KR100500283B1 - Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition Comprising Same - Google Patents

Abstract

The present invention provides a humanized monoclonal polypeptide having specificity to a human 4-1BB molecule prepared by humanizing a mouse monoclonal antibody against a human 4-1BB molecule, an antibody linked to a constant region thereof, and an autoimmune disease treatment comprising the same. The present invention relates to a pharmaceutical composition for use in immunosuppression or immunosuppression, wherein the humanized monoclonal polypeptide of the present invention and an antibody linked to a constant region thereof have a binding affinity for human 4-1BB and have a sequence similar to that of human antibodies. It can be effectively used as a therapeutic agent or an immunosuppressive agent without side effects.

Description

Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition Comprising Same}

The present invention relates to a novel autoimmune disease (autoimmune disease) treatment or immunosuppressive composition, and more specifically, human 4-1BB for treating typical rheumatoid arthritis and lupus erythematosus among autoimmune diseases A novel humanized monoclonal polypeptide specific for and a pharmaceutical composition for treating or immunosuppressing autoimmune diseases comprising the same.

Initiation of the human immune response depends on the recognition of protein antigens by T cells. However, T cells are unable to recognize antigens alone, and are associated with major histocompatibility complexes (MHCs) on the surface of antigen presenting cells such as B cells, macrophages, and the like. Only when the antigen is in the complex can trigger an immune response.

MHC class I molecules trigger killer T cell responses to destroy cells with antigens, and MHC class II molecules trigger helper T cell responses to regulate the growth of selected B cells and the activation of macrophages. One of the important functions of this immune system is the ability to discriminate and recognize self-antigens from foreign antigens. This distinction is necessary for the immune system to respond to invading external pathogens, while maintaining resistance to magnetic proteins so as not to harm normal tissues.

Autoimmune diseases are disorders in which self-tolerance is destroyed so that the immune system responds to self tissues such as the joints of rheumatoid arthritis. Another example is lupus erythematosus. Prevention of autoimmune diseases with maintenance of resistance depends absolutely on the function of the MHC molecule.

The fact that several autoimmune diseases are related to the inheritance of certain MHC alleles suggests that MHC plays an important role in autoimmune diseases. For example, insulin dependent diabetes is associated with HLA-DR3 and / or HLA-DR4, Hashimoto thyroiditis is associated with HLA-DR5, and chronic inflammatory arthritis is associated with HLA-DR4w14 and / or HLA-DR1. It is related.

MHC molecules involved in autoimmune diseases are thought to be involved in autoimmune reactions by binding to specific autoantigens and expressing them to T cells.

Can bind to, interfere with the binding of MHC molecules involved in autoimmune diseases, remove autologous antigens already bound, inhibit T cell activation or increase the activity of protective T cells (Th 2 cells) Peptides may inhibit autoimmune responses mediated through the MHC molecule.

While these types of drugs provide treatment for autoimmune diseases, their use is limited because they have side effects that interfere with the suppression of the normal immune system. In addition, MHC and the number of autoantigens that respond to it, and because there are many kinds of specific peptides for this too many types are not suitable as a therapeutic agent.

Peptides that bind to MHC molecules and inhibit T cell activity are described in International Patent Applications WO 92/02543, WO 93/05011 and WO 95/07707. Although many molecules have been found that bind to HLA-DR molecules and inhibit T cell activation, there is a continuing need for alternative compounds that inhibit or modify autoimmune reactions with other compounds or other mechanisms that bind to such molecules. .

4-1BB is a costimulatory molecule that is expressed on the surface of activated T cells, delivers a survival signal to CD8 T cells, induces CD8 T cell proliferation and cytotoxic T cell responses. It is known to be involved. Therefore, in the present invention, in order to suppress cytotoxic T cells activated by self-recognizing self antigens in organ transplantation or autoimmune diseases, anti-h4 is a humanized monoclonal polypeptide having a sequence similar to that of human antibodies. Hu4785-2 in the form of -1BB ScFv and Hu4785-2H / Hu4785-2K in the form of H2L2 linked to the constant region were prepared and studied for the possibility of treatment or immune suppression of autoimmune diseases.

As a result, the humanized monoclonal polypeptides Hu4785-2 and Hu4785-2H / Hu4785-2K according to the present invention were confirmed to have specificity and high binding affinity to human 4-1BB molecules, thereby completing the present invention.

It is therefore an object of the present invention to provide humanized monoclonal polypeptides which are specific for human 4-1BB (h4-1BB) molecules, have high binding affinity and are in anti-h4-1BB ScFv form.

It is also an object of the present invention to provide an antibody in which a constant region is linked to the humanized monoclonal polypeptide.

Another object of the present invention to provide a pharmaceutical composition for treating or immunosuppressive autoimmune disease, comprising the humanized monoclonal polypeptide.

In order to achieve the above object, the present invention has an amino acid sequence of SEQ ID NO: 5 corresponding to a heavy chain variable region (VH), a linker and a light chain variable region (VL), human 4 Provided are humanized monoclonal polypeptides specific for a -1BB molecule.

The present invention provides humanized monoclonal polypeptides specific for human 4-1BB molecules having amino acid sequences of SEQ ID 40 and SEQ ID 42 respectively.

The present invention also provides a pharmaceutical composition for treating autoimmune diseases and a pharmaceutical composition for immunosuppression, comprising the humanized monoclonal polypeptide as an active ingredient.

Hereinafter, the present invention will be described in detail.

The present invention has an amino acid sequence of SEQ ID NO: 5 corresponding to heavy chain variable region (VH), linker and light chain variable region (VL), and has specificity for human 4-1BB molecule. And a humanized monoclonal polypeptide Hu4785-2 in the form of an anti-h4-1BB single-chain fragment variable (ScFv).

Humanized monoclonal polypeptides of the invention can be prepared by humanizing mouse 4785 monoclonal antibodies against 4-1BB in which the heavy and light chains have amino acid sequences of SEQ ID NOs: 1 and 2, specifically, antigen binding of variable regions The region of complementarity determining regions (CDRs) and canonical residues match the sequence of mouse monoclonal antibodies, and the sequence between the heavy and light chains of the framework region (FR) is a mouse antibody. And specific sequences match those of human antibodies, and solvent-exposed residues are designed to match those of mouse antibodies.

Among the humanized monoclonal polypeptides of the present invention prepared as described above, Hu4785-2, which has been shown to have the highest affinity with human 4-1BB, has an amino acid sequence of SEQ ID NO: 5, which is represented by SEQ ID NO: 6 Cell line TG1 / Hu4785-2, which can be encoded by the nucleotide sequence of the present invention and produces the humanized monoclonal polypeptide Hu4785-2 of the present invention, was deposited on November 12, 2002 to the Bank of Biotechnology Gene Bank (KCTC). Deposited as KCTC 10365BP.

In addition, the present invention provides a DNA sequence encoding the Hu4785-2 monoclonal polypeptide, and preferably provides a nucleotide sequence of SEQ ID NO: 6.

The present invention also provides a plasmid Hu4785-2 / pCANTAB 5E (Accession No .: KCTC 10365BP) encoding the humanized monoclonal polypeptide Hu4785-2.

Humanized monoclonal polypeptide Hu4785-2, ScFv form of the present invention, has affinity with 4-1BB molecules about 1000 times higher than mouse 4785, and humanized ScFv has the same biological effect as the original monoclonal antibody in competitive ELISA experiments. By expressing the composition as an active ingredient, it is possible to prevent the interaction between 4-1BB and 4-1BB ligand, inhibiting cytotoxic T cells activated by self-antigens that recognize self in organ transplantation or autoimmune disease. Applicable to

Humanized monoclonal polypeptides in the ScFv form are linked to VH, linker, and VL. ScFv is artificially linked to the neutral linker and is expressed as a single strand of polypeptide. The -Linker-VL ScFv protein has 15 amino acid linkers (Gly ₄ Ser) ₃ . Such a flexible peptide linker is specifically designed to form a bridge of 3.5 nm distance between the carboxy-terminus of the VH chain and the amino terminus of the VL chain. This structure can promote chain pairing and minimize aggregation or refolding that occurs when two chains are expressed, respectively. ScFv with (Gly ₄ Ser) ₃ residues is the same as the original antibody in terms of affinity and stability.

The constant region of the antibody (Constant region) by connecting the two heavy chains and two light chains to form a complete antibody form of H2L2 form, the effect can be maximized.

The present invention also provides a humanized monoclonal polypeptide Hu4785-2H / Hu4785- having amino acid sequences of SEQ ID NO: 40 and SEQ ID NO: 42, specific for human 4-1BB molecules, and having the anti-h4-1BB H2L2 form. Provide 2K.

Hu4785-2H / pcDNA produced by linking the leader sequence and the constant region of human IgG1 to the VH of the humanized monoclonal polypeptide Hu4785-2 of the present invention and subcloning into a eukaryotic expression vector, Hu4785-2H when expressed in a eukaryotic cell line. And the polypeptide has an amino acid sequence of SEQ ID NO: 40 and is encoded by the nucleotide sequence of SEQ ID NO: 41.

Cell line XL-1 Blue / Hu4785-2H with the plasmid Hu4785-2H / pcDNA producing the humanized monoclonal polypeptide Hu4785-2H of the present invention was deposited on March 6, 2003 to the Institute of Biotechnology Gene Bank (KCTC). Deposited as No. KCTC 10440BP.

