KR101690408B1 - An apparatus for treatment of obesity using LED - Google Patents

Abstract

More particularly, the present invention relates to a method for preventing or treating obesity, which comprises irradiating an LED having a wavelength of 350 to 500 nm with an intensity of 10 to 50 mW / cm ² for 1 to 30 minutes for 3 to 7 days .
Further, the present invention relates to an obesity treating apparatus including an irradiating unit for irradiating an LED at a wavelength of 350 to 500 nm.

Description

[0001] The present invention relates to an apparatus for treating obesity using an LED,

The present invention is to investigate as to be related to obesity prevention or treatment comprises the step of irradiating with a 350 to 500nm wavelength of a light emitting diode (LED) to an object, and more particularly, the intensity of the LED 10 to 50mW / cm ² Wherein the LED is irradiated for 1 to 30 minutes at a time of 3 days to 7 days, a method for preventing or treating obesity, an obesity treatment including an irradiation part for irradiating the LED with a wavelength of 350 to 500 nm ≪ / RTI >

Obesity is a state in which excessive energy is accumulated in the body due to high energy intake compared to energy consumption. According to the 2005 National Health and Nutrition Examination Survey, 31.8% of adults over 20 years of age are obese, (Ministry of Health & Welfare, 2006. The third Korea National Health and Nutrition Examination Survey). In addition, due to the increasing trend, socioeconomic losses due to obesity are increasing every year from 1.7 trillion won surveyed in 2001.

The cause of obesity is not only energy overdose, lack of exercise but also nervous system secretion factor, drug cause, genetic factor, etc. The main function of the adipocytes that accumulate the energy consumed is to maintain energy balance in the body. When energy is excessive in the body, it stores neutral lipids in the cell. Conversely, when energy is deficient, energy is supplied. If this balance is broken and the amount of fat cells is rapidly increased or the size of fat cells becomes excessively large, do.

Obesity is a major cause of obesity worldwide, as it can cause cardiovascular disease, diabetes, respiratory disease and osteoarthritis as well as problems of its own (Antipatis VJ et al., 2001, Obesity as a global problem), the World Health Organization (WHO) treats obesity as a global nutritional problem and recognizes it as a disease to treat rather than a simple risk factor that harms health (World Health Organization, 1998. Obesity: Preventing and managing the global epidemic Report of WHO Consultation on Obesity, Geneva).

Many studies have been carried out for the development of obesity treatment drugs in order to recognize the risk of obesity and prevent socioeconomic loss due to obesity. Among the various treatments, there is pancreatic lipase inhibitor as one of studies for inhibiting lipolysis.

Currently known representative pancreatic lipase inhibitors include Orlistat (tetrahydrolipstatin), a derivative of lipstatin derived from Streptomyces toxitricini . It is known that orlistat, currently marketed as a pharmaceutical product in 1998, is highly effective in inhibiting digestion and uptake of about 30% of the ingested fat (Drent M. et al., 1995, Int. J. Obesity. 19 : 221-226), and it was reported to have generated sales of about $ 963,300 in 2001.

However, in spite of this efficacy, Orlast has been reported to have adverse effects such as gastrointestinal disorder, hypersensitivity, biliary secretion, inhibition of absorption of fat soluble vitamin (Peter C. et al., 2001, Br. J. Clin. Pharmacol 51: 135-141). In addition, according to the FDA's weight loss treatment regimen, long-term anti-obesity drug effects should be reduced by 5% of body weight before administration, and this loss should be maintained for at least 12 months, Even though it is reported that 3% ~ 5% of body weight is decreased and fat absorption vitamin A, D, E absorption is inhibited more than the diet alone, sales are gradually decreasing.

In Korea, it was reported that 30.4% (241/793) of adolescents had adverse reactions after the postmarketing survey conducted on 793 people to review Oristat. Among the adverse reactions, 29.9% (237) were found to be causally related to orlistat. The most frequently observed adverse events were gastrointestinal symptoms (29%) (230 patients), and new abnormalities that were not seen in pre-market clinical studies were skin sensation abnormality, constipation, indigestion and genital sores. In particular, the KFDA warned that excessive weight loss could increase the risk of cholelithiasis by changing the permit. Clinical trials for the prevention of type 2 diabetes have reported a 2.9% (47 / 1,649) incidence of cholelithiasis in the orlistat group and 1.8% (30 / 1,655) in the placebo group (Dailyfarm, 2007. 10. 02.) It is reported that even diarrhea that is practically unpredictable causes many inconveniences during the life of taking orlistat, and the development of an obesity treatment agent having excellent side-effect, Interest is growing.

