR was performed in 95 ℃ 30, 30 in 56 ℃, 72 ℃ from 30 seconds to 40 cycloalkyl, stabilized by additional 10 min at the end 72 ℃. 증폭의 모든 데이터는 매 사이클의 72℃, 30초 단계에서 수집되었다. All data were collected from the amplifier 72 ℃, 30 second steps of each cycle.

본 분석에 사용된 프라이머는 표 1과 같다. The primers used in this analysis are given in Table 1.

유전자 gene 프라이머 primer 서열번호 SEQ ID NO: 프라이머 서열(5'-3') Primer sequence (5'-3 ')
PCSK9 PCSK9
정방향 Forward 1 One GGCAGGTTGGCAGCTGTTT GGCAGGTTGGCAGCTGTTT
역방향 Reverse 2 2 CGTGTAGGCCCCGAGTGT CGTGTAGGCCCCGAGTGT
LDLR LDLR
정방향 Forward 3 3 AGGAGACGTGCTTGTCTGTC AGGAGACGTGCTTGTCTGTC
역방향 Reverse 4 4 CTGAGCCGTTGTCGCAGT CTGAGCCGTTGTCGCAGT
SREBP2 SREBP2
정방향 Forward 5 5 CGGTAATGATCACGCCAACAT CGGTAATGATCACGCCAACAT
역방향 Reverse 6 6 TGGTATATCAAAGGCTGCTGGAT TGGTATATCAAAGGCTGCTGGAT
HMGCR HMGCR
정방향 Forward 7 7 CAAGGAGCATGCAAAGATAATCC CAAGGAGCATGCAAAGATAATCC
역방향 Reverse 8 8 GCCATTACGGTCCCACACA GCCATTACGGTCCCACACA
HNF1α HNF1α
정방향 Forward 9 9 TGGCGCAGCAGTTCACCCAT TGGCGCAGCAGTTCACCCAT
역방향 Reverse 10 10 TGAAACGGTTCCTCCGCCCC TGAAACGGTTCCTCCGCCCC
GAPDH GAPDH
정방향 Forward 11 11 ATGTTCGTCATGGGTGTGAAC ATGTTCGTCATGGGTGTGAAC
역방향 Reverse 12 12 GCATGGACTGTGGTCATGAGT GCATGGACTGTGGTCATGAGT

모든 반응은 삼 반복으로 시행되었으며, 상대적 발현 및 SD 값은 비교 연구법을 사용하여 계산하였다. All reactions were performed in three repeats, the relative expression and SD values ​​were calculated using the comparative Research Methods.

5. LDLR의 리보좀 분해 및 단백질 합성 조절 측정 5. ribosomal protein synthesis and the decomposition of the measured control LDLR

HepG2 세포가 약 70% 밀집 상태에 도달하였을 때, 6-웰 플레이트에 세포를 시딩하였다(day 0). When the HepG2 cells reached approximately 70% dense state, they seeded the cells in 6-well plates (day 0). 24시간 이후, 세포를 차가운 DPBS로 2회 세척한 후, DMEM+10% DLPS를 첨가하여 24시간 동안 배양하였다(day 1). 24 hours after, and then the cells were washed twice with cold DPBS, added to DMEM + 10% DLPS were incubated for 24 hours (day 1).

배지를 제거하고, 차가운 DPBS로 2회 세척한 후, DMEM+10% DLPS를 첨가하였고, 이 때, 리보좀 분해 억제제(lysosomal degradation inhibitor)인 바필로마이신 A1(bafilomycin A1)(BA1; Sigma-Aldrich)을 0 또는 50 nM 처리하고, 20 μM의 부테인 또는 100 μM의 이소유제놀을 동시에 처리하였다(day 2). After removing the culture medium, washed twice with cold DPBS, was added to DMEM + 10% DLPS, at this time, a ribosome decomposition inhibitor (lysosomal degradation inhibitor) the bar Philo hygromycin A1 (bafilomycin A1) (BA1; Sigma-Aldrich) It was treated with 0 or 50 nM, and the handle portion of heptane or 100 μM iso-eugenol of 20 μM at the same time (day 2). 18시간 배양 후(day 3), 차가운 DPBS로 2회 세척하고 세포를 회수하였다. After 18 hours the culture (day 3), washed twice with cold DPBS, and the cells were collected. 원심분리(1,200 rpm, 3분) 후, 세포 펠렛을 얻었다. After centrifugation (1,200 rpm, 3 minutes) to obtain a cell pellet.

LDLR 단백질 합성 조절 실험을 위해서 day 1까지 동일하게 처리하였다. For LDLR protein synthesis control experiments were treated in the same manner up to 1 day. day 2에 배지를 제거하고, 차가운 DLPS로 2회 세척한 후, DMEM+10% DLPS를 첨가하고, 20 μM의 부테인을 처리하였다. After removal of the medium on day 2, washed twice with cold DLPS, the addition of DMEM + 10% DLPS and treated retain a portion of 20 μM. 24시간 배양한 후, day 3에는 단백질 합성 억제제인 시클로헥시미드(cycloheximide)(CHX; 5 μg/ml; Sigma-Aldrich)를 처리하고 0, 1, 2, 4, 8 시간 후 세포를 회수하였다. After 24 hours incubation, day 3, the protein synthesis inhibitor, a cyclohexyl during mid (cycloheximide) to recover the handle and 0, 1, 2, 4, and 8 hours after the cells (CHX; Sigma-Aldrich; 5 μg / ml) . 위의 방법으로 웨스턴 블롯을 실시하였다. The above method was subjected to Western blot.

