KR101470595B1 - Extracellular Secreted GFP Gene and Vector Expressing the Gene - Google Patents

Abstract

Since the present invention has the characteristic of GFP and emits intrinsic fluorescence under light irradiation at a wavelength of 480 nm and is released to the outside through the cell membrane upon expression, when the sGFP gene is used as a reporter gene, long wavelength ultraviolet (GFP) or a modified protein thereof and a recombinant protein of a rat FSHB signaling protein, a gene coding therefor and a vector for expressing the gene. will be. The present invention can be used for time-course experiments because the amount of expression can be quantified in a living state without cells being broken.

Description

Extracellular Secreted GFP Gene and Vector Expressing the Gene < RTI ID = 0.0 >

The present invention relates to a green fluorescent protein which is secreted out of the cell, a gene encoding the same, and a vector for expression of the gene. The present invention also aims to provide a method for quantitatively analyzing the expression of a protein or gene using the expression vector as a reporter.

Reporter genes are genes that are easily distinguishable from proteins that are endogenously expressed in the cell and have phenotypes that are easily measurable (Alam and Cook, Anal Biochem 1990. 188: 245-254). In general, the choice of reporter genes is determined by the sensitivity to which the degree of gene expression can be easily detected, the range to be applied, the convenience of gene use, and the convenience of gene expression analysis.

Representative reporter genes include β-galactosidase, luciferase, alkaline phosphatase, and GFP (green fluorescent protein) genes. Unlike other reporter genes, the GFP gene among the various reporter genes has the advantage that it does not require any other cofactor or substrate to measure the expression of the gene, or to sacrifice the cell to measure expression of the gene.

GFP was first identified in the jellyfish Aequorea victoria by Shimomura et al. (J. Cell Comp. Physiol., 1962. 59: 223-239) and was named "aequorin", followed by Johnson et al., J. Cell Comp. Physiol. 60: 85-104). The fluorescence spectrum of the green protein was measured. The biochemical character of aequorin was identified by Hastings and Morin (Biol. Bull. 1969. 137: 402) and named as green fluorescent protein (GFP). In 1992, the GFP gene was cloned and GFP was a monomer with a molecular weight of 27 kDa and consisted of 238 amino acids (Prasher et al., Gene 1992, 111, 229-233). The three-dimensional structure of GFP is a cylindrical structure surrounded by 11 β-sheets around one α-helical (Chalfie, Photobiol. 1995. 62: 651-656). It also stably exists in neutral buffer at 64 ° C and is very stable at pH 5.5 to 12 (Morise, Biochemistry 1974. 13: 2656-2662). GFP acts as an energy transfer receptor that carries the energy of the calcium-activated photoprotein or luciferase-oxyluciferin complex and acts as a secondary fluorescent protein that emits green fluorescence at 508 nm by receiving energy from these aequorins (Inouye et al. FEBS Lett. 1994. 341: 277-280).

The fluorescence of GFP comes from the covalently attached chromophore and the chromophore of GFP corresponds to the serine-trypsin-glycine residue, which is the 65th, 66th and 67th amino acids (Prasher et al., Gene 1992. 111, 229-233; Cody Biochemistry 1993, 32: 1212-8). Fluorescent proteins are now known to emit fluorescence in a variety of colors, most of which are made by mutagenesis from the GFP gene. GFPs are divided into 7 types according to the chromophore configuration, and the excitation and emission wavelengths of each GFP are different (Tsien, Annu. Rev. Biochem. 1998. 67: 509-544). For example, the eGFP described in the examples is a green fluorescent protein in which the 64th amino acid phenylalanine of GFP is leucine and the 65th amino acid serine is threonine, and has a maximum excitation wavelength of 488 nm And a maximum emission wavelength of 507 to 509 nm. eGFP is the most widely used fluorescent protein among reporter genes because it exhibits 5 to 6 times stronger green fluorescence than conventional GFP (Tsien, Annu. Rev. Biochem. 1998. 67: 509-544).

As described above, the greatest merit of the GFP gene as a reporter gene is to confirm the expression of the gene in living cells without sacrificing the cell. In order to confirm the expression of the GFP gene, a different cofactor, I do not need a substrate. However, the GFP gene can not be used for time-course experiments because it has to sacrifice cells to quantify its expression.

The follicle-stimulating hormone (FSH) is a glycoprotein hormone produced in the anterior pituitary gland. It consists of an α subunit made from the CGA (coding for the alpha subunit of glycoprotein hormones) gene and a β subunit made from the FSHB gene. The α subunit expressed from the CGA gene is identical to the α subunit of LH (luteinizing hormone), TSH (Thyroid-stimulating hormone), which is produced in the anterior pituitary gland, and the β subunit expressed from FSHB is a part of the physiological characteristics of FSH . The FSHB gene expresses one polypeptide consisting of 130 amino acids. From the N-terminus to the 20th amino acid, a signal sequence that secretes the protein out of the cell. A protein consisting of 110 amino acids 21 to 130 is a protein that constitutes FSH (Gharib et al., DNA 1989. 8: 339- 349).

Therefore, the inventors of the present invention have anticipated that a recombinant protein that secretes GFP expressed intracellularly by the recombination of GFP with the signal sequence of FSHB can be produced. As a result, the present inventors have completed the present invention.

Anal Biochem 1990. 188: 245-254 J. Cell Comp. Physiol. 1962. 59: 223-239 J. Cell Comp. Physiol. 1962. 60: 85-104 Biol. Bull. 1969. 137: 402 Gene 1992, 111, 229-233 Photobiol. 1995. 62: 651-656 Biochemistry 1974. 13: 2656-2662 FEBS Lett. 1994. 341: 277-280 Biochemistry 1993. 32: 1212-8 Annu. Rev. Biochem. 1998. 67: 509-544 DNA 1989. 8: 339-349

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made to solve the above-mentioned problems of the prior art, and it is an object of the present invention to provide a novel fusion protein having fluorescence and secreted out of cells of animal cells, a gene encoding the fusion protein and an expression vector thereof.

It is another object of the present invention to provide a method for quantitatively analyzing the expression of a protein or a gene using the expression vector as a reporter.

In order to accomplish the above object, the present invention relates to a recombinant protein of a green fluorescent protein (GFP) or a modified protein thereof and a rat FSHB signal protein, which is secreted outside the cell and exhibits fluorescence.

In the following examples, the 64th amino acid phenylalanine in the GFP is leucine, the 65th amino acid serine is threonine-modified eGFP, and the protein of SEQ ID NO: 2, which is a recombinant protein of the FSHB signal protein Hereinafter, the term " sGFP ") has been described as an example. However, the 64th amino acid and the 65th amino acid affect the chromophore function and are independent of the recombination site. It is natural that a protein can be produced. In the modified GFP, a part of the GFP is replaced with another amino acid, and it does not necessarily represent green fluorescence. BFP (blue flurescent protein), CFP (cyan flurescent protein), YFP (yellow flurescent protein), etc. (Tsien, 1998. Annu. Rev Biochem. 67: 509-544). The recombinant protein of the present invention is characterized by the fluorescence characteristic of GFP and secreted outside the cell upon its expression.

The present invention also relates to a gene encoding the recombinant protein. The signal protein gene of the rat FSHB gene is produced by synthesis and is produced by treating the gene of GFP or its modified protein with restriction enzyme and DNA ligase under conditions generally known in the art and recombining it by site- Respectively.

The present invention also relates to an expression vector comprising a gene sequence encoding said recombinant protein. In the following example, a retrovirus vector derived from murine leukemia virus (MLV) was used as an expression vector for expressing a gene of a recombinant protein. The retroviral vector system is genetically stable compared to other foreign gene transfer systems, and only a single gene that is not repeated when the foreign gene is inserted into the target cell's genome is selectively introduced into the true chromosomal region, It has the advantage of being able to infect various kinds of foreign genes with high efficiency.