Hu4785-2K / pcDNA produced by linking the VL leader sequence of the humanized monoclonal polypeptide Hu4785-2 and the human kappa chain sequence of the present invention and subcloning into a eukaryotic expression vector produces Hu4785-2K when expressed in a eukaryotic cell line. This polypeptide has an amino acid sequence of SEQ ID NO: 42 and is encoded by a nucleotide sequence of SEQ ID NO: 43.

Cell line XL-1 Blue / Hu4785-2K with the plasmid Hu4785-2K / pcDNA producing the humanized monoclonal polypeptide Hu4785-2K of the present invention was deposited on March 6, 2003 to the Institute of Biotechnology Gene Bank (KCTC). Deposited as KCTC 10441BP.

The present invention also provides a DNA nucleotide sequence encoding the Hu4785-2H / Hu4785-2K monoclonal polypeptide, and preferably provides the nucleotide sequences of SEQ ID NO: 41 and SEQ ID NO: 43.

In addition, the invention comprises a humanized monoclonal polypeptide Hu4785-2 and comprises a plasmid Hu4785-2H / pcDNA (Accession No .: KCTC 10440BP) and a humanized monoclonal polypeptide Hu4785-2 for expressing the antibody heavy chain constant region. Plasmid Hu4785-2K / pcDNA (Accession No .: KCTC 10441BP) for expressing the light chain constant region is provided.

The composition containing the humanized monoclonal polypeptide Hu4785-2H / Hu4785-2K of the H2L2 form as an active ingredient may be applied to inhibit cytotoxic T cells activated by autoantigens that recognize self in organ transplantation or autoimmune diseases. Can be.

ScFv has one binding site, but H2L2 forms two binding sites, so that more effective binding occurs. ScFv forms a non-existent human body, so H2L2 forms in the body have lower antigenicity. In addition, IgG1, an isotype of a constant region of humanized Hu4785-H2L2, binds to cells and then fixes complement, resulting in a reaction that kills cytotoxic T cells bound to Hu4785-H2L2 antibody. It specifically kills cytotoxic T cells activated by self-recognized self antigens in organ transplantation or autoimmune diseases, thereby causing self-reactive cytotoxic T cells that cause organ transplant rejection and autoimmune reactions. T cell) can be removed completely. Therefore, conversion to H2L2 form is preferred.

Therefore, the humanized monoclonal polypeptides of the present invention have high binding affinity for human 4-1BB and have sequences similar to those of human antibodies, so that they can be effectively used without side effects as therapeutic agents for autoimmune diseases or immunosuppressive agents for organ transplant rejection. Can be.

The present invention provides a pharmaceutical composition for treating autoimmune diseases comprising a humanized monoclonal polypeptide Hu4785-2 or Hu4785-2H / Hu4785-2K as an active ingredient.

The present invention also provides a pharmaceutical composition for immunosuppression for preventing and treating rejection in organ transplantation comprising the humanized monoclonal polypeptide Hu4785-2 or Hu4785-2H / Hu4785-2K as an active ingredient.

The autoimmune diseases include rheumatoid arthritis, chronic inflammatory arthritis, lupus erythematosus, Shogran syndrome, thyroid diseases such as thyroiditis due to autoimmunity, autoimmune diabetes, and the like.

To this end, the composition comprising the humanized monoclonal polypeptide of the present invention as an active ingredient further comprises a suitable carrier, excipient and diluent commonly used in the manufacture of pharmaceutical compositions for the treatment or suppression of autoimmune diseases. It may be prepared as a pharmaceutical composition.

Carriers, excipients and diluents that may be included in a composition comprising a humanized monoclonal polypeptide of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate , Gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention may further include a disintegrant, a sweetener, a lubricant, a flavoring agent, and the like, which are commonly used, and may be in a unit dosage form such as a preparation for oral administration or a preparation for parenteral administration by a conventional method or It may be formulated into several dosage forms.

Compositions comprising the humanized monoclonal polypeptides according to the present invention may be prepared in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injectable solutions, respectively, according to a conventional method. Formulated in the form of can be used.

The amount of the humanized monoclonal polypeptide of the present invention may vary depending on the purpose of use, the age, sex and weight of the patient, but the amount of 0.01 to 5 mg / kg, preferably 0.1 to 0.5 mg / kg once or several times a day. May be administered. In addition, the dosage level for a particular patient may be increased or decreased depending on the specific antibody to be used, route of administration, time of administration, excretion rate, health condition, severity of disease, sex, weight, age, diet, and the like. Therefore, the above dosage does not limit the scope of the present invention in any aspect.

Hereinafter, the present invention will be described in more detail with reference to the following examples. only. The following examples are only for illustrating the present invention, but the scope of the present invention is not limited thereto.

Example 1: Preparation of 4-1BB

(Step 1) Preparation of hybridoma cell line

CDNA encoding human 4-1BB molecule (Ulsan University Immune Control Research Institute, Professor Kwon Byung-se) and DNA (Glutathione S Transferase (GST)) that encode the glutathione binding site (Pharmacia LKB Biotechnology Co., Ltd.) by combining the pGEX3 expression vector ( Pharmacia LKB Biotechnology). The extracellular site of human 4-1 BB and GST were combined and added to pGEX3. E. coli (Top1, Stratagene) was transformed with this vector, and then a single colony of transformed E. coli was inoculated in 1 × LB and shaken at 37 ° C. for 12 hours. The culture was inoculated in 1 × LB 1/100 volume and shaken at 37 ° C. for 3 hours. After treatment with 0.1 mM IPTG, shaking culture at 25 ° C. for 5 hours to induce the expression of 4-1BB-GST fusion protein, and then put the culture medium into a glutathione Sepharose-4B column (Pharmacia LKB Biotechnology). The 4-1BB-GST fusion protein was purified by eluting with phosphorus 0.5M glycine-HCl.

(Step 2) Immunity

20 μg of 4-1BB-GST fusion protein was mixed with 0.1 ml of Freund complete adjuvant and injected intraperitoneally of Balb / c mice 4-8 weeks old to minimize immunity. Thereafter, 20 µg of 4-1BB-GST fusion protein was mixed with 0.1 ml of Freund's incomplete adjuvant and immunized by intraperitoneal injection twice at three weeks intervals. After 3 days from the last day of immunization, a small amount of blood was collected from the tail, and the titer of the desired antibody was measured by enzyme-immunoassay. When the immunity was above a certain level, spleens were extracted from the mice and splenocytes were used for fusion.

(Step 3) Cell Fusion

Splenocytes from immunized mice were mixed 1: 2 with SP2 / 0-Ag14 myeloma cells (ATCC CRL 1581) and fused using 50% polyethylene glycol 4000 (Gibco BRL) (Mishell and SHiigi, Seledted Methods). in Cellular Immunology, WH Freeman Company, 1980).

To screen for hybridoma cell lines, the fused cell mixture was resuspended in HAT medium (15% calf fetal serum, 0.1 mM hypoxanthine, 0.4 μM aminopterin, RPMI 1640 medium supplemented with 16 μM thymidine) and then 3 The cells were placed in a 96-well micro culture tray at a concentration of 10 ⁷ cells / ml and cultured in a 37 ° C cell incubator containing 5% CO ₂ . Since myeloma cells and unfused splenocytes cannot grow well in HAT medium, the cells growing in the medium can be considered to be cells which have been fused. After 6, 7, 8 days half of the cell culture was replaced with fresh cell culture. The cell proliferation was observed using an inverted microscope, and when the cells were sufficiently grown, the supernatant containing the antibody was taken from the 96-well micro culture tray, and ELISA was performed.

(Step 4) Hybridoma Cell Line Selection

The 4-1BB-GST fusion protein was diluted in phosphate buffer (PBS, pH 7.2) and coated on an ELISA plate at a concentration of 200 ng / 0.1 mL. After the coated plate was washed several times with phosphate buffer, phosphate buffer containing 1% bovine serum albumin was added to the plate and left for 1 hour, washed several times with phosphate buffer, and the cell supernatant obtained above was added for 2 hours. Reacted for a while. After completion of the reaction, the plate was washed with phosphate buffer several times, and alkaline phosphatase-bound goat anti-mouse immunoglobulin (Southern Biotech) was diluted 1000-fold and added in an amount of 0.1 ml. After standing for 2 hours, the mixture was washed several times with phosphate buffer, and 0.1 ml of a substrate (p-nitrophenyl disodium salt dissolved in carbonate buffer, 1 mg / ml solution, pH 9.6) was added and stored at room temperature for 10 minutes. The reaction was then measured with an automated microplate recorder, and the hybridoma cell line producing an antibody that specifically acts on the 4-1BB molecule was named 4785 (Accession No .: KCTC 0952BP).

(Step 5) Preparation of antibody using hybridoma cell line

Balb / c mice pretreated with 0.5 ml of prestain (pristane: 2,6,10,14-tetramethylpentadedecane, Sigma) after propagating 1 × 10 ⁷ 4785 cell lines prepared in step 4 in a culture medium The ascites fluid was collected 10 days after injection into the peritoneum. This ascites was subjected to affinity chromatography using a Protein-A Sepharose column (Pharmacia) to separate monoclonal antibodies. The antibody generation rate at this time was 1 mg per 1 ml ascites fluid.

As a result of the measurement using the antibody assay kit, the prepared monoclonal antibody was found to be IgG1 and it was confirmed that it had an isotype of kappa light chain.

Example 2 Cloning of Monoclonal Antibody Genes in Mice

(Step 1) mRNA Extraction of 4785 Cell Lines

Total RNA was extracted from 2 x 10 ⁸ 4785 cells by the following method. First, cell pellets were treated with TriPure Isolation Reagent (Sigma) and extracted once with phenol / chloroform. The supernatant was treated with isopropanol to precipitate RNA, washed twice with 75% ethanol, and then dissolved in distilled water treated with DEPC (Sigma) to obtain total RNA. MRNA extraction from the total RNA obtained was isolated and purified mRNA using the Dynalbeads mRNA purification kit (DYNAL).

(Step 2) cDNA library construction of 4785 cell line

ZAP-cDNA Synthesis Kit (STRATAGENE) and ZAP-cDNA Gigapack III Gold Cloning Kit (STRATAGENE) were used for the production of cDNA libraries of 4785 cell lines.

5 μg of the mRNA obtained in step 1, 2.8 μg of a linker primer having SEQ ID NO: 19 having an XhoI recognition sequence, RNase H ^- reverse transcriptase (40U, Stratagene), a methyl nucleotide mixture (1.25 mM), and an RNase inhibitor (40U, Stratagene) was reacted at 37 ° C. for 1 hour to synthesize the first strand. Subsequently, the second strand was synthesized by using RNase H (3U) and DNA polymerase I (99U, Stratagene) for 2 hours and 30 minutes at 16 ° C. After the reaction, the mixture was extracted with phenol-chloroform, concentrated using ethanol, washed with 70% ethanol, the precipitate was dissolved in water, and the protein was removed using an Ultrafree-Probind filter (SIGMA). Klenow fragment and dNTP were used to smooth the 3 'and 5' ends, and the protein was removed using an ultrapre-probind filter. Subsequently, rATP 2 mM, T4 DNA ligase (2U) was added and reacted at 4 ° C. for 12 hours, and then heated at 70 ° C. for 30 minutes to inactivate Eco RI enzyme. Again rATP 2mM, T4 polynucleotide kinase (10U) was added, and reacted for 30 minutes at 37 ℃ and inactivated for 30 minutes at 70 ℃ to kinase the Eco RI terminal. Subsequently, cleavage using Xho I was followed by removal of the protein using an UltraFree-Probind filter to obtain cDNA. Ethidium bromide plate analysis was used to determine the amount of cDNA. 125 μg of Uni-ZAP XR vector (Stratagene), rATP (1 mM) and T4 DNA ligase (2U) were mixed with 100 ng of cDNA and reacted at 12 ° C. for 12 hours. When the packaging extract (packaging extract, Stratagene) stored at 80 ° C was taken out and dissolved, 2 μl of the linked DNA was added and mixed with a pipette while being careful not to bubble, followed by reaction at room temperature for 2 hours. Here the SM buffer was placed the _{(100mM NaCl, 10mM MgSO 4.} 7H 2 O, 50mM Tris-HCl pH 7.5, 0.01% gelatin) 500㎕, chloroform 20㎕ mixed, then centrifuged and the supernatant transferred to a new tube.

As a host cell, LB medium containing 10 mM magnesium sulfate and 0.2% maltose was obtained from a single colony obtained by E. coli XL-1 blue MRF '(Stratagene Co., Ltd.) and smearing onto LB / tetracycline (50 µg / ml) plate. Was inoculated. It was grown at 37 ° C. with OD ₆₀₀ shaking at 200 rpm, not exceeding 1.0. The culture was centrifuged at 500 x g for 10 minutes to remove the medium and diluted to OD ₆₀₀ to 0.5 by adding 10 mM magnesium sulfate to the cell pellet. Thus prepared host cells can be used for 48 hours when stored at 4 ℃.

1 μl of a packaged reaction diluted in 1/10 was added to 200 μl of host cells, and attached at 37 ° C. for 15 minutes. 3 ml of the top agar cooled to 48 ° C. was vortexed, immediately poured onto a preheated LB agar plate, grown at 37 ° C. for 10 hours, and the number of plaques was counted as pfu / ml. . As a result, 1.9 x 10 ⁵ pfu was obtained.

(Step 3) Screening of Heavy and Kappa Chain Genes

The transformed cell lines obtained in (Step 2) were plated to form about 200-300 plaques each on a 100 mm plate and transferred to a nylon membrane for UV crosslinking. Hybridization was carried out using this membrane. At this time, a fragment of each constant region cloned by PCR was used as a probe for screening heavy and light chain kappa chains. Specifically, the PCR primer for obtaining the heavy chain probe is G-1U: 5'-gaactctggatccctgtcca-3 'of SEQ ID NO: 8 G-1D: 5'-tgcaaggcttacaaccacaa-3 of SEQ ID NO: 8 to obtain the CH1 region of the cDNA of mouse IgG1. Was used to obtain a 200bp PCR product was used as a probe. The light chain probe used K-1U: 5'- atcttcccaccatccagtga -3 'of SEQ ID NO: 10 and K-1D: 5'- cgtccttggtcaacgtga3-3' of SEQ ID NO: 10 to obtain the CH1 region of the mouse kappa chain cDNA. PCR product of 200bp was obtained and used as a probe. Hybridization was performed using an ECL direct nucleic acid labeling and detection kit, and the resulting clones were subjected to plasmids through in vivo excision using an Exassit / SOLR system. And the sequence was confirmed. The amino acid sequences of the heavy chain gene and the kappa chain are shown in SEQ ID NOs: 38 and 39, respectively.

Example 3: Humanization of heavy chain variable region (VH) and light chain variable region (VL) of 4785 clone

Among the human antibody genes, the most similar to the nucleotide sequence of the variable region of the 4785 clone encoding the mouse protein was selected through a database search, and the nucleotide sequence was compared with the nucleotide sequence of 4785 to perform the PCR template for the preparation of the combinatorial antibody library. Used to prepare primers.

The positions of the CDR and FR regions of the heavy and light chains of the 4785 clone were determined, and whether to replace them with amino acid residues in humans or to use the residues in mice were determined according to Table 1 below.

Mouse residues Explanation decision CDR Ig blast (http://www.ncbi.nlm.nih.gov) mouse Canonical residues Chothia canonical assignment (http://www.cryst.bbk.ac.uk/~ubcg07s/) mouse Interchain packing residue mouse N-glycosylation sites human Specific framework residues 5-6 of CDR residues ?? All residues within mouse All other residues human Solvent-exposed residues CDR, canonical, interchain residues mouse All other residues (http://imgt.cines.fr:8104/textes/IMGTrepertoire.html) human

Among the variable region sequences of the heavy and light chains, the CDR region, which is a portion that directly binds to the antigen, is left as the sequence of the mouse, and the canonical residue is present between the heavy and the light chain even if the sequence exists in the mouse sequence and the FR region. The sequence to be referred to was mouse, the specific sequence to human sequence, and the solvent-releasing residue to mouse residue.

Based on this, the humanized nucleotide sequence of the 4785 clone was determined, and the amino acid sequence obtained according to this law and the amino acid sequence of the human template were compared and shown in FIGS. 1 and 2.

Example 4 Determination of Humanized 4785 VH and VL Sequences

4785 VH combinations having the sequences of SEQ ID NOs: 11 to 23 based on amino acid sequences obtained by comparing the nucleotide sequences of the heavy and light chains of the 4785 clone with the nucleotide sequences of the human template to prepare the inserts for making the combinatorial antibody library 4785 VL combinatorial primers were prepared having a primer and a sequence of SEQ ID NOs: 24-34.

Using the primers thus prepared as templates and primers, PCR of the VH region and the VL region was performed in the order as shown in FIGS. 3 and 4. PCR reactions were pre-denatured 94 ° C., 5 min; 94 ° C., 1 minute; 55 ° C., 1 minute; 72 ° C., 2 minutes; Post-elongation was carried out 35 times at 72 ° C. for 7 minutes. The PCR product thus obtained was separated by purification separation (Qiagen Gel Extraction Kit, Qaigen) to obtain PCR products of humanized VH and VL, each of which is shown in SEQ ID NOs: 3 and 4.

Example 5: Linkage of Combination VH with Combination VL and Addition of Restriction Enzyme Sites

To link VH and VL obtained by PCR into single strands using linker DNA and add enzyme sites to 5'- and 3'-, 50 ng of heavy chain product, 50 ng of light chain product, 4785 VH-Sfi-U of SEQ ID NO: 35 (5 μM) 1 μl, 1 μl 4785 VL-NotI-D (5 μM) of SEQ ID NO: 36, 2 μl of linker primer of SEQ ID NO: 37, 5 μl of 10 × PCR buffer, 2.5 μl of dNTP mixture, 5 μl of 25mM MgCl ₂ And 1T of ExTag (5U, Takara Co., Ltd.) was put into a microcentrifuge tube and PCR was performed by adjusting the total amount to 50 μl with distilled water. PCR reactions were pre-denatured 94 ° C., 5 min; 94 ° C., 1 minute; 55 ° C., 1 minute; 72 ° C., 2 minutes; Post-elongation was carried out 35 times at 72 ° C. for 7 minutes. The PCR product (4785 ScFv DNA) thus obtained was isolated by Qiagen gel extraction kit (QIAGEN).

Example 6: Restriction Enzyme Treatment and Purification of ScFv DNA Inserts

(Step 1) Sfi I cleavage reaction

The total amount of the purified ScFv DNA (ScFv DNA obtained in Example 5) 1㎍, 10 × Sfi reaction buffer (Roche Inc.) 8.5㎕, restriction enzyme Sfi I (10U / ㎕, Roche Inc.) and deionized water is 2㎕ The mixture was mixed in an amount of 85 μl, and 85 μl of mineral oil was added and reacted at 50 ° C. for 4 hours.

(Step 2) Not I cleavage reaction

3M sodium chloride 3.6㎕, 10 × buffer, the ScFv cut with Sfi I prepared in step 1 (Not I reaction buffer: 50mM Tris-HCl, 100mM NaCl , 10mM MgCl 2, 1mM dithioerythritol, pH7.5, Roche Inc.) 1.5㎕, 4 μl of restriction enzyme Not I (10 U / μl, Roche) and tertiary distilled water were mixed in an amount of 15 μl and reacted at 37 ° C. for 4 hours. Extracted with phenol / chloroform and separated by spun-column (Pharmacia Biotech) purification.

Example 7: Quantification and Cloning of ScFv

ScFv DNA was quantified by electrophoresis of 12.5 ng and 25 ng of ScFv markers on a 0.75 cm thick 1% agarose gel followed by electrophoresis with the purified purified ScFv DNA, 150 ng of 4785 ScFv DNA, 5 μl of 10 × OPA buffer, 5 μl of pCANTAB 5E (50 ng / μl, Pharmacia Biotech), 5 μl of 10 mM ATP, 2 μl of T4 DNA ligase (4 U / μl) and tertiary distilled water in an amount such that the total amount is 50 μl. The reaction was allowed to react for hours and the heat inactivation of the ligase at 70 ° C. for 10 minutes, followed by cooling on ice for 5 minutes.

Example 8: Preparation of Competent Cells

Glycerol stock of TG1 E. coli (Pharmacia Biotech) was streaked on a minimal medium plate and incubated overnight at 37 ° C. Single colonies of minimal culture plates were inoculated in 5 ml 2 × YT medium (17 g Bacto-tryptone 17 g, Bacto-yeast extract 10 g, NaCl 5 g in dH ₂ O 1 liter) and incubated at 37 ° C. for 12 hours. 1 ml of the obtained culture was inoculated in 100 ml of 2 x YT medium, and cultured until the OD ₆₀₀ reached 0.4 to 0.5 with stirring at 250 rpm. Subsequently, centrifugation at 4 ° C., 2500 × g for 15 minutes, and the cell precipitate was washed with 10 ml of cold TSS (1 g Bacto-tryptone, 0.5 g Bacto-yeast extract, 0.5 g NaCl, 10 g PEG (MW 3350), 5 ml). dimethylsulfoxide, 5 ml 1 M MgCl ₂ in 100 ml distilled water (pH 6.5), filtered after sterilization with a 0.22 μm filter) and stored on ice.

Example 9: Transformation and Library Preparation.

The ligation reaction solution was added to 1 ml of competent TG1 cells prepared above and left for 45 minutes on ice. The mixture was incubated at 42 ° C. for 2 minutes and then cooled on ice. To 100 μl of this, 900 μl of LBG (1 g of Bacto-tryptone, 1 g of Bacto-yeast extract, 0.5 g of NaCl, 0.5 g / dH ₂ O, and 1 ml of 2M glucose) was added, followed by incubation at 250 rpm. The transformed cells were diluted in various ratios to prepare SOBAG plates (20 g Bacto-tryptone 20 g, Bacto-yeast extract 5 g, NaCl 0.5 g / dH ₂ O 1 liter, 1 M MgCl ₂ 10 ml, 2 M glucose 55.6 ml, 20 mg / ml). Ampicillin 5ml, Bacto agar 15g) was plated cfu was confirmed to give a library of 6 × 10 ⁶ cfu.

Example 10 Conversion to 4785 Recombinant Phage Antibody Library

9.1 ml of 2 × YT-G medium was added to 900 µl of the bacterial library obtained above, and incubated at 37 ° C. for 1 hour with stirring at 250 rpm. The cells were centrifuged at 1000 x g for 10 minutes to precipitate the cells, and then the supernatant was removed.

10 ml of 2 × YT-AK medium (2 × YT medium, 100 μg / ml ampicillin, 50 μg / ml kanamycin) was added to the precipitate and incubated at 37 ° C. overnight with stirring at 250 rpm. The cells were centrifuged at 1000 × g for 20 minutes to precipitate the cells and the supernatant was transferred to 50 ml conical sterile tubes. Subsequently, the mixture was stored at 4 ° C. after passing through a 0.45 μm filtration membrane.

Example 11: PEG Precipitation of Recombinant Phage

To 4785 recombinant phage antibody library, 2 ml of PEG / NaCl (dissolved and sterilized in 200 g of PEG 8000, 146.1 g of NaCl in 1 liter of water) were mixed well and incubated for 60 minutes on ice. Subsequently, the mixture was centrifuged at 4 ° C. at 10000 × g for 20 minutes and the supernatant was removed. 16 ml of 2 × YT medium was added to the precipitate, mixed, and passed through a 0.45 μm filtration membrane, followed by panning.

Example 12 Panning for Selection of Antigen-Positive Recombinant Phage Antibodies

4-1 BB protein was diluted to 10 µg / ml in 0.05 M carbonate buffer (pH 9.6) and then coated in a T25 (Corning) flask at room temperature for 1-2 hours. Subsequently, the flask was washed three times with PBS, and then the flask was filled with blocking buffer (10% non fat milk in 1 × PBS) and left at room temperature for 1 hour. Then, after washing three times with PBS, 16ml PEG precipitated recombinant phage was diluted in 14ml of the blocking buffer containing 0.01% sodium azide and reacted at room temperature for 15 minutes. 20 ml of the recombinant phage in this dilution was placed in a flask and reacted at 37 ° C for 2 hours. The flask was then washed 20 times with 50 ml PBS and then 20 times with 50 ml 0.1% PBS-T. 10 ml of log-phase TG1 cells (Pharmacia Biotech) were placed in a flask, incubated at 37 ° C. for 1 hour, and then 100 μl of the culture solution was added in 2 × YT medium at 1:10, 1: 100. And 1: 1000 diluted to 100 μl plate on SOBAG plate and incubated overnight at 30 ° C.

The cfu of the plate was calculated to estimate the library size, yielding 9 × 10 ⁴ cfu.

Example 13: Monoclonal Preparation for Screening

The 800 colonies obtained after panning were each 200 μl of 2 × YT-AG medium (17 g of Bacto-tryptone, 10 g of Bacto-yeast extract, 1 liter of NaCl 5 g / dH ₂ O, 100 μg / ml ampicillin, 2% glucose). The inoculated 96-well plate was incubated overnight at 37 ℃ with stirring at 250rpm.

50 ml of 2 × YT-AG medium containing 2.5 × 10 ¹⁰ pfu of M13KO7 helper phage (Pharmacia Biotech Co., Ltd.) were dispensed in 200 μl each into a 96 well plate. The plates were inoculated with 40 µl of the culture solution overnight. The inoculated plate was incubated at 37 ° C. for 2 hours with stirring at 150 rpm, then centrifuged at 1500 × g for 20 minutes at room temperature to remove supernatant and 200 μl of 2 × YT-AK (2 × YT medium, 100 Μg / ml ampicillin and 50 μg / ml kanamycin) medium was added to each well. Subsequently, the mixture was incubated at 37 ° C with stirring at 250 rpm, then centrifuged at 1500 x g for 20 minutes at room temperature, and screened by ELISA as a supernatant.

After diluting the 4-1 BB protein to 10 µg / ml in 0.05 M carbonate buffer (pH 9.6), 200 µl each was coated on an ELISA plate for 1-2 hours at room temperature. Subsequently, the plate was washed three times with PBS, and then 200 µl of blocking buffer (10% non fat milk in 1 × PBS) was added to each well and allowed to react at room temperature for 1 hour. Subsequently, the plate was washed three times with 0.01% PBS-T, and then 100 µl of the recombinant phage antibody supernatant obtained on the previously blocked microtiter plate was added thereto, and the same amount of blocking buffer was added thereto to react at room temperature for 30 minutes. .

200 μl of the diluted recombinant phage antibody supernatant was placed in an antigen-coated well and allowed to react at room temperature for 1 hour. Subsequently, wash the plate 5 times with 0.01% PBS-T, then dilute HRP / anti-M13 monoclonal conjugate (Pharmacia Biotech) 1: 5000 in blocking buffer and add 200 μL to each well, The reaction was carried out at room temperature for 1 hour. Subsequently, the plates were washed six times with 0.01% PBS-T, followed by 200 µl of 21 ml 1 × ABTS stock solution (Sigma), each containing 36 µl of 30% H ₂ O ₂ per 96 well plate. After the addition, the mixture was allowed to react at room temperature for 20 minutes, and the absorbance was measured at 410 nm to obtain 19 clones having an absorbance of 0.2 or more, which was designated as a positive clone. Table 2 below shows the absorbance of each clone obtained through ELISA.