6. 통계 분석 6. Statistical Analysis

본 발명에서는 최소 3회 반복에 대한 평균 및 표준편차로 표시하였으며, 각 실험군을 대조군에 대한 백분율로 나타내었다. According to the present invention were expressed as mean and standard deviation for at least three times, are shown for each test group as a percentage of the control group. 각 실험군간의 통계적 유의성은 Student's t-test를 사용하여 검정하였다. Statistical significance between each group was black using the Student's t-test. 통계검정은 GraphPad Prism(version 5.0)을 이용하였다. Statistical test was performed using GraphPad Prism (version 5.0).

실험 결과 Experiment result

I. 부테인 Part I. Thane

1. HepG2 세포에서 부테인의 PCSK9 단백질 발현 조절 1. PCSK9 protein expression in HepG2 cells retain control of the unit

부테인의 콜레스테롤 저감 관련 메커니즘을 밝히기 위해 HepG2 세포를 DLPS에 배양하여 지방이 제거된 환경으로 만들어 주고 부테인을 5, 10, 20, 40, 80, 100 μM 농도로 처리한 후 세포 생존능력을 MTT 용액을 이용하여 측정하였다. The cultured HepG2 cells in DLPS after local exchange is created by the removal of Environment handle retain a 5, 10, 20, 40, 80, 100 μM concentration of cell viability to uncover the cholesterol reduction associated mechanism in the sub-ylmethyl MTT It was measured using a solution.

도 1a에서 확인할 수 있듯이, 부테인 20 μM 농도까지는 세포 생존능력에 영향을 주지 않았으나, 40 μM 이상의 농도에서 세포 생존능력이 감소되었다. As can be seen in Figure 1a, part retain up to 20 μM concentration did not affect cell viability, it reduced the cell viability at least 40 μM concentration.

또한, 독성 없는 농도의 부테인을 세포에 처리하여 PCSK9 발현 조절을 ELISA로 측정하였다. In addition, the handle portion retain the toxic concentration that is not in the cells was measured PCSK9 expression control in ELISA.

도 1b에서 확인할 수 있듯이, 간암세포주(HepG2 cells)에 10% DLPS 처리는 10% FBS 처리군과 비교했을 때, PCSK9의 농도를 유의적으로 증가시켰으며, 부테인(2.5, 5, 10 μM)은 지방 제거 상태에서 PCSK9을 농도 의존적으로 감소시켰다. As it can be seen from Figure 1b, liver cancer cell line, compared with 10% DLPS process FBS-treated group with 10% (HepG2 cells), was increased the concentration of PCSK9 significantly, part octane (2.5, 5, 10 μM) PCSK9 is reduced in fat removed in a concentration-dependent manner.

2. HepG2 세포에서 부테인의 LDLR, PCSK9, SREBP2, HMGCR, HNF1α 발현 조절 2. LDLR, PCSK9, SREBP2, HMGCR , HNF1α expression control of the sub-heptane in HepG2 cells

2-1. 2-1. 유전자 수준 Genetic level

부테인의 PCSK9 억제 및 LDLR 발현 증진을 조절하는 유전자 및 전사 인자의 발현량을 qRT-PCR로 측정하였다. The expression level of the sub-heptane of PCSK9 and inhibition LDLR gene and promotes transcription factors that control the expression was determined by qRT-PCR.

도 2a 내지 2e에서 확인할 수 있듯이, 지방이 제거된 상태에서 HepG2 세포의 PCSK9, LDLR, SREBP2, HMGCR, HNF1α 유전자 발현량이 유의적으로 높았다. Amount As can be seen in Figures 2a to 2e, fat PCSK9, LDLR, SREBP2, HMGCR, HNF1α gene expression in HepG2 cells in the removed state was significantly higher. 이는 지방이 없는 상태에서 세포는 항상성을 이루려는 노력의 일환으로 SREBP2의 유전자 발현 증진을 통해 LDLR을 증진시켜 세포 내 LDL 흡수를 증가시키기 때문이다. This is because in the absence of local conditions within the cell to increase the cellular LDL uptake by promoting the LDLR through the enhancement of gene expression of SREBP2 in an effort is fulfilled homeostasis.

도 2a에서 확인할 수 있듯이, 부테인(2.5, 5, 10, 20 μM)은 지방 제거 상태에서 증가한 PCSK9의 유전자 발현량을 농도 의존적으로 감소시켰으며, 이는 통계적으로 유의하였다(p<0.05). As can be seen from Figure 2a, portions octane (2.5, 5, 10, 20 μM) were reduced the expression level of the gene PCSK9 increase in fat removed in a concentration-dependent manner, which was statistically significant (p <0.05).

도 2b에서 확인할 수 있듯이, 부테인은 지방 제거 상태에서 증가한 LDLR의 유전자 발현량을 감소시켰다. As you can see in Figure 2b, section Thane reduced the gene expression of LDLR increase in fat removed. 부테인 2.5 μM와 5 μM 처리는 LDLR 유전자 발현량을 유의적으로 감소시켰다. Part retain 2.5 μM and 5 μM treatment reduced the LDLR gene expression level significantly.

도 2c에서 확인할 수 있듯이, 부테인(2.5, 5, 10, 20 μM)은 지방 제거 상태에서 증가한 SREBP2의 유전자 발현량을 농도 의존적으로 감소시켰으며, 이는 통계적으로 유의하였다(p<0.05). As can be seen in Figure 2c, part octane (2.5, 5, 10, 20 μM) it was reduced the gene expression level of SREBP2 increase in fat removed in a concentration-dependent manner, which was statistically significant (p <0.05).

도 2d에서 확인할 수 있듯이, 지방 제거에 의해 증가한 HMGCR 유전자 발현량 또한 부테인 처리(2.5 내지 20 μM)에 의해서 유의적으로 감소하였다(p<0.05). As can be seen in Figure 2d, HMGCR amount of gene expression increased by fat removal it was also significantly decreased by the treatment portion heptane (2.5 to 20 μM) (p <0.05).

도 2e에서 확인할 수 있듯이, 지방 제거에 의해 증가한 HNF1α 유전자 발현량 또한 부테인 처리(5, 10, 20 μM)에 의해 유의적으로 감소하였다(p<0.05). As can be seen in Fig. 2e, HNF1α amount of gene expression increased by fat removal also decreased significantly by the unit retain processing (5, 10, 20 μM) (p <0.05).

종합적으로, 부테인은 전사인자인 SREBP2의 유전자 발현을 감소시킴으로써 PCSK9, HMGCR의 발현량을 감소시켰음을 알 수 있었고, PCSK9의 단독 조절 전사인자인 PCSK9의 유전자 발현량 또한 감소시킴을 알 수 있었다. All in all, part octane was found to Sikkim transcription factor by reducing the gene expression of SREBP2 was to find out-rescue decrease the expression level of PCSK9, HMGCR, exclusive control of the PCSK9 transcription factor PCSK9 gene expression levels also decrease the.

2-2. 2-2. 단백질 수준 Protein levels

부테인의 PCSK9 억제 및 LDLR 단백질 발현 조절 정도를 평가하기 위하여 웨스턴 블랏을 실시하였다. Western blotting was carried out to evaluate the inhibition PCSK9 and LDLR protein expression level of control unit heptane.

도 3에서 확인할 수 있듯이, 부테인 20 μM는 지방 제거 상태에서 LDLR 단백질 발현량을 증가시켰고, PCSK9 단백질 발현량을 감소시켰다. As can be seen in Figure 3, portion 20 μM retain increased the LDLR protein expression level in the fat removed, reduced PCSK9 protein expression level.

상위 전사인자인 HNF1α와 SREBP2의 단백질 발현을 확인한 결과, 부테인은 SREBP2가 아닌 HNF1α의 단백질 발현을 억제하였다. Results confirmed the high transcription factor and HNF1α SREBP2 protein expression, retain part inhibited the protein expression of the non-SREBP2 HNF1α. 따라서, 부테인의 PCSK9 억제는 HNF1α 억제를 통해 이루어짐을 알 수 있다. Thus, inhibition of PCSK9 portion retain it can be seen through the HNF1α yirueojim suppressed.

부테인을 스타틴과 동시 처리 혹은 단독으로 처리한 후, 웨스턴 블롯팅을 통해 LDLR 과 PCSK9의 단백질 발현 조절 정도를 비교하였다. Through a portion after the treatment with statins and retain the simultaneous treatment or alone, Western blotting and compared to control protein expression level of LDLR and PCSK9.

도 4(왼쪽 패널)에서 확인할 수 있듯이, 스타틴 처리는 지방 제거 상태에서 LDLR과 PCSK9의 단백질 발현을 증가시켰다. As can be seen in Figure 4 (left panel), statin treatment increased the LDLR and PCSK9 protein expression in fat removed. 이는 종전에 알려진 바와 같이 스타틴이 전사인자인 SREBP2의 발현을 증가시킴으로써 이루어진다. This is a statin, as is known in the former takes place by increasing the expression of the transcription factor SREBP2.

부테인 20 μM을 스타틴과 동시에 처리한 실험군은 스타틴 단독 처리 군보다 LDLR의 발현을 더욱 증가시켰으며, 이는 스타틴에 의해 증가했던 PCSK9의 발현량을 감소시켰기 때문으로 사료된다. Stylized part retain the experimental group treated with 20 μM and at the same time Statins further increase the expression of LDLR than statin-only treatment group, which is considered as due sikyeotgi reduce the expression of PCSK9 was increased by the statins.

도 4(오른쪽 패널)는 스타틴과 부테인 단독 처리시 LDLR과 PCSK9의 단백질 발현 조절을 보여준다. Figure 4 (right panel) shows the statin and retain part only treatment when LDLR and PCSK9 protein expression modulation of. 스타틴은 LDLR 증진을 통해 혈중 LDL 콜레스테롤 수치를 저감시키는 강력한 약물로 알려져있다. Statins are known to be a powerful drug for reducing the serum LDL cholesterol levels through enhancement LDLR. 지방 제거 상태에서 스타틴 단독 처리는 LDLR 단백질 발현량을 증가시켰다. Statin-only treatment in the fat removed increased the LDLR protein expression level.