In the following example, pLNGsGW was constructed by combining a DNA fragment of the sGFP gene with a retrovirus vector pLNCXW plasmid as an expression vector of an sGFP gene recombined with a rat FSHB signal protein gene and a GFP gene. In the pLNGsGW, the sGFP gene is located 3 'of the CMV (cytomegalo virus) promoter. To maximize the expression of this gene, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) Respectively. pLNCsGW was deposited with KCTC (KCTC), an international depository institution, Science Route 125, Yusung-gu, Daejeon, on July 10, 2012 under accession number KCTC 12240BP.

Transformation of an animal cell with an expression vector of the present invention is carried out using a retrovirus obtained by transferring and expressing an expression vector into a packaging cell. Transformation of animal cells using pLNCsGW was successfully performed and it was confirmed that sGFP was expressed in the cells and secreted into the culture medium through the cell membrane after fluorescence detection or western blot in the transformed cells and culture solution . Therefore, the expression of the protein or gene can be effectively analyzed using the recombinant expression vector of the present invention as a reporter, and the expression analysis can be performed not only by the cell or the tissue itself, but also by analyzing the culture medium of the cell or tissue have. Therefore, in the analysis of expression, for example, it is not necessary to sacrifice the cells by a method such as crushing, and the expression amount thereof can be analyzed using a protein secreted from the cell in a living state.

As described above, the recombinant protein of the present invention has the characteristic of GFP and emits green fluorescence intrinsically under irradiation with light having a wavelength of 480 nm. Since the recombinant protein of the present invention is secreted through the cell membrane when expressed, the recombinant protein gene of the present invention is used as a reporter gene , It is possible to observe its expression simply by irradiating ultraviolet rays of long wavelength in living cells, tissues or animals. In addition, it can be used for time-course experiments because the amount of expression can be quantified in the living state of cells without destroying the cells.

Brief Description of the Drawings Fig. 1 is a schematic flow chart showing the production process of a pLNCsGW vector. Fig.
Figure 2 shows a cleavage map of the plasmid pLNCsGW.
Figure 3 is a fluorescence microscope photograph of animal cells and cell lysates and culture transformed with LNCsGW or LNCGW retrovirus.
4 is a graph quantifying the amount of GFP expressed in animal cells transformed with LNCsGW or LNCGW retrovirus.
Figure 5 is a Western blot photograph of GFP expressed in animal cells transformed with LNCsGW and LNCGW retrovirus.

BRIEF DESCRIPTION OF THE DRAWINGS The invention will be described more fully hereinafter with reference to the accompanying drawings, However, the drawings and the embodiments are only illustrative of the contents and scope of the technical idea of the present invention, and the technical scope of the present invention is not limited or changed. It will be apparent to those skilled in the art that various changes and modifications can be made within the scope of the technical idea of the present invention based on these examples.

Example 1 Construction of Retroviral Vectors for sGFP Expression

The sGFP gene is a recombinant gene designed to have the nucleotide sequence of SEQ ID NO: 1 by fusing the cDNA sequence (GenBank No. M36804.1) of the signal protein in the follicle stimulating hormone beta polypeptide (FSHB) to be.

The plasmid pGEM-11Zf-sGFP containing the sGFP gene was constructed from pGEM-Teasy-eGFP cloned by PCR reaction with pGEM-11Zf-rFSHBs plasmid in which the signal protein gene sequence of rat FSHB was synthesized and ligated. Construction of pGEM-11Zf-sGFP plasmid was performed by a general DNA cloning method.

First, the DNA strands of SEQ ID NOS: 3 and 4 including the complementary sequence of the FSHB signal protein gene sequence of the rat were synthesized, respectively, and complementary binding was performed to complete the DNA double strand. The DNA strands of SEQ ID NOS: 3 and 4 were designed to have a sticky end composed of four bases at each end after double-stranded binding. The pGEM-11Zf-rFSHBs plasmid was constructed by ligation of the double-stranded DNA having the sticky end with pGEM-11Zf plasmid vector (Promega, USA) which was treated with Not I and Sal I restriction enzyme.