Clone number One 2 7 10 11 13 14 15 16 17 A405-1。 0.807 0.543 0.747 1.636 0.901 1.698 0.393 0.549 0.137 0.663 A405-2。 0.625 0.802 0.736 1.103 0.520 0.215 0.464 0.185 0.670 2.122 Clone number 18 19 20 21 22 23 24 25 26 A405-1。 0.358 0.375 0.476 0.722 0.802 0.804 0.193 0.785 2.284 A405-2。 1.093 0.481 0.209 1.125 0.809 0.852 0.489 0.329 0.362

The entire sequence of the 19 clones was identified and compared, and shown in Table 3 divided into eight groups except for overlapping ones.

Group 1 Hu4785-1, Hu4785-7, Hu4785-10, Hu4785-13, Hu4785-15, Hu4785-16, Hu4785-22, Hu4785-23 Group 2 Hu4785-11, Hu4785-18, Hu4785-26 Group 3 Hu4785-14 Group 4 Hu4785-24 Group 5 Hu4785-19 Group 6 Hu4785-2 Group 7 Hu4785-17 Group 8 Hu4785-21

TG1 cells transformed with the pCANTAB / Hu4785-2 plasmid containing the nucleotide sequence of the Hu4785-2 clone were deposited as KCTC 10365BP in the Biotechnology Research Institute Gene Bank.

Example 14 Protein Expression and Purification

E. coli was transformed by infecting E. coli HB2151 (Pharmacia Biotech) to convert the eight groups of M13 phages found to bind antigen to a water-soluble ScFv state. Each bacterial clone was inoculated in 80 ml of 2 × YT-AG and incubated overnight with stirring at 250 rpm at 37 ° C. It was again inoculated in 800 ml of 2 × YT-AG, incubated for 1 hour with stirring at 250 rpm at 37 ℃, and centrifuged for 10 minutes at 5000 rpm. The obtained pellet was added to 800 ml of 2 × YT-AI medium (Bacto-tryptone 17g, Bacto-yeast extract 10g, NaCl 5g / dH ₂ O 1 liter) and incubated for 4 hours with stirring at 250 rpm at 37 ° C. Centrifugation at 6000 rpm for 10 minutes. 8 ml of cold 1 × TES (0.2M Tris-HCl (pH 8.0), 0.5mM EDTA, 0.5M sucrose) was added to the obtained pellet, thoroughly mixed, 12 ml of 1/5 × TES was added, and the mixture was mixed well. Incubate for 30 minutes on the bed, then centrifuge at 12000 rpm for 10 minutes to transfer the supernatant to a new tube and purified using the RPAS purification module (Pharmacia Biotech, Cat. # 17-1362-01), the results are shown in Figure 5 Shown in FIG. 5 shows the results of pure separation of humanized ScFv from humanized anti-h4-1BB ScFv using anti-E tag Sepharose. FIG.

Example 15 Measurement of Affinity of Each ScFv

In order to measure the affinity of ScFv, Hu4785 clones (anti-h4-1BB ScFv) having ScFv with BIAcore2000 (BIAcore), a device for analyzing biomolecular interactions using Surface Plasmon Resonance (SPR). Intermolecular interactions between the 4-1BB-GST fusion proteins were analyzed.

The results are shown in Table 4 below. Comparing the equilibrium dissociate rate constant (KD) in the results, it can be seen that 4785 is 2.94 × 10 ⁹ , Hu4785-2 is 3.04 × 10 ¹² , and Hu4785-10 is 8.23 × 10 ⁹ . This indicates that the affinity Hu4785-2 is about 1000 times higher than the mouse 4785.

ka kd KD (M) Chi2 Mouse4785 1.04E + 03 3.06E-06 2.94E-09 3.06 Hu4785-2 3.21E + 04 9.76E-08 3.04E-12 0.30 Hu4785-10 5.20E + 02 4.28E-06 8.23E-09 2.83 Hu4785-14 6.14E + 02 8.21e-06 1.34E-08 1.61 Hu4785-17 4.95E + 02 5.99E-06 1.21E-08 1.25 Hu4785-18 2.00E + 02 4.85E-06 2.43E--08 204.00 Hu4785-24 9.72E + 01 2.03E-06 2.09E-08 5.53

Example 16: Competitive ELISA

4-1 BB-GST was diluted to 5 μg / ml in coating buffer and coated on ELISA plate, washed three times with PBS, blocked with 1% BSA-PBS for 1 hour at room temperature, and three times with PBS. . Eight ScFv and biotin-labeled anti-4-1 BB mAb 4785 at the same concentration were added to 50 μl of 4785 at 0, 0.25, 0.5, 1, 2, 4, 8 μg / ml and the total volume was 1% BSA-PBS. After adjusting to 100ul using the reaction for 15 minutes, it was added to the ELISA plate and reacted for 1 hour at room temperature, and then washed 5 times with PBS-0.05% Tween. A control Ab for this was used as an anti-TR2 mAb 108 (manufactured by Immunnomics, Inc.). 100 μl of HRP-conjugated anti-E tag Ab (Pharmacia Biotech) diluted 1: 10000 was treated and reacted at room temperature for 1 hour. Subsequently, after washing five times with PBS-0.05% Tween, 100 μl of the ABTS substrate was treated, and the absorbance was measured at 405 nm, and the inhibition rate (%) was calculated according to Equation 1 below, and the results are shown in FIG. 6.

% Inhibition = 100 × - OD ₄₀₅ in the absence of (in the absence of competitive antibody OD ₄₀₅ OD ₄₀₅ of the competitive antibody if present) / antibody competitively

 Competitive ELISA is an experiment to determine whether each clone has the same epitope as the original mouse 4785. Competitive ELISA can be obtained as a% inhibition value to see how much the binding of humanized ScFv decreases as the concentration of mouse mAb prior to humanization with Ag increases. In the results of FIG. 6, the percent inhibition rate increased with increasing mouse mAb concentration, demonstrating that humanized ScFv competes with the same epitope as the original mAb, which indicates that the humanized ScFv has the same biological effect as the original mAb. It strongly suggests that it will have a biological effect.

Example 17 Determination of Binding Affinity Using FACS

Human Jurkat 8-1 cell line is a cell line infected to stably express human 4-1BB and was used for fluorescence activated cell sorter (FACS) analysis. 50 μl of FACS buffer (1XPBS, 0.1% sodium azide, 1% FBS) was added to ⁵ × 10 ⁵ Jurkat 8-1 cells and each primary antibody was treated. The primary antibody was treated with mouse 4785 (A) and Hu4785-2 protein (B) at 4 ° C. for 30 minutes. Mouse IgG1 was used as an isotype control to identify nonspecific responses. After washing the cells with FACS buffer, (A) was treated with rabbit anti-mouse IgG (Jackson ImmunoResearch Laboratory Inc.) labeled with fluorescein isothiocyanate (FITC) for 30 minutes at 4 ° C, and (B) was anti-E- The tag antibody (anti-E-Tag antibody) and anti-mouse IgG-FITC (anti-mouse IgG-FITC) were treated sequentially and washed three times with FACS buffer, followed by FACS analysis. The results are shown in FIG.

The thin lines in A and B of FIG. 7 are heterozygous controls and the thick lines were treated with mouse 4785 antibody (A) and Hu4785-2 (b), respectively. In the results, the thick line shows higher FITC levels than the thin line of the heterologous control group. As a result, it was confirmed that mouse 4785 and Hu4785-2 bind to human 4-1 BB expressed in Jurkat 8-1.

Example 18 Constant Region Linkage of Humanized ScFv

4-1BB is a costimulatory molecule that is expressed on the surface of activated T cells, delivers a survival signal to CD8 T cells, induces CD8 T cell proliferation and cytotoxic T cell responses. It is known to be involved. Therefore, we would like to use humanized Hu4785 antibodies to inhibit cytotoxic T cells activated by self antigens that recognize self in organ transplantation or autoimmune diseases. In this case, the ScFv form alone can prevent the interaction between 4-1BB and 4-1BB ligands, but it can be maximized by switching to H2L2 (heavy chain 2, light chain 2) form. have. ScFv has one binding site, but H2L2 forms two binding sites, so more effective binding occurs. Since the ScFv form does not exist in human living bodies, the H2L2 form present in living bodies is less antigenic. In addition, IgG1, an isotype of a constant region of humanized Hu4785-H2L2, binds to cells and then fixes complement, resulting in a reaction that kills cytotoxic T cells bound to Hu4785-H2L2 antibody. It specifically kills cytotoxic T cells activated by self-recognized self antigens in organ transplantation or autoimmune diseases, thereby causing self-reactive cytotoxic T cells that cause organ transplant rejection and autoimmune reactions. T cell) can be removed completely. Therefore, conversion to H2L2 form is essential.

The humanized ScFv of each Ab is a form in which the VH, linker, and VL are linked. In order to make it into H2L2 form, which is originally an antibody form, the VH is linked with a leader sequence and a constant region of human IgG1, and the VL is linked with a leader sequence and a human kappa chain sequence. Linking of each section was performed by PCR. The sequence after conjugation is described in SEQ ID NOs: 40 to 43, as shown in FIGS. 8A to 8D.

Example 19: ELISA with H2L2

Examples 19, 20, and 21 were carried out to determine whether the binding capacity and the biological effect of ScFv remain after the conversion from ScFv form to H2L2.

A fully humanized gene up to the constant region, namely, the Hu4785-2 heavy chain gene (SEQ ID NO: 41) and Hu4785-2 light chain gene (SEQ ID NO: 43) are pcDNAs which are eukaryotic expression vectors. Subcloning into Hu4785-2H / pcDNA (Accession No. KCTC 10440BP) and Hu4785-2K / pcDNA (Accession No. KCTC 10441BP) yielded two plasmids infected with 293EBNA cells (ATCC) (transfection) and infected cells. ELISA was performed with the culture supernatant (transfectant).

First, ELISA was performed. 4-1BB-GST was used as an antigen, and culture supernatants of 50 infected cells were used. Among the 50, the highest expression rate was the B4 clone, which is about 15 times higher than the negative control group when looking at the ELISA results in Table 5 below.

sample Absorbance Hu4785-2H / pcDNA, Hu4785-2K / pcDNA infected 293 EBNA culture supernatant (B4) 1.935 293 EBNA Culture Supernatants 0.126

Example 20: Western blot analysis using H2L2

The plasmid obtained by subcloning the fully humanized gene up to the constant region of Example 18 into the eukaryotic expression vector pcDNA or pD18 was Hu4785-2H / pcDNA + Hu4785-2K / pcDNA or Hu4785-2H / pD18 + Hu4785-. 293EBNA cells (ATCC) were infected in the same combination as 2K / pD18, and antibody production was confirmed by Western blot with the culture supernatant of the infected cells. The antigen used in the western blot process was 4-1BB-GST.

9 is a Western blot results using H2L2, lane 1 is Hu4785-2H / pcDNA + Hu4785-2K / pcDNA infected cells (B4 clone), lane 2 is Hu4785-2H / pD18 + Hu4785-2K / pD18 infected cells Lane 3 is the 293EBNA cell-negative control. It was confirmed that the humanized antibody binds well to human 4-1BB.

Example 21: Pure Separation of H2L2

In the culture medium supernatant of the B4 clone, the SDS-PAGE was purely isolated from the fully humanized antibody using a protein G column (see FIG. 10).

Example 22 Cell Proliferation Assay

To examine the biological functions of humanized ScFv and H2L2, cell proliferation assay was performed.

In many cases, the antibody after humanization loses the biological effect of the mouse antibody before humanization. Therefore, after completing the humanization of the antibody, it is essential to prove that the mouse antibody retains the biological effects it had.

Peripheral blood mononuclear cells (PBMC) were isolated from human whole blood, and each Ab (mouse 4785, Hu4785-2 and Hu4785 H2L2) was treated at different concentrations (0, 1.25, 2.5 and 5 μg / ml), [ ³ H Inclusion results were measured with a beta counter. Mouse 4785 is an antibody that binds to human 4-1BB.

FIG. 10A shows that the treatment of mouse 4785 by concentration shows dose-dependent inhibition of proliferation of PBMCs. 10B shows the same tendency as the mouse 4785 as treated with humanized Hu4785-2 ScFv. 10C shows the same tendency as the mouse 4785 as treated with humanized Hu4785-2 H2L2. This proves that the antibody after humanization has the biological effect that the original mouse antibody has.

Since the ScFv form of humanized Hu4785-2 and H2L2 form of Hu4785-2H / Hu4785-2K of the present invention have a similar binding affinity to human 4-1BB and have a sequence similar to that of human antibodies, the therapeutic agent or immunity to autoimmune diseases As an inhibitor it can be used effectively without side effects.

1 and 2 show a comparison of the humanized nucleotide sequence of 4785 VH and VL with the amino acid sequence of the human template, respectively,

3 and 4 show PCR sequences for preparing regions of humanized 4785 VH and VL, respectively,

5 shows the results of purifying humanized anti-h4-1BB ScFv using anti-E tag Sepharose,

6 shows the inhibition rate of humanized anti-h4-1BB ScFv via competitive ELISA,

7 shows the binding affinity of humanized anti-h4-1BB ScFv with human 4-1BB molecules,

8A is a heavy chain nucleotide sequence in which a leader sequence and a constant region of human IgG1 are linked to VH of a humanized ScFv,

Figure 8b is a heavy chain amino acid sequence corresponding to the heavy chain nucleotide sequence of Figure 8a,

8C is a light chain nucleotide sequence of a leader sequence and a human kappa chain sequence linked to the VL of the humanized ScFv,

8D is a light chain amino acid sequence corresponding to the light chain nucleotide sequence of FIG. 8C,

Figure 9 is a Western blot result photograph observing the Hu4785-2H / Hu4785-2K gene expression of Example 20,

10 is an SDS-PAGE picture of purely isolated humanized antibody,

Figure 11a is a diagram showing the inhibition of proliferation of PBMC upon treatment by concentration of mouse 4785,

Figure 11b is a diagram showing the inhibition of proliferation of PBMC upon humanized Hu4785-2 ScFv treatment,

Figure 11c is a diagram showing the proliferation inhibition of PBMC when humanized Hu4785-2 H2L2 treatment.

<110> IMMUNOMICS CO., LTD. <120> Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition comprising Same <130> DIF-2002-0019 <160> 43 <170> KopatentIn 1.71 <210> 1 <211> 466 <212> PRT <213> Artificial Sequence <220> Mouse 4785-heavy chain amino acid sequence <400> 1 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn 85 90 95 Thr Val Tyr Met Gln Leu Asn Ser Pro Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Tyr Cys Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala 115 120 125 Met Glu Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys 130 135 140 Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln 145 150 155 160 Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro 165 170 175 Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val 180 185 190 His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser 195 200 205 Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys 210 215 220 Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val 225 230 235 240 Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val 245 250 255 Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile 260 265 270 Thr Leu Thr Pro Lys Val Thr Cys Val Val Asp Ile Ser Lys Asp 275 280 285 Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His 290 295 300 Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg 305 310 315 320 Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys 325 330 335 Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Ser Gln Val Tyr 355 360 365 Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu 370 375 380 Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp 385 390 395 400 Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile 405 410 415 Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln 420 425 430 Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His 435 440 445 Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro 450 455 460 Gly lys 465 <210> 2 <211> 234 <212> PRT <213> Artificial Sequence <220> Mouse 4785-light chain amino acid sequence <400> 2 Met Arg Phe Ser Ala Gln Phe Leu Gly Leu Leu Leu Leu Cys Phe Gln 1 5 10 15 Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Thr Thr Ser Ala Leu Ser 20 25 30 Ala Ser Leu Gly Asp Arg Val Thr Ile Gly Cys Arg Ala Ser Gln Asp 35 40 45 Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val 50 55 60 Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Arg 85 90 95 Asn Leu Glu Gln Glu Asp Val Ala Thr Tyr Phe Cys Gln Gln Gly Tyr 100 105 110 Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 115 120 125 Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln 130 135 140 Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr 145 150 155 160 Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln 165 170 175 Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg 195 200 205 His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro 210 215 220 Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 <210> 3 <211> 1526 <212> DNA <213> Artificial Sequence <220> Mouse 4785-Heavy chain nucleotide sequence <400> 3 atgggatgga gctgtatcat cctcttcttg gtagcaacag ctacaggtgt ccactcccag 60 gtccaactgc agcagcctgg ggctgagctg gtgaggcctg gggcttcagt gaagctgtct 120 tgcaaggctt ctggctacac cttcaccagc tactggataa actgggtgaa gcagaggcct 180 ggacaaggcc ttgagtggat cggaaatatt tatccttctg atagttatac taactacaat 240 caaaagttca aggacaaggc cacattgact gtagacaagt cctccaacac agtttacatg 300 cagctcaaca gcccgacatc tgaggactct gcggtctatt actgtacaag aaacggggtg 360 gagggttacc ctcattacta tgctatggaa tactggggtc aaggaacctc agtcaccgtc 420 tcctcagcca aaacgacacc cccatctgtc tatccactgg cccctggatc tgctgcccaa 480 actaactcca tggtgaccct gggatgcctg gtcaagggct atttccctga gccagtgaca 540 gtgacctgga actctggatc cctgtccagc ggtgtgcaca ccttcccagc tgtcctgcag 600 tctgacctct acactctgag cagctcagtg actgtcccct ccagcacctg gcccagcgag 660 accgtcacct gcaacgttgc ccacccggcc agcagcacca aggtggacaa gaaaattgtg 720 cccagggatt gtggttgtaa gccttgcata tgtacagtcc cagaagtatc atctgtcttc 780 atcttccccc caaagcccaa ggatgtgctc accattactc tgactcctaa ggtcacgtgt 840 gttgtggtag acatcagcaa ggatgatccc gaggtccagt tcagctggtt tgtagatgat 900 gtggaggtgc acacagctca gacgcaaccc cgggaggagc agttcaacag cactttccgc 960 tcagtcagtg aacttcccat catgcaccag gactggctca atggcaagga gttcaaatgc 1020 agggtcaaca gtgcagcttt ccctgccccc atcgagaaaa ccatctccaa aaccaaaggc 1080 agaccgaagg cttcacaggt gtacaccatt ccacctccca aggagcagat ggccaaggat 1140 aaagtcagtc tgacctgcat gataacagac ttcttccctg aagacattac tgtggagtgg 1200 cagtggaatg ggcagccagc ggagaactac aagaacactc agcccatcat ggacacagat 1260 ggctcttact tcgtctacag caagctcaat gtgcagaaga gcaactggga ggcaggaaat 1320 actttcacct gctctgtgtt acatgagggc ctgcacaacc accatactga gaagagcctc 1380 tcccactctc ctggtaaatg atcccagtgt ccttggagcc ctctggtcct acaggactct 1440 gacacctacc tccacccctc cctgtataaa taaagcaccc agcactgcct tgggaccctg 1500 caaaaaaaaa aaaaaaaaaa aaaaaa 1526 <210> 4 <211> 932 <212> DNA <213> Artificial Sequence <220> <223> mouse 4785-light chain nucleotde sequence <400> 4 atgaggttct ctgctcagtt ccttggtctc ctgttgctct gttttcaagg taccagatgt 60 gatatccaga tgacacagac tacatccgcc ctgtctgcct ctctgggaga cagagtcacc 120 atcggttgca gggcaagtca ggaccttagc aatcatttat actggtatca gcagaaacca 180 gatggaactg ttaaactcct gatctactac acatcaagat tacactcagg agtcccatca 240 aggttcagtg gcagtggctc tggaacagat tattctctca ccattaggaa cctggagcaa 300 gaagatgttg ccacttactt ttgccaacag ggttatacgc ttccgtacac gttcggaggg 360 gggaccaagc tggaaataaa acgggctgat gctgcaccaa ctgtatccat cttcccacca 420 tccagtgagc agttaacatc tggaggtgcc tcagtcgtgt gcttcttgaa caacttctac 480 cccaaagaca tcaatgtcaa gtggaagatt gatggcagtg aacgacaaaa tggcgtcctg 540 aacagttgga ctgatcagga cagcaaagac agcacctaca gcatgagcag caccctcacg 600 ttgaccaagg acgagtatga acgacataac agctatacct gtgaggccac tcacaagaca 660 tcaacttcac ccattgtcaa gagcttcaac aggaatgagt gttagagaca aaggtcctga 720 gacgccacca ccagctcccc agctccatcc tatcttccct tctaaggtct tggaggcttc 780 cccacaagcg acctaccact gttgcggtgc tccaaacctc ctccccacct ccttctcctc 840 ctcctccctt tccttggctt ttatcatgct aatatttgca gaaaatattc aataaagtga 900 gtctttgcac ttgaaaaaaa aaaaaaaaaa aa 932 <210> 5 <211> 244 <212> PRT <213> Artificial Sequence <220> <223> Hu4785-2 clone amino acid sequence <400> 5 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Trp Ile Asn Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe 50 55 60 Lys Asp Lys Val Thr Met Thr Val Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala Met Glu Tyr 100 105 110 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Pro 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln 130 135 140 Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr 145 150 155 160 Cys Arg Ala Ser Gln Asp Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln 165 170 175 Lys Pro Gly Glu Ile Val Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu 180 185 190 His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205 Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220 Phe Cys Gln Gln Gly Tyr Thr Leu Pro Tyr Thr Phe Gly Gly Thr Lys 225 230 235 240 Leu Glu Ile Lys <210> 6 <211> 732 <212> DNA <213> Artificial Sequence <220> <223> Hu4785-2 clone nucleotide sequence <400> 6 caggtccaac tggtgcagtc tggggctgag gtgaaaaaac ctggggcttc agtgaagctg 60 tcttgcaagg cttctggcta caccttcacc agctactgga taaactgggt gaggcagagg 120 cctggacaag gccttgagtg gatcggaaat atttatcctt ctgatagtta tactaactac 180 aatcaaaagt tcaaggacaa ggtcacaatg actgtagaca catccacatc aacagtttac 240 atggagctca gcagcctgag atctgaggac actgcggtct attactgtac aagaaacggg 300 gtggagggtt accctcatta ctatgctatg gaatactggg gtcaaggaac ctcagtcacc 360 gtctcctcag gcggcggcgg cccaggcggc ggcggctcag gcggcggcgg ctcagatatc 420 cagatgacac agtctccatc ctccctgtct gcctctgttg gagacagagt caccatcact 480 tgcagggcaa gtcaggacct tagcaatcat ttatactggt atcagcagaa accaggtgaa 540 attgttaaac tcctgatcta ctacacatca agattacact caggagtccc atcaaggttc 600 agtggcagtg gctctggaac agattttacg ctcaccattt cctccctgca gccagaagat 660 ttcgccactt acttttgcca acagggttat acgcttccgt acacgttcgg agggaccaag 720 ctggaaataa aa 732 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> linker primer containing XhoI recognition site <400> 7 ctcgagtttt tttttttt 18 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> G-1U: sense primer of mouse Ig G1 <400> 8 gaactctgga tccctgtcca 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> G-1D: antisense primer of mouse Ig G1 <400> 9 tgcaaggctt acaaccacaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> K-1U: sense primer of mouse kappa CH1 domain <400> 10 atcttcccac catccagtga 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> K-1D: antisense primer of mouse kappa CH1 domain <400> 11 cgtccttggt caacgtgag 19 <210> 12 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-2U: sense primer for humanized 4785 heavy chain variable region <400> 12 caggtccaac tgswgcagyc tggggctgag gtgaaaaaac ctggggcttc agtgaagstg 60 tcttgcaagg 70 <210> 13 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-3U: sense primer for humanized 4785 heavy chain variable region <400> 13 agtgaagstg tcttgcaagg cttctggcta caccttcacc agctactgga taaactgggt 60 gargcagrsg 70 <210> 14 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-4U: sense primer for humanized 4785 heavy chain variable region <400> 14 taaactgggt gargcagrsg cctggacaag gccttgagtg gatcggaaat atttatcctt 60 ctgatagtta 70 <210> 15 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-5U: sense primer for humanized 4785 heavy chain variable region <400> 15 atttatcctt ctgatagtta tactaactac aatcaaaagt tcaaggacar ggycacaatg 60 actgtagaca 70 <210> 16 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-6U: sense primer for humanized 4785 heavy chain variable region <400> 16 ggycacaatg actgtagaca catccacatc aacagtttac atggagctca gcagcctgag 60 atctgaggac 70 <210> 17 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-7U: sense primer for humanized 4785 heavy chain variable region <400> 17 gcagcctgag atctgaggac wctgcggtct attactgtac aagaaacggg gtggagggtt 60 accctcatta 70 <210> 18 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-8U: sense primer for humanized 4785 heavy chain variable region <400> 18 gtggagggtt accctcatta ctatgctatg gaatactggg gtcaaggaac ctyagtcacc 60 gtctcctca 69 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-6D: antisense primer for humanized 4785 heavy chain variable region <400> 19 tgaggagacg gtgactragg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-1U: sense primer for humanized 4785 heavy chain variable region <400> 20 caggtccaac tgswgcagyc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-1D: antisense primer for humanized 4785 heavy chain variable region <400> 21 csyctgcytc acccagttta 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-3D: antisense primer for humanized 4785 heavy chain variable region <400> 22 tgtctacagt cattgtgrcc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-9U: sense primer for humanized 4785 heavy chain variable region <400> 23 ggycacaatg actgtagaca 20 <210> 24 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-2U: sense primer for humanized 4785 light chain variable region <400> 24 gatatccaga tgacacagwc tmcatcctcc ctgtctgcct ctgttggaga cagagtcacc 60 atcacttgca 70 <210> 25 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-3U: sense primer for humanized 4785 light chain variable region <400> 25 cagagtcacc atcacttgca gggcaagtca ggaccttagc aatcatttat actggtatca 60 gcagaaacca 70 <210> 26 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-4U: sense primer for humanized 4785 light chain variable region <400> 26 actggtatca gcagaaacca grtrrarctg ttaaactcct gatctactac acatcaagat 60 tacactcagg 70 <210> 27 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-5U: sense primer for humanized 4785 light chain variable region <400> 27 acatcaagat tacactcagg agtcccatca aggttcagtg gcagtggctc tggaacagat 60 tttacgctca 70 <210> 28 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-6U: sense primer for humanized 4785 light chain variable region <400> 28 tggaacagat tttacgctca ccatttcctc cctgcagcca gaagatttcg ccacttactt 60 ttgccaacag 70 <210> 29 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-6U: sense primer for humanized 4785 light chain variable region <400> 29 ccacttactt ttgccaacag ggttatacgc ttccgtacac gttcggasrg gggaccaagc 60 tggaaataaa a 71 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-1U: sense primer for humanized 4785 light chain variable region <400> 30 gatatccaga tgacacagwc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-1D: antisense primer for humanized 4785 light chain variable region <400> 31 tggtttctgc tgataccagt 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-3D: antisense primer for humanized 4785 light chain variable region <400> 32 tgagcgtaaa atctgttcca 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-8U: sense primer for humanized 4785 light chain variable region <400> 33 ctggaacaga ttttacgctc a 21 <210> 34 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-6D: antisense primer for humanized 4785 light chain variable region <400> 34 ttttatttcc agcttggtcc cctccgaacg tgtacggaag cgtataaccc tgttggcaaa 60 agtaagtgg 69 <210> 35 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> 4785 VH SfiI-U: sense primer of 4785 heavy chain variable region contaning SfiI recognition site <400> 35 actgcggccc agccggccat ggcccaggtc caactgswgc agyctgg 47 <210> 36 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 4785 VL NotI-D: antisense primer of 4785 light chain variable region containing NotI recogniton site <400> 36 gagtcattct cgacttgcgg ccgcttttat ttccagcttg gtcccctc 48 <210> 37 <211> 84 <212> DNA <213> Artificial Sequence <220> <223> 4785VH-Linker-VL: linker sequence to bridge between 4785 heavy chain variable region and light chain variable region <400> 37 cctyagtcac cgtctcctca ggcggcggcg gctcaggcgg cggcggctca ggcggcggcg 60 gctcagatat ccagatgaca cagw 84 <210> 38 <211> 466 <212> PRT <213> Artificial Sequence <220> <223> Heavy chain amino acid sequence <400> 38 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn 85 90 95 Thr Val Tyr Met Gln Leu Asn Ser Pro Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Tyr Cys Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala 115 120 125 Met Glu Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys 130 135 140 Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln 145 150 155 160 Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro 165 170 175 Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val 180 185 190 His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser 195 200 205 Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys 210 215 220 Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val 225 230 235 240 Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val 245 250 255 Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile 260 265 270 Thr Leu Thr Pro Lys Val Thr Cys Val Val Asp Ile Ser Lys Asp 275 280 285 Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His 290 295 300 Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg 305 310 315 320 Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys 325 330 335 Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Ser Gln Val Tyr 355 360 365 Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu 370 375 380 Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp 385 390 395 400 Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile 405 410 415 Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln 420 425 430 Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His 435 440 445 Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro 450 455 460 Gly lys 465 <210> 39 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> light (kappa) chain amino acid sequence <400> 39 Met Arg Phe Ser Ala Gln Phe Leu Gly Leu Leu Leu Leu Cys Phe Gln 1 5 10 15 Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Thr Thr Ser Ala Leu Ser 20 25 30 Ala Ser Leu Gly Asp Arg Val Thr Ile Gly Cys Arg Ala Ser Gln Asp 35 40 45 Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val 50 55 60 Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Arg 85 90 95 Asn Leu Glu Gln Glu Asp Val Ala Thr Tyr Phe Cys Gln Gln Gly Tyr 100 105 110 Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 115 120 125 Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln 130 135 140 Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr 145 150 155 160 Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln 165 170 175 Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg 195 200 205 His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro 210 215 220 Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 <210> 40 <211> 473 <212> PRT <213> Artificial Sequence <220> <223> Hu4785-2H: heavy chain amino acid sequence of humanized monoclonal antibody <400> 40 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Trp Ile Asn Trp Val Arg Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asp Lys Val Thr Met Thr Val Asp Thr Ser Thr Ser 85 90 95 Thr Val Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala 115 120 125 Met Glu Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Ser 130 135 140 Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr 145 150 155 160 Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro 165 170 175 Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val 180 185 190 His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser 195 200 205 Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile 210 215 220 Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Ser 225 230 235 240 Leu Ser Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 245 250 255 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 260 265 270 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 275 280 285 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 290 295 300 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 305 310 315 320 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 325 330 335 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 340 345 350 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 355 360 365 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met 370 375 380 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 385 390 395 400 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 405 410 415 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 420 425 430 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 435 440 445 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 450 455 460 Lys Ser Leu Ser Leu Ser Pro Gly Lys 465 470 <210> 41 <211> 1422 <212> DNA <213> Artificial Sequence <220> <223> Hu4785-2H: heavy chain nucleotide sequnce of humanized monoclonal antibody <400> 41 atgggatgga gctgtatcat cctcttcttg gtagcaacag ctacaggtgt ccactcccag 60 gtccaactgg tgcagtctgg ggctgaggtg aaaaaacctg gggcttcagt gaagctgtct 120 tgcaaggctt ctggctacac cttcaccagc tactggataa actgggtgag gcagaggcct 180 ggacaaggcc ttgagtggat cggaaatatt tatccttctg atagttatac taactacaat 240 caaaagttca aggacaaggt cacaatgact gtagacacat ccacatcaac agtttacatg 300 gagctcagca gcctgagatc tgaggacact gcggtctatt actgtacaag aaacggggtg 360 gagggttacc ctcattacta tgctatggaa tactggggtc aaggaacctc agtcaccgtc 420 tcctcagcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caaaagcacc 480 tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg 540 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag 600 tcctcaggac tctactccct cagcagcgtg gtgaccgtgc cctccagcag cttgggcacc 660 cagacctaca tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caaaaaaagt 720 ttgagtccca aatcttgtga caaaactcat acttgcccgc cgtgcccggc tccggaactc 780 ctggggggac cgtcagtctt cctcttcccc ccaaaaccca aggacaccct catgatctcc 840 cggacccctg aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag 900 ttcaactggt acgtggacgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag 960 cagtacaaca gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg 1020 aatggcaagg agtacaagtg caaggtctcc aacaaagccc tcccagcccc catcgagaaa 1080 accatctcca aagccaaagg gcagccccga gaaccacagg tgtacaccct gcccccatcc 1140 cgggaggaga tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctatccc 1200 agcgacattg ccgtggagtg ggagagcaat gggcagccgg agaacaacta caagaccacg 1260 cctcccgtgc tggactccga cggctccttc ttcctctata gcaagctcac cgtggacaag 1320 agcaggtggc agcaggggaa cgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1380 cactacacgc agaagagcct ctccctgtcc ccgggtaaat ga 1422 <210> 42 <211> 232 <212> PRT <213> Artificial Sequence <220> <223> Hu4785-K: light chain amino acid sequence of humanized monoclonal antibody <400> 42 Met Arg Phe Ser Ala Gln Phe Leu Gly Leu Leu Leu Leu Cys Phe Gln 1 5 10 15 Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 20 25 30 Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp 35 40 45 Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln Lys Pro Gly Glu Ile Val 50 55 60 Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Gly Tyr 100 105 110 Thr Leu Pro Tyr Thr Phe Gly Gly Thr Lys Leu Glu Ile Lys Thr Val 115 120 125 Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys 130 135 140 Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg 145 150 155 160 Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn 165 170 175 Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser 180 185 190 Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys 195 200 205 Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr 210 215 220 Lys Ser Phe Asn Arg Gly Glu Cys 225 230 <210> 43 <211> 699 <212> DNA <213> Artificial Sequence <220> <223> Hu4785-2K: light chain nucleotide sequence of humanized monoclonal antibody <400> 43 atgaggttct ctgctcagtt ccttggtctc ctgttgctct gttttcaagg taccagatgt 60 gatatccaga tgacacagtc tccatcctcc ctgtctgcct ctgttggaga cagagtcacc 120 atcacttgca gggcaagtca ggaccttagc aatcatttat actggtatca gcagaaacca 180 ggtgaaattg ttaaactcct gatctactac acatcaagat tacactcagg agtcccatca 240 aggttcagtg gcagtggctc tggaacagat tttacgctca ccatttcctc cctgcagcca 300 gaagatttcg ccacttactt ttgccaacag ggttatacgc ttccgtacac gttcggaggg 360 accaagctgg aaataaaaac tgtggctgca ccatctgtct tcatcttccc gccatctgat 420 gagcagttga aatctggaac tgcctctgtt gtgtgcctgc tgaataactt ctatcccaga 480 gaggccaaag tacagtggaa ggtggataac gccctccaat cgggtaactc ccaggagagt 540 gtcacagagc aggacagcaa ggacagcacc tacagcctca gcagcaccct gacgctgagc 600 aaagcagact acgagaaaca caaagtctac gcctgcgaag tcacccatca gggcctgagt 660 tcgcccgtca caaagagctt caacagggga gagtgttag 699

Claims (16)

Humanized monocles specific for human 4-1BB molecules having the amino acid sequence of SEQ ID NO: 5 corresponding to heavy chain variable region (VH), linker and light chain variable region (VL) Ronald polypeptide. The humanized monoclonal polypeptide according to claim 1, which is produced by the cell line Hu4785-2 (Accession No .: KCTC 10365BP). Humanized monoclonal polypeptides specific for human 4-1BB molecules, each having the amino acid sequences of SEQ ID 40 and SEQ ID 42. The humanized monoclonal polypeptide according to claim 3, which is produced by cell line Hu4785-2H (Accession No .: KCTC 10440BP) and Cell line Hu4785-2K (Accession No .: KCTC 10441BP). DNA encoding the monoclonal polypeptide of claim 1. The DNA of claim 5 having the nucleotide sequence of SEQ ID NO: 6. 7. DNA encoding the monoclonal polypeptide of claim 3. 8. The DNA of claim 7 having the nucleotide sequence of SEQ ID 41 or SEQ ID 43. Plasmid Hu4785-2H / pCANTAB (Accession No .: KCTC 10365BP) comprising the humanized monoclonal polypeptide Hu4785-2 and expressing the antibody heavy chain constant region. Plasmid Hu4785-2H / pcDNA (Accession No .: KCTC 10440BP) for containing the humanized monoclonal polypeptide Hu4785-2 and expressing the antibody heavy chain constant region. Plasmid Hu4785-2K / pcDNA (Accession No .: KCTC 10441BP) for containing the humanized monoclonal polypeptide Hu4785-2 and expressing the antibody light chain constant region. delete delete delete delete delete