부테인 단독 처리(20 μM)는 지방 제거 상태에서 LDLR의 단백질 발현량을 증가시키기는 하나, 증가 정도가 스타틴 처리군 보다는 미미하였다. Part retain one, increased by the statins it was insignificant than treatment group to increase the protein expression level of LDLR in fat removed only treatment (20 μM). 스타틴 처리는 알려진 바와 같이 PCSK9 단백질 발현을 증가시키나 부테인 단독 처리는 지방 제거 상태에서 증가한 PCSK9 단백질 발현을 현저하게 감소시켰다. Statins process increase, but the PCSK9 protein expression as is known retain part was only treatment is significantly reduced the PCSK9 protein expression increased in the fat removed.

3. HepG2 세포에서 부테인의 LDLR 단백질의 합성 및 리보좀 분해 조절 3. Synthesis and degradation regulation of ribosomal protein LDLR portion of the octane in HepG2 cells

단백질 합성 억제제인 CHX를 이용하여 부테인의 단백질 생성 억제 회복능을 측정하였고, 지방 제거 상태에서 HepG2 세포에 부테인을 0 또는 20 μM 처리하여 배양하고 0, 1, 2, 4, 8 시간 동안 CHX에 배양한 후 세포를 회수하여 웨스턴 블롯을 수행하였다. During protein synthesis inhibitor, using the CHX was measured the inhibition produced protein recovery function in the sub-heptane, fat removed by unit handles retain either 0 or 20 μM in HepG2 cells cultured in the 0, 1, 2, 4, 8 hours CHX after incubation the cells were collected, followed by a Western blot performed.

도 5a 좌측 패널에서 확인할 수 있듯이, 부테인을 처리하지 않은 군에서는 예상했던 바와 같이 CHX의 처리 시간이 길어 질수록, LDLR의 발현이 감소하였다. In Figure 5a As can be seen on the left-hand panel, the group not treated with sub-ylmethyl CHX, decreased the expression of LDLR The more the longer the processing time, as expected. 이는 CHX 처리에 의해 LDLR 단백질의 생성이 시간이 지날수록 억제됨을 보여 주고 있다. This shows a suppressed generation of the LDLR protein over time by CHX treatment. 반면 부테인을 미리 처리한 군에서는 이와 같은 현상이 역전되었다(도 5a, 오른쪽 패널). On the other hand, in the group pre-treated to retain portion was reversed this phenomenon (Fig. 5a, right panel). 즉, CHX 처리에 의해 감소하는 LDLR 단백질의 발현을 부테인이 효과적으로 막음을 알 수 있었다. That is, the portion retain the expression of the LDLR proteins reduced by CHX treatment could effectively know the blocking.

지방 제거 상태에서 HepG2 세포에 리보좀 억제제인 BA1을 처리하고, 동시에 부테인을 0 혹은 20 μM 처리하여 LDLR의 단백질 발현을 측정하였다. In the local treatment removed the ribosome inhibitor BA1 in HepG2 cells, and at the same time to handle the parts retain 0 or 20 μM were measured for protein expression of LDLR.

도 5b에서 확인할 수 있듯이, BA1 처리는 LDLR의 발현을 확연하게 증가시켰고, 이는 LDLR의 리보좀 분해을 보여주는 결과이다. As can be seen in Figure 5b, the process BA1 sikyeotgo remarkably increased the expression of LDLR, which is a result showing the LDLR ribosomal bunhaeeul. BA1과 부테인을 동시에 처리했을 때, LDLR 단백질 발현이 더욱 증가하였다. When the handle portion BA1 and retain at the same time, the LDLR protein expression was further increased. 이는 부테인이 BA1 단독 처리 보다 더욱 효과적으로 LDLR의 리보좀 분해를 막는다는 것을 보여 주고 있다. This demonstrates that part retain more effectively prevent the degradation of ribosomal LDLR than BA1-only treatment.

종합적으로, 부테인은 LDLR 단백질의 합성 억제를 리버스(reverse)시키며, 이는 리보좀 분해 억제를 통해 이루어짐을 알 수 있었다. Overall, the parts retain the sikimyeo reverse (reverse) inhibiting the synthesis of the LDLR protein, which was found yirueojim via ribosomal inhibiting decomposition.

지방이 제거된 상태에서 LDLR의 단백질 발현량은 증가하였고, 부테인은 LDLR 단백질의 발현량을 더욱 증가시켰다. Protein expression level of LDLR in the fat is removed is increased, which further increases the unit retain the expression of LDLR protein. 이러한 부테인의 LDLR 조절능은 PCSK9 억제를 통해 이루어질 가능성이 크다. LDLR regulation of these portions retain ability is likely to be via inhibition of PCSK9. LDLR 억제제인 PCSK9은 LDLR의 리보좀 분해를 통해서 콜레스테롤 항상성을 조절하는 역할을 한다. The LDLR inhibitor PCSK9 plays a role in regulating cholesterol homeostasis through the ribosome degradation of LDLR. 예를 들어, PCSK9은 LDLR의 세포 막으로의 재순환(recycle)을 막고, 대신 LDLR의 리보좀 분해를 유도한다. For example, PCSK9 is blocking the recirculation (recycle) of the LDLR of a cell membrane, but instead leads to decomposition of the ribosome LDLR. 즉, PCSK9의 농도가 높은 상황에서 LDL 콜레스테롤 클리어런스(clearance)가 일어나지 않게 된다. That is, the LDL cholesterol clearance (clearance) will not occur in the concentration of PCSK9 high. 본 발명에서는 실험을 통해 PCSK9 억제제인 부테인이 LDLR의 리보좀 분해 억제를 통해 LDLR 단백질 합성 억제를 리버스함을 밝혔다. In the present invention, the experiment revealed that a portion of heptane PCSK9 inhibitors reverse the LDLR protein synthesis inhibition by a ribosomal inhibiting decomposition of LDLR.

Ⅱ. Ⅱ. 이소유제놀 Iso eugenol

1. HepG2 세포에서 오미자 추출물의 LDLR, PCSK9, SREBP2, HNF1α 단백질 발현 조절 1. LDLR, PCSK9, SREBP2, HNF1α protein regulation of Schisandra chinensis Extract in HepG2 cells

유제놀 또는 이소유제놀을 세포에 처리하여 PCSK, LDLR, SREBP2, HNF1α 발현 조절을 웨스턴 블롯 기법으로 측정하였다. Treat the eugenol or iso-eugenol the cells was measured PCSK, LDLR, SREBP2, HNF1α expression control by Western blot technique.

도 6a 및 6b에서 확인할 수 있듯이, 간암세포주(HepG2 cells)에 10% DLPS 처리는 10% FBS 처리군과 비교했을 때, LDLR와 PCSK9의 농도를 유의적으로 증가시켰다. As can be seen in Figures 6a and 6b, liver cancer cell line (HepG2 cells) were 10% DLPS treatment is compared to the FBS-treated group 10%, increasing the concentration of LDLR and PCSK9 significantly on.

도 6a에서 확인할 수 있듯이, 유제놀(50, 100 μM)을 지방 제거 상태에서 HepG2 세포에 처리하였을 때, LDLR 증진 및 PCSK9 저해 효능이 없음을 알 수 있었다. As can be found at the 6a, eugenol was found (50, 100 μM) a, no increase LDLR and PCSK9 inhibition efficacy when in fat removed after treatment in HepG2 cells. 하지만 도 6b에서 확인할 수 있듯이, 동일한 농도의 이소유제놀(50, 100 μM)을 동일한 조건에서 HepG2 세포에 처리했을 때, 지방 제거에 의해 증가한 LDLR 단백질 발현은 감소하지 않고 유지되는 경향을 보였다. However, when FIG. As can be seen in 6b, the HepG2 cells were treated under the same conditions of the same iso-eugenol (50, 100 μM) in concentration, LDLR protein expression increased by fat removal tended to be maintained without decrease. 또한 이소유제놀(50, 100 μM)은 지방 제거에 의해 증가한 PCSK9을 농도 의존적으로 감소시켰다. In addition, iso eugenol (50, 100 μM) reduced the increase of PCSK9 by fat removal in a concentration dependent manner.

유제놀과 이소유제놀 중 LDLR 및 PCSK9 조절 효능이 상대적으로 뛰어났던 이소유제놀로 실험을 진행하였다. It was performed with isopropyl emulsion nolro experiment eugenol and iso-eugenol of LDLR and PCSK9 control efficacy over, relatively excellent with. LDLR과 PCSK9의 상위 조절 전사인자인 SREBP2와 HNF1α의 단백질 발현을 측정한 결과, 도 7에서 확인할 수 있듯이, 이소유제놀은 HNF1α가 아닌 SREBP2를 감소시킴을 알 수 있었다. As a result of measuring the LDLR and PCSK9 upper control transcription factor SREBP2 HNF1α and protein expression of, as can be see in Figure 7, iso-eugenol was found to decrease the non-SREBP2 HNF1α. 즉, 이소유제놀은 SREBP2 억제를 통해 PCSK9 및 LDLR의 전사를 감소시키고, 이 때, 감소된 PCSK9이 LDLR 단백질 분해를 막을 수 있었을 것이다. In other words, iso eugenol reduces transcription of PCSK9 and LDLR through SREBP2 suppressed, and at this time, is reduced PCSK9 this could prevent the LDLR protein degradation.

2. HepG2 세포에서 이소유제놀의 PCSK9, LDLR, SREBP2, HNF1α 유전자 발현 조절 2. PCSK9 iso eugenol in HepG2 cells, LDLR, SREBP2, HNF1α gene expression

이소유제놀의 PCSK9 억제 및 LDLR 발현 증진을 조절하는 유전자 및 전사 인자의 발현량을 qRT-PCR로 측정하였다. The expression level of the gene and the transcription factors that control the increase of the iso-eugenol inhibit PCSK9 and LDLR expression was determined by qRT-PCR.

도 8a 내지 8d에서 확인할 수 있듯이, 지방이 제거된 상태에서 HepG2 세포의 PCSK9, LDLR, SREBP2, HNF1α 유전자 발현량이 유의적으로 높았다. Amount As can be seen in FIG. 8a to 8d, this local PCSK9, LDLR, SREBP2, HNF1α gene expression in HepG2 cells in the removed state was significantly higher. 이는 지방이 없는 상태에서 세포는 항상성을 이루려는 노력의 일환으로 SREBP2의 유전자 발현 증진을 통해 LDLR을 증진시켜 세포 내 LDL 흡수를 증가시키기 때문이다. This is because in the absence of local conditions within the cell to increase the cellular LDL uptake by promoting the LDLR through the enhancement of gene expression of SREBP2 in an effort is fulfilled homeostasis.

도 8a에서 확인할 수 있듯이, 이소유제놀(12.5 내지 100 μM)은 지방 제거 상태에서 증가한 PCSK9의 유전자 발현량을 농도 의존적으로 감소시켰으며, 이는 통계적으로 유의하였다(p<0.05). (12.5 to 100 μM) Fig. As can be seen from 8a, iso-eugenol were reduced the expression level of the gene PCSK9 increase in fat removed in a concentration-dependent manner, which was statistically significant (p <0.05). 도 8b에서 보여지는 바와 같이, 이소유제놀(25 내지 100 μM)은 지방 제거 상태에서 증가한 LDLR의 유전자 발현량을 유의적으로 감소시켰다. As shown in Figure 8b, iso eugenol (25 to 100 μM) reduced the gene expression level of LDLR increase in fat removed significantly. 이는 이소유제놀에 의한 SREBP2 유전자 발현 억제에 의한 것으로 사료된다. This is thought to be due to the inhibition of gene expression by SREBP2 iso eugenol. 이소유제놀에 의한 PCSK9 의 감소는 HNF와는 무관하며, SREBP2 전사 인자 억제에 의한 것으로 사료된다. Reduction of PCSK9 by iso-eugenol, and is independent of HNF, is thought to be due to SREBP2 transcription factor suppressed. 이러한 결과는 이소유제놀에 의한 PCSK9, LDLR, SREBP2, HNF1α 단백질 발현 조절과 유사하였다. These results were similar to PCSK9, LDLR, SREBP2, HNF1α protein expression regulation by iso eugenol.

3. HepG2 세포에서 이소유제놀의 LDLR 단백질의 합성 및 리보좀 분해 조절 3. Synthesis and degradation regulation of ribosomal protein LDLR of iso eugenol in HepG2 cells

지방 제거 상태에서 HepG2 세포에 리보좀 억제제인 BA1을 처리하고, 동시에 이소유제놀을 0 혹은 100 μM 처리하여 LDLR의 단백질 발현을 측정하였다. In the local treatment removed the ribosome inhibitor BA1 in HepG2 cells, by simultaneously processing a 0 or 100 μM iso-eugenol was measured for protein expression of LDLR.

도 9에서 확인할 수 있듯이, BA1 처리는 LDLR의 발현을 확연하게 증가시켰고, 이는 LDLR의 리보좀 분해을 보여주는 결과이다. As it can be found in 9, BA1 process sikyeotgo remarkably increased the expression of LDLR, which is a result showing the ribosome LDLR bunhaeeul. BA1과 이소유제놀을 동시에 처리했을 때, LDLR 단백질 발현이 더욱 증가하였다. When processing the BA1 and iso eugenol at the same time, the LDLR protein expression was further increased. 이는 이소유제놀이 BA1 단독 처리 보다 더욱 효과적으로 LDLR의 리보좀 분해를 막는다는 것을 보여 주고 있다. This demonstrates that iso emulsion play BA1 more effectively prevent the degradation of ribosomal LDLR than the single treatment. 종합적으로, 이소유제놀은 LDLR 단백질의 합성 억제를 리버스(reverse)시키며, 이는 리보좀 분해 억제를 통해 이루어짐을 알 수 있었다. Overall, iso eugenol is sikimyeo reverse (reverse) inhibiting the synthesis of the LDLR protein, which was found yirueojim via ribosomal inhibiting decomposition.

지방이 제거된 상태에서 LDLR의 단백질 발현량은 증가하였고, 부테인은 LDLR 단백질의 발현량을 더욱 증가시켰다. Protein expression level of LDLR in the fat is removed is increased, which further increases the unit retain the expression of LDLR protein. 이러한 이소유제놀의 LDLR 조절능은 PCSK9 억제를 통해 이루어질 가능성이 크다. LDLR regulation of these iso-eugenol performance is likely to be via inhibition of PCSK9. LDLR 억제제인 PCSK9은 LDLR의 리보좀 분해를 통해서 콜레스테롤 항상성을 조절하는 역할을 한다. The LDLR inhibitor PCSK9 plays a role in regulating cholesterol homeostasis through the ribosome degradation of LDLR. 예를 들어, PCSK9은 LDLR의 세포막으로의 재순환(recycle)을 막고, 대신 LDLR의 리보좀 분해를 유도한다. For example, PCSK9 is blocking the recirculation (recycle) of the LDLR of a cell membrane, but instead leads to decomposition of the ribosome LDLR. 즉, PCSK9의 농도가 높은 상황에서 LDL 콜레스테롤 클리어런스(clearance)가 일어나지 않게 된다. That is, the LDL cholesterol clearance (clearance) will not occur in the concentration of PCSK9 high. 본 발명에서는 실험을 통해 PCSK9 억제제인 이소유제놀이 LDLR의 리보좀 분해 억제를 통해 LDLR 단백질 합성 억제를 리버스함을 밝혔다. In the present invention revealed that reverse the LDLR protein synthesis through the inhibition of PCSK9 inhibitors ribosomal inhibiting decomposition of isopropyl emulsion play LDLR through experiment.

이소유제놀(12.5 내지 100 μM)을 스타틴과 동시 처리한 후, 웨스턴 블롯팅을 통해 LDLR과 PCSK9의 단백질 발현 조절 정도를 비교하였다. Through iso eugenol after (12.5 to 100 μM) and concurrent treatment with statins, Western blotting and compared to control protein expression level of LDLR and PCSK9. 도 10에서 확인할 수 있듯이, 스타틴 처리는 지방제거 상태에서 LDLR과 PCSK9의 단백질 발현을 증가시켰다. As can be seen in Figure 10, a statin treatment increased the LDLR and PCSK9 protein expression in fat removed. 이는 기 알려진 바와 같이 스타틴이 전사인자인 SREBP2의 발현을 증가시킴으로써 이루어진다. This is accomplished by increasing the expression of the transcription factor SREBP2 the statins, as known groups. 이소유제놀을 스타틴과 동시에 처리한 군은 스타틴 단독 처리 군보다 LDLR의 발현을 다소 증가시켰으며, PCSK9의 단백질 발현은 농도 의존적으로 감소시켰다. The group treated with iso-eugenol simultaneously with the statin is stylized rather than increasing the expression of LDLR Statin-only treatment group, expression of the PCSK9 protein was decreased in a concentration-dependent manner.

<110> KOREA FOOD RESEARCH INSTITUTE <120> Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol <130> PN170187 <160> 12 <170> KopatentIn 2.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PCSK9 Forward Primer <400> 1 ggcaggttgg cagctgttt 19 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PCSK9 Reverse Primer <400> 2 cgtgtaggcc ccgagtgt 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LDLR Forward Primer <400> 3 aggagacgtg cttgtctgtc 20 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> LDLR Reverse Primer <400> 4 ctgagccgtt gtcgcagt 18 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SREBP2 Forward Primer <400> 5 cggtaatgat cacgccaaca t 21 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SREBP2 Reverse Primer <400> 6 tggtatatca aaggctgctg gat 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> < <110> KOREA FOOD RESEARCH INSTITUTE <120> Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol <130> PN170187 <160> 12 <170> KopatentIn 2.0 <210> 1 <211> 19 < 212> DNA <213> Artificial Sequence <220> <223> PCSK9 Forward Primer <400> 1 ggcaggttgg cagctgttt 19 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PCSK9 Reverse Primer <400> 2 cgtgtaggcc ccgagtgt 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LDLR Forward Primer <400> 3 aggagacgtg cttgtctgtc 20 <210> 4 <211> 18 <212 > DNA <213> Artificial Sequence <220> <223> LDLR Reverse Primer <400> 4 ctgagccgtt gtcgcagt 18 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SREBP2 Forward Primer < 400> 5 cggtaatgat cacgccaaca t 21 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SREBP2 Reverse Primer <400> 6 tggtatatca aaggctgctg gat 23 <210> 7 <211> 23 < 212> DNA <213> Artificial Sequence <220> < 223> HMGCR Forward Primer <400> 7 caaggagcat gcaaagataa tcc 23 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HMGCR Reverse Primer <400> 8 gccattacgg tcccacaca 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HNF1alpha Forward Primer <400> 9 tggcgcagca gttcacccat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HNF1alpha Reverse Primer <400> 10 tgaaacggtt cctccgcccc 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Forward Primer <400> 11 atgttcgtca tgggtgtgaa c 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Reverse Primer <400> 12 gcatggactg tggtcatgag t 21 223> HMGCR Forward Primer <400> 7 caaggagcat gcaaagataa tcc 23 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> HMGCR Reverse Primer <400> 8 gccattacgg tcccacaca 19 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HNF1alpha Forward Primer <400> 9 tggcgcagca gttcacccat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> < 223> HNF1alpha Reverse Primer <400> 10 tgaaacggtt cctccgcccc 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Forward Primer <400> 11 atgttcgtca tgggtgtgaa c 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Reverse Primer <400> 12 gcatggactg tggtcatgag t 21

Claims (5)