SEQ ID NO: 3:

5'-GGCCGCATGATGAAGTCGATCCAGCTTTGCATCCTACTCTGGTGCTTGAGAGCAGT CTGCTGCCATATGACGCGTG-3 '

SEQ ID NO: 4:

5'-TCGACACGCGTCATATGGCAGCAGACTGCTCTCAAGCACCAGAGTAGGATGCAAA GCTGGATCGACTTCATCATGC-3 '

The eGFP gene to be ligated to the 3 'position of the rat FSHB signaling protein gene was amplified by PCR using the pEGFP-N1 plasmid (Clontech, USA) as a template and primers of SEQ ID NOS: 5 and 6, ProGema, USA) to complete the pGEM-Teasy-eGFP plasmid. After that, the pGEM-Teasy-eGFP vector was subjected to DNA sequencing to confirm the eGFP gene.

SEQ ID NO: 5: 5'-CATATGGTGAGCAAGGGCGAGGA-3 '

SEQ ID NO: 6: 5'-ACGCGTTTACTTGTACAGCTCGTCCA-3 '

The above-prepared pGEM-Teasy-eGFP plasmid was treated with restriction enzymes Nde I and Mlu I to obtain a DNA fragment of eGFP gene and ligated with the same restriction enzyme-treated pGEM-11Zf-rFSHBs plasmid to complete pGEM-11Zf-sGFP To thereby clone the sGFP gene.

pGNC -11Zf-sGFP and pLNCXW to construct the pLNCsGW retrovirus vector for expression of sGFP gene. First, pLNCXW was constructed by introducing WPRE sequence to maximize gene expression in pLNCX (Clontech, USA). The pCDF1-MCS2-EF1-Puro (System Biosciences, USA) was treated with Kpn I, T4 DNA polymerase and Hind III in order to obtain a blunt-end tertiary and sticky end A DNA fragment of about 1.5 Kb containing the WPRE sequence with the terminal region and the puromycin resistance gene sequence was isolated. This was treated with Cla I and T4 DNA polymerase and Hind III, and ligated with pLNCX, which had the same terminal shape as the former. Hind III and Sal I were simultaneously treated to remove unnecessary DNA fragments including the puromycin resistance gene sequence except the WPRE sequence from the recombinant plasmid. Hind III, Not I, Hpa I and Sal I sequences were synthesized and ligated to complete pLNCXW. Since, pGEM-11Zf-sGFP the restriction enzyme Not I and then treated with Sal I obtained sGFP gene DNA fragment was mixed with retroviral vector pLNCXW treated with the same restriction enzymes and ligation was complete pLNCsGW which the sGFP gene inserted (Fig. 1).

FIG. 1 is a schematic flow chart showing a cloning process of a recombinant gene sGFP that secretes eGFP into the cell and a process of producing the expression vector pLNCsGW vector, and the cleavage map of the plasmid pLNCsGW is shown in FIG.

The expression vector pLNCsGW was deposited with KCTC (International Collection Service for Type Cultures, KCTC) on July 10, 2012 and received the deposit number KCTC 12240BP.

As a control, pGFP-N1 was digested with restriction enzymes Hind III and Not I to obtain eGFP DNA fragments, and ligated with the same restriction enzyme-treated retroviral vector pLNCXW to prepare pLNCGW containing the eGFP gene. The eGFP gene that this vector expresses is a unique eGFP gene that is not secreted out of the cell.

Example 2 Establishment of an Antibiotic Resistant Animal Cell Line Transformed by LNCsGW and Expression of sGFP

The retroviral vector, pLNCsGW, was transfected and expressed in PT67 packaging cells (Clontech, USA) and cultured for 2 weeks with a selection solution containing G418 (800 / / ml). Viral stock harvested from PT67 cells surviving the G418-containing selection solution was infected to GP2-293 (Clontech, USA) cells and screened for 2 weeks with a selection solution containing G418 (800 μg / ml). Of 20 ㎍ the calcium phosphate method for the screening G418- resistant cells GP2-293-LNCsGW pVSV-G (Clontech, USA) and plasmid expression vector transition and 37 ℃, 5% CO ₂ conditions after 8 hours of incubation in culture medium to a new I changed it. After 48 hours, the culture containing the retrovirus was harvested.

The harvested culture was filtered through a cellulose acetate filter having a pore size of 0.45 mu m, and then the culture medium containing the virus was used as a culture medium containing bovine fetal fibroblast (BEF), chicken embryo fibroblast (CEF), human cervical cancer cell HeLa cells , NIH3T3 cells in rat fibroblasts, and fetal fibroblasts (PFF) in pigs, respectively. Each infected cell was selected for 2 weeks with a selective solution containing G418 (800 / / ml) to establish an antibiotic resistant cell line.

In addition, LNCGW-transforming antibiotic-resistant cell lines were established in the same manner as above except that pLNCGW retrovirus vector was used instead of pLNCsGW as a control group.

Each established cell line was observed with a fluorescence microscope, and the cell lysate and the culture solution were observed in a tube through a 535/40 emission filter while irradiating light of about 480 nm. 3 is a fluorescence microscope photograph of each animal cell transformed by LNCGW or LNCsGW, and II is a fluorescence photograph of cell lysates and cell media. In FIG. 3, N represents normal cells, G represents cells transformed by LNCGW, and sG represents cells transformed by LNCsGW.

As shown in FIG. 3, GFP expression in the cytoplasm was more strongly observed in the LNCGW transformed cell line, and the fluorescence of GFP contained in the cell lysate was also detected in the LNCsGW transformed cell lines of about 0.09-0.22 / / 100 단백질 protein While 1.1 ~ 7.1 ㎍ / 100 ㎍ protein was detected in LNCGW transformed cell lines, and was more strongly released in LNCGW cell lines. However, the fluorescence of GFP contained in the cell culture medium was more strongly released in the LNCsGW cell lines (1.3 ~ 6.8 / / ml), indicating that the sGFP gene was expressed and secreted through the cell membrane. In each cell transformed with the control LNCGW retrovirus, about 0 ~ 0.35 ㎍ / ㎖ of GFP was quantified.

Example 3 Quantitative Analysis of GFP Expressed in LNCsGW Transformed Animal Cells and Western Blot

The amount of GFP expressed from each cell in Example 2 was measured with a TwinkleTM LB 970T fluorometer (Berthold technologies, Germany) equipped with an excitation filter F485 and an emission filter F535 using a GFP Quantification Kit (BioVision, USA).

In Example 2, the culture solution was separated by centrifugation for 1 x 10 ⁶ animal cells in the cell culture transformed with LNCGW or LNCsGW. After the culture broth was separated, 0.25 ml of assay buffer was added, and the cells were resuspended and pulverized to prepare a sample for cell lysate. The content of eGFP in the cell lysate samples was determined by Bradford protein analysis, and the content of eGFP contained in the total protein content of 100 ㎍ was measured. The cell culture medium was added with 100 μl of each cell culture solution to measure eGFP content. FIG. 4 is a graph showing the results of measurement of eGFP content in each cell lysate and cell culture medium.

As shown in FIG. 4, the eGFP content measured in the cell lysate was about 6 to 60 times larger than that of the LNCGW transformed cells in the LNCsGW transformed cells, and the GFP content in the cell culture medium Conversely, much higher amounts of LNCsGW cells were found than in LNCGW transformed cells by a factor of several tens of times. Since GFP expressed in cells transformed with LNCGW, which is a control, is not secreted extracellularly, green fluorescence intensifies only intracellularly, and GFP expressed in cells transfected with LNCsGW is expressed in cells and secreted into culture medium It can be interpreted that the green fluorescence in the cells did not appear as strong as the control. In other words, eGFP is a protein present in the cytoplasm, while sGFP is a protein secreted into the culture medium through the cell membrane.

The cell lysate and the cell culture prepared by the above method were also subjected to Western blotting. More specifically, each cell lysate was used at a total protein content of 10 μg, and 10 μl of the cell culture was used. Each sample was electrophoresed on a 12% SDS-polyacrylamide gel at a voltage of 80 V and transferred to polyvinylidene fluoride (PVDF) membrane using a Trans-Blot SD semi-dry transfer cell (Bio-Rad, USA). Protein-transferred membranes were blocked with 0.1% Tween-20 blocking solution containing 5% skim milk for 1 hour. The anti-eGFP antibody (Clontech, USA) and α-tubulin (Abcam , USA) for 16 hours. The membrane was washed three times with TBS-T containing 0.1% tween-20, and HRP-conjugated goat anti-mouse IgG (Pierce, USA) was diluted in blocking buffer at 1: 3,000 for 1 hour. The reacted membrane was washed with TBS-T 3 times, exposed to X-ray film, and developed with SuperSignal West Pico Substrate (Pierce, USA). 5 is a Western blot photograph of GFP expressed in animal cells transformed with LNCsGW and LNCGW retrovirus. In FIG. 5, reGFP means a sample of recombinant eGFP, 1 is a normal cell, 2 is a cell transformed with the retrovirus LNCGW and 3 is a cell transformed with LNCsGW.

The Western blot of FIG. 5 also showed that the GFP expressed in the LNCGW animal cells was not secreted extracellularly, so that only the protein content in the cell showed a blot. The LNCsGW transformed cells showed weak spots in the cell solution, The spots appeared stronger and appeared similar to the previous results.

Korea Biotechnology Research Institute KCTC12240BP 20120710

<110> CATHOLIC UNIVERSITY OF DAEGU INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Extracellular Secreted GFP Gene and Vector Expressing the Gene <130> P0812-352 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 780 <212> DNA <213> Artificial Sequence <220> <223> Recombinant DNA <400> 1 atgatgaagt cgatccagct ttgcatccta ctctggtgct tgagagcagt ctgctgccat 60 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 120 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 180 ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 240 ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 300 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 360 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 420 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 480 aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 540 ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 600 gccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 660 tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 720 ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 780                                                                          780 <210> 2 <211> 259 <212> PRT <213> Artificial Sequence <220> <223> Recombinant Protein <400> 2 Met Met Lys Ser Ile Gln Leu Cys Ile Leu Leu Trp Cys Leu Arg Ala   1 5 10 15 Val Cys Cys His Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val              20 25 30 Val Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe          35 40 45 Ser Val Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr      50 55 60 Leu Lys Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr  65 70 75 80 Leu Val Thr Thr Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro                  85 90 95 Asp His Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly             100 105 110 Tyr Val Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys         115 120 125 Thr Arg Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile     130 135 140 Glu Leu Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His 145 150 155 160 Lys Leu Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp                 165 170 175 Lys Gln Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile             180 185 190 Glu Asp Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro         195 200 205 Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr     210 215 220 Gln Ser Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val 225 230 235 240 Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu                 245 250 255 Leu Tyr Lys             <210> 3 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleoside <400> 3 ggccgcatga tgaagtcgat ccagctttgc atcctactct ggtgcttgag agcagtctgc 60 tgccatatga cgcgtg 76 <210> 4 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleoside <400> 4 tcgacacgcg tcatatggca gcagactgct ctcaagcacc agagtaggat gcaaagctgg 60 atcgacttca tcatgc 76 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 catatggtga gcaagggcga gga 23 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 acgcgtttac ttgtacagct cgtcca 26

Claims (9)

delete delete delete delete delete delete A recombinant expression vector comprising the gene sequence of SEQ. ID. NO. 1 encoding a protein expressing fluorescence, and the plasmid form being pLNCsGW (KCTC 12240BP).
Wherein the expression of the protein or gene in the animal cell or tissue is analyzed using the recombinant expression vector of claim 7 as a reporter.
9. The method of claim 8,
Wherein the expression analysis is performed by analyzing a culture medium of cells or tissues.

Images