In recent years, laser treatment methods have been widely used in the medical field. On the other hand, LED has less heat generation, higher conversion efficiency, and longer life expectancy compared to other artificial light sources. Also, the price of LED is cheaper than laser, LED is safe and it is not hard to use compared with laser. Recently, LED is being used as a new medical light source.

Under the background of interest in the treatment of obesity without side effects and stability and efficiency of LEDs, the present inventors confirmed that the LED having a specific wavelength or intensity has the effect of preventing or treating obesity by inhibiting the differentiation of lipid precursor cells, .

One object of the present invention is to provide a method for preventing or treating obesity comprising irradiating an LED to a subject at a wavelength of 350 to 500 nm.

Another object of the present invention is to provide an obesity treating apparatus including an irradiating unit for irradiating an LED at a wavelength of 350 to 500 nm.

According to one aspect of the present invention, there is provided a method of preventing or treating obesity comprising irradiating an LED to a subject at a wavelength of 350 to 500 nm.

The term "LED" used in the present invention is an abbreviation of Light Emitting Diode, and refers to a light emitting diode in which a plurality of diodes (semiconductors) are arrayed, and electricity flows only in specific portions. It has advantages such as long durability and no need to surround with glass because it does not heat. For the purpose of the present invention, the LED light source is used as a means for irradiating light to the skin of a part requiring inhibition of lipid differentiation.

The term " individual " as used herein refers to all animals, including mammals including humans, rats, livestock, and the like.

As shown in FIG. 1B, FIG. 1C, FIG. 2B, FIG. 2C, FIG. 3B, FIG. 3C, FIG. 4B and FIG. 4C, when the wavelength of 350-500 nm was irradiated onto 3T3- The LED of the wavelength can effectively prevent or treat obesity.

Preferably, the wavelength of the LED is from 390 to 420 nm.

Further, in the step of irradiating the LED to the object at a wavelength of 350 to 500 nm, the LED may be irradiated at an intensity of 10 to 50 mW / cm ² .

As a result of irradiation of the wavelength of 350 to 500 nm with 3T3-L1 cells at an intensity of 10 to 50 mW / cm ² , the effect of inhibiting the differentiation of 3T3-L1 cells was observed as shown in FIGS. 5B, 5C, 6B and 6C The LED of the wavelength can effectively prevent or treat obesity.

Preferably, the intensity of the LED may be 10 to 30 mW / cm ² .

Further, in the step of irradiating the LED to the object at a wavelength of 350 to 500 nm, the irradiation time of the LED may be 1 to 30 minutes, 3 to 7 days.

As a result of irradiation with the wavelength of 350 to 500 nm at an intensity of 10 to 50 mW / cm ² for 1 to 30 minutes at a time of 3 to 7 days, as shown in Figs. 7B and 7C, the inhibition of 3T3-L1 cell differentiation The LED of the above wavelength can effectively prevent or treat obesity.

Preferably, the time of the LED irradiation may be 10 minutes to 20 minutes, 3 days to 7 days.

According to another aspect, the present invention provides an obesity treating apparatus comprising an irradiating unit for irradiating an LED at a wavelength of 350 to 500 nm.

The term " device " used in the present invention may include, but is not limited to, a power source, an input unit, an irradiation unit, a sensor, a control unit, and a display unit.

The input unit may be one capable of inputting the intensity of the LED, the irradiation time, and the wavelength of the LED as necessary for the irradiation.

The irradiation unit may be one in which an LED is generated and irradiated, and the wavelength of the generated LED may be 350 to 500 nm, preferably 390 to 420 nm, but is not limited thereto.

The sensor may include various kinds of sensors for measuring the distance between the irradiation device and the skin.

The control unit may control the irradiation of the visible light through the irradiation unit according to the contents input to the input unit.

The display unit may display the contents input through the input unit and the distance to the skin.

According to the present invention, a method comprising irradiating an LED to an individual at a wavelength of 350 to 500 nm according to the present invention has the effect of preventing or treating obesity by inhibiting differentiation into adipocytes without lowering the cell survival rate of normal cells.

FIG. 1A shows the 3T3-L1 cell survival rate (3T3-L1) according to the wavelength (nm) of the LED irradiated at an intensity of 90 J (30 mW / cm ² , 10 minutes, 5 days).
FIG. 1B shows the lipid accumulation of 3T3-L1 in 3T3-L1 cells according to the wavelength of the LED irradiated at an intensity of 90J (30 mW / cm ² , 10 minutes, 5 days).
1C shows the results of Oil Red O staining of 3T3-L1 cells differentiated according to the wavelength of the LED irradiated at an intensity of 90J (30 mW / cm ² , 10 min, 5 days)
FIG. 2A shows the 3T3-L1 cell survival rate according to the wavelength of the LED irradiated at an intensity of 150J (50 mW / cm ² , 10 minutes, 5 days).
FIG. 2B shows the degree of inhibition of lipid differentiation by 3T3-L1 cells according to the wavelength of the LED irradiated at an intensity of 150J (50 mW / cm ² , 10 minutes, 5 days).
FIG. 2C shows the results of Oil Red O staining of 3T3-L1 cells differentiated according to the wavelength of the LED irradiated at an intensity of 150J (50 mW / cm ² , 10 minutes, 5 days).
FIG. 3A shows the 3T3-L1 cell survival rate according to the wavelength of the LED irradiated at an intensity of 270 J (30 mW / cm ² , 30 minutes, 5 days).
3B shows the degree of inhibition of lipid differentiation of 3T3-L1 cells according to the wavelength of the LED irradiated at an intensity of 270 J (30 mW / cm ² , 30 minutes, 5 days).
Figure 3c shows the result of Oil Red O staining of 3T3-L1 cells differentiated according to the wavelength of the LED irradiated at 270 J (30 mW / cm ² , 30 min, 5 days)
4A shows the 3T3-L1 cell survival rate according to the wavelength of the LED irradiated at an intensity of 450 J (50 mW / cm ² , 30 minutes, 5 days).
FIG. 4B shows the degree of inhibition of lipid differentiation of 3T3-L1 cells according to the wavelength of the LED irradiated at an intensity of 450 J (50 mW / cm ² , 30 minutes, 5 days).
4C shows the results of Oil Red O staining of 3T3-L1 cells differentiated according to the wavelength of the LED irradiated at an intensity of 450 J (50 mW / cm ² , 30 minutes, 5 days).
5A shows the survival rate of 3T3-L1 cells according to the irradiation intensity of 410 nm wavelength LED (10 minutes, 3 days).
FIG. 5B shows the degree of inhibition of lipid differentiation by 3T3-L1 cells according to irradiation intensity of 410 nm wavelength LED (10 minutes, 3 days).
FIG. 5c shows the result of Oil Red O staining of 3T3-L1 cells differentiated according to the irradiation intensity of 410 nm wavelength LED (10 minutes, 3 days).
6A shows the survival rate of 3T3-L1 cells according to the irradiation intensity of 410 nm wavelength LED (10 minutes, 5 days).
6B shows the degree of suppression of lipid differentiation of 3T3-L1 cells according to irradiation intensity of 410 nm wavelength LED (10 minutes, 5 days).
FIG. 6C shows the results of Oil Red O staining of 3T3-L1 cells differentiated according to the irradiation intensity of 410 nm wavelength LED (10 min, 5 days).
7A shows the 3T3-L1 cell survival rate with irradiation time of 20 mW / cm ² and 410 nm wavelength LED.
FIG. 7B shows the results of Oil Red O staining of 3T3-L1 cells differentiated according to irradiation time of 20mW / cm ² , 410nm wavelength LED.
Fig. 7C shows the degree of inhibition of lipid differentiation of 3T3-L1 cells according to irradiation time of 20 mW / cm ² , 410 nm wavelength LED.
8A shows the expression level of the adipocyte marker gene C / EBP alpha upon irradiation with 410 nm wavelength LED (20 mW / cm ² , 10 min, 5 days).
8B shows the expression level of the adipocyte marker gene PPAR gamma upon irradiation with a 410 nm wavelength LED (20 mW / cm ² , 10 minutes, 5 days).
FIG. 9A shows the survival rate of 3T3-L1 cells at different concentrations in a hypoxic concentration environment. FIG.
FIG. 9B shows the degree of inhibition of lipid differentiation by 3T3-L1 cells according to the concentration of oxygen according to irradiation of 410 nm wavelength LED (20 mW / cm ² , 10 minutes, 5 days) in a hypoxic concentration environment.
FIG. 9c shows the result of Oil Red O staining of differentiated 3T3-L1 cells according to the concentration of oxygen according to irradiation of 410 nm wavelength LED (20 mW / cm ² , 10 minutes, 5 days) in a hypoxic concentration environment.
FIG. 10A shows the expression levels of adipocyte marker genes C / EBPδ and PPARγ by irradiation of 410 nm wavelength LEDs (20 mW / cm ² , 10 minutes, and 5 days) in 3T3-L1 cells at early stages of adipocyte differentiation .
FIG. 10B shows the expression levels of adipocyte marker genes C / EBPα and PPARγ according to irradiation of 410 nm wavelength LEDs (20 mW / cm ² , 10 minutes, 5 days) in 3T3-L1 cells at the late stage of adipocyte differentiation .
FIG. 11 shows the expression levels of GLUT-1, PGK-1, TGF-βR1 and VEGF specific for hypoxia in a hypoxic concentration environment.

Hereinafter, the constitution and effects of the present invention will be described in more detail with reference to Examples and Experimental Examples. These Examples and Experimental Examples are only for illustrating the present invention, and the scope of the present invention is not limited by these Examples and Experimental Examples.

Example  1: 3 T3 - L1  Cell culture

The 3T3-L1 cells used in this experiment were obtained from a mouse cell-derived fibroblast from the American Type Culture Collection (ATCC, Manassas, USA). The medium was maintained in DMEM (high glucose concentration) supplemented with 10% calf serum (BCS; Bovine calf serum, Hyclone, USA) and 1% penicillin-streptomycin (PS, Hyclone, USA) (Dulbecco's modified Eagle's medium, Hyclone, USA). Cells were incubated in an incubator (Thermo Forma, USA) maintained at 37 ° C in a 5% CO 2 environment.

A hypoxia chamber was used to provide a hypoxic environment for 3T3-L1 cells. The hypoxic chambers were connected to mixed gas lines containing 2, 5, 8, 11, and 20% oxygen, respectively, and oxygen was supplied at a constant concentration.

Example  2: 3 T3 - L1  Cell differentiation

The differentiation medium for inducing the differentiation of 3T3-L1 was supplemented with 10% fetal bovine serum (FBS) and dexamethasone (Dexamethasone, available from Cayman Chemical) in fresh DMEM medium with high glucose concentration (Sigma Aldrich, St. Louis, USA), 0.5 mM, IBMX (3-isobutyl-1-methylxanthine, Sigma Aldrich, St. Louis, USA) mL, and Indomethacin (Sigma Aldrich, St. Louis, USA). Differentiation was done by first planting 3T3-L1 cells in a 24-well plate and putting it in a post-confluent state for one day. In this state, the existing medium was removed and the differentiation medium was treated and cultured for 2 days. Two days later, the existing differentiation medium was removed and replaced with a basal medium containing only 10 μg / mL of insulin (recombinant human, Sigma Aldrich, St. Louis, USA) and further cultured for 2 days. Two days later, the culture medium was removed and replaced with a medium containing only fetal bovine serum (FBS) and cultured for 2 days.

Example  3: Type of light source and range of wavelength

LEDs were used as the light source for illuminating the light. For the LED, a cylindrical LED with a diameter of 5 mm was used. For ease of use, 200 LEDs (10 × 20) were attached to a panel of 73 mm × 145 mm. The wavelengths of the LEDs used in the experiments were 6, 7, 8, and 940 nm, and the actual wavelengths of each LED plate were measured using a spectrometer

Example  4: LED Measurement of temperature and temperature

LEDs were controlled by a power supply (Hanil, Korea) and the amount of LED light was measured using a power meter before each experiment in order to maintain a constant intensity of light for each experiment. In order to confirm that the LED does not die due to the temperature of the LED itself, it was measured using an electronic thermometer in three places on the lid and bottom of the LED plate and the 24 well plate. Before the temperature measurement, the temperature of the lid and the bottom of the LED plate and the plate was made constant at 26.5 ° C (± 0.5 ° C) and then the measurement was started. Temperature measurements were performed three times to obtain mean and standard deviation.

Example  5: Measurement of cell survival rate

2-yl) -2,5-diphenyl tetrazolium bromide (MTT, 2 mg / mL solution; Sigma Aldrich, St. Louis, MO) to determine whether the light irradiation using LEDs is cytotoxic. Louis, USA) assay. The amount of cells, the irradiation intensity of the light, the irradiation time of the light, and the like were the same as those in Example 3. The cells were treated with MTT solution and reacted for 3 hours. After 3 hours, the supernatant was removed and DMSO (99% Dimethyl sulfoxide, Daejung, Korea) was added to dissolve the formazan crystal. When all of the crystals were dissolved, the absorbance was measured at 540 nm using an ELISA reader (Biochrom, Ez Read 406, England). The measured absorbance was expressed as a percentage based on the absorbance of the control group.

Example  6: Oil Red  O dyeing carried out

Oil Red O staining was performed to observe lipids in differentiated 3T3-L1 cells. First, the differentiated cells were fixed with 2% formalin (diluted in PBS). Dyeing stock solutions were prepared by dissolving 1.5 g of Oil Red O powder (Sigma Aldrich, St. Louis, USA) in 500 mL of 99% isopropanol. For dyeing, the stock solution was mixed with distilled water at a ratio of 3: 2 and then filtered through a 0.4 μm syringe filter. Dyed lipids were observed through an optical microscope. For lipid determination, the stained lipids were dissolved in 99% isopropanol and absorbance was measured at 540 nm in an ELISA reader (Biochrom, Ez Read 406, England).

Example  7: Real-time quantitative PCR  practice

Real-time quantitative PCR was performed to confirm the expression of the adipocyte marker gene. The amount of cells required for the experiment, the irradiation intensity of the light, and the irradiation time of the light are the same as the other experiments. TRIzol reagent (Life technologies) was used to extract RNA from cells. The extracted RNA was synthesized by cDNA using iScript ™ cDNA synthesis kit (Bio-Rad, Hercules, USA). The real-time quantitative PCR was performed using the StepOne Plus real-time PCR system (Applied Biosystems, Foster City, USA) and the Power SYBR Green PCR master mix (Applied Biosystems, Foster City, USA) Primers for the adipocyte marker genes shown in Table 1 below were prepared in Bioneer (Daejeon, Korea).

Genes Primer sequence (5'-3 ') Annealing
Temp (캜) Product
Size (bp) C / EBPα F CGGTGGACAAGAACAGCAACG (SEQ ID NO: 1) 60.0 141 R GGCGGTCATTGTCACTGGTCA (SEQ ID NO: 2) 60.2 C / EBPδ F CTCTTCGCCGACCTCTTCAAC (SEQ ID NO: 3) 60.2 106 R TAGCGACAGACCCCACACCC (SEQ ID NO: 4) 59.2 PPARγ F TGTTCGCCAAGGTGCTCCAG (SEQ ID NO: 5) 60.6 115 R AGCAGGGGGTGAAGGCTCAT (SEQ ID NO: 6) 59.4 GAPDH F TCAAGCTCATTTCCTGGTATGACA (SEQ ID NO: 7) 60.0 104 R TGGGTGGTCCAGGGTTTCTTAC (SEQ ID NO: 8) 60.0

Example  8: Reverse transcription PCR  practice

Reverse transcription PCR was performed to confirm expression of hypoxia-related specific genes. TRIzol reagent (Life technologies) was used to extract RNA from the cells. The extracted RNA was synthesized by cDNA using iScript ™ cDNA synthesis kit (Bio-Rad, Hercules, USA). For reverse transcription, EmeraldAmp GT PCR Master Mix (TaKaRa, Japan) was used. After the reverse transcription PCR, the result was confirmed by electrophoresis on 2% agarose gel containing ethidium bromide. Electrophoresis results were analyzed using TINA (ver 2.10e). Primers of the hypoxic marker genes shown in Table 2 below were prepared in Bioneer (Daejeon, Korea)

Genes Primer sequence (5'-3 ') Annealing
Temp (캜) Product
Size (bp) VEGF F TACCTCCACCATGCCAAGT (SEQ ID NO: 9) 55.4 141 R CTCCTGGAAGATGTCCACCA (SEQ ID NO: 10) 54.4 GLUT-1 F GTGGCTGCTGTGCTTATGGGC (SEQ ID NO: 11) 61.3 411 R CAGGTCTCGGGTCACATCGG (SEQ ID NO: 12) 59.7 PGK-1 F CCTTATGAGCCACCTGGGCC (SEQ ID NO: 13) 60.1 453 R AGCCAGGAAGGGTCGCTCTG (SEQ ID NO: 14) 60.2 TGF-β1 F GTCCGCAGCTCCTCATCGTG (SEQ ID NO: 15) 60.2 449 R TGGCACACGGTGGTGAATGAC (SEQ ID NO: 16) 61.0 GAPDH F AACTTTGGCATTGTGGAAGG (SEQ ID NO: 17) 53.8 305 R ACACATTGGGGGTAGGAACA (SEQ ID NO: 18) 53.7

Example  9: Statistical methods

All experimental results are expressed as mean value and standard deviation. Data were analyzed by one-way analysis of variance (ANOVA). Statistical significance of mean value was tested at p <0.05 level. Analysis was performed with GraphicPad Prism (ver 5.02).

Experimental Example  1: No cytotoxicity, and effective for inhibiting lipid differentiation LED  Experiment to verify the wavelength

Among the wavelengths of the LEDs, LEDs having various wavelength ranges were examined in order to confirm the wavelengths having the effect of inhibiting lipid differentiation.

Specifically, the above-described different LED wavelength through the method of Example 3, 410, 530, 630, 730, 810, to 940 nm upon irradiation intensity of 30mW / cm ² or 50mW / cm ^2, the irradiation time of 10 minutes or 30 minutes 90J in groups by varying the (10 minutes 30mW / cm ^2, 5 ^{days), 150J (50mW / cm 2} , 10 minutes, 5 ^{days), 270J (30mW / cm 2} , 30 minutes, 5 days), 450J ( 50mW / cm ² , 30 min, 5 days) were investigated on 3T3-L1 cells as lipid precursor cells.

The cell viability was examined using the MTT assay of Example 5 to determine if there was cytotoxicity depending on the wavelength range of the irradiation using the LED. As a result, there was no significant difference in cell survival rate at wavelengths of 530, 630, 730, 810 and 940 nm except for 410 nm (Fig. 1A, Fig. 2A, Fig. 3A, Fig. 4A). However, in the case of the 410 nm wavelength, the cell survival rate was about 80% in the irradiation with the 410 nm LED in the 90 J and 150 J groups in which the irradiation time was short (FIGS. 1A and 2 A) (Fig. 3A, Fig. 4A).

Further, the lipid differentiation of 3T3-L1 cells according to the wavelength of the LED was observed, and the lipid differentiation was not observed at the wavelengths of 530, 630, 730, 810 and 940 nm except 410 nm. However, in all groups, 410 nm LEDs were used and the degree of lipid differentiation was greatly suppressed. Specifically, in the group of 90J and 150J having a short irradiation time, an effect of suppressing lipid differentiation was observed in 83 ~ 97% (Figures 1b, 1c, 2b and 2c) (Fig. 3B, Fig. 3C, Fig. 4B and Fig. 4C).

As a result of the above-mentioned experiments, it can be seen that the effect of inhibiting lipid differentiation is exhibited at an LED wavelength of 410 nm. Further, in the case of irradiating the LED of 410nm ^{wavelength, 270J (30mW / cm 2,} 30 minutes and 5 days), 450J than (50mW / cm ^2, 30 minutes and 5) strength, 90J (30mW / cm2, 10 bun , 5 days) and 150 J (50 mW / cm ² , 10 minutes, 5 days), respectively.

Experimental Example  2: effective to inhibit lipid differentiation without cytotoxicity LED  Confirmation experiment intensity

In order to determine the irradiation intensity (Irradiance, mW / cm ² ), which has the effect of inhibiting lipid differentiation without cytotoxicity, the irradiation intensity of the LED was varied and experimented.

Specifically, the LED illumination intensity used in the experiment was 10, 20, 30, 40 or 50 nm at a wavelength of 410 nm as confirmed in Experimental Example 1. The irradiation period was 3 days or 5 days, and the first group was 18 J (10 mW / cm ^2, 10 minutes, 3 ^{days), 36J (20mW / cm 2} , 10 minutes, 3 ^{days), 54J (30mW / cm 2} , 10 minutes, 3 ^{days), 72J (40mW / cm 2} , 10 minutes and 3 days ^{), 90J (50mW / cm 2} , 10 minutes and was irradiated with a strength of 3) and a second group of 30J (10mW / cm ^2, 10 minutes, 5 days), 60J (20mW / cm ^2, 10 minutes, 5 ^{day), 90J (30mW / cm 2} , 10 minutes, 5 ^{days), 120J (40mW / cm 2} , 10 minutes and 5 days), 3T3-L1 with intensity of 150J (50mW / cm ^2, 10 minutes and 5 days) Cells.

Cell viability was examined using the MTT assay of Experimental Example 5 in order to confirm cytotoxicity according to the intensity of irradiation using the LED. As a result, the cell survival rate was decreased as the intensity of LED irradiation increased in both groups. Specifically, in the first group treated for 3 days, the cell survival rate was over 98% in 36J, At the above intensity, the cell viability decreased to 70% (Fig. 5A). Even in the case of the second group treated for 5 days, the cell survival rate was 95% at 60 J, but the cell survival rate was decreased to 70% at the higher intensity (Fig. 6A).

Further, as a result of observing lipid differentiation of 3T3-L1 cells according to the intensity of LED irradiation, the effect of inhibiting lipid differentiation was increased as the intensity of irradiation was increased in both groups. As compared with the first group of 3 days, The inhibitory effect was greater in the second group. Specifically, lipid differentiation was inhibited from at least 23% to at most 85% in the first group (FIG. 5B, FIG. 5C), but in the second group at least 45% and up to 99% 6c).

As a result of the above-mentioned experiments, it can be seen that the larger the intensity of the LED irradiation is, the more excellent the effect of inhibiting lipid differentiation. However, when the cytotoxicity was considered together, it was found that the cytotoxicity was low and the effect of inhibiting lipid differentiation was excellent for 5 days at an irradiation intensity of 20 mW / cm ² .

Experimental Example  3: In addition to being cytotoxic and having an inhibitory effect on lipid differentiation LED  Confirmation experiment time

In order to determine the time of irradiation with the effect of inhibiting lipid differentiation without cytotoxicity, the irradiation time of the LED was varied and experimented.

Specifically, the LED irradiation time was changed to 10 minutes, 20 minutes, and 30 minutes at a wavelength of 410 nm, 20 mW / cm ² , and 5 days as confirmed in Experimental Example 1 and Experimental Example ² , Min, 5 days), 120 J (20 mW / cm ² , 20 minutes and 5 days) and 180 (20 mW / cm ² , 30 minutes and 5 days).

Cell viability was examined using the MTT assay of Experimental Example 5 to determine if cytotoxicity was present according to the time of irradiation using the LED. As a result, the cell viability was 93% or more when irradiated with 60 J (10 min), but the survival rate of cells was lowered to 70% when the cell viability was 120 (20 min) and 180 (30 min) (Fig. 7A).

Furthermore, the lipid differentiation of 3T3-L1 cells according to the time of LED irradiation was observed, and the fat differentiation was suppressed at 10, 20 and 30 minutes irradiation time. Specifically, when 10 minutes of irradiation was applied, the inhibition of lipid peroxidation was 86%, and when 20 minutes and 30 minutes were irradiated, 90% and 96% of lipid-lowering inhibition was observed, respectively (FIGS. 7B and 7C).

As a result of the above experiments, it can be seen that the longer the time of the LED irradiation, the better the effect of inhibiting the lipid differentiation. However, when the cytotoxicity is considered together, it can be understood that the cytotoxicity is low and the effect of inhibiting lipid differentiation is excellent for 10 minutes.

Experimental Example  4: 410 nm LED  Fat cells by irradiation Marker  Inhibition experiment of gene expression

As the known adipocyte marker genes, PPARγ (Peroxisome proliferator-activated receptor γ) and C / EBP family (CCAAT / enhancer binding proteins) exist and they are known as important transcription factors have.

Therefore, by examining the LED, it was confirmed whether expression of an adipocyte marker gene in 3T3-L1 cells induced differentiation by differentiation inducing substance (MDI) was reduced, and the inhibitory effect of the lipid-forming process according to the LED irradiation was confirmed.

Specifically, the gene expression of C / EBPα and PPARγ was analyzed by irradiating 410 nm LEDs with an intensity of 60 J (20 mW / cm ² , 10 minutes, 5 days) based on the results of Experimental Examples 2 to 3, The expression of the marker gene was confirmed using real-time quantitative PCR of Example 7

As a result of the above experiment, when the differentiation inducing substance was treated but the light-irradiated group (MDI) and the light-irradiated group (LED + MDI) were compared, the C / EBPα group (Fig. 8A), and the expression of PPAR [gamma] was about 2-fold lower than that of the group not irradiated with the LED (Fig. 8B). Therefore, it can be seen that the irradiation of the LED suppresses the formation of the fat through the result that the expression of the two marker genes is suppressed by the 410 nm LED irradiation.

Experimental Example  5: Hypoxia  In the environment 410 nm LED  Experiment to inhibit lipid differentiation by irradiation

Oxygen concentration in general air is 21%, but human fat tissue usually maintains oxygen concentration of 3 ~ 11%. In order to confirm that the effect of inhibition of lipid differentiation by LED irradiation is effective not only in general cell culture environment but also in hypoxic environment in which actual fat tissue exists, 3T3-L1 cells cultured in a hypoxic environment are irradiated with LED to inhibit lipid differentiation Were observed.

Specifically, irradiation of the 410 nm LED was carried out with an intensity of 60 J (20 mW / cm ² , 10 minutes, 5 days) based on the results of Experimental Examples 2 to 3. In order to culture the cells in a hypoxic environment, hypoxic chamber), and the oxygen concentration was maintained at 2, 5, 8, 11, and 20%.

In order to confirm cytotoxicity in a hypoxic environment, cell viability was examined using the MTT assay of Experimental Example 5. As a result, the survival rate was maintained at 90% at an oxygen concentration of 5% or less and is not cytotoxic at an oxygen concentration of 8% or more (Fig. 9A).

Lipid differentiation of 3T3-L1 cells resulted in a decrease in lipid differentiation of 3T3-L1 cells compared with the control group at 20, 11, 8, 5, and 2% oxygen concentration as well as normoxia (Fig. 9B, Fig. 9C), even at the low oxygen concentration, which is the environment where the fat tissue is actually present.

Experimental Example  6: Hypoxia  In the environment 410 nm LED  Fat cells by irradiation Marker  Inhibition experiment of gene expression

We examined the expression of C / EBPδ, C / EBPα, and PPARγ, which are adipocyte marker genes, by irradiating 410 nm LED onto 3T3-L1 cultured in a hypoxic environment.

Specifically, the irradiation of the 410 nm LED was carried out at an intensity of 60 J (20 mW / cm ² , 10 minutes, 5 days) based on the results of Experimental Examples 2 to 3, PCR. Hypoxic chambers were used for culturing the cells in a hypoxic environment, and oxygen concentrations were maintained at 2, 5, 8, 11, and 20% in the hypoxic environment.

The marker genes to be observed are C / EBPδ, which is expressed in the early stage of fat differentiation, and C / EBPα and PPARγ, which are expressed in the late stage. Observation time was divided into early stage of lipid differentiation and late stage of lipid differentiation. In the case of the PPARγ gene, the marker gene or expression itself appearing in the later stage of lipid differentiation appears from the beginning, and thus it is also observed at the early stage of lipid differentiation.

As a result of observing the degree of expression of the adipocyte marker gene, the expression of C / EBPδ and PPARγ was decreased by 30 to 50% when compared with the group in which the LED was irradiated and the group which was not irradiated in the early stage of fat differentiation ). When compared to the control group in which no LED was irradiated in the latter stage of lipid differentiation, mRNA expression of the C / EBPα and PPARγ in the LED-irradiated group was reduced by about 70% (FIG. 10b).

3T3-L1 was cultured in a hypoxic environment in order to determine whether hypoxic environment was properly induced in the expression of adipocyte marker gene. Then, RNA was extracted from the cells to obtain hypoxia specific genes GLUT-1 (Glucose transporter-1), PGK-1 Phosphoglycerate kinase-1), TGF-β1r (Transforming growth factor-beta 1 receptor) and VEGF (vascular endothelial growth factor)

As a result of analysis of the expression level of the gene through reverse transcription PCR of Example 8, it was found that as the oxygen concentration was lowered, the expression of these genes was increased and the hypoxic concentration was maintained (FIG. 11).

As a result of the above experiments, it was found that when the 3T3-L1 cells were irradiated with 410 nm wavelength light even in the hypoxic concentration, which is the environment where the adipose tissue was present, not only the C / EBPδ expressed in the early stage of adipocyte differentiation as an adipocyte marker gene, It is shown that the expression of C / EBPα and PPARγ expressed in the later stage of adipocyte differentiation is reduced and the inhibitory effect on differentiation into adipocytes is exhibited. Therefore, it can be seen that the method is effective for preventing or treating obesity.

<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> A method for treatment of obesity using LED <130> KPA150230-KR <160> 18 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 cggtggacaa gaacagcaac g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 ggcggtcatt gtcactggtc a 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 3 ctcttcgccg acctcttcaa c 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 tagcgacaga ccccacaccc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 5 tgttcgccaa ggtgctccag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 6 agcagggggt gaaggctcat 20 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 7 tcaagctcat ttcctggtat gaca 24 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 8 tgggtggtcc agggtttctt ac 22 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 9 tacctccacc atgccaagt 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 10 ctcctggaag atgtccacca 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 11 gtggctgctg tgcttatggg c 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 12 caggtctcgg gtcacatcgg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 13 ccttatgagc cacctgggcc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 14 agccaggaag ggtcgctctg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 15 gtccgcagct cctcatcgtg 20 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 16 tggcacacgg tggtgaatga c 21 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 17 aactttggca ttgtggaagg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 18 acacattggg ggtaggaaca 20

Claims (8)

And an irradiating unit for irradiating the light emitting diode (LED) with a wavelength of 410 nm and an intensity of 10 mW / cm ² or more and less than 30 mW / cm ² .
delete delete The apparatus of claim 1, wherein the intensity is 20 mW / cm ² .
The obesity treating apparatus according to claim 1, wherein the irradiating unit irradiates the LEDs for 1 minute to 30 minutes at a time of 3 days to 7 days.
6. The device according to claim 5, wherein the time is from 10 minutes to less than 20 minutes, from 3 days to 7 days.
2. The device of claim 1, wherein the device inhibits the expression of C / EBPa, PPARy or C / EBPδ. delete

Images