  1. 이소유제놀(Isoeugenol)을 포함하는 PCSK9(Proprotein convertase subtilisin/kexin type 9) 유전자의 발현 감소용 식품 조성물. Iso eugenol (Isoeugenol) PCSK9 (Proprotein convertase subtilisin / kexin type 9) a food composition for decreasing the expression of a gene comprising a.
  2. 제 1 항에 있어서, 상기 조성물은 이소유제놀 이외에 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 미네랄, 인지질, 말톨, 올리고당, 아미노산, 알코올 및 탄산음료에 사용되는 탄산화제로 구성된 군으로부터 선택되는 하나 이상을 추가적으로 포함하는 것인, 식품 조성물. The method of claim 1, wherein the composition is iso eugenol addition to nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acid, protective colloidal thickeners, pH adjusting agents, stabilizing agents, preservatives, would additionally include glycerine, mineral, phospholipids, maltol, oligosaccharide, amino acid, alcohol, and one or more selected from the group consisting of carbon dioxide agent to be used in soft drinks, food compositions.
  3. 이소유제놀(Isoeugenol)을 포함하는 저밀도 지단백 수용체(Low-Density Lipoprotein Receptor, LDLR) 증가용 식품 조성물. Low-density lipoprotein receptors, including iso-eugenol (Isoeugenol) (Low-Density Lipoprotein Receptor, LDLR) food composition increases.
  4. 제 3 항에 있어서, 상기 조성물은 이소유제놀 이외에 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 미네랄, 인지질, 말톨, 올리고당, 아미노산, 알코올 및 탄산음료에 사용되는 탄산화제로 구성된 군으로부터 선택되는 하나 이상을 추가적으로 포함하는 것인, 식품 조성물. 4. The method of claim 3 wherein the composition is iso eugenol addition to nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acid, protective colloidal thickeners, pH adjusting agents, stabilizing agents, preservatives, would additionally include glycerine, mineral, phospholipids, maltol, oligosaccharide, amino acid, alcohol, and one or more selected from the group consisting of carbon dioxide agent to be used in soft drinks, food compositions.
  5. 이소유제놀을 포함하는 스타틴(statin)에 대하여 내성을 갖는 고콜레스테롤 혈증의 예방 또는 치료용 약제학적 조성물. Prevention or treatment a pharmaceutical composition for hypercholesterolemia against statin (statin) containing iso eugenol resistant.
KR1020190020723A 2019-02-21 2019-02-21 Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol KR101956805B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190020723A KR101956805B1 (en) 2019-02-21 2019-02-21 Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190020723A KR101956805B1 (en) 2019-02-21 2019-02-21 Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol

Publications (1)

Publication Number Publication Date
KR101956805B1 true KR101956805B1 (en) 2019-03-11

Family

ID=65758347

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190020723A KR101956805B1 (en) 2019-02-21 2019-02-21 Composition for Inhibiting PCSK9 Gene Expression or Increasing Amount of Low Density Lipoprotein Receptor Comprising Butein or Isoeugenol

Country Status (1)

Country Link
KR (1) KR101956805B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3262850A (en) * 1958-06-20 1966-07-26 Ici Ltd Methods for reducing cholesterol in the blood
KR20130101908A (en) * 2012-03-06 2013-09-16 연세대학교 산학협력단 Composition for increasing the amount of the ldl receptor by inhibition of the expression of pcsk9
KR20160132611A (en) * 2015-05-11 2016-11-21 한국 한의학 연구원 Composition for increasing amount of low density lipoprotein receptor by inhibition of PCSK9 gene expression comprising Rubi fructus extract as effective component and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3262850A (en) * 1958-06-20 1966-07-26 Ici Ltd Methods for reducing cholesterol in the blood
KR20130101908A (en) * 2012-03-06 2013-09-16 연세대학교 산학협력단 Composition for increasing the amount of the ldl receptor by inhibition of the expression of pcsk9
KR20160132611A (en) * 2015-05-11 2016-11-21 한국 한의학 연구원 Composition for increasing amount of low density lipoprotein receptor by inhibition of PCSK9 gene expression comprising Rubi fructus extract as effective component and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Journal of Pharmacy and Pharmacology. 2009, vol.61, pp.517-525 *

Similar Documents

Publication Publication Date Title
RU2174393C2 (en) Naringin and naringenin as inhibitor of activity of 3-hydroxy-3-methylglutaryl-coa-reductase
CN103272071A (en) Grape extract, dietary supplement thereof, and processes therefor
JPWO2005074962A1 (en) Muscle tension enhancers
AU2002227771B2 (en) Regulation of lipids and/or bone density and compositions therefor
KR100877600B1 (en) Pharmaceutical composition comprising metadoxine and garlic oil for preventing and treating alcohol-induced fatty liver and steatohepatitis
EP2200576B1 (en) Novel use of lignan-type compounds isolated from extract of nutmeg or aril of nutmeg
WO2005056035A1 (en) Alga extract and sugar hydrolase inhibitor containing the same
US20070128299A1 (en) Functional beverage and composition
JPWO2006043671A1 (en) Transcription factor Nrf2 activators and food whose function is assigned
KR101262686B1 (en) Decrease body fat composition for
KR101473017B1 (en) Aging inhibitors
JP4880276B2 (en) Estrogen-dependent cell growth promoter, and epidermal keratinocytes growth promoting agent
KR101841256B1 (en) Composition for improving skin wrinkle and enhancing elasticity
US20120052138A1 (en) Composition comprising green tea extract
JP2009013123A (en) Health-retaining preparation
CN101516407B (en) Improvement of arginase levels/activity
KR20070031430A (en) Lipase inhibitor
CN1980656B (en) New pharmaceutical use of lipase inhibitor
JP4788994B2 (en) Functional food and beverage
KR101405574B1 (en) Antioxidant
JP4494033B2 (en) Serum cholesterol lowering agents, food and a method for producing
KR20060009391A (en) Extract from plant of japanese parsley family and process for producing the same
JP5686496B2 (en) Metabolic syndrome relieving and preventing composition
Quiñones et al. Long-term intake of CocoanOX attenuates the development of hypertension in spontaneously hypertensive rats
RU2530769C2 (en) Reduction of cholesterol level by combined application of quercetin and statin

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant