KR101797168B1 - Vesicle with novel protein transduction domain - Google Patents

Vesicle with novel protein transduction domain Download PDF

Info

Publication number
KR101797168B1
KR101797168B1 KR1020160149622A KR20160149622A KR101797168B1 KR 101797168 B1 KR101797168 B1 KR 101797168B1 KR 1020160149622 A KR1020160149622 A KR 1020160149622A KR 20160149622 A KR20160149622 A KR 20160149622A KR 101797168 B1 KR101797168 B1 KR 101797168B1
Authority
KR
South Korea
Prior art keywords
seq id
liposome
amino acid
acid sequence
liposomes
Prior art date
Application number
KR1020160149622A
Other languages
Korean (ko)
Inventor
장상호
이길환
황정순
김지안
박주희
이정옥
조현종
정재영
Original Assignee
주식회사 바이오셀트란
제이앤팜유한책임회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 바이오셀트란, 제이앤팜유한책임회사 filed Critical 주식회사 바이오셀트란
Priority to KR1020160149622A priority Critical patent/KR101797168B1/en
Application granted granted Critical
Publication of KR101797168B1 publication Critical patent/KR101797168B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/14Esters of carboxylic acids, e.g. fatty acid monoglycerides, medium-chain triglycerides, parabens or PEG fatty acid esters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/42Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K8/00Cosmetics or similar toilet preparations
    • A61K8/02Cosmetics or similar toilet preparations characterised by special physical form
    • A61K8/14Liposomes; Vesicles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K8/00Cosmetics or similar toilet preparations
    • A61K8/18Cosmetics or similar toilet preparations characterised by the composition
    • A61K8/30Cosmetics or similar toilet preparations characterised by the composition containing organic compounds
    • A61K8/55Phosphorus compounds
    • A61K8/553Phospholipids, e.g. lecithin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K8/00Cosmetics or similar toilet preparations
    • A61K8/18Cosmetics or similar toilet preparations characterised by the composition
    • A61K8/30Cosmetics or similar toilet preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Liposomes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Liposomes
    • A61K9/1271Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • A61K9/1272Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers with substantial amounts of non-phosphatidyl, i.e. non-acylglycerophosphate, surfactants as bilayer-forming substances, e.g. cationic lipids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILET PREPARATIONS
    • A61Q19/00Preparations for care of the skin

Abstract

본 발명은 신규의 프로테인 트랜스덕션 도메인이 자가조립된 구형 구조체에 관한 것으로, 본 발명의 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 이용할 경우, 세포 또는 피부 침투성이 한층 증진된 구형 구조체 (일 예로, 리포좀)를 제조할 수 있다. The invention for example as a protein transport production domain of the novel about the spherical structure assembled self, when using the peptides having the amino acid sequence shown in SEQ ID NO: 1 of the present invention, the cells or the skin permeability even promote spherical structure (one, it is possible to manufacture a liposome). 또한, 본 발명에서 제조된 구형 구조체 (일 예로, 리포좀)를 이용할 경우, 난용성 물질 (피부기능성 물질 또는 약리학적 효능 물질)을 구조체 내부에 탑재시켜 피부 또는 세포로 효율적으로 수송할 수 있다. In addition, when using a spherical structure prepared in the present invention (an example, liposomes), I can be to mount the refractory material (the skin or the functional material pharmacological efficacy material) in the internal structure to efficiently transported into the skin or cells.

Description

신규의 프로테인 트랜스덕션 도메인을 함유하는 구형 구조체 {Vesicle with novel protein transduction domain} {Vesicle with novel protein transduction domain} spherical structure containing a novel protein domain of production trans

본 발명은 활성 성분 또는 유용 성분을 세포 또는 피부로 전달할 수 있는 구형 구조체에 관한 것으로, 더욱 상세하게는 신규의 프로테인 트랜스덕션 도메인을 함유하는 구형 구조체에 관한 것이다. The present invention relates to a that can deliver the active component or components useful in the skin cell or a spherical structure, and more particularly, to a spherical structure containing a protein domain transport production of the novel.

PTD(Protein transduction domain)는 자신의 분자량의 수배에 이르는 거대분자를 세포 안으로 운반할 수 있는데, 다양한 세포 형태에 대해서도 효율적이라는 점에서 의약품, 기능성 식품 또는 기능성 화장품에 함유되어 있는 활성 성분 또는 유효 성분을 효율적으로 세포 안으로 침투시킬 수 있는 잠재력을 가지고 있는 것으로 평가된다. PTD (Protein transduction domain) is there to transport macromolecules up to several times of their molecular weight in the cells, a variety of cellular drug in that it is effective even for the form, the active contained in a functional food or a functional cosmetic ingredient or active ingredient efficient cells are assessed as having the potential to penetrate inside.

예를 들어, 표적 물질과 결합한 PTD는 시험관 내( in vitro ) 또는 생체 내( in vivo )에서 세포막을 전위시켜 세포 및/또는 세포 핵 내로 진입할 수 있다. For example, PTD combined with the target material may be potential to the cell membrane in vitro (in vitro) or in vivo (in vivo) enters the cell and / or cell nucleus. 항원성 펩타이드, 펩타이드 핵산, 안티센스 올리고뉴클레오티드, 전장 단백질, 나노 입자, 리포좀과 같은 다양한 생체 분자들은 PTD를 통하여 전달될 수 있는 것으로 알려져 있다. Antigenic peptides, peptide nucleic acids, antisense oligonucleotides, full-length protein, a variety of biomolecules such as nanoparticles, liposomes are known that can be transmitted via the PTD.

대부분의 펩타이드 또는 핵산 기반의 의약품이 세포 내로의 유입이 곤란하여 이들 물질의 치료제로서의 개발에 한계로 작용하고 있다는 점을 고려해 볼 때, PTD는 이들 의약품의 생체 내에서의 효율을 배가시킬 수 있을 것으로 기대된다. In view of the fact that most of the peptide or the nucleic acid-based drugs and is difficult to influx into the cell acts as a limit to develop as therapeutic agents of these materials, PTD is to be able to double the efficiency of in vivo of these drugs It is expected.

이러한 PTD는 피부로의 약물 전달에 있어서도 단순 혼합물이나 약물에 직접 화학 결합시켜 적용된 바 있다. This PTD has been applied also to directly chemical coupling to a simple mixture or drugs in drug delivery to the skin. 하지만, PTD와 약물을 혼합한 경우에는 PTD와 약물의 피부 투과 시간 격차가 발생할 수 있으며, 난용성 약물은 적용에 한계가 존재하고, 투여 조건에 따라 큰 편차를 야기할 수 있다. However, when mixing the PTD and the drug, and can cause skin permeation time gap PTD and drugs, poorly soluble drug may be a limit to the present application, and causes a large variation depending on the dose condition. 또한, 화학 결합 역시 활성 물질과 펩타이드와의 결합의 용이성 및 활성 물질의 활성 유지 여부에 문제점이 발생하여 그 활용이 매우 제한적이다. In addition, the chemical bond is also very limited its application to the problem occurs with or maintain the activity of the active substance and a peptide bond with ease and an active material of the.

한편, 난용성 약물은 화합물의 구조상 소수성 부위를 포함하고 있어 물에 잘 녹지 않는데, 난용성으로 인해 그 실용성이 제한되는 경우가 많다. On the other hand, it is poorly soluble drugs and comprises a hydrophobic structural portion of the compound does poorly soluble in water, I often a practical limit due to the availability. 예를 들어, 신약으로 개발되는 약물 중 약 41% 이상이 난용성으로 인하여 중도에 포기되고 있으며, 미국 약전(US Pharmacopeia)에 등재된 약물의 약 ⅓이상이 난용성 약물로 분류되고 있다. For example, due to the approximately 41% or more of the drug to be developed as new drugs hardly soluble has been abandoned in the middle, and is classified as the approximately ⅓ or more of the drugs listed in the USP (US Pharmacopeia) poorly soluble drugs.

난용성 약물의 대표적인 예로, 카페익산 (Caffeic acid), 코엔자임큐텐(coenzyme Q10), 우르소데옥시콜린산(ursodeoxycholic acid), 일라프라졸(ilaprazol), 파클리탁셀(paclitaxel), 이마티닙 메실레이트(imatinib mesylate) 등이 있으며, 이러한 약물들은 우수한 효능에도 불구하고 난용성으로 인하여 사용이 제한된다. I, etc. Representative examples of the poorly soluble drug, a cafe acid (Caffeic acid), coenzyme Q10 (coenzyme Q10), Ur sode oxy choline acid (ursodeoxycholic acid), Ilaprazole (ilaprazol), paclitaxel (paclitaxel), imatinib mesylate (imatinib mesylate) , and the use of these drugs is limited due to the insoluble despite the excellent efficacy.

이러한 난용성 약물을 사용하기 위해서는 난용성을 해결하기 위한 부가적인 물질이 첨가되어야 한다. These I to be an additional material to correct the poorly water-soluble addition to using soluble drug. 예컨대, 일반적으로 난용성 물질을 수용화하기 위해서는 유화제를 이용한 유화, 리포좀을 이용한 포집 등이 널리 이용되고 있다. For example, generally I to be used widely, such as to accommodate the screen soluble matter captured by the emulsion, a liposome using an emulsifier.

한편, 리포좀과 PTD를 결합시킬 경우, 리포좀의 피부 투과 기능(vesicular skin penetration), 투과 촉진 기능(penetration enhancing effect), 땀샘을 포함한 부속기관을 통한 침투(penetration of liposomes through the transappendageal route) 기능과, PTD의 피부 세포 내 약물 이입 촉진 및 이에 의한 농도 구배 형성 작용에 의한 피부 침투 증가 기전이 함께 적용됨으로써, 약물의 피부 침투성을 상승적으로 향상시킬 수 있다. On the other hand, when to combine liposome PTD, skin penetration capabilities of liposomes (vesicular skin penetration), permeation promoting function (penetration enhancing effect), penetration through the appendages, including sweat gland (penetration of liposomes through the transappendageal route) function, drug transfected skin cells and thereby promote the PTD is applied with a skin penetration increasing mechanism due to the concentration gradient formation operation by being, it is possible to improve the skin permeability of drugs synergistically.

대한민국 특허공개번호 제10-2011-0046961호 (공개일자 2011.05.06)에는, 세포투과성 펩타이드 표면 결합 나노 리포좀 및 이를 포함하는 항-아토피 조성물이 기재되어 있다. Republic of Korea Patent Publication No. 10-2011-0046961 No. (Publication date 05.06.2011), the cell-permeable peptide coupling surface and wherein the nano-liposomes containing the same - is atopic composition is described.

본 발명에서는 본 발명자들이 개발한 새로운 PTD를 이용하여, 세포 또는 피부 침투성이 한층 증진된 구형 구조체를 개발하여 제공하고자 한다. In the present invention, by using a new PTD developed by the present inventors, it is intended to provide the developing cells or skin penetration is further enhanced spherical structure.

본 발명은 친수성 부위와 소수성 부위를 갖는 양친매성 분자가 자가응집하여 형성되는 구형 구조체에 있어서, 상기 구형 구조체에는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드가 함유된 것을 특징으로 하는 구형 구조체를 제공한다. The present invention is an amphipathic molecule having a hydrophilic portion and a hydrophobic portion provides a spherical structure, characterized in that self-a in the rectangular structure to be agglomerated to form the rectangular structure has contained the peptide having the amino acid sequence shown in SEQ ID NO: 1 .

또한, 본 발명은 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 결합시킴으로써 제조한 양친매성 분자가 자가응집하여 형성되는 구형 구조체를 제공한다. In addition, the present invention is an amphipathic molecule prepared by coupling a peptide having an amino acid sequence shown in SEQ ID NO: 1 lipid to provide a spherical structure formed by self-aggregation. 이때, 상기 지질은, 일 예로, 말레이미드, N-하이드록시석시니미드, 아민, 카르복실산, 하이드록실과 같은 관능기가 결합되어 있는 포스파티딜콜린; At this time, the lipids are, For example, a maleimide, N- hydroxy-seat shinny imide, amine, carboxylic acid, hydroxyl functional groups are combined with fruit, such as phosphatidylcholine; 포스파티딜에탄올아민; Phosphatidylethanolamine; 포스파티딜글리세롤; Phosphatidylglycerol; 포스파티딜세린; Phosphatidylserine; 포스파티딜이노시톨; Phosphatidylinositol; 세라마이드; Ceramides; 스핑가닌; Nin's ping; 파이토스핑고신; Phytosphingosine; 스핑고신; Sphingosine; 디메틸디옥타데실암모늄; Dimethyl dioctadecyl ammonium; 디올레오일트리메틸암모늄프로판; Diol Leo one trimethylammonium propane; 및 디옥타데세닐트리메틸암모늄프로판; And di-octadecenyl trimethylammonium propane; 중 선택되는 어느 하나 또는 이들의 유도체일 수 있다. Any one of which is selected or may be derivatives thereof.

본 발명의 구형 구조체에 있어서, 상기 구형 구조체는, 바람직하게 양친매성 분자의 소수성 분자들이 서로 맞닿도록 배향되어 이중막 형태의 테둘레를 구성하는 것을 특징으로 하는 구형 구조체일 수 있다. In the spherical structure of the present invention, the spherical structure, may preferably be an amphiphilic spherical structure, characterized in that constituting the hydrophobic molecules are aligned to abut each other in the form of bilayers rim circumference of the molecule. 이때, 상기 구형 구조체는, 일 예로, 리포좀일 수 있다. In this case, the rectangular structure may be, for an example, liposomes.

본 발명의 구형 구조체에 있어서, 상기 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드는, 바람직하게 구형 구조체의 외부 방향으로 배향되어 것이 좋다. In the spherical structure of the present invention, the peptide having the amino acid sequence described in SEQ ID NO: 1 is preferably is preferably oriented in the outer direction of the rectangular structure.

본 발명의 구형 구조체에 있어서, 상기 구형 구조체는, 바람직하게 콜레스테롤이 소수성 부위에 함유되어 있는 것이 좋다. In the spherical structure of the present invention, the spherical structure is preferably in a preferably cholesterol is contained in the hydrophobic portion.

본 발명의 구형 구조체에 있어서, 상기 구형 구조체는, 바람직하게 내부에 포집대상물질을 내포하고 있는 것일 수 있다. In the spherical structure of the present invention, the spherical structure may be one that preferably involve collecting the substance therein.

한편, 본 발명은 상기 본 발명의 구형 구조체를 함유하는 것을 특징으로 하는 화장료 조성물을 제공한다. On the other hand, the present invention provides a cosmetic composition characterized in that it contains the spherical structure of the present invention. 또한, 본 발명의 구형 구조체를 함유하는 것을 특징으로 하는 약학 조성물을 제공한다. It also provides a pharmaceutical composition comprising a spherical structure of the present invention.

한편, 본 발명은 양친매성 분자, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드 및 포집대상물질을 용매에 용해시키는 단계 (a); On the other hand, the present invention comprises the steps of dissolving the polypeptide and collecting the target substance having the amino acid sequence shown in amphiphilic molecules, SEQ ID NO: 1 in a solvent (a); 상기 단계 (a) 후, 용매를 증발시켜 필름을 제조하는 단계 (b); After said step (a), the method comprising evaporating the solvent to prepare a film (b); 상기 단계 (b) 후, 필름에 정제수 또는 완충액을 첨가하여, 수화시킨 후, 에너지를 가해 입자 크기를 감소시키는 단계 (c);를 포함하는 것을 특징으로 하는 구형 구조체의 제조방법을 제공한다. After said step (b), was added to purified water or a buffer solution to the film, after hydration, the step of applying energy to reduce the particle size (c); provides a process for the preparation of a spherical structure comprises a. 이때, 상기 양친매성 분자는, 일 예로, 인지질일 수 있다. At this time, the amphipathic molecules may be, for one embodiment, a phospholipid.

본 발명은 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 결합시킴으로써 제조한 양친매성 분자 및 포집대상물질을 용매에 용해시키는 단계 (a); The present invention comprises the steps of dissolving the amphiphilic molecules and collecting the target substance prepared by coupling a peptide having an amino acid sequence shown in SEQ ID NO: 1 in lipid solvents (a); 상기 단계 (a) 후, 용매를 증발시켜 필름을 제조하는 단계 (b); After said step (a), the method comprising evaporating the solvent to prepare a film (b); 상기 단계 (b) 후, 필름에 정제수 또는 완충액을 첨가하여, 수화시킨 후, 에너지를 가해 입자 크기를 감소시키는 단계 (c);를 포함하는 것을 특징으로 하는 구형 구조체의 제조방법을 제공한다. After said step (b), was added to purified water or a buffer solution to the film, after hydration, the step of applying energy to reduce the particle size (c); provides a process for the preparation of a spherical structure comprises a. 이때, 상기 단계 (a)는, 바람직하게 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 결합시킴으로써 제조한 양친매성 분자 외에, 별도의 양친매성 분자를 용매에 더 첨가하여 용해시키는 것이 좋다. In this case, the step (a), preferably in addition to the amphipathic molecules prepared by coupling a peptide having an amino acid sequence shown in SEQ ID NO: 1 in lipid, it is preferable to dissolve and further adding a separate amphipathic molecules in a solvent. 이때, 상기 별도의 양친매성 분자는, 일 예로, 인지질일 수 있다. In this case, the separate amphipathic molecules may be, for one embodiment, a phospholipid.

본 발명의 구형 구조체 제조방법에 있어서, 상기 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 결합시킴으로써 제조한 양친매성 분자는, 일 예로, 필름 형태의 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 함유하는 용액을 첨가하여, 지질과 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드 간의 결합 반응을 유도함으로써 제조하되, 상기 필름 형태의 지질은, 지질을 소수성 유기용매에 녹인 후, 유기용매를 휘발시켜 필름 형태로 제조한 것이고, 상기 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 함유하는 용액은, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 암모니움 카르보네이트과 함께 증류수에 녹인 후, pH 8~10로 조절하여 제조한 것일 수 있다. In the rectangular structure, the production method of the present invention, having the amino acid sequence shown in amphipathic molecules prepared by coupling a peptide having an amino acid sequence shown in SEQ ID NO: 1 in the lipid, in one example, SEQ ID NO: 1 in lipid in a film form was dissolved in a solution containing the peptide was added, was prepared by inducing a bond with the peptide reaction with the amino acid sequence set forth in lipid and SEQ ID NO: 1, lipids to the film form, the lipid in a hydrophobic organic solvent, evaporation of the organic solvent by will manufactured in film form, a solution containing a peptide having the amino acid sequence described in SEQ ID NO: 1, then a peptide having the amino acid sequence shown in SEQ ID NO: 1 was dissolved in with ammonium carbonate neyiteugwa distilled water, pH 8 ~ It may be prepared by adjusted to 10. 이때, 상기 지질은, 일 예로, 말레이미드, N-하이드록시석시니미드, 아민, 카르복실산, 하이드록실과 같은 관능기가 결합되어 있는 포스파티딜콜린; At this time, the lipids are, For example, a maleimide, N- hydroxy-seat shinny imide, amine, carboxylic acid, hydroxyl functional groups are combined with fruit, such as phosphatidylcholine; 포스파티딜에탄올아민; Phosphatidylethanolamine; 포스파티딜글리세롤; Phosphatidylglycerol; 포스파티딜세린; Phosphatidylserine; 포스파티딜이노시톨; Phosphatidylinositol; 세라마이드; Ceramides; 스핑가닌; Nin's ping; 파이토스핑고신; Phytosphingosine; 스핑고신; Sphingosine; 디메틸디옥타데실암모늄; Dimethyl dioctadecyl ammonium; 디올레오일트리메틸암모늄프로판; Diol Leo one trimethylammonium propane; 및 디옥타데세닐트리메틸암모늄프로판; And di-octadecenyl trimethylammonium propane; 중 선택되는 어느 하나 또는 이들의 유도체일 수 있다. Any one of which is selected or may be derivatives thereof.

본 발명의 구형 구조체 제조방법에 있어서, 상기 단계 (a)는, 바람직하게 콜레스테롤을 추가로 용매에 용해시키는 것이 좋다. In the rectangular structure, the production method of the present invention, the step (a), it is preferable that preferably added dissolved in a solvent to cholesterol.

본 발명의 구형 구조체 제조방법에 있어서, 상기 용매는, 일 예로, 클로로포름과 메탄올의 혼합물일 수 있다. In the rectangular structure, the production method of the present invention, the solvent is one example, it may be a mixture of chloroform and methanol.

본 발명의 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 이용할 경우, 세포 또는 피부 침투성이 한층 증진된 구형 구조체 (일 예로, 리포좀)를 제조할 수 있다. When using a peptide having the amino acid sequence shown in SEQ ID NO: 1 of the present invention, the cells or the skin permeation enhancement is even spherical structure can be produced (For example, a liposome).

또한, 상기와 같이 본 발명에서 제조된 구형 구조체 (일 예로, 리포좀)를 이용할 경우, 난용성 물질 (피부기능성 물질 또는 약리학적 효능 물질)을 구조체 내부에 탑재시켜 피부 또는 세포로 효율적으로 수송할 수 있다. In addition, when using a spherical structure prepared in the present invention as described above (an example, liposomes), I can was equipped with a refractory material (skin, the functional material or pharmacological effect material) on the internal structure to efficiently transported into the skin or cells have.

도 1은 일반적인 GFP 발현 벡터의 맵이다. Figure 1 is a map of a typical GFP expression vector.
도 2는 TAT-GFP 발현 벡터의 맵이다. Figure 2 is a map of the TAT-GFP expression vectors.
도 3은 PEP1-GFP 발현 벡터의 맵이다. Figure 3 is a map of the vector PEP1-GFP expression.
도 4는 STeP-GFP 발현 벡터의 맵이다. Figure 4 is a map of the STeP-GFP expression vectors.
도 5는 GFP 재조합 단백질의 발현 결과이다. Figure 5 is a result of expression of recombinant protein GFP.
도 6은 GFP 재조합 단백질의 정제 결과이다. 6 is a result of the GFP purified recombinant protein.
도 7은 GFP 단백질의 세포 투과력 비교 결과이다. Figure 7 shows the results compared to the cell permeability of the GFP protein.
도 8은 GFP 단백질의 피부 투과력 비교 결과이다. 8 is a skin permeability compared to the results of the GFP protein.
도 9는 지질(DSPE-PEG3.4K-maleimide)-PTD(STeP 펩타이드)의 화학적 구조를 보여준다. Figure 9 shows the chemical structure of the lipid (DSPE-PEG3.4K-maleimide) -PTD (STeP peptide).
도 10은 자가조립 PTD-리포좀-(카페익산)의 입자 특성 평가 결과이다. 10 is a self-assembly PTD- liposome - the evaluation of the particle properties (cafe acid).
도 11은 자가조립 PTD-리포좀-(카페익산)의 입자 모양 (TEM image) 관찰 결과이다 (좌: 리포좀-(카페익산), 우: 자가조립 PTD-리포좀-(카페익산)). Particle shape (TEM image) of the observation (cafe acid) 11 is self-assembled PTD- liposomes (L: liposome (cafe acid), and the right: self-assembly PTD- liposomes (cafe acid)).
도 12는 자가조립 PTD-리포좀-(카페익산)의 입자 안정성 평가 결과이다. 12 is a self-assembly PTD- liposome-particle stability is the result of (cafe acid).
도 13은 산화스트레스에 의한 세포 손상에서 카페익산의 세포 보호 효과를 비교한 결과이다. 13 is a result of comparing the cell protection effect of the cafe acid in the cell damage caused by oxidative stress.
도 14는 자가조립 PTD-리포좀-(카페익산)의 피부 투과력 비교 결과이다. 14 is a self-assembled PTD- liposome - a comparison of skin penetration (cafe acid).

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. This has a number of patents and publications are referenced and its cited throughout the specification. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다. The disclosures of the cited patents and publications are incorporated by references into this specification in its entirety is described in the two-level more apparent and content of this invention in the art to which this invention pertains.

본 발명자들은 목적 물질을 세포 내로 전달할 수 있는 보다 효율적인 펩타이드 및 이를 이용한 약물전달체(drug delivery system)를 개발하고자 노력한 결과, 서열번호 1에 기재된 세포투과 펩타이드 및 이를 함유한 원형의 구형체 (예로써, 리포좀)를 개발하였다. As the present inventors have sought results, cell permeation peptide, and a sphere (for example, a circular containing the same shown in SEQ ID NO: 1 to develop a drug delivery system (drug delivery system) using efficient peptides and these in more that can be passed to the target substance into a cell, It developed a liposome).

서열번호 1에 기재된 아미노산 서열을 갖는 본 발명의 펩타이드는 양친매성 특성의 띄며, 목적 물질의 세포 내 전달에 효율적으로 적용될 수 있는 것이 하기 본 발명의 실험을 통해 확인되었다. The peptide of the invention having the amino acid sequence shown in SEQ ID NO: 1 to that which can efficiently be applied to the intracellular delivery of ttuimyeo, the target substance of amphipathic characteristics was confirmed through the experiment of the present invention. 상기 서열번호 1의 아미노산 서열은, 바람직하게 서열번호 2에 기재된 핵산 서열로 암호화되는 것일 수 있다. Amino acid sequence of SEQ ID NO: 1, may be one which is preferably encrypted by the nucleic acid sequence shown in SEQ ID NO: 2. 또한, 필요 목적에 따라, 본 아미노산 서열의 N-말단 또는 C-말단에 필요 목적의 구현을 위한 펩타이드를 결합시킬 수도 있다. Further, if necessary purpose, it is also possible to combine the peptide for the implementation of required purposes to N- terminus or the C- terminus of the amino acid sequence.

본 발명은 친수성 부위와 소수성 부위를 갖는 양친매성 분자가 자가응집하여 형성되는 구형 구조체에 있어서, 상기 구형 구조체에는 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드가 함유된 것을 특징으로 하는 구형 구조체를 제공한다. The present invention is an amphipathic molecule having a hydrophilic portion and a hydrophobic portion provides a spherical structure, characterized in that self-a in the rectangular structure to be agglomerated to form the rectangular structure has contained the peptide having the amino acid sequence shown in SEQ ID NO: 1 . 또한, 본 발명은 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 결합시킴으로써 제조한 양친매성 분자가 자가응집하여 형성되는 구형 구조체를 제공한다. In addition, the present invention is an amphipathic molecule prepared by coupling a peptide having an amino acid sequence shown in SEQ ID NO: 1 lipid to provide a spherical structure formed by self-aggregation.

분자 내에 친수성 부위와 소수성 부위를 갖는 양친매성 분자를, 일 예로써 수용성 용액 중에 분산시키면, 소수성 부분끼리 자가응집(회합)하여 소수성 부분이 중심으로 모이는 구형의 구조체를 형성하게 된다. When dispersed in aqueous solution, the amphiphilic molecules having a hydrophilic site and a hydrophobic site in a molecule, as an example, the hydrophobic portion between self-aggregation (association) to form a spherical structure of the hydrophobic portion to the gathering center. 이를 소위 '마이셀(micelle)'이라 하는데, 이와 같이 형성된 구형의 구조체는 소수성 부분에 지용성 물질을 탑재시켜 해당 지용성 물질의 이송을 위한 수단으로 활용될 수가 있다. To referred to as so-called "micelle (micelle) ', thus formed a spherical structure can be mounted to the oil-soluble substance in a hydrophobic moiety used as a means for transport of the fat-soluble substance. 또한, 양친매성 분자들은 수용성 용액 중에 분산 시, 소수성 분자들이 서로 맞닿도록 배향되어 이중막 형태의 테둘레를 구성할 수도 있는데, 양친매성 분자로써 인지질이 사용되어 이중막 형태로 제조된 것을 리포좀(liposome)이라 한다. Further, the amphipathic molecules are oriented so that dispersion when, hydrophobic molecules abut one another in an aqueous solution double layer there may also be configured in the form of the rim circumference, the liposomes that this phospholipid is used made of a double layer form by amphiphilic molecules (liposome ) it is referred to. 리포좀은 안쪽에 친수성 부분의 공간이 존재하고, 그 주변을 소수성의 인지질 이중막이 형성되어 있는 구조이다. Liposome is a structure in which the area of ​​the hydrophilic portion present on the inside, and is formed around the hydrophobic phospholipid double film. 리포좀은 그 내부에 수용성 물질을 탑재시켜, 해당 수용성 물질의 이송을 위한 수단으로 많이 활용되고 있다. Liposomes was equipped with a water-soluble substance therein, has been widely used as a means for the transfer of the water-soluble substance. 특히, 여러가지 유용한 수용성 물질의 인체 내 전달을 위한 수단으로 화장품 또는 의약품 분야에서 많이 활용되고 있다. In particular, there is a lot of leverage in the cosmetics or pharmaceuticals sectors as a means for human intracellular delivery of a variety of useful water-soluble substances.

한편, 본 발명의 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드는 양친매성을 가지는데, 지질에 결합될 경우, 전체 지질에 양친매성을 부여할 수 있는 파트너로써의 역할을 수행하게 된다. On the other hand, peptides having the amino acid sequence shown in SEQ ID NO: 1 of the present invention I have an amphipathic, when coupled to a lipid, and performs a role as a partner to grant amphiphilic lipids in total. 이렇게 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드가 결합되어 양친매성을 나타내게 되는 지질은 수용액에 분산시 자가응집 (또는 자가조립)되어 단일막의 구형 구조체 (소위, '마이셀') 또는 이중막의 구형 구조체 (대표적인 예로써, '인지질')을 형성하게 된다. Thus SEQ ID NO: 1 is a peptide having an amino acid sequence binding according to lipid that exhibit the amphipathic is self-distributing aggregation in aqueous solution (or self-assembled) is a single film spherical structure (so-called "micelles") or double film spherical structure ( as a representative example, to form a 'phospholipid'). 이때, 상기 지질은 일 예로서, 말레이미드, N-하이드록시석시니미드, 아민, 카르복실산, 하이드록실과 같은 관능기가 결합되어 있는 포스파티딜콜린; At this time, the lipids are one example, maleimide, N- hydroxy-seat shinny imide, amine, carboxylic acid, hydroxyl functional groups are combined with fruit, such as phosphatidylcholine; 포스파티딜에탄올아민; Phosphatidylethanolamine; 포스파티딜글리세롤; Phosphatidylglycerol; 포스파티딜세린; Phosphatidylserine; 포스파티딜이노시톨; Phosphatidylinositol; 세라마이드; Ceramides; 스핑가닌; Nin's ping; 파이토스핑고신; Phytosphingosine; 스핑고신; Sphingosine; 디메틸디옥타데실암모늄; Dimethyl dioctadecyl ammonium; 디올레오일트리메틸암모늄프로판; Diol Leo one trimethylammonium propane; 및 디옥타데세닐트리메틸암모늄프로판; And di-octadecenyl trimethylammonium propane; 중 선택되는 어느 하나 또는 이들의 유도체일 수 있다. Any one of which is selected or may be derivatives thereof.

한편, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드는 구형 구조체에 함유되어 본 발명 구형 구조체의 세포 내 또는 피부 내 침투를 도우는 역할을 수행하기도 한다. On the other hand, peptides having the amino acid sequence shown in SEQ ID NO: 1 will also perform the role is to help the penetration within the cell or within the skin of the present invention, the spherical structure is contained in a spherical structure.

한편, 본 발명의 '서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드'는, 바람직하게 구형 구조체의 외부 방향으로 배향될 수 있다. On the other hand, according to the present invention, the peptide having the amino acid sequence shown in SEQ ID NO: 1 ', can preferably be oriented in the outer direction of the rectangular structure. 이와 같은 구조에 의해 구형 구조체의 외부 방향으로 배향된 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드는 PTD(protein transduction domaim)로써 역할을 수행하게 되고, 구형 구조체를 세포 또는 피부 내로 용이하게 이송하게 된다. By such structure of the peptide having the amino acid sequence shown in one of SEQ ID NO oriented in the outer direction of the spherical structure is to serve as a PTD (protein transduction domaim), it is easy to transfer a rectangular structure into cells or skin.

한편, 본 발명의 구형 구조체는, 콜레스테롤이 소수성 부위에 함유되어 있을 수 있는데, 그를 통해 구형 구조체의 구조를 안정화시킬 수 있다. On the other hand, the spherical structure of the present invention, there cholesterol may contain a hydrophobic region, it is possible to stabilize the structure of the spherical structure therethrough.

한편, 본 발명의 구형 구조체에 있어서, 상기 구형 구조체는, 바람직하게 내부에 포집대상물질을 내포하고 있는 것일 수 있다. On the other hand, in the spherical structure of the present invention, the spherical structure may be one that preferably involve collecting the substance therein. 포집대상물질은 다양할 수 있는데, 마이셀 형태의 구형 구조체에서는 소수성 물질을 내부에 탑재할 수 있고, 이중막 형태의 구형 구조체 (일 예로써, 리포좀)에서는 친수성 물질을 내부에 탑재할 수 있다. Collecting the target substance can vary, in the form of a spherical micelle structure it can be equipped with a hydrophobic material therein, a double membrane in the form of spherical structure (as an example, a liposome) can be mounted in the hydrophilic material therein. 포집대상물질은 일 예로, 생리기능성물질, 피부기능성물질, 약학물질 등이 있을 수 있고, 그 형태로는 화합물, 펩타이드, 단백질 등이 있을 수 있다. Collecting the target substance may be an example, physiologically functional material, there can be such as skin functional materials, pharmaceutical materials, as a form of compounds, peptides, proteins and the like.

한편, 본 발명은 상기 본 발명의 구형 구조체를 함유하는 것을 특징으로 하는 화장료 조성물을 제공한다. On the other hand, the present invention provides a cosmetic composition characterized in that it contains the spherical structure of the present invention. 본 발명의 구형 구조체를 함유하기만 하면 특정의 화장품 제형으로 반드시 한정되는 것은 아니고, 모든 제형을 다 포함한다. Simply containing spherical structural body of the present invention is not necessarily limited to the specific cosmetic formulations, it includes all the formulations.

또한, 본 발명의 구형 구조체를 함유하는 것을 특징으로 하는 약학 조성물을 제공한다. It also provides a pharmaceutical composition comprising a spherical structure of the present invention. 약학 조성물의 경우도 본 발명의 구형 구조체를 함유하기만 하면 특정의 약학 제형으로 반드시 한정되는 것은 아니고, 모든 제형을 다 포함한다. For the pharmaceutical composition also contains, just the spherical structure of the present invention not necessarily limited to the particular pharmaceutical formulation, the dosage form includes everything.

한편, 본 발명은 양친매성 분자, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드 및 포집대상물질을 용매에 용해시키는 단계 (a); On the other hand, the present invention comprises the steps of dissolving the polypeptide and collecting the target substance having the amino acid sequence shown in amphiphilic molecules, SEQ ID NO: 1 in a solvent (a); 상기 단계 (a) 후, 용매를 증발시켜 필름을 제조하는 단계 (b); After said step (a), the method comprising evaporating the solvent to prepare a film (b); 상기 단계 (b) 후, 필름에 정제수 또는 완충액을 첨가하여, 수화시킨 후, 에너지를 가해 입자 크기를 감소시키는 단계 (c);를 포함하는 것을 특징으로 하는 구형 구조체의 제조방법을 제공한다. After said step (b), was added to purified water or a buffer solution to the film, after hydration, the step of applying energy to reduce the particle size (c); provides a process for the preparation of a spherical structure comprises a. 이때, 상기 양친매성 분자는, 일 예로, 인지질일 수 있다. At this time, the amphipathic molecules may be, for one embodiment, a phospholipid.

또한, 본 발명은 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 결합시킴으로써 제조한 양친매성 분자 및 포집대상물질을 용매에 용해시키는 단계 (a); In addition, the present invention comprises the steps of dissolving the amphiphilic molecules and collecting the target substance prepared by coupling a peptide having an amino acid sequence shown in SEQ ID NO: 1 in lipid solvents (a); 상기 단계 (a) 후, 용매를 증발시켜 필름을 제조하는 단계 (b); After said step (a), the method comprising evaporating the solvent to prepare a film (b); 상기 단계 (b) 후, 필름에 정제수 또는 완충액을 첨가하여, 수화시킨 후, 에너지를 가해 입자 크기를 감소시키는 단계 (c);를 포함하는 것을 특징으로 하는 구형 구조체의 제조방법을 제공한다. After said step (b), was added to purified water or a buffer solution to the film, after hydration, the step of applying energy to reduce the particle size (c); provides a process for the preparation of a spherical structure comprises a. 이때, 상기 단계 (a)는, 바람직하게 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 결합시킴으로써 제조한 양친매성 분자 외에, 별도의 양친매성 분자를 용매에 더 첨가하여 용해시키는 것이 좋다. In this case, the step (a), preferably in addition to the amphipathic molecules prepared by coupling a peptide having an amino acid sequence shown in SEQ ID NO: 1 in lipid, it is preferable to dissolve and further adding a separate amphipathic molecules in a solvent. 이때, 상기 별도의 양친매성 분자는, 일 예로, 인지질일 수 있다. In this case, the separate amphipathic molecules may be, for one embodiment, a phospholipid. 또한, 상기 에너지를 가해 입자 크기를 감소시키는 단계는 초음파를 가함으로써 수행할 수 있다. Further, the step of applying the energy decrease the particle size may be carried out by the ultrasonic waves.

본 발명은 상기 과정을 통해 포집대상물질이 내포된 구형 구조체를 제조할 수 있는데, 양친매성 분자로 인지질을 사용할 경우, 리포좀으로 제조할 수 있다. The present invention may be prepared a rectangular structure is a nested collection target substance through the process, can be produced by liposomes when using a phospholipid as amphiphilic molecules. 상기 본 발명의 구형 구조체 제조방법은, 원형 구조체의 구조적 안정성을 증대시키기 위하여, 단계 (a)에서 콜레스테롤을 추가로 용매에 용해시킬 수 있다. Spherical structure manufacturing method of the present invention, it is possible to increase the structural stability of the circular structure, dissolved in a solvent to add the cholesterol in step (a). 또한, 본 발명의 구형 구조체 제조방법에서, 상기 용매는, 일 예로 클로로포름과 메탄올의 혼합물을 사용할 수 있다. Further, in the spherical structure manufacturing method of the present invention, the solvent can be an example use a mixture of chloroform and methanol.

본 발명의 구형 구조체 제조방법은, '서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드'를 사용함에 특징이 있는 것으로써, 양친매성 분자를 사용하여 구형 구조체를 제조하는 방법(일 예로써, 인지질을 사용하여 리포좀을 제조하는 것을 포함)은 당업계에 널리 알려져 있기 때문에, 상기 구형 구조체의 제조를 위한 각 단계에 대한 구체적인 설명은 생략하기로 한다. Spherical structure manufacturing method of the present invention, the use of the "peptide having the amino acid sequence shown in SEQ ID NO: 1" written to have a feature, by using the amphiphilic molecules method for producing a spherical structure (as an example, using a phospholipid since, including those for preparing a liposome) are well known in the art, a detailed description of each step in the production of the spherical structure will be omitted.

한편, 본 발명의 구형 구조체의 제조방법에 있어서, 상기 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 결합시킴으로써 제조한 양친매성 분자는, 일 예로, 필름 형태의 지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 함유하는 용액을 첨가하여, 지질과 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드 간의 결합 반응을 유도함으로써 제조할 수 있다. On the other hand, in the production method of the spherical structure of the present invention, an amino acid according to the amphipathic molecules prepared by coupling a peptide having an amino acid sequence shown in SEQ ID NO: 1 in the lipid, in one example, SEQ ID NO: 1 in lipid in a film form to a solution containing a peptide having the sequence is added, it can be prepared by inducing the binding reaction between a peptide having an amino acid sequence shown in SEQ ID NO: 1 and the lipid. 이때, 상기 필름 형태의 지질은, 지질을 소수성 유기용매에 녹인 후, 유기용매를 휘발시켜 필름 형태로 제조한 것이고, 상기 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 함유하는 용액은, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 암모니움 카르보네이트과 함께 증류수에 녹인 후, pH 8~10로 조절하여 제조한 것일 수 있다. In this case, the dissolved lipids Lipids in the film form, the hydrophobic organic solvent, will one to volatilize the organic solvent made of a film form, a solution containing a peptide having the amino acid sequence described in SEQ ID NO: 1, SEQ ID NO: 1 a peptide having an amino acid sequence set forth in was dissolved in distilled water with ammonium carbonate neyiteugwa, may be prepared by adjusted to pH 8 ~ 10. 이때, 상기 지질은, 일 예로, 말레이미드, N-하이드록시석시니미드, 아민, 카르복실산, 하이드록실과 같은 관능기가 결합되어 있는 포스파티딜콜린; At this time, the lipids are, For example, a maleimide, N- hydroxy-seat shinny imide, amine, carboxylic acid, hydroxyl functional groups are combined with fruit, such as phosphatidylcholine; 포스파티딜에탄올아민; Phosphatidylethanolamine; 포스파티딜글리세롤; Phosphatidylglycerol; 포스파티딜세린; Phosphatidylserine; 포스파티딜이노시톨; Phosphatidylinositol; 세라마이드; Ceramides; 스핑가닌; Nin's ping; 파이토스핑고신; Phytosphingosine; 스핑고신; Sphingosine; 디메틸디옥타데실암모늄; Dimethyl dioctadecyl ammonium; 디올레오일트리메틸암모늄프로판; Diol Leo one trimethylammonium propane; 및 디옥타데세닐트리메틸암모늄프로판; And di-octadecenyl trimethylammonium propane; 중 선택되는 어느 하나 또는 이들의 유도체일 수 있다. Any one of which is selected or may be derivatives thereof.

이상에서 살펴본 바와 같이 본 발명은, 서열번호 1에 기재된 27개의 아미노산 서열로 구성된 펩타이드를 통해 한층 증진된 세포투과 또는 피부투과성을 보이며, 구조체 내부에 목적물질을 탑재하여 세포 또는 피부 내로 이송 가능하다. As described above, the present invention, showed a 27 amino acid sequence further enhanced cellular permeation or skin permeability via a peptide consisting of SEQ ID NO: 1, it is embedded with the target substance on the internal structure can be transferred into cells or skin.

이상으로 본 발명의 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 일 구현예일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. According to a person of more than a certain ordinary skill in the art, bar, hayeotneun detail the portion of the context of the present invention, this description is the point rather than being just an example only implement one, and thereby limit the scope of the present invention it will be apparent. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다. Thus, the substantial scope of the present invention will be defined by appended claims and their equivalents.

[ 실시예 1. 세포 및 피부 투과성 GFP 단백질 발현 벡터의 제작] Example 1. Preparation of the cells and skin permeability GFP protein expression vector;

거대 분자 단백질 또는 펩타이드를 세포 및 피부 내로 용이하게 전달할 수 있도록 하기 위하여 세포 및 피부 투과능을 갖는 펩타이드와 전달하고자 하는 단백질(cargo)을 융합하여 재조합 단백질 발현 벡터를 제조하였다. The fusion proteins (cargo) to be delivered and a peptide having cell permeability and skin were prepared recombinant expression vectors in order that the macromolecular protein or peptide can be easily delivered into cells, and skin.

본 실시예에서는 이러한 융합 단백질이 얼마나 세포 및 피부에 전달될 수 있는지의 전달 능력을 용이하게 분석하기 위하여 전달하고자 하는 목적 단백질(cargo)로써, 녹색 형광 단백질(Green Fluorescence Protein: 이하“GFP”라 약칭함)을 선택하였다. In this embodiment, as the target protein (cargo) to be delivered in order to facilitate analysis of the carrying capacity of that such a fusion protein it is much can be delivered to the cells, and skin, green fluorescent protein (Green Fluorescence Protein: less "GFP" La abbreviated was selected that).

기존에 잘 알려진 PTD인 TAT 또는 PEP1을 GFP에 융합하여, 본 발명에서 신규로 개발된 STeP (서열번호 1의 아미노산 서열을 갖는 펩타이드, 서열번호 2의 핵산 서열로 암호화됨)와 세포 및 피부 내 전달 능력을 비교하고자 하였다. To fuse the well-known PTD is TAT ​​or PEP1 existing in GFP, (encrypted with the nucleic acid sequence of the peptide, SEQ ID NO: 2 comprising the amino acid sequence of SEQ ID NO: 1) In the present invention the STeP developed as new and cells and skin passed in the to compare the ability.

(1) pGFP 벡터 제작 (1) pGFP vector production

GFP의 염기서열에 해당하는 DNA 절편을 플라스미드 pET15b의 XhoI, BamHI 자리에 서브클론하여 GFP 단백질을 발현시키는 pGFP를 제조하였다. To subclone the DNA fragment corresponding to the nucleotide sequence of GFP in XhoI, BamHI place of the plasmid pET15b were prepared pGFP expressing the GFP protein. pGFP 발현 벡터에는 세포 및 피부투과능을 갖는 펩타이드가 융합되지 않았고, GFP는 약 29kDa의 친수성 고분자 단백질이기 때문에, 이 벡터에서 발현된 GFP는 세포 및 피부에 전달할 수 있는 능력이 없다고 할 수 있다. pGFP expression vector is a peptide having cell permeability and skin was not fused, GFP may be because hydrophilic polymer protein of about 29kDa, the GFP expression in this vector is that the ability to pass to the cells, and skin. 따라서, 세포 및 피부 투과성 비교를 위한 대조군으로써 제작한 것이다. Thus, it was created by the control for the cell and compare the skin permeability.

GFP의 염기서열에 해당하는 DNA 절편을 플라스미드 pEGFP-C2(클론텍)를 이용하여 Pfu DNA 중합효소로 중합효소 연쇄반응(PCR)시켜 GFP의 완전한 서열을 증폭하였다. A DNA fragment corresponding to the nucleotide sequence of GFP was chain reaction (PCR) with Pfu polymerase DNA polymerase using the plasmid pEGFP-C2 (Clontech) was amplified the complete sequence of the GFP. 정방향 개시체(sense primer)는 5'- CTCGAGGTGAGCAAGGGCGAGGAGCTG-3'이고, 역방향 개시체(antisense primer)의 서열은 5'-GGATCCTTACTTGTACAGCTCGTCC ATGCCGAG-3'이다. Forward one body (sense primer) is 5'- CTCGAGGTGAGCAAGGGCGAGGAGCTG-3 'sequence, and the reverse dog body (antisense primer) is 5'-GGATCCTTACTTGTACAGCTCGTCC ATGCCGAG-3' a. PCR산물은 Xho I- Bam HI으로 잘리며, pET15b(Invitrogen, Carlsbad, CA)의 XhoI - BamHI 자리에 서브클론되어 일반적인 GFP 단백질을 발현시키는 pGFP를 제조하였다. Was prepared pGFP of the BamHI sub-clones expressing the seat typical GFP protein - PCR product was truncated by Xho I- Bam HI, XhoI in pET15b (Invitrogen, Carlsbad, CA). 도 1은 일반적인 GFP 발현 벡터의 맵이다. Figure 1 is a map of a typical GFP expression vector.

(2) pTAT - GFP 벡터 제작 (2) pTAT - GFP vector production

HIV-1 TAT와 융합된 GFP를 발현시키는 pTAT-GFP는 다음의 방법으로 제작하였다. pTAT-GFP expressing GFP fused to the HIV-1 TAT is fabricated in the following manner. 첫째, 두 개의 올리고뉴클레오타이드가 제조되어 HIV-1 TAT의 9개의 아미노산을 코딩하는 이중사슬 올리고뉴클레오타이드로 합성되었다. First, two oligonucleotides are prepared double-stranded oligonucleotide encoding the 9 amino acids of the HIV-1 TAT was synthesized in nucleotides. HIV-1 TAT의 9개 아미노산을 코딩하는 서열은 위쪽 사슬 5'-TAGGAAGAAGCGGAGACAGCGACGAAGAC-3'과 아래쪽 사슬 5'-TCGAGTCTTCGTCGCTGTCTCCGCTTCTTCC-3'이다. Sequence encoding the 9 amino acids of the HIV-1 TAT is a top chain 5'-TAGGAAGAAGCGGAGACAGCGACGAAGAC-3 'and the bottom chain 5'-TCGAGTCTTCGTCGCTGTCTCCGCTTCTTCC-3'. 이중사슬 올리고뉴클레오타이드는 직접 pGFP의 NdeI - XhoI으로 서브클론되어 TAT-GFP 단백질을 발현시키는 pTAT-GFP를 제작하였다. Oligo double-stranded oligonucleotide is directly NdeI the pGFP - XhoI is a sub-clone was produced pTAT-GFP expressing the TAT-GFP protein. 도 2는 TAT-GFP 발현 벡터의 맵이다. Figure 2 is a map of the TAT-GFP expression vectors.

(3) pPEP1 - GFP 벡터 제작 (3) pPEP1 - GFP vector production

PEP1이 융합된 GFP를 발현시키는 pPEP1-GFP는 다음의 방법으로 제작하였다. pPEP1-GFP to the PEP1 expressing the GFP fusion was constructed in the following manner. 첫째, 두 개의 올리고뉴클레오타이드 위쪽사슬 5'-TATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGAGCCAGCCGAAAAAAAAACGTAAAGTGC-3'과 아래쪽 사슬 5'-TCGAGCACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3'이 합성되어 PEP1 펩타이드를 코딩하는 이중사슬 올리고뉴클레오타이드를 만들었다. First, two oligonucleotides top chain 5'-TATGAAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGAGCCAGCCGAAAAAAAAACGTAAAGTGC-3 'and the bottom chain 5'-TCGAGCACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3' is synthesized oligonucleotides made double-stranded coding for peptide PEP1.

이중사슬 올리고뉴클레오타이드는 직접 pGFP의 NdeI - XhoI으로 서브클론되어 PEP1-GFP 단백질을 발현시키는 pPEP1-GFP를 제작하였다. Double-stranded oligonucleotide is directly NdeI the pGFP - was produced pPEP1-GFP which is a sub-clone expressing the XhoI PEP1-GFP protein. 도 3은 PEP1-GFP 발현 벡터의 맵이다. Figure 3 is a map of the vector PEP1-GFP expression.

(4) pSTeP - GFP 벡터 제작 (4) pSTeP - GFP vector production

본 발명의 STeP이 융합된 GFP를 발현시키는 pSTeP-GFP는 다음의 방법으로 제작하였다. pSTeP-GFP to the STeP expressing the GFP fusion of the present invention was prepared in the following manner. 첫째, 두 개의 올리고뉴클레오타이드 위쪽사슬 5'-TATG AAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCCCAGCCGTATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTC-3'과 아래쪽 사슬 5'- TCGAGACGACGACGCTGACGACGTTTTTTACGGCCATACGGCTGGGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3'이 합성되어 STeP 펩타이드를 코딩하는 이중사슬 올리고뉴클레오타이드를 만들었다. First, two oligonucleotides top chain 5'-TATG AAAGAAACCTGGTGGGAAACCTGGTGGACCGAATGGTCCCAGCCGTATGGCCGTAAAAAACGTCGTCAGCGTCGTCGTC-3 'and the bottom chain 5'- TCGAGACGACGACGCTGACGACGTTTTTTACGGCCATACGGCTGGGACCATTCGGTCCACCAGGTTTCCCACCAGGTTTCTTTCC-3' is synthesized oligonucleotides made double-stranded STeP encoding the peptide. 이중사슬 올리고뉴클레오타이드는 직접 pGFP의 NdeI - XhoI으로 서브클론되어 STeP-GFP 단백질을 발현시키는 pSTeP-GFP를 제작하였다. Oligo double-stranded oligonucleotide is directly NdeI the pGFP - XhoI is a sub-clone was produced pSTeP-GFP expressing STeP-GFP protein. 도 4는 STeP-GFP 발현 벡터의 맵이다. Figure 4 is a map of the STeP-GFP expression vectors.

[ 실시예 2. GFP 재조합 단백질의 발현] Example 2. Expression of GFP recombinant protein;

본 실시예에서는 상기 실시예에서 제작된 재조합 벡터들로부터 해당 단백질을 발현하고자 하였다. In the present embodiment it was to express the protein from the recombinant vector prepared in the above Examples. 네 종류의 발현 벡터들을 각각 E. coli Each of the four types of E. coli expression vector Rosetta-gami 2(DE3) 세포 내로 형질 전환시켰다. It was transformed into the Rosetta-gami 2 (DE3) cells. 형질 전환된 박테리아 세포는 엠피실린이 포함된 1,000ml의 LB배지를 이용하여 OD 600 값이 0.6이 될 때까지 37℃에서 배양하였고, 22℃에서 0.5mM IPTG를 도입하여 24시간 동안 추가 배양하여 GFP 단백질의 발현을 유도하였다. The transformed bacteria cells were incubated at 37 ℃ until the OD 600 value of 0.6 using a 1,000ml of LB medium containing the ampicillin, by introducing 0.5mM IPTG at 22 ℃ in addition for 24 hours GFP to induce expression of the protein.

각각의 GFP 단백질 발현 유무 확인은 IPTG의 첨가에 의한 목적 단백질의 유도 발현 전과 후의 배양 세포들을 수확하여 SDS-PAGE 전기영동을 한 뒤, 쿠마시 브릴리언트블루 (Coomassie brilliant blue)로 단백질을 염색하여 관찰하였다. Check each of the GFP protein expressed presence was examined by staining the protein to the harvested induce expression before and after the culture cells of the target protein by the addition of IPTG after the SDS-PAGE electrophoresis, and Brilliant Blue (Coomassie brilliant blue) when Kumar .

그 결과, 도 5에서 확인되는 바와 같이, GFP는 29.35kDa, TAT-GFP는 30.54kDa, PEP1-GFP는 32.18kDa, STeP-GFP는 32.95kDa의 크기를 가지는 단백질이 발현됨을 확인할 수 있었다. As a result, as seen on Figure 5, it was confirmed that the GFP is 29.35kDa, TAT-GFP is 30.54kDa, PEP1-GFP is 32.18kDa, STeP-GFP is a protein is expressed with a size of 32.95kDa. 도 5는 GFP 재조합 단백질의 발현 결과이다. Figure 5 is a result of expression of recombinant protein GFP.

[ 실시예 3. GFP 재조합 단백질의 정제] Example 3. Purification of Recombinant GFP protein;

본 실시예에서는 상기 실시예에서 각각 발현된 단백질에 대하여 세포 파쇄 공정 실시 후, His tag 친화 컬럼을 이용하여 GFP 단백질만을 순수 분리 정제하고자 하였다. In this embodiment, it was to conduct after cell disruption process with respect to the expressed protein, respectively, and separate pure water only GFP protein using the His tag affinity purification column in the above embodiment. 4가지 GFP 단백질의 정제 방법은 아래와 같이 동일한 방법을 이용하여 정제하였다. 4 kinds of purification of the GFP protein was purified using the same method as shown below.

pET15-GFP, pTAT-GFP, pPEP1-GFP, pSTeP-GFP 형질 전환 세포를 1X Native 완충액(50mM NaPO5, 0.5M NaCl)에서 초음파기를 이용하여 파괴한 후, 이것을 원심분리하여 응집체(inclusion body)와 세포질(상청액)로 분리하였다. pET15-GFP, pTAT-GFP, pPEP1-GFP, pSTeP-GFP transformants after the switch cell disruption using a choeumpagi in 1X Native buffer (50mM NaPO5, 0.5M NaCl), and this centrifugal aggregates (inclusion body) and cytoplasmic It was separated into (supernatant).

4가지 GFP 단백질에는 모두 His 6 태깅되어(tagging) 있으므로 이러한 특성을 이용하여 세포 파쇄 후 원심분리에 의해 분리된 각각의 상청액을 Ni 2 + -NTA 친화 컬럼(Nitrilotriacetic acid Sepharose affinity column, GE Healthcare, USA)으로 정제하였다. 4 kinds of GFP protein has both the His 6 tagged (tagging), because using such a characteristic cell destruction after each supernatant was separated by centrifugation and Ni 2 + -NTA affinity column (Nitrilotriacetic acid Sepharose affinity column, GE Healthcare, USA ) it was purified.

컬럼의 평형 및 GFP 단백질의 결합은 1X Native 완충액을 사용하였으며, 세척(Washing)과 용출(Elution)은 1X Native 완충액에 농도별 이미다졸(Imidazole)을 제조하여 사용하였다. And equilibrium binding of GFP protein in the column was used for 1X Native buffer and washing (Washing) and eluted (Elution) was used to prepare an already imidazole (Imidazole) by concentration to 1X Native buffer. 순수 분리 정제된 GFP 단백질은 안정화 버퍼 (50mm NaPO4, 0.1M NaCl, 10% Glycerol, pH 7.5)를 이용하여 투석을 실시하였다. Purified of purified GFP protein was subjected to dialysis using a stabilizing buffer (50mm NaPO4, 0.1M NaCl, 10% Glycerol, pH 7.5). 여기서 얻어진 최종 산물을 각각 GFP, Tat-GFP, PEP1-GFP, STeP-GFP라 명명하였다. The final product was respectively named as GFP, Tat-GFP, PEP1-GFP, GFP-STeP obtained here. 도 6은 GFP 재조합 단백질의 정제 결과이다. 6 is a result of the GFP purified recombinant protein.

[ 실시예 4. 세포 및 피부 투과성 GFP 단백질의 세포 투과 분석] Example 4. Analysis of the cell and the cell transmitting the skin permeability GFP protein;

본 실시예에서는 상기 실시예에서 정제된 4가지의 GFP 단백질의 세포 투과 능력을 비교하고자 HaCaT(human keratinocyte) 세포에서 GFP 녹색 형광을 이용한 세포 내 투과를 관찰하였다. In the present embodiment, to compare the transmission power of the cells of the four GFP protein purified in the above Example was observed using a transmission intracellular GFP green fluorescence in HaCaT (human keratinocyte) cells.

HaCaT(human keratinocyte) 세포는 배양용 슬라이드에서 24시간 동안 배양하였다. HaCaT (human keratinocyte) cells were cultured for 24 hours on a slide for culture. 그 후 배양 배지를 제거한 후, HBSS로 3회 세척 후 GFP 및 세포투과성 GFP 단백질(PEP1-GFP, TAT-GFP, STeP-GFP)을 세포에 처리하였다. Then after removing the culture medium, then washed three times with HBSS and treated with GFP and GFP protein, cell permeability (PEP1-GFP, GFP-TAT, STeP-GFP) to the cell. 세포에 처리 시 각각의 단백질의 농도가 10mM이 되도록 스탁(stock)을 만들어 배지에 1/10로 희석하여 최종 10μM이 되도록 처리한 후 2시간 동안 배양하였다. After the treatment the concentration of each protein in the cells during the process to a final 10μM to make the stock (stock) diluted to 1/10 in a medium such that 10mM and incubated for 2 hours. 2시간 뒤 배지를 제거하고 PBS를 이용하여 세포를 세척한 후, 냉각 메탄올을 이용하여 10분간 -20℃에서 세포를 고정하였다. After 2 hours after removal of the medium and the cells were washed using PBS, using a cooled methanol, followed by fixing the cells at -20 ℃ 10 minutes. 세포는 PBS로 충분히 세척한 뒤 PBS에 1/5000으로 희석된 핵 염색 시약 (DAPI)를 넣고 빛이 차단된 상태에서 10분간 염색시켰다. Cells into a sufficiently cleaned one after diluted 1/5000 in PBS nuclear staining reagent (DAPI) in PBS was dyed for 10 minutes at the light blocking state. PBS로 충분히 세척하고, 마운팅(mounting) 한 뒤 컨포칼 스캐닝 레이저 현미경을 이용하여 분석하였다. Sufficiently washed with PBS and then mounted (mounting) Confocal were analyzed using the scanning laser microscope.

그 결과, STeP-GFP 단백질 처리 그룹의 세포 내 녹색 형광이 가장 밝게 보이는 것으로 보아, STeP가 세포 내 투과 효과를 크게 향상시켜줌을 알 수 있었다. As a result, as in the green fluorescence of the GFP protein STeP-treated cell group showing the brightest when viewed, it can be seen that the STeP cells significantly improves the effectiveness in the transmission sikyeojum. 도 7은 GFP 단백질의 세포 투과력 비교 결과이다. Figure 7 shows the results compared to the cell permeability of the GFP protein.

[ 실시예 5. 세포 및 피부 투과성 GFP 단백질의 피부 투과 분석] Example 5. Analysis of the skin permeability cells and skin permeation GFP protein;

세포뿐만 아니라 피부에서도 STeP에 의해 GFP 단백질의 투과가 향상되는지 알아보기 위해, 프란츠 셀(Franz cell, 직경 9mm)을 이용하였다. Cells, as well as to see if the transmission of the enhanced GFP protein by STeP skin in Franz cells were used (Franz cell, diameter of 9mm).

셀의 상단과 하단 사이에 돼지 피부(0.7mm 두께, Medikinetics)를 장착하고, 그 상단에 50μM GFP 단백질을 300μl 처리하였다. Mounting the pig skin (0.7mm thick, Medikinetics) between the top and bottom of the cell and treated with 300μl 50μM GFP protein in its upper end. 24시간 후, 돼지 피부를 빼낸 뒤 PBS로 3회 세척하였다. After 24 hours, remove the rear pig skin was washed three times with PBS. 세척 후, 크라이요 몰드 (cryo mold)에 OCT 임베딩 매트릭스 (OCT embedding matrix, Cell Path Ltd., UK)를 처리하여 조직을 -70℃에서 동결하였다. After washing, the tissue was treated for OCT embedding matrix (OCT embedding matrix, Cell Path Ltd., UK) in Klein am mold (mold cryo) was frozen at -70 ℃. 동결 조직은 크라이요톰(cryotome, HM520, Germany)을 이용하여 -20℃에서 7 μm의 두께로 크로스 섹션 (cross-section)하여 절편 슬라이드를 제작하였다. Frozen tissue was produced Klein am fragments slide to Tom (cryotome, HM520, Germany) cross-section (cross-section) at -20 ℃ to a thickness of 7 μm by using a. 피부 세포의 핵을 염색하기 위하여 슬라이드 글라스 (slide glass)에 고정시킨 조직 절편은 PBS에 1/5000으로 희석된 핵 염색 시약 (DAPI)을 넣고 빛이 차단된 상태에서 10분간 염색한 후 PBS로 3회 세척하였다. Tissue sections were fixed to a slide glass (slide glass) to stain the nucleus of the skin cells into the nuclear staining reagent (DAPI) diluted 1/5000 in a PBS were stained in the state that light is blocked 10 minutes with PBS 3 times and washed. 마운팅(mounting) 한 뒤 콘포칼 스캐닝 레이저 현미경을 이용하여 분석하였다. After mounting (mounting) the focal cones were analyzed using the scanning laser microscope.

실험결과, GFP는 돼지 피부 조직 내로 전혀 전달되지 않음에 반해, 본 발명의 STeP-GFP는 피부 내로 효율적으로 전달이 가능함을 확인할 수 있었다. Experiments, GFP was not delivered at all, while the pig into the skin tissue, STeP-GFP of the present invention was confirmed to have available efficient delivery into the skin. 도 8은 GFP 단백질의 피부 투과력 비교 결과이다. 8 is a skin permeability compared to the results of the GFP protein. 도 8에서 'LUT Image'는 LUT(Look Up Table)을 이용하여 명암 대비를 향상시킨 이미지이다. 'Image LUT' in Figure 8 is an image with improved contrast by using a LUT (Look Up Table).

[ 실시예 6. 지질- PTD(DSPE-PEG-PTD)의 제조] Example 6. Lipid - Preparation of PTD (DSPE-PEG-PTD) ]

본 실시예에서는 자가조립 PTD-리포좀 제조 기술을 개발하였다. In this embodiment, self-assembly was developed PTD- liposome manufacturing technique.

본 발명의 자가조립 PTD-리포좀에서, '자가조립'은, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드가 인지질에 결합된 상태로 리포좀의 막을 형성하게 됨으로써, 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드가 막 성분의 일원으로 리포좀의 제조에 참여된 것을 의미한다. In the self-assembly PTD- liposomes of the present invention, the "self-assembly", the peptides are peptides having an amino acid sequence shown in SEQ ID NO: 1 having the amino acid sequence set forth in being to form a film of the liposome in a state of being coupled to a phospholipid, SEQ ID NO: 1 means that the membrane as part of a component involved in the preparation of liposomes.

본 실시예의 자가조립 PTD-리포좀은 지질에 PTD가 결합되어 있어 따로 생리활성물질에 PTD를 연결하는 합성 과정의 번거로움 없이, 다양한 생리활성물질을 바로 자가조립 PTD-리포좀에 봉입하여, 효율적으로 피부 내로 전달시킬 수 있게 해준다. Of this embodiment self-assembly PTD- liposomes encapsulated without the hassle of PTD's are combined in the lipid synthesis to separately connect the PTD the physiologically active substance, a wide range of physiologically active substance directly self assembled PTD- liposome, effective skin It allows to pass into.

자가조립 PTD-리포좀의 제조를 위해, 지질-PTD는 다음 방법을 통해 제조하였다. For the preparation of self-assembled PTD- liposomes, lipid -PTD was prepared by the following methods. 우선, DSPE-PEG3.4K-maleimide (지질, 1 equiv,)을 디클로로메탄(dichloromethane)에 녹인 후, 50℃에서 증발시켜 유기용매를 제거함으로써, 필름 형태의 DSPE-PEG3.4K-maleimide를 제조하여 준비하였다. First, after the DSPE-PEG3.4K-maleimide (lipid, 1 equiv,) was dissolved in dichloromethane (dichloromethane), and evaporated at 50 ℃ was prepared by removing the organic solvent, a film form of DSPE-PEG3.4K-maleimide It was prepared. 또한, PTD (STeP 펩타이드: KETWWETWWTEWSQPYGRKKRRQRRRC, 서열번호 1) (3 equiv.) 및 암모니움 카르보네이트 (3 equiv.)을 증류수에 녹인 후 완충액 (pH 9.6)으로 pH 9 정도가 되도록 조절하여 PTD 용액을 별도로 제조하여 준비하였다. In addition, PTD: (. 3 equiv) (STeP peptide KETWWETWWTEWSQPYGRKKRRQRRRC, SEQ ID NO: 1) and ammonium carbonate (. 3 equiv), the adjusted so that pH 9 degree with a buffer solution (pH 9.6) was dissolved in distilled water to a PTD solution It was prepared by separately prepared.

상기에서 제조한 PTD 용액을, 상기에서 필름 형태로 제조한 DSPE-PEG3.4K-maleimide에 넣고, 37℃에서 수화 및 교반 과정 (4 시간)을 수행함으로써, DSPE-PEG3.4K-maleimide의 maleimide와 STeP 펩타이드의 'C' 아미노산 사이에 maleimide-thiol 반응을 유도시켰다. A PTD solution prepared in the above, by putting a DSPE-PEG3.4K-maleimide prepared in the form of a film, performing a process of hydration and stirred (4 hours) at 37 ℃, DSPE-PEG3.4K-maleimide and maleimide of between 'C' amino acids of the peptide was derived STeP a maleimide-thiol reaction. 반응 완료 후, 동결건조 및 분리·정제 과정을 진행하였다. After completion of the reaction, it was carried out the freeze-drying and separation and purification process. 도 9는 본 실시예에서 제조한 지질(DSPE-PEG3.4K-maleimide)-PTD(STeP 펩타이드)의 화학적 구조를 보여준다. Figure 9 shows the chemical structure of the lipid (DSPE-PEG3.4K-maleimide) -PTD (STeP peptide) prepared in this embodiment.

[ 실시예 7. 카페익산이 Example 7. The acid cafe 봉입된 자가조립 PTD - 리포좀의 제조] The enclosed self-assembly PTD - Preparation of liposomes;

리포좀은 인지질로 구성된 인위적인 막으로써, 액상 상태의 내부 물질을 감싸는 캡슐화된 구조체로 이용될 수 있다. Liposomes may be used as artificial membrane consisting of a phospholipid, wrapping the inner material of the liquid state to the encapsulated structure. 리포좀 안에 가둬진 물질의 보유는 지질의 조성에 의해 영향을 받을 수 있다. Retention of material Jean trapped inside the liposomes may be influenced by the composition of the lipid. 그 중 두 가지 중요한 지질 종류는 인지질과 콜레스테롤이다. Two important types of lipids that is the phospholipid and cholesterol. 인지질은 리포좀의 막을 구성하는 역할을 수행하고, 콜레스테롤은 친수성 수산기와 소수성 고리를 가지고 있어, 반데르발스 결합으로 세포막 내의 포화 지방산의 사슬을 안정화시키는 작용을 하여 세포막의 유동성을 감소시키며 견고성을 부여하는 기능을 담당한다. Phospholipid serves to structure of the liposome membrane, and cholesterol and act to stabilize the chain of a saturated fatty acid in the hydrophilic got a hydroxyl group and a hydrophobic chain, cell membrane by van der Waals binding decreases the fluidity of the plasma membrane to give firmness responsible for the function.

한편, 상기 제조 방법으로 만들어진 지질-PTD와 인지질, 콜레스테롤, 카페익산을 혼합하여 카페익산(caffeic acid)이 봉입된 자가조립 PTD-리포좀(자가조립 PTD-리포좀-(카페익산))을 제조하였다. On the other hand, the method for producing mixed lipid -PTD with phospholipids, cholesterol, cafe acid made by cafe acid (caffeic acid), the self-sealing assembly PTD- liposomes (liposomes self-assembly PTD- (cafe acid)) was prepared. 구체적인 방법은 다음과 같다. Specific methods are as follows. 인지질 : 콜레스테롤 : 지질-PTD : 카페익산을 8:2:1:1 (중량비)로 클로로포름:메탄올 혼합물 (1:1, 용적비)에 용해시킨 후, 용매를 증발시켜 지질/약물 필름을 제조하였다. Phospholipid: cholesterol: a cafe acid 8: Lipid -PTD 2: 1: 1 chloroform (by weight): methanol mixture was dissolved in (1: 1, by volume), the solvent was evaporated to prepare a lipid / drug film. 정제수로 수화시킨 후 초음파 처리(sonication)를 통해 리포좀을 제조하였고, 동결건조 후 보관하였다. Then hydrated with purified water was prepared liposomes by ultrasonic treatment (sonication), and stored after lyophilization.

한편, 제조한 리포좀의 입자 크기, 입도 분포, 봉입률을 확인하여 자가조립 PTD-리포좀-카페익산의 물리화학적 특성을 분석하고자 하였다. On the other hand, to determine the particle size, particle size distribution, percentage of encapsulated liposome prepared self-assembly PTD- liposomes - To evaluate the physical and chemical properties of the cafe acid. 이때, 자가조립 PTD-리포좀에 의한 카페익산의 피부 투과력 우월성을 입증하기 위한 대조군으로, 일반 리포좀에 봉입된 카페익산(리포좀-카페익산)을 함께 분석하였다. At this time, the self-assembly as a control to demonstrate the superiority of the skin permeability cafe acid by PTD- liposome, a cafe acid encapsulated in general liposome-a (liposomes cafe acid) were analyzed together.

입자 크기, 입도 분포, 표면 전하는 전기영동광산란법 (electrophoretic light scattering; ELS)을 이용하여 확인하였으며, 그 결과는 도 10과 같았다. The particle size, particle size distribution, surface charge electrophoresis light-scattering method; was confirmed using an (electrophoretic light scattering ELS), the results were as Fig. 도 10의 결과에 따르면, 자가조립 PTD-리포좀-(카페익산)은 평균 직경이 250nm 정도로 비교적 균일한 입도분포를 갖는 리포좀이 제조된 것을 확인할 수 있었다. According to the results of Figure 10, the self-assembly PTD- liposomes (cafe acid) has been confirmed that the average diameter of the manufacturing liposomes having a relatively uniform particle size distribution around 250nm. 도 10은 자가조립 PTD-리포좀-(카페익산)의 입자 특성 평가 결과이다. 10 is a self-assembly PTD- liposome - the evaluation of the particle properties (cafe acid).

또한, 일반 리포좀-카페익산에 비해 자가조립 PTD-리포좀의 표면 전하가 음의 값에서 양의 값으로 변하는 것을 확인할 수 있었다. In addition, general liposome-acid than the cafe it was confirmed that the surface charge of the liposomes self-assemble PTD- changes from negative to positive values. 이러한 결과는 본 발명의 자가조립 PTD-리포좀에서 PTD가 외부 표면에 배향하고 있다는 것을 암시해 준다. These results suggest that by the PTD is oriented to the outer surface in PTD- liposomes self assembly of the present invention. 본 발명의 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드(STeP)는 양친매성 펩타이드이지만, 소수성보다는 친수성의 성향이 강하다. Peptide having an amino acid sequence shown in SEQ ID NO: 1 of the present invention (STeP) is but an amphiphilic peptide, a strong tendency of the hydrophilic rather than hydrophobic. 이러한 친수성 펩타이드의 경우, 리포좀 제조시 외부 또는 내부의 친수성 환경에 위치할 것이라 예상되는데, 도 10의 제타 전위 분석 결과 (-에서 +로 변화)를 통해, STeP가 리포좀의 외부 표면 환경에 노출되어 있음을 알 수 있었다. For such a hydrophilic peptide, a liposome in the manufacture there is expected to be located outside or inside the hydrophilic environment, resulting zeta potential analysis of the 10 (- changed to + In) that through, STeP is exposed to the outer surface environment of the liposomes And it was found.

한편, 투과전자현미경(TEM)을 이용하여 자가조립 PTD-리포좀의 입자 모양을 관찰하였다. On the other hand, self using a transmission electron microscope (TEM) observation was the particle-shaped assembly PTD- liposomes. 그 결과, 리포좀-카페익산에 비해 자가조립 PTD-리포좀-(카페익산)의 입자 크기가 다소 커진 것을 확인할 수 있었으며, 또한, PTD-지질이 포함된 리포좀을 제조하였음에도 불구하고, 이의 입자 모양이 일반적인 리포좀과 구조적으로 유사하다는 것을 확인할 수 있었다. As a result, the liposome-liposome as compared to self-assembled PTD- cafe acid - was confirmed that the particle size is somewhat larger for (cafe acid), and, in spite of producing a liposome containing a lipid PTD-, and its particle shape is typical it was confirmed that it is structurally similar to liposomes. 도 11은 자가조립 PTD-리포좀-(카페익산)의 입자 모양 (TEM image) 관찰 결과이다 (좌: 리포좀-(카페익산), 우: 자가조립 PTD-리포좀-(카페익산)). Particle shape (TEM image) of the observation (cafe acid) 11 is self-assembled PTD- liposomes (L: liposome (cafe acid), and the right: self-assembly PTD- liposomes (cafe acid)).

한편, 수용액 상에서 입자 안정성을 확인하기 위해, 전기영동광산란법을 이용하여 입자 크기 변화를 관찰하였다. On the other hand, to make the particle stable in aqueous solution, using an electrophoretic light scattering method was observed in particle size variation. 그 결과, 도 12와 같이, 리포좀-(카페익산), 자가조립 PTD-리포좀-(카페익산) 모두 24시간까지 입자 크기와 입도 분포 양상에 큰 변화가 없어 안정함을 확인하였다. As a result, as shown in Figure 12, the liposomes was confirmed that the (cafe acid) do not have a large change in stability of the particle size and particle size distribution all aspects up to 24 hours (cafe acid), self-assembly PTD- liposomes. 도 12는 자가조립 PTD-리포좀-(카페익산)의 입자 안정성 평가 결과이다. 12 is a self-assembly PTD- liposome-particle stability is the result of (cafe acid).

[ 실시예 8. 자가조립 PTD - 리포좀 -( 카페익산 )의 세포 내 항산화 효능 평가] Example 8. Self-assembled PTD-liposome-antioxidant efficacy of the cell (cafe acid);

자가조립 PTD-리포좀-카페익산이, 카페익산과 리포좀-카페익산보다 세포 내 투과가 증가하여 항산화 효능이 증진됨을 확인하고자 산화스트레스(과산화수소, H 2 O 2 )에 의한 세포 손상에서 카페익산의 세포 보호 효과를 비교 관찰하였다. Self-assembly PTD- liposome-cafe acid is, cafes acid and liposome-increasing cafe intracellular transmission than acid to oxidative stress to confirm that the enhancement of antioxidant effectiveness (hydrogen peroxide, H 2 O 2) cells of a cafe acid from cell damage caused by the protective effects were compared.

10% FBS가 포함된 DMEM 배지에서 배양된 HaCaT 세포를 2×10 4 씩 96웰 플레이트에 분주하여 16시간 배양한 후 HBSS로 2회 세척하여 주었다. The HaCaT cells grown in DMEM medium containing 10% FBS and 2 × 10 4 in the frequency divider by 96-well plate was washed twice with HBSS and then incubated for 16 hours. 카페익산과 리포좀에 봉입된 카페익산, 자가조립 PTD 리포좀 카페익산을 최종농도가 12.5μM이 되도록 세포에 처리해 주고 24시간 동안 배양하였다. Cafe acid and the cafe acid, self-assembly to a final concentration of liposomes PTD cafe acid encapsulated in the liposome to the cell such that the process is giving 12.5μM were incubated for 24 hours. 상층액을 제거한 후, HBSS로 2회 세척한 뒤 H 2 O 2 를 0.75mM 농도로 2시간 30분 동안 처리하여 배양하였다. After removing the supernatant, twice washed with HBSS after H 2 O 2 and incubated for 2 hours with 30-minute concentration 0.75mM. 배양 후, 상층액을 제거하고 WST 용액을 배지에 1:9 비율로 희석하여 세포에 처리해 주었다. After incubation, the supernatant was removed and 1 of WST solution to the medium: 9 aspect ratio and diluted to a given process on the cell. 3시간 동안 배양 후, 450nm에서 흡광값을 측정하여 세포생존율을 계산해 카페익산, 리포좀에 봉입한 카페익산 및 자가조립 PTD 리포좀 카페익산의 처리에 따른 항산화 효능을 비교하였다. After incubation for 3 hours, and compared the antioxidant effects of the process of the cafes on the cafe sealed by measuring the absorbance value at 450nm to calculate the cell viability acid, liposomes acid and self-assembled PTD liposome cafe acid.

그 결과, 도 13에 나타나는 바와 같이 카페익산에 비해 자가조립 PTD 리포좀 카페익산의 항산화효능이 동일 농도에서 대략 3배 정도 높은 것을 확인할 수 있었다. As a result, it was confirmed that compared to the cafe acid antioxidant efficacy of a self-assembled PTD liposome cafe acid approximately three times higher at the same concentration as shown in Fig. 도 13은 산화스트레스에 의한 세포 손상에서 카페익산의 세포 보호 효과를 비교한 결과이다. 13 is a result of comparing the cell protection effect of the cafe acid in the cell damage caused by oxidative stress. 이와 같은 결과로부터 카페익산과 일반 리포좀에 비해 자가조립 PTD 리포좀 카페익산이 PTD에 의해 세포투과가 용이해져서 항산화 효능이 높아진 것으로 해석할 수 있었다. The resulting self-haejyeoseo cafe than regular liposomes from the same acid and the assembly is PTD liposome cafe acid by the PTD cell transmission is easily could be interpreted as a higher antioxidant effect.

[ 실시예 9. 자가조립 PTD - 리포좀 -( 카페익산 )의 피부 투과 분석] Example 9 self-assembled PTD-liposome-skin permeation analysis (cafe acid);

자가조립 PTD-리포좀에 의해 카페익산의 피부 투과가 향상되는지 알아보기 위해, 프란츠 셀(Franz cell, 직경 9mm)을 이용하였다. To see if the liposomes self-assemble PTD- acid skin permeation enhancement Café by Franz cells were used (Franz cell, diameter 9mm).

셀의 상단과 하단 사이에 돼지 피부(0.7mm 두께, Medikinetics)를 장착하고, 그 상단에 4mM 카페익산, 리포좀-(카페익산), 자가조립 PTD-리포좀-(카페익산)을 300μl 처리하였다. Mounting the pig skin (0.7mm thick, Medikinetics) between the top and bottom of the cell and, 4mM cafe acid, liposomes in that the top (cafe acid), self-assembly PTD- liposome-a (cafe acid) was treated with 300μl. 하단에는 버퍼를 채워 주었다. At the bottom it was filled with a buffer. 24시간 뒤, 하단에 있는 샘플을 채취하였다. 24 hours later, a sample was collected at the bottom. 채취한 샘플은 HPLC를 이용하여 정량하였다. The collected samples was quantified using HPLC. HPLC Column으로는 C18 (4.6 × 250 ㎜ reversed phase)을 사용하였고, 0.7 ㎖/min의 유속으로 흘려주었으며, UV absorbance detector를 사용하여 330㎚의 파장에서 검출하였다. By HPLC Column was used as the C18 (4.6 × 250 ㎜ reversed phase), it gave flowing at a flow rate of 0.7 ㎖ / min, using a UV absorbance detector was detected at a wavelength 330㎚.

그 결과, 도 14에서 보듯이, 카페익산은 전혀 투과가 되지 않은 반면, 일반 리포좀은 로딩한 펩타이드 양 대비 3.9%, 자가조립 PTD-리포좀-(카페익산)은 5.84%로 나타나, 자가조립 PTD-리포좀-(카페익산)이 약 1.5배 높은 투과 효과를 나타내는 것을 확인할 수 있었다. As a result, as shown in Figure 14, Cafe acid, while not transmitting at all, general liposome was 3.9% from the amount of peptide loaded, self-assembly PTD- liposomes (cafe acid) is indicated by 5.84%, self-assembly PTD- liposomes - it was confirmed that (cafe acid) represents approximately 1.5 times the permeation effect. 도 14는 자가조립 PTD-리포좀-(카페익산)의 피부 투과력 비교 결과이다. 14 is a self-assembled PTD- liposome - a comparison of skin penetration (cafe acid).

<110> Bioceltran <120> Vesicle with novel protein transduction domain <130> YP-16-230 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> Protein transduction domain, STeP <400> 1 Lys Glu Thr Trp Trp Glu Thr Trp Trp Thr Glu Trp Ser Gln Pro Tyr 1 5 10 15 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Cys 20 25 <210> 2 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide coding protein transduction domain, STeP <400> 2 aaagaaacct ggtgggaaac ctggtggacc gaatggtccc agccgtatgg ccgtaaaaaa 60 cgtcgtcagc gtcgtcgttg t 81 <110> Bioceltran <120> Vesicle with novel protein transduction domain <130> YP-16-230 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> Protein transduction domain, STeP <400> 1 Lys Glu Thr Trp Trp Glu Thr Trp Trp Thr Glu Trp Ser Gln Pro Tyr 1 5 10 15 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Cys 20 25 <210> 2 < 211> 81 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide coding protein transduction domain, STeP <400> 2 aaagaaacct ggtgggaaac ctggtggacc gaatggtccc agccgtatgg ccgtaaaaaa 60 cgtcgtcagc gtcgtcgttg t 81

Claims (19)

  1. 인지질이 자가응집하여 형성되는 리포좀에 있어서, In the liposome is a phospholipid self-aggregation to form,
    상기 인지질은, The phospholipid,
    서열번호 1에 기재된 아미노산 서열로 구성된 펩타이드가 씨오에테르(thioether) 결합되어 있는 것을 특징으로 하는 리포좀. A peptide consisting of the amino acid sequence set forth in SEQ ID NO: 1, characterized in that the liposomes are bonded ssioh ether (thioether).
  2. 삭제 delete
  3. 제1항에 있어서, According to claim 1,
    상기 인지질은, The phospholipid,
    DSPE-PEG-말레이미드인 것을 특징으로 하는 리포좀. Liposomes, characterized in that DSPE-PEG- maleimide.
  4. 삭제 delete
  5. 삭제 delete
  6. 제1항에 있어서, According to claim 1,
    상기 서열번호 1에 기재된 아미노산 서열로 구성된 펩타이드는, Peptide consisting of the amino acid sequence shown in SEQ ID NO: 1,
    리포좀의 외부 방향으로 배향되는 것을 특징으로 하는 리포좀. Liposomes characterized in that the oriented direction outside of the liposome.
  7. 제1항에 있어서, According to claim 1,
    상기 리포좀은, The liposomes,
    콜레스테롤이 소수성 부위에 결합되어 있는 것을 특징으로 하는 리포좀. Liposomes characterized in that cholesterol is bound to hydrophobic regions.
  8. 제1항에 있어서, According to claim 1,
    상기 리포좀은, The liposomes,
    내부에 포집대상물질을 내포하고 있는 것을 특징으로 하는 리포좀. Liposomes characterized in that pose a trapping substance inside.
  9. 제1항의 리포좀을 함유하는 것을 특징으로 하는 경피 투여용 화장료 조성물. The cosmetic composition for transdermal administration comprising the liposome of claim 1.
  10. 제1항의 리포좀을 함유하는 것을 특징으로 하는 경피 투여용 약학 조성물. The pharmaceutical composition for transdermal administration comprising the liposome of claim 1.
  11. 삭제 delete
  12. 삭제 delete
  13. 인지질에 서열번호 1에 기재된 아미노산 서열로 구성된 펩타이드를 씨오에테르(thioether) 결합시킴으로써 제조한 양친매성 분자 및 포집대상물질을 용매에 용해시키는 단계 (a); Dissolving the amphiphilic molecules and collecting the target substance prepared by coupling a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 to the phospholipid ssioh ether (thioether) in a solvent (a);
    상기 단계 (a) 후, 용매를 증발시켜 필름을 제조하는 단계 (b); After said step (a), the method comprising evaporating the solvent to prepare a film (b);
    상기 단계 (b) 후, 필름에 정제수 또는 완충액을 첨가하여, 수화시킨 후, 에너지를 가해 입자 크기를 감소시키는 단계 (c);를 포함하여 리포좀을 제조하되, After said step (b), was added to purified water or a buffer solution to the film, after the hydration step (c) which is applied the energy reduction in particle size; including the prepared liposomes,
    상기 인지질에 서열번호 1에 기재된 아미노산 서열로 구성된 펩타이드를 씨오에테르(thioether) 결합시킴으로써 제조한 양친매성 분자는, Amphiphilic molecules to peptides consisting of amino acid sequence shown in SEQ ID NO: 1 to the phospholipid prepared by combining ssioh ether (thioether), the
    필름 형태의 인지질에 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드를 함유하는 용액을 첨가하여, 인지질과 서열번호 1에 기재된 아미노산 서열을 갖는 펩타이드 간의 씨오에테르(thioether) 결합 반응을 유도함으로써 제조하되, 상기 필름 형태의 인지질은, 인지질을 소수성 유기용매에 녹인 후, 유기용매를 휘발시켜 필름 형태로 제조한 것이고, Was added to a solution containing a peptide having the amino acid sequence shown in the film form phospholipids in SEQ ID NO: 1, was prepared by inducing ssioh ether (thioether) bond reaction between a peptide having an amino acid sequence shown in phospholipids and SEQ ID NO: 1, the in film form phospholipids, phospholipid was dissolved in a hydrophobic organic solvent, which will volatilize the organic solvent was made of a film form,
    상기 서열번호 1에 기재된 아미노산 서열로 구성된 펩타이드를 함유하는 용액은, 서열번호 1에 기재된 아미노산 서열로 구성된 펩타이드를 암모니움 카르보네이트과 함께 증류수에 녹인 후, pH 8~10로 조절하여 제조한 것임 특징으로 하는 리포좀의 제조방법. The solution containing the peptide consisting of the amino acid sequence shown in SEQ ID NO: 1 is a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 ammonium carbonate neyiteugwa shall one was dissolved in with distilled water and prepared to adjust to pH 8 ~ 10 characterized process for producing a liposome according to.
  14. 제13항에 있어서, 14. The method of claim 13,
    상기 단계 (a)는, Wherein step (a),
    인지질에 서열번호 1에 기재된 아미노산 서열로 구성된 펩타이드를 씨오에테르(thioether) 결합시킴으로써 제조한 양친매성 분자 외에, 별도의 인지질을 용매에 더 첨가하여 용해시키는 것을 특징으로 하는 리포좀의 제조방법. In addition to the amphipathic molecules prepared by coupling a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 to the phospholipid ssioh ether (thioether), method for producing a liposome comprising a step of dissolving by further addition of a separate solvent in a phospholipid.
  15. 삭제 delete
  16. 삭제 delete
  17. 제13항에 있어서, 14. The method of claim 13,
    상기 인지질은, The phospholipid,
    DSPE-PEG-말레이미드인 것을 특징으로 하는 리포좀의 제조방법. Method of producing a liposome characterized in that the DSPE-PEG- maleimide.
  18. 제13항에 있어서, 14. The method of claim 13,
    상기 단계 (a)는, Wherein step (a),
    콜레스테롤을 추가로 용매에 용해시키는 것을 특징으로 하는 리포좀의 제조방법. Process for producing a liposome comprising a step of dissolving a solvent in addition to cholesterol.
  19. 제13항에 있어서, 14. The method of claim 13,
    상기 용매는, The solvent,
    클로로포름과 메탄올의 혼합물인 것을 특징으로 하는 리포좀의 제조방법. Method of producing a liposome, characterized in that a mixture of chloroform and methanol.




KR1020160149622A 2016-11-10 2016-11-10 Vesicle with novel protein transduction domain KR101797168B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160149622A KR101797168B1 (en) 2016-11-10 2016-11-10 Vesicle with novel protein transduction domain

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160149622A KR101797168B1 (en) 2016-11-10 2016-11-10 Vesicle with novel protein transduction domain
PCT/KR2017/011917 WO2018088734A2 (en) 2016-11-10 2017-10-26 Globular structure containing novel protein transduction domain

Publications (1)

Publication Number Publication Date
KR101797168B1 true KR101797168B1 (en) 2017-11-13

Family

ID=60385914

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160149622A KR101797168B1 (en) 2016-11-10 2016-11-10 Vesicle with novel protein transduction domain

Country Status (2)

Country Link
KR (1) KR101797168B1 (en)
WO (1) WO2018088734A2 (en)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100449889B1 (en) * 2001-08-30 2004-09-22 동국제약 주식회사 Liposome for Containing Anion Polymer and Phospholipid and Manufacturing Method the Same and Application
KR100811745B1 (en) * 2006-07-07 2008-03-11 조선대학교산학협력단 1 A novel antimicrobial peptide Pep-1-K designed from the cell-penetrating peptide Pep-1 and uses thereof
KR20090122769A (en) * 2008-05-26 2009-12-01 메디스커브 주식회사 Method for delivering proteins into cells and peptide therefor
EP2902013A1 (en) * 2008-10-16 2015-08-05 Marina Biotech, Inc. Processes and Compositions for Liposomal and Efficient Delivery of Gene Silencing Therapeutics
KR101130550B1 (en) * 2009-10-29 2012-03-23 고려대학교 산학협력단 Cell Penetrating Peptide Modified Nanoliposome and Anti-Atopic Composition Comprising the Same

Also Published As

Publication number Publication date
WO2018088734A3 (en) 2018-08-09
WO2018088734A2 (en) 2018-05-17

Similar Documents

Publication Publication Date Title
Yamada et al. MITO-Porter: a liposome-based carrier system for delivery of macromolecules into mitochondria via membrane fusion
Thorén et al. The antennapedia peptide penetratin translocates across lipid bilayers–the first direct observation
Dreher et al. Temperature triggered self-assembly of polypeptides into multivalent spherical micelles
Nakase et al. Efficient intracellular delivery of nucleic acid pharmaceuticals using cell-penetrating peptides
Rehman et al. Mechanism of polyplex-and lipoplex-mediated delivery of nucleic acids: real-time visualization of transient membrane destabilization without endosomal lysis
Simões et al. On the formulation of pH-sensitive liposomes with long circulation times
Dohmen et al. Nanosized multifunctional polyplexes for receptor-mediated siRNA delivery
AU703419B2 (en) Compositions of nucleic acid and viscosity-increasing polymers for use in gene therapy
Creusat et al. Proton sponge trick for pH-sensitive disassembly of polyethylenimine-based siRNA delivery systems
Kunath et al. Integrin targeting using RGD‐PEI conjugates for in vitro gene transfer
Re et al. Functionalization of liposomes with ApoE-derived peptides at different density affects cellular uptake and drug transport across a blood-brain barrier model
Were et al. Size, stability, and entrapment efficiency of phospholipid nanocapsules containing polypeptide antimicrobials
Batrakova et al. A Macrophage− Nanozyme Delivery System for Parkinson's Disease
Sarparanta et al. Intravenous delivery of hydrophobin-functionalized porous silicon nanoparticles: stability, plasma protein adsorption and biodistribution
Napoli et al. Glucose-oxidase based self-destructing polymeric vesicles
US20140134232A1 (en) Encapsulation of Plasmid DNA (Lipogenes™) and Therapeutic Agents with Nuclear Localization Signal/Fusogenic Peptide Conjugates into Targeted Liposome Complexes
Cao et al. Multistimuli-responsive supramolecular vesicles based on water-soluble pillar [6] arene and SAINT complexation for controllable drug release
Al-Ahmady et al. Lipid–peptide vesicle nanoscale hybrids for triggered drug release by mild hyperthermia in vitro and in vivo
Danino Cryo-TEM of soft molecular assemblies
KR100588241B1 (en) Peptide-Lipid Complex Formation by co-lyophilization
EP1596828B1 (en) Lipophilic drug delivery vehicle and methods of use thereof
ES2666559T3 (en) Mrna delivery for augmentation proteins and enzymes in human genetic diseases
Maherani et al. Liposomes: a review of manufacturing techniques and targeting strategies
Ramamoorthy et al. Deletion of all cysteines in tachyplesin I abolishes hemolytic activity and retains antimicrobial activity and lipopolysaccharide selective binding
EP1838286B2 (en) Preparation of lipid based nano-particles with a dual asymetric centrifuge

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant