KR100500283B1 - Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition Comprising Same - Google Patents
Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition Comprising Same Download PDFInfo
- Publication number
- KR100500283B1 KR100500283B1 KR10-2003-0018621A KR20030018621A KR100500283B1 KR 100500283 B1 KR100500283 B1 KR 100500283B1 KR 20030018621 A KR20030018621 A KR 20030018621A KR 100500283 B1 KR100500283 B1 KR 100500283B1
- Authority
- KR
- South Korea
- Prior art keywords
- ser
- thr
- val
- leu
- gly
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
- C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
본 발명은 인간 4-1BB 분자에 대한 마우스 모노클로날 항체를 인간화함으로써 제조된, 인간 4-1BB 분자에 특이성을 갖는 인간화 모노클로날 폴리펩티드, 이에 불변영역이 연결된 항체 및 이들을 포함하는 자가면역질환 치료용 또는 면역억제용 약학조성물에 관한 것으로, 본 발명의 인간화 모노클로날 폴리펩티드 및 이에 불변영역이 연결된 항체는 인간 4-1BB에 대한 결합친화도가 높으면서 인간의 항체와 유사한 서열을 가지므로 자가면역질환의 치료제 또는 면역억제제로서 부작용 없이 효과적으로 사용될 수 있다.The present invention provides a humanized monoclonal polypeptide having specificity to a human 4-1BB molecule prepared by humanizing a mouse monoclonal antibody against a human 4-1BB molecule, an antibody linked to a constant region thereof, and an autoimmune disease treatment comprising the same. The present invention relates to a pharmaceutical composition for use in immunosuppression or immunosuppression, wherein the humanized monoclonal polypeptide of the present invention and an antibody linked to a constant region thereof have a binding affinity for human 4-1BB and have a sequence similar to that of human antibodies. It can be effectively used as a therapeutic agent or an immunosuppressive agent without side effects.
Description
본 발명은 새로운 자가면역 질환(autoimmune disease) 치료용 또는 면역 억제용 조성물에 관한 것으로, 보다 구체적으로는 자가면역질환 중 대표적인 류마티스성 관절염 및 루퍼스성 홍진(lupus erythematosus) 등을 치료하는 인간 4-1BB에 특이적인 새로운 인간화 모노클로날 폴리펩티드 및 이를 포함하는 자가면역 질환 치료용 또는 면역억제용 약학 조성물에 관한 것이다.The present invention relates to a novel autoimmune disease (autoimmune disease) treatment or immunosuppressive composition, and more specifically, human 4-1BB for treating typical rheumatoid arthritis and lupus erythematosus among autoimmune diseases A novel humanized monoclonal polypeptide specific for and a pharmaceutical composition for treating or immunosuppressing autoimmune diseases comprising the same.
인간 면역반응의 시작은 T 세포에 의한 단백질 항원의 인식에 의존한다. 그러나, T 세포는 항원을 단독으로는 인식할 수 없고, B 세포, 마크로파지 (macrophage) 등과 같은 항원표출세포(antigen presenting cell) 표면의 조직적합성복합체(major histocompatibility complex; 이하 "MHC"라 함)와 항원이 복합체를 이루고 있는 경우에만 면역반응을 촉발할 수 있다.Initiation of the human immune response depends on the recognition of protein antigens by T cells. However, T cells are unable to recognize antigens alone, and are associated with major histocompatibility complexes (MHCs) on the surface of antigen presenting cells such as B cells, macrophages, and the like. Only when the antigen is in the complex can trigger an immune response.
MHC 클래스 I 분자는 킬러 T 세포반응을 촉발하여 항원을 가진 세포를 파괴하고, MHC 클래스 Ⅱ분자는 헬퍼 T 세포반응을 촉발하여 선택된 B 세포의 성장과 마크로파지의 활성화를 조절한다. 이런 면역계의 중요한 기능 중 하나는 자기항원과 외부에서 들어온 항원을 감별하고 인지하는 능력이다. 이 구별은 면역계가 침입한 외부 병원체에 반응하는 반면에 자기 단백질에 대해서는 내성을 유지하여 정상조직에 해를 가하지 않게 하는 데 필요하다. MHC class I molecules trigger killer T cell responses to destroy cells with antigens, and MHC class II molecules trigger helper T cell responses to regulate the growth of selected B cells and the activation of macrophages. One of the important functions of this immune system is the ability to discriminate and recognize self-antigens from foreign antigens. This distinction is necessary for the immune system to respond to invading external pathogens, while maintaining resistance to magnetic proteins so as not to harm normal tissues.
자가면역 질환은 자기내성(self-tolerance)이 파괴되어 면역계가 류마티스 관절염의 관절과 같은 자기 조직에 대해 반응하는 질환이고, 또 다른 예로 루퍼스성 홍진(lupus erythematosus)이 있다. 내성의 유지에 따른 자가면역질환의 방지는 MHC 분자의 기능에 절대적으로 의존한다.Autoimmune diseases are disorders in which self-tolerance is destroyed so that the immune system responds to self tissues such as the joints of rheumatoid arthritis. Another example is lupus erythematosus. Prevention of autoimmune diseases with maintenance of resistance depends absolutely on the function of the MHC molecule.
여러 자가면역질환이 특정 MHC 대립형질(alleles)의 유전과 관련이 있다는 결과는 자가면역질환에 MHC가 중요한 역할을 한다는 것을 암시한다. 예를 들어, 인슐린 의존 당뇨병은 HLA-DR3 및/또는 HLA-DR4와 관련이 있고, 하시모토 갑상선염(thyroiditis)은 HLA-DR5와 관련이 있으며, 만성 염증성 관절염은 HLA-DR4w14 및/또는 HLA-DR1과 관련이 있다.The fact that several autoimmune diseases are related to the inheritance of certain MHC alleles suggests that MHC plays an important role in autoimmune diseases. For example, insulin dependent diabetes is associated with HLA-DR3 and / or HLA-DR4, Hashimoto thyroiditis is associated with HLA-DR5, and chronic inflammatory arthritis is associated with HLA-DR4w14 and / or HLA-DR1. It is related.
자가면역질환에 관여하는 MHC 분자는 특정 자가 항원에 결합하여 그들을 T 세포에 표출시켜 자가면역반응에 관여하는 것으로 생각된다. MHC molecules involved in autoimmune diseases are thought to be involved in autoimmune reactions by binding to specific autoantigens and expressing them to T cells.
자가면역질환에 관여하는 MHC 분자에 결합할 수 있거나, 결합하는 것을 방해하거나 또는 이미 결합된 자가 항원을 제거하거나, T 세포 활성화를 저해하거나 방어적 T 세포(Th 2세포)의 활성을 증가시킬 수 있는 펩타이드가 상기 MHC 분자를 통해 중재되는 자가면역반응을 저해할 수 있을 것이다. Can bind to, interfere with the binding of MHC molecules involved in autoimmune diseases, remove autologous antigens already bound, inhibit T cell activation or increase the activity of protective T cells (Th 2 cells) Peptides may inhibit autoimmune responses mediated through the MHC molecule.
이러한 종류의 약제들은 자가면역질환에 대한 치료를 제공하는 반면에 정상적인 면역계의 억제를 방해하는 부작용을 가지므로 그 사용이 제한된다. 또한 MHC와 이에 반응하는 자가항원의 수가 많고, 종류가 다양하므로 이에 대한 특이 펩타이드도 종류가 너무 많아 치료제로는 적합하지 않다.While these types of drugs provide treatment for autoimmune diseases, their use is limited because they have side effects that interfere with the suppression of the normal immune system. In addition, MHC and the number of autoantigens that respond to it, and because there are many kinds of specific peptides for this too many types are not suitable as a therapeutic agent.
MHC 분자에 결합하여 T 세포 활성을 억제하는 펩타이드들이 국제특허출원 공개번호 WO 92/02543, WO 93/05011 및 WO 95/07707에 기재되어 있다. 비록 HLA-DR 분자들에 붙어서 T 세포 활성화를 저해하는 많은 분자들이 발견되었지만, 그런 분자들에 결합하는 다른 화합물들이나 다른 메카니즘으로 자가면역반응을 억제하거나 변형시키는 대체 화합물들에 대한 필요성은 계속되고 있다. Peptides that bind to MHC molecules and inhibit T cell activity are described in International Patent Applications WO 92/02543, WO 93/05011 and WO 95/07707. Although many molecules have been found that bind to HLA-DR molecules and inhibit T cell activation, there is a continuing need for alternative compounds that inhibit or modify autoimmune reactions with other compounds or other mechanisms that bind to such molecules. .
4-1BB는 활성화된 T 세포의 표면에 발현하는 공동자극분자(costimulatory molecule)로써, CD8 T 세포에 생존시그날(survival signal)을 전달하고, CD8 T 세포 증식 및 세포독성(cytotoxic) T 세포 반응 유도에 관여하는 것으로 알려져 있다. 그러므로, 장기이식 또는 자가면역질환에서 자기(self)를 인지하는 자기 항원에 의해서 활성화된 세포독성 T 세포를 억제하기 위해서 본 발명에서는 인간의 항체와 유사한 서열을 갖는 인간화 모노클로날 폴리펩티드인 항-h4-1BB ScFv형태의 Hu4785-2 및 불변영역이 연결된 H2L2형태의 Hu4785-2H/Hu4785-2K를 제조하여, 자가면역질환의 치료 또는 면역 억제에 가능성이 있는지 연구하였다.4-1BB is a costimulatory molecule that is expressed on the surface of activated T cells, delivers a survival signal to CD8 T cells, induces CD8 T cell proliferation and cytotoxic T cell responses. It is known to be involved. Therefore, in the present invention, in order to suppress cytotoxic T cells activated by self-recognizing self antigens in organ transplantation or autoimmune diseases, anti-h4 is a humanized monoclonal polypeptide having a sequence similar to that of human antibodies. Hu4785-2 in the form of -1BB ScFv and Hu4785-2H / Hu4785-2K in the form of H2L2 linked to the constant region were prepared and studied for the possibility of treatment or immune suppression of autoimmune diseases.
연구 결과, 본 발명에 따른 인간화 모노클로날 폴리펩티드인 Hu4785-2 및 Hu4785-2H/Hu4785-2K 가 인간 4-1BB 분자에 특이성이 있고, 결합 친화도가 높음을 확인하여 본 발명을 완성하였다.As a result, the humanized monoclonal polypeptides Hu4785-2 and Hu4785-2H / Hu4785-2K according to the present invention were confirmed to have specificity and high binding affinity to human 4-1BB molecules, thereby completing the present invention.
따라서 본 발명의 목적은 인간 4-1BB(h4-1BB) 분자에 대해 특이성이 있고 결합 친화도가 높으며 항-h4-1BB ScFv 형태인 인간화 모노클로날 폴리펩티드를 제공하는 것이다.It is therefore an object of the present invention to provide humanized monoclonal polypeptides which are specific for human 4-1BB (h4-1BB) molecules, have high binding affinity and are in anti-h4-1BB ScFv form.
또한 본 발명의 목적은 상기 인간화 모노클로날 폴리펩티드에 불변영역이 연결된 항체를 제공하는 것이다.It is also an object of the present invention to provide an antibody in which a constant region is linked to the humanized monoclonal polypeptide.
본 발명의 다른 목적은 상기 인간화된 모노클로날 폴리펩티드를 포함하는, 자가면역 질환 치료용 또는 면역억제용 약학 조성물을 제공하는 것이다. Another object of the present invention to provide a pharmaceutical composition for treating or immunosuppressive autoimmune disease, comprising the humanized monoclonal polypeptide.
상기 목적을 달성하기 위하여, 본 발명은 중쇄 가변영역(heavy chain variable region, VH), 링커 및 경쇄 가변영역(light chain variable region, VL)에 해당하는 서열번호: 5의 아미노산 서열을 갖는, 인간 4-1BB 분자에 대해 특이성이 있는 인간화 모노클로날 폴리펩티드를 제공한다.In order to achieve the above object, the present invention has an amino acid sequence of SEQ ID NO: 5 corresponding to a heavy chain variable region (VH), a linker and a light chain variable region (VL), human 4 Provided are humanized monoclonal polypeptides specific for a -1BB molecule.
본 발명은 서열번호: 40 및 서열번호: 42의 아미노산 서열을 각각 갖는, 인간 4-1BB 분자에 대해 특이성이 있는 인간화 모노클로날 폴리펩티드를 제공한다.The present invention provides humanized monoclonal polypeptides specific for human 4-1BB molecules having amino acid sequences of SEQ ID 40 and SEQ ID 42 respectively.
또한 본 발명은 상기 인간화 모노클로날 폴리펩티드를 유효성분으로 포함하는 자가면역질환 치료용 약학조성물 및 면역억제용 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition for treating autoimmune diseases and a pharmaceutical composition for immunosuppression, comprising the humanized monoclonal polypeptide as an active ingredient.
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명에서는 중쇄 가변영역(heavy chain variable region, VH), 링커 및 경쇄 가변영역(light chain variable region, VL)에 해당하는 서열번호: 5 의 아미노산서열을 가지고, 인간 4-1BB 분자에 대해 특이성이 있으며, 항-h4-1BB ScFv(single-chain fragment variable)형태인 인간화 모노클로날 폴리펩티드 Hu4785-2를 제공한다.The present invention has an amino acid sequence of SEQ ID NO: 5 corresponding to heavy chain variable region (VH), linker and light chain variable region (VL), and has specificity for human 4-1BB molecule. And a humanized monoclonal polypeptide Hu4785-2 in the form of an anti-h4-1BB single-chain fragment variable (ScFv).
본 발명의 인간화 모노클로날 폴리펩티드는 중쇄 및 경쇄가 서열번호: 1 및 2의 아미노산 서열을 갖는 4-1BB에 대한 마우스 4785 모노클로날 항체를 인간화함으로써 제조할 수 있으며, 구체적으로 가변영역의 항원결합부위인 CDRs (complementarity determining regions) 서열 및 정준 잔기(canonical residue)는 마우스 단일클론항체의 서열과 일치하고, 프레임워크 영역(framework region, FR)의 서열 중 중쇄와 경쇄 사이에 존재하는 서열은 마우스 항체의 것과 일치하고, 특이적 서열은 인간 항체의 것과 일치하고, 용매 표출 잔기(solvent-exposed residue)는 마우스 항체의 것과 일치하도록 고안된 것이다. Humanized monoclonal polypeptides of the invention can be prepared by humanizing mouse 4785 monoclonal antibodies against 4-1BB in which the heavy and light chains have amino acid sequences of SEQ ID NOs: 1 and 2, specifically, antigen binding of variable regions The region of complementarity determining regions (CDRs) and canonical residues match the sequence of mouse monoclonal antibodies, and the sequence between the heavy and light chains of the framework region (FR) is a mouse antibody. And specific sequences match those of human antibodies, and solvent-exposed residues are designed to match those of mouse antibodies.
상기와 같이 제조된 본 발명의 인간화 모노클로날 폴리펩티드들 중에서 인간의 4-1BB와 친화도가 가장 높은 것으로 나타난 Hu4785-2는 서열번호: 5의 아미노산 서열을 가지며, 이 아미노산 서열은 서열번호: 6의 염기서열에 의해 암호화될 수 있고, 본 발명의 인간화 모노클로날 폴리펩티드 Hu4785-2를 생산하는 세포주 TG1/Hu4785-2는 2002년 11월 12일자로 생명공학연구소 유전자은행(KCTC)에 기탁번호 제 KCTC 10365BP 호로서 기탁하였다.Among the humanized monoclonal polypeptides of the present invention prepared as described above, Hu4785-2, which has been shown to have the highest affinity with human 4-1BB, has an amino acid sequence of SEQ ID NO: 5, which is represented by SEQ ID NO: 6 Cell line TG1 / Hu4785-2, which can be encoded by the nucleotide sequence of the present invention and produces the humanized monoclonal polypeptide Hu4785-2 of the present invention, was deposited on November 12, 2002 to the Bank of Biotechnology Gene Bank (KCTC). Deposited as KCTC 10365BP.
또한, 본 발명은 상기 Hu4785-2 모노클로날 폴리펩티드를 암호화 하는 DNA 염기서열을 제공하며, 바람직하게는 서열번호: 6의 염기서열을 제공한다.In addition, the present invention provides a DNA sequence encoding the Hu4785-2 monoclonal polypeptide, and preferably provides a nucleotide sequence of SEQ ID NO: 6.
그리고, 본 발명은 인간화 모노클로날 폴리펩티드 Hu4785-2를 암호화하는 플라스미드 Hu4785-2/pCANTAB 5E(기탁번호: KCTC 10365BP)를 제공한다.The present invention also provides a plasmid Hu4785-2 / pCANTAB 5E (Accession No .: KCTC 10365BP) encoding the humanized monoclonal polypeptide Hu4785-2.
본 발명의 ScFv 형태인 인간화 모노클로날 폴리펩티드 Hu4785-2는 4-1BB 분자와의 친화도가 마우스 4785보다 약 1000배정도 높으며, 인간화된 ScFv는 경쟁적 ELISA 실험에서 원래의 모노클로날 항체와 같은 생물학적 효과를 나타냄으로써, 이를 유효성분으로 하는 조성물은 4-1BB와 4-1BB 리간드의 상호작용을 막을 수 있어, 장기이식 또는 자가면역질환에서 자기를 인지하는 자기항원에 의해 활성화된 세포독성 T 세포를 억제하는데 적용할 수 있다.Humanized monoclonal polypeptide Hu4785-2, ScFv form of the present invention, has affinity with 4-1BB molecules about 1000 times higher than mouse 4785, and humanized ScFv has the same biological effect as the original monoclonal antibody in competitive ELISA experiments. By expressing the composition as an active ingredient, it is possible to prevent the interaction between 4-1BB and 4-1BB ligand, inhibiting cytotoxic T cells activated by self-antigens that recognize self in organ transplantation or autoimmune disease. Applicable to
ScFv 형태의 인간화 모노클로날 폴리펩티드는 VH, 링커(linker), VL이 연결되어 있는 형태이고, ScFv는 뉴트랄 링커(neutral linker)로 인위적으로 연결되어 있어서 한 가닥의 폴리펩티드로 발현되고, 대부분의 VH-Linker-VL ScFv 단백질은 15개의 아미노산링커인 (Gly4Ser)3를 가지고 있다. 이러한 유연 펩티드링커 (flexible peptide linker)는 VH 사슬의 카르복시말단(carboxy-terminus)과 VL 사슬의 아미노말단(amino terminus) 사이에 3.5nm 거리의 브릿지(bridge)를 형성하도록 특별히 고안된 것이다. 이러한 구조는 사슬간 페어링(chain pairing)을 촉진시키고 두 개의 사슬이 각각 발현되었을 때 발생하는 응집(aggregation)이나 리폴딩(refolding)을 최소화시킬 수 있다. (Gly4Ser)3 잔기를 가지고 있는 ScFv는 친화도(affinity)와 안정성(stability)의 면에서 원래의 항체와 같다.Humanized monoclonal polypeptides in the ScFv form are linked to VH, linker, and VL. ScFv is artificially linked to the neutral linker and is expressed as a single strand of polypeptide. The -Linker-VL ScFv protein has 15 amino acid linkers (Gly 4 Ser) 3 . Such a flexible peptide linker is specifically designed to form a bridge of 3.5 nm distance between the carboxy-terminus of the VH chain and the amino terminus of the VL chain. This structure can promote chain pairing and minimize aggregation or refolding that occurs when two chains are expressed, respectively. ScFv with (Gly 4 Ser) 3 residues is the same as the original antibody in terms of affinity and stability.
이에 항체의 불변영역(Constant region)을 연결하여 중쇄사슬 2개 및 경쇄사슬 2개가 연결된 H2L2 형태의 완전한 항체 형태를 제조함으로써, 그 효과를 극대화 시킬 수 있다.The constant region of the antibody (Constant region) by connecting the two heavy chains and two light chains to form a complete antibody form of H2L2 form, the effect can be maximized.
또한 본 발명은 서열번호: 40 및 서열번호: 42의 아미노산서열을 갖고, 인간 4-1BB 분자에 대해 특이성이 있으며, 항-h4-1BB H2L2 형태를 갖는 인간화 모노클로날 폴리펩티드 Hu4785-2H/Hu4785-2K를 제공한다.The present invention also provides a humanized monoclonal polypeptide Hu4785-2H / Hu4785- having amino acid sequences of SEQ ID NO: 40 and SEQ ID NO: 42, specific for human 4-1BB molecules, and having the anti-h4-1BB H2L2 form. Provide 2K.
본 발명의 인간화 모노클로날 폴리펩티드 Hu4785-2의 VH에 리더서열과 인간 IgG1의 불변영역을 연결시켜 진핵세포 발현벡터 내로 서브클로닝하여 제작한 Hu4785-2H/pcDNA는, 진핵세포주에서 발현시 Hu4785-2H를 생산하고, 이 폴리펩티드는 서열번호: 40의 아미노산 서열을 가지고 서열번호: 41의 염기서열에 의해 암호화된다. Hu4785-2H / pcDNA produced by linking the leader sequence and the constant region of human IgG1 to the VH of the humanized monoclonal polypeptide Hu4785-2 of the present invention and subcloning into a eukaryotic expression vector, Hu4785-2H when expressed in a eukaryotic cell line. And the polypeptide has an amino acid sequence of SEQ ID NO: 40 and is encoded by the nucleotide sequence of SEQ ID NO: 41.
본 발명의 인간화 모노클로날 폴리펩티드 Hu4785-2H를 생산하는 플라스미드 Hu4785-2H/pcDNA를 갖는 세포주 XL-1 Blue/Hu4785-2H는 2003년 3월 6일자로 생명공학연구소 유전자은행(KCTC)에 기탁번호 제 KCTC 10440BP 호로서 기탁하였다.Cell line XL-1 Blue / Hu4785-2H with the plasmid Hu4785-2H / pcDNA producing the humanized monoclonal polypeptide Hu4785-2H of the present invention was deposited on March 6, 2003 to the Institute of Biotechnology Gene Bank (KCTC). Deposited as No. KCTC 10440BP.
본 발명의 인간화 모노클로날 폴리펩티드 Hu4785-2의 VL 리더서열과 인간 카파사슬서열을 연결시켜 진핵세포 발현벡터 내로 서브클로닝하여 제작한 Hu4785-2K/pcDNA는, 진핵세포주에서 발현시 Hu4785-2K를 생산하고, 이 폴리펩티드는 서열번호: 42의 아미노산 서열을 가지고, 서열번호: 43의 염기서열에 의해 암호화된다.Hu4785-2K / pcDNA produced by linking the VL leader sequence of the humanized monoclonal polypeptide Hu4785-2 and the human kappa chain sequence of the present invention and subcloning into a eukaryotic expression vector produces Hu4785-2K when expressed in a eukaryotic cell line. This polypeptide has an amino acid sequence of SEQ ID NO: 42 and is encoded by a nucleotide sequence of SEQ ID NO: 43.
본 발명의 인간화 모노클로날 폴리펩티드 Hu4785-2K를 생산하는 플라스미드 Hu4785-2K/pcDNA를 갖는 세포주 XL-1 Blue/Hu4785-2K는 2003년 3월 6일자로 생명공학연구소 유전자은행(KCTC)에 기탁번호 제 KCTC 10441BP 호로서 기탁하였다.Cell line XL-1 Blue / Hu4785-2K with the plasmid Hu4785-2K / pcDNA producing the humanized monoclonal polypeptide Hu4785-2K of the present invention was deposited on March 6, 2003 to the Institute of Biotechnology Gene Bank (KCTC). Deposited as KCTC 10441BP.
또한, 본 발명은 Hu4785-2H/Hu4785-2K 모노클로날 폴리펩티드를 암호화하는 DNA 염기서열을 제공하며, 바람직하게는 서열번호: 41 및 서열번호: 43의 염기서열을 제공한다.The present invention also provides a DNA nucleotide sequence encoding the Hu4785-2H / Hu4785-2K monoclonal polypeptide, and preferably provides the nucleotide sequences of SEQ ID NO: 41 and SEQ ID NO: 43.
그리고, 본 발명은 인간화 모노클로날 폴리펩티드 Hu4785-2를 포함하고 항체 중쇄 불변영역을 발현하기 위한 플라스미드 Hu4785-2H/pcDNA (기탁번호: KCTC 10440BP) 및 인간화 모노클로날 폴리펩티드 Hu4785-2를 포함하고 항체 경쇄 불변영역을 발현하기 위한 플라스미드 Hu4785-2K/pcDNA (기탁번호: KCTC 10441BP)를 제공한다.In addition, the invention comprises a humanized monoclonal polypeptide Hu4785-2 and comprises a plasmid Hu4785-2H / pcDNA (Accession No .: KCTC 10440BP) and a humanized monoclonal polypeptide Hu4785-2 for expressing the antibody heavy chain constant region. Plasmid Hu4785-2K / pcDNA (Accession No .: KCTC 10441BP) for expressing the light chain constant region is provided.
상기 H2L2 형태의 인간화 모노클로날 폴리펩티드 Hu4785-2H/Hu4785-2K를 유효성분으로 함유하는 조성물은 장기이식 또는 자가면역질환에서 자기를 인지하는 자기항원에 의해 활성화된 세포독성 T 세포를 억제하는데 적용할 수 있다.The composition containing the humanized monoclonal polypeptide Hu4785-2H / Hu4785-2K of the H2L2 form as an active ingredient may be applied to inhibit cytotoxic T cells activated by autoantigens that recognize self in organ transplantation or autoimmune diseases. Can be.
ScFv는 결합부위가 한개 이지만, H2L2 형태는 결합부위가 2개라서 더 효과적인 결합이 일어나며, ScFv 형태는 인간의 생체에 존재하지 않는 형태이므로, 생체에 존재하는 H2L2 형태가 항원성이 더 낮다. 그리고 인간화된 Hu4785-H2L2의 불변부위(constant region)의 이형(isotype)인 IgG1은 세포에 결합되고 나서 보체(complement)를 고정시키므로 Hu4785-H2L2 항체가 결합한 세포독성 T 세포를 죽이는 반응이 일어난다. 이것은 장기이식 또는 자가면역질환에서 자기를 인지하는 자기 항원에 의해서 활성화된 세포독성 T 세포를 특이적으로 사멸시킴으로서 장기이식 거부반응과 자가면역반응의 원인이 되는 자기반응세포독성 T 세포(self reactive cytotoxic T cell)를 완전히 제거할 수 있다. 그러므로 H2L2 형태로의 전환이 바람직하다.ScFv has one binding site, but H2L2 forms two binding sites, so that more effective binding occurs. ScFv forms a non-existent human body, so H2L2 forms in the body have lower antigenicity. In addition, IgG1, an isotype of a constant region of humanized Hu4785-H2L2, binds to cells and then fixes complement, resulting in a reaction that kills cytotoxic T cells bound to Hu4785-H2L2 antibody. It specifically kills cytotoxic T cells activated by self-recognized self antigens in organ transplantation or autoimmune diseases, thereby causing self-reactive cytotoxic T cells that cause organ transplant rejection and autoimmune reactions. T cell) can be removed completely. Therefore, conversion to H2L2 form is preferred.
그러므로, 본 발명의 인간화 모노클로날 폴리펩티드들은 인간 4-1BB에 대한 결합 친화도가 높으면서 인간의 항체와 유사한 서열을 가지므로 자가면역 질환의 치료제 또는 장기이식 거부반응 등에 대한 면역억제제로서 부작용 없이 효과적으로 사용될 수 있다.Therefore, the humanized monoclonal polypeptides of the present invention have high binding affinity for human 4-1BB and have sequences similar to those of human antibodies, so that they can be effectively used without side effects as therapeutic agents for autoimmune diseases or immunosuppressive agents for organ transplant rejection. Can be.
본 발명은 인간화 모노클로날 폴리펩티드 Hu4785-2 또는 Hu4785-2H/Hu4785-2K를 유효성분으로 포함하는 자가면역질환 치료용 약학조성물을 제공한다.The present invention provides a pharmaceutical composition for treating autoimmune diseases comprising a humanized monoclonal polypeptide Hu4785-2 or Hu4785-2H / Hu4785-2K as an active ingredient.
또한, 본 발명은 인간화 모노클로날 폴리펩티드 Hu4785-2 또는 Hu4785-2H/Hu4785-2K를 유효성분으로 포함하는 장기 이식시 거부반응 방지 및 치료를 위한 면역억제용 약학조성물을 제공한다.The present invention also provides a pharmaceutical composition for immunosuppression for preventing and treating rejection in organ transplantation comprising the humanized monoclonal polypeptide Hu4785-2 or Hu4785-2H / Hu4785-2K as an active ingredient.
상기 자가면역질환은 류마티스 관절염, 만성염증성관절염, 루퍼스성 홍진(lupus erythematosus), 쇼그랜증후군, 자가면역으로 인한 갑상선염 (thyroiditis)과 같은 갑상선질환, 자가면역 당뇨병 등을 포함한다.The autoimmune diseases include rheumatoid arthritis, chronic inflammatory arthritis, lupus erythematosus, Shogran syndrome, thyroid diseases such as thyroiditis due to autoimmunity, autoimmune diabetes, and the like.
이러한 목적으로, 본 발명의 인간화 모노클로날 폴리펩티드를 유효성분으로 포함하는 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함하여 자가면역질환의 치료용 또는면역억제용 약학조성물로 제조될 수 있다. To this end, the composition comprising the humanized monoclonal polypeptide of the present invention as an active ingredient further comprises a suitable carrier, excipient and diluent commonly used in the manufacture of pharmaceutical compositions for the treatment or suppression of autoimmune diseases. It may be prepared as a pharmaceutical composition.
본 발명의 인간화 모노클로날 폴리펩티드를 포함하는 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는, 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.Carriers, excipients and diluents that may be included in a composition comprising a humanized monoclonal polypeptide of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate , Gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
본 발명의 약학조성물은 통상적으로 사용되는 붕해제, 감미제, 활택제, 향미제 등을 추가로 포함할 수 있으며, 통상적인 방법에 의해 경구 투여용 제제 또는 비경구 투여용 제제와 같은 단위 투여형 또는 수회 투여형 약제학적 제제로 제형화될 수 있다. The pharmaceutical composition of the present invention may further include a disintegrant, a sweetener, a lubricant, a flavoring agent, and the like, which are commonly used, and may be in a unit dosage form such as a preparation for oral administration or a preparation for parenteral administration by a conventional method or It may be formulated into several dosage forms.
본 발명에 따른 인간화 모노클로날 폴리펩티드를 포함하는 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.Compositions comprising the humanized monoclonal polypeptides according to the present invention may be prepared in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injectable solutions, respectively, according to a conventional method. Formulated in the form of can be used.
본 발명의 인간화 모노클로날 폴리펩티드의 사용량은 사용목적, 환자의 나이, 성별, 체중에 따라 달라질 수 있으나, 0.01 내지 5mg/kg, 바람직하게는 0.1 내지 0.5 mg/㎏의 양을 일일 1회 내지 수회 투여할 수 있다. 또한 특정 환자에 대한 투여용량 수준은 사용될 특정 항체, 투여경로, 투여시간,배 설율, 건강상태, 질환의 중증도, 성별, 체중, 나이, 식이 등에 따라서 증감될 수 있다. 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.The amount of the humanized monoclonal polypeptide of the present invention may vary depending on the purpose of use, the age, sex and weight of the patient, but the amount of 0.01 to 5 mg / kg, preferably 0.1 to 0.5 mg / kg once or several times a day. May be administered. In addition, the dosage level for a particular patient may be increased or decreased depending on the specific antibody to be used, route of administration, time of administration, excretion rate, health condition, severity of disease, sex, weight, age, diet, and the like. Therefore, the above dosage does not limit the scope of the present invention in any aspect.
이하 하기 실시예에 의하여 본 발명을 좀더 상세하게 설명하고자 한다. 단. 하기 실시예는 본 발명을 예시하기 위한 것일 뿐 본 발명의 범위가 이들만으로 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to the following examples. only. The following examples are only for illustrating the present invention, but the scope of the present invention is not limited thereto.
실시예 1: 4-1BB의 제조 Example 1: Preparation of 4-1BB
(단계 1) 하이브리도마 세포주 제조(Step 1) Preparation of hybridoma cell line
사람의 4-1BB 분자를 코딩하는 cDNA(울산대 면역제어연구소, 권병세교수)와 글루타치온 S 트랜스퍼라제(GST) 중 글루타치온이 결합하는 부위를 코딩하는 DNA(Pharmacia LKB Biotechnology사)를 결합시켜서 pGEX3 발현벡터(Pharmacia LKB Biotechnology사)를 제작하였다. human 4-1 BB의 세포외 부위와 GST를 결합시켜서 pGEX3에 넣었다. 이 벡터로 대장균(Top1, Stratagene사)을 형질 전환시킨 후 형질전환된 대장균의 단일 콜로니(colony)를 1X LB에 접종한 다음 37℃에서 12시간 진탕배양하였다. 이 배양액을 1× LB 100분의 1 부피로 접종하고 37℃에서 3시간 동안 진탕배양하였다. 여기에 0.1mM의 IPTG를 처리하고, 25℃에서 5시간동안 진탕배양하여 4-1BB-GST 융합단백질의 발현을 유도한 다음 배양액을 글루타치온 세파로즈-4B 컬럼(Pharmacia LKB Biotechnology사)에 넣고 용출완충액인 0.5M 글리신-HCl으로 용출시킴으로써 4-1BB-GST 융합단백질을 정제하였다.CDNA encoding human 4-1BB molecule (Ulsan University Immune Control Research Institute, Professor Kwon Byung-se) and DNA (Glutathione S Transferase (GST)) that encode the glutathione binding site (Pharmacia LKB Biotechnology Co., Ltd.) by combining the pGEX3 expression vector ( Pharmacia LKB Biotechnology). The extracellular site of human 4-1 BB and GST were combined and added to pGEX3. E. coli (Top1, Stratagene) was transformed with this vector, and then a single colony of transformed E. coli was inoculated in 1 × LB and shaken at 37 ° C. for 12 hours. The culture was inoculated in 1 × LB 1/100 volume and shaken at 37 ° C. for 3 hours. After treatment with 0.1 mM IPTG, shaking culture at 25 ° C. for 5 hours to induce the expression of 4-1BB-GST fusion protein, and then put the culture medium into a glutathione Sepharose-4B column (Pharmacia LKB Biotechnology). The 4-1BB-GST fusion protein was purified by eluting with phosphorus 0.5M glycine-HCl.
(단계 2) 면역(Step 2) Immunity
20㎍의 4-1BB-GST 융합단백질을 0.1㎖의 완전 프로인트 보조제(Freund complete adjuvant)와 섞어서 생후 4 내지 8주된 Balb/c 마우스의 복강 내에 주사하여 최소면역을 시켰다. 이 후 20㎍의 4-1BB-GST 융합단백질을 0.1㎖의 불완전 프로인트 보조제(Freund incomplete adjuvant)와 섞어서 3주 간격으로 2차례 복강내에 주사하여 면역화시켰다. 면역화시킨 최종일로부터 3일 후에 꼬리로부터 소량의 피를 채혈하여 효소면역 검정법에 의해 원하는 항체의 역가를 측정하였다, 면역가가 일정수준 이상이 되면 마우스로부터 비장을 적출하여 비장세포를 얻어 융합에 사용하였다.20 μg of 4-1BB-GST fusion protein was mixed with 0.1 ml of Freund complete adjuvant and injected intraperitoneally of Balb / c mice 4-8 weeks old to minimize immunity. Thereafter, 20 µg of 4-1BB-GST fusion protein was mixed with 0.1 ml of Freund's incomplete adjuvant and immunized by intraperitoneal injection twice at three weeks intervals. After 3 days from the last day of immunization, a small amount of blood was collected from the tail, and the titer of the desired antibody was measured by enzyme-immunoassay. When the immunity was above a certain level, spleens were extracted from the mice and splenocytes were used for fusion.
(단계 3) 세포융합(Step 3) Cell Fusion
면역화된 마우스로부터 얻은 비장세포를 SP2/0-Ag14 골수종 세포(ATCC CRL 1581)와 1:2로 혼합하고, 50% 폴리에틸렌글리콜 4000(Gibco BRL사)을 사용하여 융합시켰다(Mishell and SHiigi, Seledted Methods in Cellular Immunology, W. H. Freeman Company, 1980).Splenocytes from immunized mice were mixed 1: 2 with SP2 / 0-Ag14 myeloma cells (ATCC CRL 1581) and fused using 50% polyethylene glycol 4000 (Gibco BRL) (Mishell and SHiigi, Seledted Methods). in Cellular Immunology, WH Freeman Company, 1980).
하이브리도마 세포주를 선별하기 위해, 융합시킨 세포 혼합물을 HAT 배지(15% 송아지 태아 혈청, 0.1mM 하이포크산틴, 0.4μM 아미노프테린, 16μM 티미딘이 보강된 RPMI 1640 배지)내에 재현탁시킨 다음 3 ×107 세포/㎖의 농도로 96웰 마이크로 배양 트레이에 투입하여 5% CO2를 함유하는 37℃의 세포 배양기에서 배양하였다. 골수종세포 및 융합되지 않은 비장세포는 HAT 배지에서 잘 성장할 수 없으므로, 상기 배지에서 성장하는 세포는 융합이 이루어진 세포로 생각할 수 있다. 6, 7, 8일 후에 세포배양액의 1/2를 새로운 세포배양액으로 대체시켰다. 세포 증식 여부를 역상현미경을 이용하여 관찰하여 세포가 충분히 자랐을 때 96웰 마이크로 배양트레이로부터 항체를 포함하고 있는 상층액을 취하여 ELISA법을 수행하였다.To screen for hybridoma cell lines, the fused cell mixture was resuspended in HAT medium (15% calf fetal serum, 0.1 mM hypoxanthine, 0.4 μM aminopterin, RPMI 1640 medium supplemented with 16 μM thymidine) and then 3 The cells were placed in a 96-well micro culture tray at a concentration of 10 7 cells / ml and cultured in a 37 ° C cell incubator containing 5% CO 2 . Since myeloma cells and unfused splenocytes cannot grow well in HAT medium, the cells growing in the medium can be considered to be cells which have been fused. After 6, 7, 8 days half of the cell culture was replaced with fresh cell culture. The cell proliferation was observed using an inverted microscope, and when the cells were sufficiently grown, the supernatant containing the antibody was taken from the 96-well micro culture tray, and ELISA was performed.
(단계 4) 하이브리도마 세포주 선별(Step 4) Hybridoma Cell Line Selection
4-1BB-GST 융합단백질을 인산염 완충액(PBS, pH 7.2)에 희석하여 200ng/0.1㎖의 농도로 ELISA 플레이트에 코팅시켰다. 코팅이 완료된 플레이트를 인산염 완충액으로 여러 번 씻고 난 후, 1% 소혈청 알부민이 포함된 인산염 완충액을 플레이트에 가하여 1시간 동안 방치하고 인산염 완충액으로 여러번 씻은 다음, 상기에서 얻은 세포 상층액을 넣고 2시간 동안 반응시켰다. 반응이 완료된 플레이트를 인산염 완충액으로 다시 여러 번 씻고 알카라인 포스파타제가 결합된 염소 항-마우스 면역 글로불린(Southern Biotech사)을 1000배 희석하여 0.1㎖의 양으로 첨가하였다. 2시간 방치 후 인산염 완충액으로 여러 번 씻고, 기질(p-니트로페닐 인산 이나트륨염을 탄산염 완충액에 녹여서 1㎎/㎖로 만든 용액, pH 9.6) 0.1㎖을 첨가하여 실온에서 10분간 보존하였다. 이후 자동 마이크로 플레이트 기록계로 반응을 측정하고, 4-1BB 분자에 특이하게 작용하는 항체를 생성하는 하이브리도마 세포주를 4785(기탁번호:KCTC 0952BP)로 명명하였다. The 4-1BB-GST fusion protein was diluted in phosphate buffer (PBS, pH 7.2) and coated on an ELISA plate at a concentration of 200 ng / 0.1 mL. After the coated plate was washed several times with phosphate buffer, phosphate buffer containing 1% bovine serum albumin was added to the plate and left for 1 hour, washed several times with phosphate buffer, and the cell supernatant obtained above was added for 2 hours. Reacted for a while. After completion of the reaction, the plate was washed with phosphate buffer several times, and alkaline phosphatase-bound goat anti-mouse immunoglobulin (Southern Biotech) was diluted 1000-fold and added in an amount of 0.1 ml. After standing for 2 hours, the mixture was washed several times with phosphate buffer, and 0.1 ml of a substrate (p-nitrophenyl disodium salt dissolved in carbonate buffer, 1 mg / ml solution, pH 9.6) was added and stored at room temperature for 10 minutes. The reaction was then measured with an automated microplate recorder, and the hybridoma cell line producing an antibody that specifically acts on the 4-1BB molecule was named 4785 (Accession No .: KCTC 0952BP).
(단계 5) 하이브리도마 세포주를 이용한 항체의 제조(Step 5) Preparation of antibody using hybridoma cell line
상기 단계 4에서 제조된 4785 세포주 1 ×107개를 배양액에서 증식시킨 후 프리스테인(pristane : 2,6,10,14-테트라메틸펜타데칸, Sigma사) 0.5㎖로 미리 처리한 Balb/c 마우스의 복막에 주입하고 10일 후에 복수액을 수집하였다. 이 복수액을 프로테인-A 세파로즈 컬럼(Pharmacia사)을 이용하여 친화 크로마토그래피를 수행하여 모노클로날 항체를 분리하였다. 이 때 항체 생성율은 1㎖ 복수액 당 l㎎이었다.Balb / c mice pretreated with 0.5 ml of prestain (pristane: 2,6,10,14-tetramethylpentadedecane, Sigma) after propagating 1 × 10 7 4785 cell lines prepared in step 4 in a culture medium The ascites fluid was collected 10 days after injection into the peritoneum. This ascites was subjected to affinity chromatography using a Protein-A Sepharose column (Pharmacia) to separate monoclonal antibodies. The antibody generation rate at this time was 1 mg per 1 ml ascites fluid.
항체 분석키트를 사용하여 측정한 결과 제조된 모노클로날 항체는 IgG1인 것으로 나타났으며 카파 경사슬(kappa light chain)의 이형(isotype)을 갖고 있음을 확인하였다.As a result of the measurement using the antibody assay kit, the prepared monoclonal antibody was found to be IgG1 and it was confirmed that it had an isotype of kappa light chain.
실시예 2 : 생쥐의 모노클로날 항체 유전자의 클로닝Example 2 Cloning of Monoclonal Antibody Genes in Mice
(단계 1) 4785 세포주의 mRNA 추출(Step 1) mRNA Extraction of 4785 Cell Lines
2 ×108 개의 4785 세포에서 총 RNA를 다음과 같은 방법으로 추출하였다. 먼저, 세포 펠렛(pellet)에 트리퓨어 분리시약(TriPure Isolation Reagent, Sigma사)을 처리하고 페놀/클로로포름으로 1회 추출하였다. 상층액에 이소프로판올을 처리하여 RNA를 침전시키고 75% 에탄올로 2회 세척한 후에 DEPC(Sigma사)를 처리한 증류수에 녹여 총 RNA를 수득하였다. 수득한 총 RNA에서의 mRNA 추출은 다이날비드(Dynalbeads) mRNA 정제 키트(DYNAL사)를 사용하여 mRNA를 분리, 정제하였다.Total RNA was extracted from 2 x 10 8 4785 cells by the following method. First, cell pellets were treated with TriPure Isolation Reagent (Sigma) and extracted once with phenol / chloroform. The supernatant was treated with isopropanol to precipitate RNA, washed twice with 75% ethanol, and then dissolved in distilled water treated with DEPC (Sigma) to obtain total RNA. MRNA extraction from the total RNA obtained was isolated and purified mRNA using the Dynalbeads mRNA purification kit (DYNAL).
(단계 2) 4785 세포주의 cDNA 라이브러리 제작 (Step 2) cDNA library construction of 4785 cell line
4785세포주의 cDNA 라이브러리 제작을 위해서 ZAP-cDNA 합성 키트(STRATAGENE사) 및 ZAP-cDNA 기가팩 III 골드 클로닝 키트(Gigapack III Gold Cloning Kit, STRATAGENE사)를 사용하였다.ZAP-cDNA Synthesis Kit (STRATAGENE) and ZAP-cDNA Gigapack III Gold Cloning Kit (STRATAGENE) were used for the production of cDNA libraries of 4785 cell lines.
상기 단계 1에서 수득된 mRNA 5㎍, XhoI 인지서열을 갖는 서열번호: 19의 링커 프라이머 2.8㎍, RNase H- 역전사효소(40U, Stratagene사), 메틸 뉴클레오타이드 혼합물(1.25mM) 및 RNase 억제제(40U, Stratagene사)를 37℃에서 1 시간 동안 반응시켜 첫 번째 가닥을 합성하였다. 이어서, RNase H(3U)와 DNA 중합효소 I(99U, Stratagene사)를 이용하여 16℃에서 2시간 30분 동안 반응시켜 두 번째 가닥을 합성하였다. 반응 후 페놀-클로로포름으로 추출하고 에탄올을 이용하여 농축시킨 다음, 70% 에탄올로 세척한 후 침전물을 물에 녹이고 울트라프리-프로바인드 필터(Ultrafree-Probind filter, SIGMA사)를 사용하여 단백질을 제거하고 클레나우 단편(Klenow fragment)과 dNTP를 이용하여 3' 및 5' 말단을 평활말단으로 만들고 울트라프리-프로바인드 필터를 이용하여 단백질을 제거하였다. 이어서, rATP 2mM, T4 DNA 리가제(2U)를 첨가하고 4℃에서 12 시간 동안 반응시킨 다음, 70℃에서 30분 동안 가열하여 EcoRI 효소를 불활성화시켰다. 다시 rATP 2mM, T4 폴리뉴클레오타이드 키네이즈(10U)를 첨가하고, 37℃에서 30분 동안 반응시킨 다음 70℃에서 30분 동안 불활성화시켜 EcoRI 말단을 키네이즈화시켰다. 이어서, XhoI을 이용하여 절단한 다음, 울트라프리-프로바인드 필터를 이용하여 단백질을 제거하여 cDNA를 수득하였다. 에티디움 브로마이드 플레이트 분석을 이용하여 cDNA의 양을 결정하였다. cDNA 100ng에 Uni-ZAP XR 벡터(Stratagene사) 125㎍, rATP(1mM) 및 T4 DNA 리가제(2U)를 혼합하여 12℃에서 12시간 동안 반응시켰다. 80℃에 보관하던 패키징 추출물(packaging extract, Stratagene사)을 꺼내어 녹기 시작하면 상기 연결된 DNA 2㎕를 넣고 거품이 생기지 않게 조심하면서 피펫을 이용하여 혼합한 다음, 상온에서 2시간 동안 반응시켰다. 여기에 SM 완충액(100mM NaCl, 10mM MgSO4. 7H2O, 50mM Tris-HCl pH 7.5, 0.01% gelatin) 500㎕, 클로로포름 20㎕을 넣고 혼합한 다음, 원심분리하여 상층액을 새 튜브에 옮겼다.5 μg of the mRNA obtained in step 1, 2.8 μg of a linker primer having SEQ ID NO: 19 having an XhoI recognition sequence, RNase H - reverse transcriptase (40U, Stratagene), a methyl nucleotide mixture (1.25 mM), and an RNase inhibitor (40U, Stratagene) was reacted at 37 ° C. for 1 hour to synthesize the first strand. Subsequently, the second strand was synthesized by using RNase H (3U) and DNA polymerase I (99U, Stratagene) for 2 hours and 30 minutes at 16 ° C. After the reaction, the mixture was extracted with phenol-chloroform, concentrated using ethanol, washed with 70% ethanol, the precipitate was dissolved in water, and the protein was removed using an Ultrafree-Probind filter (SIGMA). Klenow fragment and dNTP were used to smooth the 3 'and 5' ends, and the protein was removed using an ultrapre-probind filter. Subsequently, rATP 2 mM, T4 DNA ligase (2U) was added and reacted at 4 ° C. for 12 hours, and then heated at 70 ° C. for 30 minutes to inactivate Eco RI enzyme. Again rATP 2mM, T4 polynucleotide kinase (10U) was added, and reacted for 30 minutes at 37 ℃ and inactivated for 30 minutes at 70 ℃ to kinase the Eco RI terminal. Subsequently, cleavage using Xho I was followed by removal of the protein using an UltraFree-Probind filter to obtain cDNA. Ethidium bromide plate analysis was used to determine the amount of cDNA. 125 μg of Uni-ZAP XR vector (Stratagene), rATP (1 mM) and T4 DNA ligase (2U) were mixed with 100 ng of cDNA and reacted at 12 ° C. for 12 hours. When the packaging extract (packaging extract, Stratagene) stored at 80 ° C was taken out and dissolved, 2 μl of the linked DNA was added and mixed with a pipette while being careful not to bubble, followed by reaction at room temperature for 2 hours. Here the SM buffer was placed the (100mM NaCl, 10mM MgSO 4. 7H 2 O, 50mM Tris-HCl pH 7.5, 0.01% gelatin) 500㎕, chloroform 20㎕ mixed, then centrifuged and the supernatant transferred to a new tube.
숙주 세포로는 대장균 XL-1 블루 MRF'(Stratagene사)를 이용하고, LB/테트라사이클린(50㎍/㎖) 플레이트에 도말하여 얻은 단일 콜로니를 10mM 황산마그네슘과 0.2% 말토즈를 포함하는 LB 배지에 접종하였다. 이를 37℃에서 OD600이 1.0이 넘지않게 200rpm으로 진탕하면서 키웠다. 이 배양액을 500×g에서 10분 동안 원심분리하면서 배지를 제거하고 세포 펠렛에 10mM 황산마그네슘을 가하여 OD600에서 0.5가 될 때까지 희석하였다. 이렇게 준비된 숙주세포는 4℃에 저장하면 48시간 동안 사용 가능하다.As a host cell, LB medium containing 10 mM magnesium sulfate and 0.2% maltose was obtained from a single colony obtained by E. coli XL-1 blue MRF '(Stratagene Co., Ltd.) and smearing onto LB / tetracycline (50 µg / ml) plate. Was inoculated. It was grown at 37 ° C. with OD 600 shaking at 200 rpm, not exceeding 1.0. The culture was centrifuged at 500 x g for 10 minutes to remove the medium and diluted to OD 600 to 0.5 by adding 10 mM magnesium sulfate to the cell pellet. Thus prepared host cells can be used for 48 hours when stored at 4 ℃.
숙주세포 200㎕에 1/10으로 희석한 패키징 반응산물(pakaged reaction)을 1㎕ 넣고, 37℃에서 15분 동안 부착시켰다. 여기에 48℃로 식힌 상층 아가(top agar)를 3㎖ 넣고 볼텍싱(vortexing)한 후에 예열한 LB 아가 플레이트에 즉시 부은 다음 37℃에서 10시간 동안 키운 후 플라크 수를 세어 ㎖당 pfu로 계산하였다. 그 결과 1.9 ×105 pfu를 얻었다.1 μl of a packaged reaction diluted in 1/10 was added to 200 μl of host cells, and attached at 37 ° C. for 15 minutes. 3 ml of the top agar cooled to 48 ° C. was vortexed, immediately poured onto a preheated LB agar plate, grown at 37 ° C. for 10 hours, and the number of plaques was counted as pfu / ml. . As a result, 1.9 x 10 5 pfu was obtained.
(단계 3) 중쇄 유전자와 카파 사슬 유전자의 스크리닝(Step 3) Screening of Heavy and Kappa Chain Genes
(단계 2)에서 얻은 형질전환 세포주를 100mm 플레이트에 각각 약 200-300개의 플라크가 형성되도록 플레이팅하고 나일론 막으로 옮겨 UV 교차연결(crosslinking)하였다. 이 막을 이용하여 하이브리다이제이션을 실시하였다. 이 때 중쇄(heavy chain)와 경쇄(light chain) 카파(kappa) 사슬의 스크리닝을 위한 프로브로는 PCR로 클로닝한 각각의 불변영역의 단편을 사용하였다. 자세하게는, 중쇄 프로브를 얻기 위한 PCR 프라이머는 마우스 IgG1의 cDNA의 CH1 영역을 얻기 위해서 서열번호 8의 G-1U: 5'-gaactctggatccctgtcca-3' 서열번호 9의 G-1D: 5'-tgcaaggcttacaaccacaa-3'를 사용했으며, 이를 이용하여 200bp의 PCR 산물을 얻어서 프로브로 사용하였다. 경쇄 프로브는 마우스 카파 사슬 cDNA의 CH1 영역을 얻기 위해서 서열번호 10의 K-1U: 5'- atcttcccaccatccagtga -3' 및 서열번호 11의 K-1D: 5'- cgtccttggtcaacgtgag -3'를 사용했으며, 이를 이용하여 200bp의 PCR 산물을 얻어서 프로브로 사용하였다. ECL 다이렉트 핵산 라벨링 및 검색 키트(direct nucleic acid labelling and detection kit)를 사용하여 하이브리다이제이션을 수행하였고, 이를 통해 수득된 클론들을 Exassit/SOLR 시스템을 사용하는 생체내 절제(in vivo excision)를 통하여 플라스미드로 전환시키고 서열을 확인하였다. 중쇄 유전자 및 카파 사슬의 아미노산 서열은 각각 서열번호: 38 및 39에 나타내었다.The transformed cell lines obtained in (Step 2) were plated to form about 200-300 plaques each on a 100 mm plate and transferred to a nylon membrane for UV crosslinking. Hybridization was carried out using this membrane. At this time, a fragment of each constant region cloned by PCR was used as a probe for screening heavy and light chain kappa chains. Specifically, the PCR primer for obtaining the heavy chain probe is G-1U: 5'-gaactctggatccctgtcca-3 'of SEQ ID NO: 8 G-1D: 5'-tgcaaggcttacaaccacaa-3 of SEQ ID NO: 8 to obtain the CH1 region of the cDNA of mouse IgG1. Was used to obtain a 200bp PCR product was used as a probe. The light chain probe used K-1U: 5'- atcttcccaccatccagtga -3 'of SEQ ID NO: 10 and K-1D: 5'- cgtccttggtcaacgtga3-3' of SEQ ID NO: 10 to obtain the CH1 region of the mouse kappa chain cDNA. PCR product of 200bp was obtained and used as a probe. Hybridization was performed using an ECL direct nucleic acid labeling and detection kit, and the resulting clones were subjected to plasmids through in vivo excision using an Exassit / SOLR system. And the sequence was confirmed. The amino acid sequences of the heavy chain gene and the kappa chain are shown in SEQ ID NOs: 38 and 39, respectively.
실시예 3: 4785 클론의 중쇄가변영역(VH)과 경쇄가변영역(VL)의 인간화Example 3: Humanization of heavy chain variable region (VH) and light chain variable region (VL) of 4785 clone
인간 항체 유전자 중에서 마우스의 단백질을 코딩하는 4785 클론의 가변 영역의 염기서열과 가장 유사한 것을 데이터 베이스 검색을 통하여 선별하고 이 염기서열을 4785의 염기서열과 비교하여 조합 항체 라이브러리의 제작에 필요한 PCR 주형 겸 프라이머를 제작하는데 사용하였다.Among the human antibody genes, the most similar to the nucleotide sequence of the variable region of the 4785 clone encoding the mouse protein was selected through a database search, and the nucleotide sequence was compared with the nucleotide sequence of 4785 to perform the PCR template for the preparation of the combinatorial antibody library. Used to prepare primers.
4785 클론의 중쇄 및 경쇄의 CDR과 FR 영역의 위치를 결정하고 인간의 아미노산 잔기로 바꿀 것인지 마우스의 잔기를 그대로 사용할 것인지는 하기 표 1에 따라 결정하였다. The positions of the CDR and FR regions of the heavy and light chains of the 4785 clone were determined, and whether to replace them with amino acid residues in humans or to use the residues in mice were determined according to Table 1 below.
중쇄 및 경쇄의 가변영역 서열 중에서 항원과 직접 결합하는 부분인 CDR 영역은 마우스의 서열로 그대로 두고, 정준 잔기(canonical residue)는 마우스의 서열, FR 영역에 존재하는 서열이라도 중쇄와 경쇄의 사이에 존재하는 서열은 마우스, 특이서열은 인간의 서열, 용매 표출 잔기는 마우스의 잔기로 하였다.Among the variable region sequences of the heavy and light chains, the CDR region, which is a portion that directly binds to the antigen, is left as the sequence of the mouse, and the canonical residue is present between the heavy and the light chain even if the sequence exists in the mouse sequence and the FR region. The sequence to be referred to was mouse, the specific sequence to human sequence, and the solvent-releasing residue to mouse residue.
이를 근거로 하여 4785 클론의 인간화 뉴클레오타이드 서열을 결정하였으며 이러한 법칙에 따라 얻어진 아미노산 서열과 인간 주형의 아미노산 서열을 비교하여 도 1 및 2에 나타내었다.Based on this, the humanized nucleotide sequence of the 4785 clone was determined, and the amino acid sequence obtained according to this law and the amino acid sequence of the human template were compared and shown in FIGS. 1 and 2.
실시예 4: 인간화된 4785 VH 및 VL 서열 결정Example 4 Determination of Humanized 4785 VH and VL Sequences
조합 항체 라이브러리를 만들기 위한 삽입체를 준비하기 위하여 4785 클론의 중쇄와 경쇄의 염기서열과 인간 주형의 염기서열을 비교해서 얻은 아미노산 서열을 근거로 하여 서열번호: 11 내지 23의 서열을 갖는 4785 VH 조합 프라이머 및 서열번호: 24 내지 34의 서열을 갖는 4785 VL 조합 프라이머를 제작하였다. 4785 VH combinations having the sequences of SEQ ID NOs: 11 to 23 based on amino acid sequences obtained by comparing the nucleotide sequences of the heavy and light chains of the 4785 clone with the nucleotide sequences of the human template to prepare the inserts for making the combinatorial antibody library 4785 VL combinatorial primers were prepared having a primer and a sequence of SEQ ID NOs: 24-34.
이렇게 제작된 프라이머를 주형 겸 프라이머로 사용하여 도 3 및 4에 제시된 바와 같은 순서로 VH 영역 및 VL 영역의 PCR을 수행하였다. PCR 반응은 전-변성 94℃, 5분; 94℃, 1분; 55℃, 1분; 72℃, 2분; 후-신장 72℃, 7분으로 35회 실시하였다. 이렇게 얻어진 PCR 산물을 정제 분리(퀴아젠 젤 추출 키트, Qaigen사)로 분리하여 인간화 VH 및 VL의 PCR 산물을 얻었으며, 이의 각 서열은 서열번호 3 및 4에 나타내었다.Using the primers thus prepared as templates and primers, PCR of the VH region and the VL region was performed in the order as shown in FIGS. 3 and 4. PCR reactions were pre-denatured 94 ° C., 5 min; 94 ° C., 1 minute; 55 ° C., 1 minute; 72 ° C., 2 minutes; Post-elongation was carried out 35 times at 72 ° C. for 7 minutes. The PCR product thus obtained was separated by purification separation (Qiagen Gel Extraction Kit, Qaigen) to obtain PCR products of humanized VH and VL, each of which is shown in SEQ ID NOs: 3 and 4.
실시예 5: 조합 VH와 조합 VL의 연결 및 제한효소 부위의 첨가Example 5: Linkage of Combination VH with Combination VL and Addition of Restriction Enzyme Sites
PCR로 얻은 VH와 VL을 링커 DNA를 이용해서 단일가닥으로 연결시키고 5'- 및 3'- 에 효소 부위를 첨가하기 위해 중쇄 산물 50ng, 경쇄 산물 50ng, 서열번호: 35의 4785 VH-Sfi-U(5μM) 1㎕, 서열번호: 36의 4785 VL-NotI-D(5μM) 1㎕, 서열번호: 37의 링커 프라이머 2㎕, 10 ×PCR 완충액 5㎕, dNTP 혼합물 2.5㎕, 25mM MgCl2 5㎕ 및 ExTag(5U, Takara사) 1㎕을 마이크로 원심분리 튜브에 넣고 증류수로 총량을 50㎕으로 조절하여 PCR을 수행하였다. PCR 반응은 전-변성 94℃, 5분; 94℃, 1분; 55℃, 1분; 72℃, 2분; 후-신장 72℃, 7분으로 35회 실시하였다. 이렇게 얻어진 PCR 산물(4785 ScFv DNA)을 퀴아젠 젤 추출 키트(QIAGEN사)로 분리하였다.To link VH and VL obtained by PCR into single strands using linker DNA and add enzyme sites to 5'- and 3'-, 50 ng of heavy chain product, 50 ng of light chain product, 4785 VH-Sfi-U of SEQ ID NO: 35 (5 μM) 1 μl, 1 μl 4785 VL-NotI-D (5 μM) of SEQ ID NO: 36, 2 μl of linker primer of SEQ ID NO: 37, 5 μl of 10 × PCR buffer, 2.5 μl of dNTP mixture, 5 μl of 25mM MgCl 2 And 1T of ExTag (5U, Takara Co., Ltd.) was put into a microcentrifuge tube and PCR was performed by adjusting the total amount to 50 μl with distilled water. PCR reactions were pre-denatured 94 ° C., 5 min; 94 ° C., 1 minute; 55 ° C., 1 minute; 72 ° C., 2 minutes; Post-elongation was carried out 35 times at 72 ° C. for 7 minutes. The PCR product (4785 ScFv DNA) thus obtained was isolated by Qiagen gel extraction kit (QIAGEN).
실시예 6: ScFv DNA 삽입체의 제한효소 처리 및 정제Example 6: Restriction Enzyme Treatment and Purification of ScFv DNA Inserts
(단계 1) SfiI 절단반응(Step 1) Sfi I cleavage reaction
정제된 ScFv DNA(상기 실시예 5 에서 얻어진 ScFv DNA) 1㎍, 10 ×Sfi 반응 완충액(Roche사) 8.5㎕, 제한효소 SfiI(10U/㎕, Roche사) 2㎕ 및 3차 증류수를 총량이 85㎕가 되도록 하는 양으로 혼합하고 85㎕의 미네랄 오일을 첨가하여 50℃에서 4 시간 동안 반응시켰다.The total amount of the purified ScFv DNA (ScFv DNA obtained in Example 5) 1㎍, 10 × Sfi reaction buffer (Roche Inc.) 8.5㎕, restriction enzyme Sfi I (10U / ㎕, Roche Inc.) and deionized water is 2㎕ The mixture was mixed in an amount of 85 μl, and 85 μl of mineral oil was added and reacted at 50 ° C. for 4 hours.
(단계 2) NotI 절단반응(Step 2) Not I cleavage reaction
단계1에서 준비된 Sfi I으로 절단된 ScFv에 3M 염화나트륨 3.6㎕, 10 ×완충액(NotI 반응 완충액 : 50mM Tris-HCl, 100mM NaCl, 10mM MgCl2, 1mM dithioerythritol, pH7.5, Roche사) 1.5㎕, 제한효소 NotI(10U/㎕, Roche사) 4㎕ 및 3차 증류수를 총량이 15㎕가 되도록 하는 양으로 혼합하여 37℃에서 4시간 동안 반응시켰다. 페놀/클로로포름으로 추출하고, 스펀-칼럼(Pharmacia Biotech사) 정제로 분리시켰다.3M sodium chloride 3.6㎕, 10 × buffer, the ScFv cut with Sfi I prepared in step 1 (Not I reaction buffer: 50mM Tris-HCl, 100mM NaCl , 10mM MgCl 2, 1mM dithioerythritol, pH7.5, Roche Inc.) 1.5㎕, 4 μl of restriction enzyme Not I (10 U / μl, Roche) and tertiary distilled water were mixed in an amount of 15 μl and reacted at 37 ° C. for 4 hours. Extracted with phenol / chloroform and separated by spun-column (Pharmacia Biotech) purification.
실시예 7: ScFv의 정량과 클로닝 Example 7: Quantification and Cloning of ScFv
0.75cm 두께의 1%의 아가로즈 젤에 12.5ng과 25ng의 ScFv 마커를 분리정제된 ScFv DNA와 같이 전기영동하여 비교함으로써 ScFv DNA를 정량한 후, 4785 ScFv DNA 150ng, 10 ×OPA 완충액 5㎕, pCANTAB 5E(50ng/㎕, Pharmacia Biotech사) 5㎕, 10mM ATP 5㎕, T4 DNA 리가제(4U/㎕) 2㎕ 및 3차 증류수를 총량이 50㎕가 되도록 하는 양으로 혼합하여 16℃에서 1 시간 동안 반응시키고, 70℃에서 10분 동안 리가제를 열 불활성화시킨 다음, 얼음에서 5분 동안 식혔다. ScFv DNA was quantified by electrophoresis of 12.5 ng and 25 ng of ScFv markers on a 0.75 cm thick 1% agarose gel followed by electrophoresis with the purified purified ScFv DNA, 150 ng of 4785 ScFv DNA, 5 μl of 10 × OPA buffer, 5 μl of pCANTAB 5E (50 ng / μl, Pharmacia Biotech), 5 μl of 10 mM ATP, 2 μl of T4 DNA ligase (4 U / μl) and tertiary distilled water in an amount such that the total amount is 50 μl. The reaction was allowed to react for hours and the heat inactivation of the ligase at 70 ° C. for 10 minutes, followed by cooling on ice for 5 minutes.
실시예 8: 수용성 세포(Competent cell)의 준비Example 8: Preparation of Competent Cells
TG1 대장균(Pharmacia Biotech사)의 글리세롤 원료(glycerol stock)를 최소 배지 플레이트에 도말(streaking)하여 37℃에서 하룻밤 동안 배양하였다. 최소 배양배지 플레이트의 단일 콜로니를 5㎖ 2 ×YT 배지(Bacto-tryptone 17g, Bacto-yeast extract 10g, NaCl 5g in dH2O 1 liter)에 접종하고 37℃에서 12시간 동안 배양하였다. 수득된 배양액 1㎖을 100㎖의 2 ×YT 배지에 접종하고 250rpm으로 교반하면서 OD600이 0.4 내지 0.5에 이를 때까지 배양하였다. 이어서, 4℃, 2500 ×g에서 15분 동안 원심분리하고, 세포 침전물을 10㎖의 차가운 TSS(1g Bacto-tryptone, 0.5g Bacto-yeast extract, 0.5g NaCl, 10g PEG(M.W. 3350), 5㎖ dimethylsulfoxide, 5㎖ 1M MgCl2 in 100㎖ 증류수(pH 6.5), 0.22㎛ 필터로 여과 후멸균)에서 재현탁시키고 얼음에서 보관하였다.Glycerol stock of TG1 E. coli (Pharmacia Biotech) was streaked on a minimal medium plate and incubated overnight at 37 ° C. Single colonies of minimal culture plates were inoculated in 5 ml 2 × YT medium (17 g Bacto-tryptone 17 g, Bacto-yeast extract 10 g, NaCl 5 g in dH 2 O 1 liter) and incubated at 37 ° C. for 12 hours. 1 ml of the obtained culture was inoculated in 100 ml of 2 x YT medium, and cultured until the OD 600 reached 0.4 to 0.5 with stirring at 250 rpm. Subsequently, centrifugation at 4 ° C., 2500 × g for 15 minutes, and the cell precipitate was washed with 10 ml of cold TSS (1 g Bacto-tryptone, 0.5 g Bacto-yeast extract, 0.5 g NaCl, 10 g PEG (MW 3350), 5 ml). dimethylsulfoxide, 5 ml 1 M MgCl 2 in 100 ml distilled water (pH 6.5), filtered after sterilization with a 0.22 μm filter) and stored on ice.
실시예 9: 형질전환과 라이브러리 제조.Example 9: Transformation and Library Preparation.
상기에서 준비된 수용능력이 있는(competent) TG1 세포 1㎖에 연결 반응액을 첨가하고, 얼음에서 45분 동안 방치하였다. 이 혼합물을 42℃에서 2분 동안 배양한 다음, 얼음에서 식혔다. 이 중 100㎕에 900㎕의 LBG(Bacto-tryptone 1g, Bacto-yeast extract 0.5g, NaCl 0.5g / dH2O 100㎖, 2M glucose 1㎖ 첨가)를 첨가하여, 250rpm으로 교반하면서 배양하였다. 이렇게 형질전환된 세포를 여러 비율로 희석하여 SOBAG 플레이트(Bacto-tryptone 20g, Bacto-yeast extract 5g, NaCl 0.5g / dH2O 1 리터, 1M MgCl2 10㎖, 2M glucose 55.6㎖, 20㎎/㎖ 암피실린 5㎖, Bacto agar 15g)에 플레이팅하여 cfu를 확인한 결과 6 ×106 cfu의 라이브러리를 수득하였다.The ligation reaction solution was added to 1 ml of competent TG1 cells prepared above and left for 45 minutes on ice. The mixture was incubated at 42 ° C. for 2 minutes and then cooled on ice. To 100 μl of this, 900 μl of LBG (1 g of Bacto-tryptone, 1 g of Bacto-yeast extract, 0.5 g of NaCl, 0.5 g / dH 2 O, and 1 ml of 2M glucose) was added, followed by incubation at 250 rpm. The transformed cells were diluted in various ratios to prepare SOBAG plates (20 g Bacto-tryptone 20 g, Bacto-yeast extract 5 g, NaCl 0.5 g / dH 2 O 1 liter, 1 M MgCl 2 10 ml, 2 M glucose 55.6 ml, 20 mg / ml). Ampicillin 5ml, Bacto agar 15g) was plated cfu was confirmed to give a library of 6 × 10 6 cfu.
실시예 10: 4785 재조합 파지 항체 라이브러리로의 전환Example 10 Conversion to 4785 Recombinant Phage Antibody Library
상기에서 수득한 박테리아 라이브러리 900㎕에 9.1㎖의 2 ×YT-G 배지를 첨가하고, 250rpm으로 교반하면서 37℃에서 1 시간 동안 배양하였다. 세포를 침전시키기 위해서 1000×g에서 10분 동안 원심분리한 다음 상층액을 제거하였다.9.1 ml of 2 × YT-G medium was added to 900 µl of the bacterial library obtained above, and incubated at 37 ° C. for 1 hour with stirring at 250 rpm. The cells were centrifuged at 1000 x g for 10 minutes to precipitate the cells, and then the supernatant was removed.
침전물에 10㎖의 2 ×YT-AK 배지(2×YT 배지, 100㎍/㎖ 암피실린, 50㎍/㎖ 카나마이신)를 첨가하고, 250rpm으로 교반하면서 37℃에서 하룻밤 동안 배양하였다. 세포를 침전시키기 위해 1000×g에서 20분 동안 원심분리시키고 상층액을 50㎖의 원추형 멸균 튜브에 옮겼다. 이어서, 0.45㎛ 여과막을 통과시킨 후 4℃에서 보관하였다.10 ml of 2 × YT-AK medium (2 × YT medium, 100 μg / ml ampicillin, 50 μg / ml kanamycin) was added to the precipitate and incubated at 37 ° C. overnight with stirring at 250 rpm. The cells were centrifuged at 1000 × g for 20 minutes to precipitate the cells and the supernatant was transferred to 50 ml conical sterile tubes. Subsequently, the mixture was stored at 4 ° C. after passing through a 0.45 μm filtration membrane.
실시예 11: 재조합 파지의 PEG 침전Example 11: PEG Precipitation of Recombinant Phage
4785 재조합 파지 항체 라이브러리에 2㎖의 PEG/NaCl(PEG 8000 200g, NaCl 146.1g 1 리터의 물에 녹이고 멸균한다.)를 가하고 잘 혼합한 다음 얼음에서 60분 동안 배양하였다. 이어서 4℃, 10000×g에서 20분 동안 원심분리하고 상층액을 제거하였다. 침전물에 16㎖의 2 ×YT 배지를 첨가하여 혼합한 다음, 0.45㎛의 여과막을 통과시킨 후 패닝(panning)을 실시하였다.To 4785 recombinant phage antibody library, 2 ml of PEG / NaCl (dissolved and sterilized in 200 g of PEG 8000, 146.1 g of NaCl in 1 liter of water) were mixed well and incubated for 60 minutes on ice. Subsequently, the mixture was centrifuged at 4 ° C. at 10000 × g for 20 minutes and the supernatant was removed. 16 ml of 2 × YT medium was added to the precipitate, mixed, and passed through a 0.45 μm filtration membrane, followed by panning.
실시예 12: 항원-양성 재조합 파지 항체의 선택을 위한 패닝(panning)Example 12 Panning for Selection of Antigen-Positive Recombinant Phage Antibodies
0.05M 카보네이트 완충액(pH 9.6)에 4-1 BB단백질을 10㎍/㎖이 되게 희석시킨 후 상온에서 1-2 시간 동안 T25(Corning사) 플라스크에 코팅하였다. 이어서, PBS로 플라스크를 3회 세척한 다음, 블로킹 완충액(blocking buffer, 10% non fat milk in 1×PBS)으로 플라스크를 가득 채우고 상온에서 1 시간 동안 두었다. 이어서, PBS로 3회 세척한 다음, 0.01% 소디움 아지드를 포함하는 블로킹 완충액 14㎖에 PEG 침전된 재조합 파지 16㎖을 희석하고 상온에서 15분간 반응시켰다. 이 희석액 중 재조합 파지 20㎖를 플라스크에 넣고 37℃에서 2 시간 동안 반응시켰다. 이어서, 50㎖의 PBS로 플라스크를 20번 세척한 다음, 50㎖의 0.1% PBS-T로 20번 세척하였다. 대수기(log-phase)에 있는 TG1 세포(Pharmacia Biotech사) 10㎖를 플라스크에 넣고, 37℃에서 1 시간 동안 배양한 다음, 배양액 중 100㎕를 2×YT 배지로 1:10, 1:100 및 1:1000으로 희석하여, SOBAG 플레이트에 100㎕씩 플레이팅하고 30℃에서 하룻밤 동안 배양하였다.4-1 BB protein was diluted to 10 µg / ml in 0.05 M carbonate buffer (pH 9.6) and then coated in a T25 (Corning) flask at room temperature for 1-2 hours. Subsequently, the flask was washed three times with PBS, and then the flask was filled with blocking buffer (10% non fat milk in 1 × PBS) and left at room temperature for 1 hour. Then, after washing three times with PBS, 16ml PEG precipitated recombinant phage was diluted in 14ml of the blocking buffer containing 0.01% sodium azide and reacted at room temperature for 15 minutes. 20 ml of the recombinant phage in this dilution was placed in a flask and reacted at 37 ° C for 2 hours. The flask was then washed 20 times with 50 ml PBS and then 20 times with 50 ml 0.1% PBS-T. 10 ml of log-phase TG1 cells (Pharmacia Biotech) were placed in a flask, incubated at 37 ° C. for 1 hour, and then 100 μl of the culture solution was added in 2 × YT medium at 1:10, 1: 100. And 1: 1000 diluted to 100 μl plate on SOBAG plate and incubated overnight at 30 ° C.
상기 플레이트의 cfu를 계산하여 라이브러리 크기를 추정한 결과 9 ×104 cfu를 수득하였다.The cfu of the plate was calculated to estimate the library size, yielding 9 × 10 4 cfu.
실시예 13: 스크리닝을 위한 단일 클론 제조Example 13: Monoclonal Preparation for Screening
패닝 후에 얻어진 800개의 콜로니를 각각 200㎕의 2×YT-AG 배지(Bacto-tryptone 17g, Bacto-yeast extract 10g, NaCl 5g / dH2O 1 리터, 100㎍/㎖ 암피실린, 2% 글루코스 포함)가 함유된 96-웰 플레이트에 접종하여 250rpm으로 교반하면서 37℃에서 하룻밤 동안 배양하였다.The 800 colonies obtained after panning were each 200 μl of 2 × YT-AG medium (17 g of Bacto-tryptone, 10 g of Bacto-yeast extract, 1 liter of NaCl 5 g / dH 2 O, 100 μg / ml ampicillin, 2% glucose). The inoculated 96-well plate was incubated overnight at 37 ℃ with stirring at 250rpm.
M13KO7 헬퍼 파지(Pharmacia Biotech사) 2.5 ×1010 pfu가 포함된 2×YT-AG 배지 50㎖를 96 웰 플레이트에 200㎕씩 각각 분주하였다. 이 플레이트에 상기 하룻밤 동안 배양한 배양액을 40㎕ 씩 접종하였다. 접종한 플레이트를 150rpm으로 교반하면서 37℃에서 2 시간 동안 배양한 다음, 1500 ×g에서 상온에서 20분 동안 원심분리하여 상층액을 제거하고 200㎕의 2×YT-AK(2×YT medium, 100㎍/㎖ 암피실린 및 50㎍/㎖ 카나마이신 포함) 배지를 각 웰에 첨가하였다. 이어서, 250rpm으로 교반하면서 37℃에서 배양한 다음, 1500×g에서 상온에서 20분 동안 원심분리하고 상층액으로 ELISA를 실시하여 스크리닝하였다.50 ml of 2 × YT-AG medium containing 2.5 × 10 10 pfu of M13KO7 helper phage (Pharmacia Biotech Co., Ltd.) were dispensed in 200 μl each into a 96 well plate. The plates were inoculated with 40 µl of the culture solution overnight. The inoculated plate was incubated at 37 ° C. for 2 hours with stirring at 150 rpm, then centrifuged at 1500 × g for 20 minutes at room temperature to remove supernatant and 200 μl of 2 × YT-AK (2 × YT medium, 100 Μg / ml ampicillin and 50 μg / ml kanamycin) medium was added to each well. Subsequently, the mixture was incubated at 37 ° C with stirring at 250 rpm, then centrifuged at 1500 x g for 20 minutes at room temperature, and screened by ELISA as a supernatant.
0.05M 카보네이트 완충액(pH 9.6)에 4-1 BB 단백질을 10㎍/㎖이 되게 희석한 후 상온에서 1-2시간동안 ELISA 플레이트에 200㎕ 씩 코팅하였다. 이어서, PBS로 플레이트를 3회 세척한 다음, 블로킹 완충액(10% non fat milk in 1×PBS) 200㎕씩 각 웰에 넣고 1 시간 동안 상온에서 반응시켰다. 이어서, 0.01% PBS-T로 플레이트를 3회 세척한 다음, 미리 블로킹된 미량 역가 플레이트 위에서 얻어진 상기 재조합 파지 항체 상층액 100㎕를 첨가하고, 여기에 블로킹 완충액을 동량 섞어서 상온에서 30 분 동안 반응시켰다.After diluting the 4-1 BB protein to 10 µg / ml in 0.05 M carbonate buffer (pH 9.6), 200 µl each was coated on an ELISA plate for 1-2 hours at room temperature. Subsequently, the plate was washed three times with PBS, and then 200 µl of blocking buffer (10% non fat milk in 1 × PBS) was added to each well and allowed to react at room temperature for 1 hour. Subsequently, the plate was washed three times with 0.01% PBS-T, and then 100 µl of the recombinant phage antibody supernatant obtained on the previously blocked microtiter plate was added thereto, and the same amount of blocking buffer was added thereto to react at room temperature for 30 minutes. .
희석된 재조합 파지 항체 상층액 200㎕를 항원 코팅된 웰에 넣고, 상온에서 1시간 동안 반응시켰다. 이어서, 0.01% PBS-T로 플레이트를 5회 세척한 다음, 블로킹 완충액에 HRP/항-M13 모노클로날 콘주게이트(Pharmacia Biotech사)를 1:5000으로 희석하여 각 웰에 200㎕씩 첨가하고, 상온에서 1시간 동안 반응시켰다. 이어서, 0.01% PBS-T로 플레이트를 6회 세척한 다음, 각 96웰 플레이트 당 36㎕의 30% H2O2를 첨가한 21㎖ 1×ABTS 원료액(Sigma사)을 각 웰당 200㎕ 씩 첨가하고, 20분간 상온에서 반응시킨 다음, 410nm에서 흡광도를 측정하여 0.2 이상의 흡광도를 가지는 19개의 클론을 수득하여 이를 양성 클론으로 정하였다. 하기 표 2는 ELISA를 통해서 얻어진 각 클론의 흡광도를 나타낸 것이다.200 μl of the diluted recombinant phage antibody supernatant was placed in an antigen-coated well and allowed to react at room temperature for 1 hour. Subsequently, wash the plate 5 times with 0.01% PBS-T, then dilute HRP / anti-M13 monoclonal conjugate (Pharmacia Biotech) 1: 5000 in blocking buffer and add 200 μL to each well, The reaction was carried out at room temperature for 1 hour. Subsequently, the plates were washed six times with 0.01% PBS-T, followed by 200 µl of 21 ml 1 × ABTS stock solution (Sigma), each containing 36 µl of 30% H 2 O 2 per 96 well plate. After the addition, the mixture was allowed to react at room temperature for 20 minutes, and the absorbance was measured at 410 nm to obtain 19 clones having an absorbance of 0.2 or more, which was designated as a positive clone. Table 2 below shows the absorbance of each clone obtained through ELISA.
상기 19개의 클론의 전체 서열을 확인하고 비교하여 중복된 것을 제외시켜 8가지의 군으로 나누어 하기 표 3에 나타내었다.The entire sequence of the 19 clones was identified and compared, and shown in Table 3 divided into eight groups except for overlapping ones.
상기의 Hu4785-2클론의 염기서열을 포함하는 pCANTAB/Hu4785-2 플라스미드로 형질전환된 TG1세포를 생명공학연구소 유전자은행에 KCTC 10365BP로 기탁하였다.TG1 cells transformed with the pCANTAB / Hu4785-2 plasmid containing the nucleotide sequence of the Hu4785-2 clone were deposited as KCTC 10365BP in the Biotechnology Research Institute Gene Bank.
실시예 14: 단백질 발현과 정제Example 14 Protein Expression and Purification
항원에 결합하는 것으로 밝혀진 8가지 군의 M13 파지를 수용성 ScFv 상태로 전환시키기 위해 대장균 HB2151(Pharmacia Biotech사)에 감염시켜 대장균을 형질전환시켰다. 각 세균성 클론들을 80㎖의 2×YT-AG에 접종하고 37℃에서 250rpm으로 교반하면서 하룻밤 동안 배양하였다. 이를 다시 800㎖의 2×YT-AG에 접종하고 37℃에서 250rpm으로 교반하면서 1시간 동안 배양한 다음, 5000rpm에서 10분 동안 원심분리하였다. 수득된 펠렛을 800㎖의 2×YT-AI 배지(Bacto-tryptone 17g, Bacto-yeast extract 10g, NaCl 5g/dH2O 1 리터)에 가하여 37℃에서 250rpm으로 교반하면서 4시간동안 배양한 후, 6000rpm에서 10분 동안 원심분리하였다. 수득된 펠렛에 차가운 1 ×TES(0.2M Tris-HCl(pH 8.0), 0.5mM EDTA, 0.5M 수크로즈) 8㎖을 넣어서 완전히 섞고 1/5 ×TES 12㎖을 첨가하여 잘 혼합한 후, 얼음 상에서 30분 동안 배양한 다음, 12000rpm에서 10분 동안 원심분리하여 상층액을 새 튜브로 옮기고 RPAS 정제 모듈(Pharmacia Biotech사, Cat.# 17-1362-01)을 사용하여 정제하여 그 결과는 도 5에 나타내었다. 도 5는 인간화된 항-h4-1BB ScFv를 항-E 태그 세파로스를 이용하여 인간화된 ScFv의 순수 분리한 결과를 나타낸 도이다.E. coli was transformed by infecting E. coli HB2151 (Pharmacia Biotech) to convert the eight groups of M13 phages found to bind antigen to a water-soluble ScFv state. Each bacterial clone was inoculated in 80 ml of 2 × YT-AG and incubated overnight with stirring at 250 rpm at 37 ° C. It was again inoculated in 800 ml of 2 × YT-AG, incubated for 1 hour with stirring at 250 rpm at 37 ℃, and centrifuged for 10 minutes at 5000 rpm. The obtained pellet was added to 800 ml of 2 × YT-AI medium (Bacto-tryptone 17g, Bacto-yeast extract 10g, NaCl 5g / dH 2 O 1 liter) and incubated for 4 hours with stirring at 250 rpm at 37 ° C. Centrifugation at 6000 rpm for 10 minutes. 8 ml of cold 1 × TES (0.2M Tris-HCl (pH 8.0), 0.5mM EDTA, 0.5M sucrose) was added to the obtained pellet, thoroughly mixed, 12 ml of 1/5 × TES was added, and the mixture was mixed well. Incubate for 30 minutes on the bed, then centrifuge at 12000 rpm for 10 minutes to transfer the supernatant to a new tube and purified using the RPAS purification module (Pharmacia Biotech, Cat. # 17-1362-01), the results are shown in Figure 5 Shown in FIG. 5 shows the results of pure separation of humanized ScFv from humanized anti-h4-1BB ScFv using anti-E tag Sepharose. FIG.
실시예 15 : 각 ScFv의 친화력(affinity) 측정Example 15 Measurement of Affinity of Each ScFv
ScFv의 친화력을 측정하기 위하여 SPR(Surface Plasmon Resonance)를 이용하여 생분자간 상호작용(biomolecular interaction)을 분석하는 장비인 BIAcore2000(BIAcore사)로 ScFv를 갖는 Hu4785 클론(항-h4-1BB ScFv)들과 4-1BB-GST 융합 단백질 사이의 분자간 상호작용을 분석하였다.In order to measure the affinity of ScFv, Hu4785 clones (anti-h4-1BB ScFv) having ScFv with BIAcore2000 (BIAcore), a device for analyzing biomolecular interactions using Surface Plasmon Resonance (SPR). Intermolecular interactions between the 4-1BB-GST fusion proteins were analyzed.
결과는 아래의 표 4와 같다. 결과에서 KD(equilibrium dissociate rate constant) 값을 비교해 보면, 4785는 2.94 ×109이며, Hu4785-2은 3.04 ×1012 이며, Hu4785-10은 8.23 ×109 인 것을 볼 수 있다. 이것은 친화도가 Hu4785-2은 마우스 4785보다 약 1000배 친화도가 높은 것을 나타내는 것이다.The results are shown in Table 4 below. Comparing the equilibrium dissociate rate constant (KD) in the results, it can be seen that 4785 is 2.94 × 10 9 , Hu4785-2 is 3.04 × 10 12 , and Hu4785-10 is 8.23 × 10 9 . This indicates that the affinity Hu4785-2 is about 1000 times higher than the mouse 4785.
실시예 16: 경쟁적(Competitive) ELISAExample 16: Competitive ELISA
4-1 BB-GST를 코팅 완충액에 5㎍/㎖로 희석하여 ELISA 플레이트에 코팅한 다음, PBS로 3회 세척하고 1% BSA-PBS로 실온에서 1 시간 동안 차단한 후 PBS로 3회 세척하였다. 동일한 농도의 8가지 ScFv와 바이오틴 표지된 항-4-1 BB mAb 4785를 50㎕에 4785를 0, 0.25, 0.5, 1, 2, 4, 8㎍/㎖ 첨가하고 총 부피를 1% BSA-PBS를 사용하여 100㎕로 조절한 후 15분 동안 반응시킨 후에 ELISA 플레이트에 첨가하여 실온에서 1 시간 동안 반응시킨 다음, PBS-0.05% 트윈으로 5회 세척하였다. 이에 대한 대조군 Ab로는 항-TR2 mAb인 108(Immunomics사/본사제조)을 사용하였다. 1:10000으로 희석한 HRP-콘쥬게이트된 항-E 태그 Ab(Pharmacia Biotech사) 100㎕를 처리하여 실온에서 1 시간 동안 반응시켰다. 이어서, PBS-0.05% 트윈으로 5회 세척한 다음, ABTS 기질 100㎕를 처리하고 405nm에서 흡광도를 측정하고 하기 수학식 1에 따라 억제율(%)을 계산하였으며, 그 결과는 도 6에 나타내었다.4-1 BB-GST was diluted to 5 μg / ml in coating buffer and coated on ELISA plate, washed three times with PBS, blocked with 1% BSA-PBS for 1 hour at room temperature, and three times with PBS. . Eight ScFv and biotin-labeled anti-4-1 BB mAb 4785 at the same concentration were added to 50 μl of 4785 at 0, 0.25, 0.5, 1, 2, 4, 8 μg / ml and the total volume was 1% BSA-PBS. After adjusting to 100ul using the reaction for 15 minutes, it was added to the ELISA plate and reacted for 1 hour at room temperature, and then washed 5 times with PBS-0.05% Tween. A control Ab for this was used as an anti-TR2 mAb 108 (manufactured by Immunnomics, Inc.). 100 μl of HRP-conjugated anti-E tag Ab (Pharmacia Biotech) diluted 1: 10000 was treated and reacted at room temperature for 1 hour. Subsequently, after washing five times with PBS-0.05% Tween, 100 μl of the ABTS substrate was treated, and the absorbance was measured at 405 nm, and the inhibition rate (%) was calculated according to Equation 1 below, and the results are shown in FIG. 6.
경쟁적 ELISA는 각 클론이 원래의 마우스 4785와 같은 에피토프(epitope)를 가지는가를 확인하기 위한 실험이다. 경쟁적 ELISA는 Ag에 인간화(humanization)하기 전의 마우스 단일클론항체(mouse mAb)의 농도가 증가됨에 따라 인간화된 ScFv의 결합이 얼마나 감소되는지를 % 억제율(% inhibition) 값으로 얻을 수 있다. 도 6의 결과에서 마우스 mAb의 농도가 증가함에 따라 % 억제율이 증가하는 것으로 보아 인간화된 ScFv가 원래의 mAb와 같은 에피토프을 가지고 경쟁하는 것을 증명할 수 있었으며, 이것은 인간화된 ScFv가 원래의 mAb와 같은 생물학적 효과(biological effect)를 가질 것이라는 것을 강력히 암시하는 것이다. Competitive ELISA is an experiment to determine whether each clone has the same epitope as the original mouse 4785. Competitive ELISA can be obtained as a% inhibition value to see how much the binding of humanized ScFv decreases as the concentration of mouse mAb prior to humanization with Ag increases. In the results of FIG. 6, the percent inhibition rate increased with increasing mouse mAb concentration, demonstrating that humanized ScFv competes with the same epitope as the original mAb, which indicates that the humanized ScFv has the same biological effect as the original mAb. It strongly suggests that it will have a biological effect.
실시예 17: FACS를 이용한 결합 친화도의 측정Example 17 Determination of Binding Affinity Using FACS
인간 Jurkat 8-1 세포주는 인간 4-1BB를 안정적으로 발현하도록 감염된 세포주로서, 형광활성세포분류기(fluorescent activated cell sorter, FACS) 분석에 사용되었다. 5x105 개의 Jurkat 8-1 세포에 50㎕의 FACS 완충액(1XPBS, 0.1% sodium azide, 1% FBS)을 넣고 각각의 1차 항체를 처리하였다. 1차 항체로 마우스 4785(A)와 Hu4785-2 단백질(B)을 4℃에서 30분 동안 처리하였다. 마우스 IgG1은 비특이적인 반응을 알아보기 위한 이형대조군(isotype control)으로 사용하였다. 세포를 FACS 완충액으로 세척한 다음, (A)은 FITC(fluorescein isothiocyanate)가 표지된 토끼 항마우스 IgG(Jackson ImmunoResearch Laboratory Inc.)를 4℃에서 30분 동안 처리하였으며, (B)는 항-E-태그 항체(anti-E-Tag antibody)와 항-마우스 IgG-FITC (anti-mouse IgG-FITC)를 차례로 처리하여 FACS 완충액으로 3회 세척한 후에 FACS 분석하였다. 그 결과를 도 7에 나타내었다.Human Jurkat 8-1 cell line is a cell line infected to stably express human 4-1BB and was used for fluorescence activated cell sorter (FACS) analysis. 50 μl of FACS buffer (1XPBS, 0.1% sodium azide, 1% FBS) was added to 5 × 10 5 Jurkat 8-1 cells and each primary antibody was treated. The primary antibody was treated with mouse 4785 (A) and Hu4785-2 protein (B) at 4 ° C. for 30 minutes. Mouse IgG1 was used as an isotype control to identify nonspecific responses. After washing the cells with FACS buffer, (A) was treated with rabbit anti-mouse IgG (Jackson ImmunoResearch Laboratory Inc.) labeled with fluorescein isothiocyanate (FITC) for 30 minutes at 4 ° C, and (B) was anti-E- The tag antibody (anti-E-Tag antibody) and anti-mouse IgG-FITC (anti-mouse IgG-FITC) were treated sequentially and washed three times with FACS buffer, followed by FACS analysis. The results are shown in FIG.
도 7의 A와 B에서 가는 선은 이형 대조군이고 굵은 선은 각각 마우스 4785항체(A)와 Hu4785-2(b)를 처리하였다. 결과에서 굵은 선은 이형 대조군의 가는 선에 비해서 더 높은 FITC 수준을 보이고 있다. 이 결과로 마우스 4785와 Hu4785-2가 Jurkat 8-1에서 발현되는 인간 4-1 BB에 결합한다는 것을 확인할 수 있었다. The thin lines in A and B of FIG. 7 are heterozygous controls and the thick lines were treated with mouse 4785 antibody (A) and Hu4785-2 (b), respectively. In the results, the thick line shows higher FITC levels than the thin line of the heterologous control group. As a result, it was confirmed that mouse 4785 and Hu4785-2 bind to human 4-1 BB expressed in Jurkat 8-1.
실시예 18: 인간화된 ScFv의 불변영역(constant region) 연결Example 18 Constant Region Linkage of Humanized ScFv
4-1BB는 활성화된 T 세포의 표면에 발현하는 공동자극분자(costimulatory molecule)로써, CD8 T 세포에 생존시그날(survival signal)을 전달하고, CD8 T 세포 증식 및 세포독성(cytotoxic) T 세포 반응 유도에 관여하는 것으로 알려져 있다. 그러므로, 장기이식 또는 자가면역질환에서 자기(self)를 인지하는 자기 항원에 의해서 활성화된 세포독성 T 세포를 억제하기 위해서 인간화된 Hu4785 항체를 사용하려고 한다. 이러한 경우에 있어서 ScFv 형태만으로도 4-1BB와 4-1BB 리간드(ligand)의 상호작용을 막을 수 있어서 적용가능하지만, H2L2(heavy chain 2, light chain 2) 형태로 전환시키면, 그 효과를 극대화 시킬 수 있다. ScFv는 결합부위가 한개 이지만, H2L2 형태는 결합부위가 2개라서 더 효과적인 결합이 일어난다. ScFv 형태는 인간의 생체에 존재하지 않는 형태이므로, 생체에 존재하는 H2L2 형태가 항원성이 더 낮다. 그리고 인간화된 Hu4785-H2L2의 불변부위(constant region)의 이형(isotype)인 IgG1은 세포에 결합되고 나서 보체(complement)를 고정시키므로 Hu4785-H2L2 항체가 결합한 세포독성 T 세포를 죽이는 반응이 일어난다. 이것은 장기이식 또는 자가면역질환에서 자기를 인지하는 자기 항원에 의해서 활성화된 세포독성 T 세포를 특이적으로 사멸시킴으로서 장기이식 거부반응과 자가면역반응의 원인이 되는 자기반응세포독성 T 세포(self reactive cytotoxic T cell)를 완전히 제거할 수 있다. 그러므로 H2L2 형태로의 전환은 필수적이다.4-1BB is a costimulatory molecule that is expressed on the surface of activated T cells, delivers a survival signal to CD8 T cells, induces CD8 T cell proliferation and cytotoxic T cell responses. It is known to be involved. Therefore, we would like to use humanized Hu4785 antibodies to inhibit cytotoxic T cells activated by self antigens that recognize self in organ transplantation or autoimmune diseases. In this case, the ScFv form alone can prevent the interaction between 4-1BB and 4-1BB ligands, but it can be maximized by switching to H2L2 (heavy chain 2, light chain 2) form. have. ScFv has one binding site, but H2L2 forms two binding sites, so more effective binding occurs. Since the ScFv form does not exist in human living bodies, the H2L2 form present in living bodies is less antigenic. In addition, IgG1, an isotype of a constant region of humanized Hu4785-H2L2, binds to cells and then fixes complement, resulting in a reaction that kills cytotoxic T cells bound to Hu4785-H2L2 antibody. It specifically kills cytotoxic T cells activated by self-recognized self antigens in organ transplantation or autoimmune diseases, thereby causing self-reactive cytotoxic T cells that cause organ transplant rejection and autoimmune reactions. T cell) can be removed completely. Therefore, conversion to H2L2 form is essential.
각 Ab의 인간화 ScFv는 VH, 링커(linker), VL이 연결되어 있는 형태이다. 이것을 원래 항체의 형태인 H2L2형태로 만들기 위해서, VH에는 리더서열(leader sequence)과 인간 IgG1의 불변영역이 연결되고, VL에는 리더서열과 인간 카파사슬서열이 연결되었다. 각 절편의 연결은 PCR을 통해서 수행하였다. 연결된 후의 서열은 서열번호 40 내지 43에 기재하였으며, 도 8a 내지 도 8d와 같다.The humanized ScFv of each Ab is a form in which the VH, linker, and VL are linked. In order to make it into H2L2 form, which is originally an antibody form, the VH is linked with a leader sequence and a constant region of human IgG1, and the VL is linked with a leader sequence and a human kappa chain sequence. Linking of each section was performed by PCR. The sequence after conjugation is described in SEQ ID NOs: 40 to 43, as shown in FIGS. 8A to 8D.
실시예 19: H2L2를 이용한 ELISAExample 19: ELISA with H2L2
ScFv 형태에서 H2L2로 전환한 후에 ScFv의 결합 능력과 생물학적 효과가 그대로 남아 있는지 알아보기 위해서 실시예 19, 20, 21을 실시하였다.Examples 19, 20, and 21 were carried out to determine whether the binding capacity and the biological effect of ScFv remain after the conversion from ScFv form to H2L2.
불변영역까지 완전히 인간화된 유전자, 즉 상기 실시예 18의 Hu4785-2 중쇄 유전자(서열번호: 41)와 Hu4785-2의 경쇄 유전자(서열번호: 43)를 진핵세포발현벡터(eukaryotic expression vector)인 pcDNA에 서브클로닝하여 Hu4785-2H/pcDNA(기탁번호 KCTC 10440BP) 및 Hu4785-2K/pcDNA(기탁번호 KCTC 10441BP)를 수득하였으며, 이 두개의 플라스미드를 293EBNA 세포(ATCC)에 감염시키고(transfection), 감염된 세포(transfectant)의 배양상층액으로 ELISA를 수행하였다.A fully humanized gene up to the constant region, namely, the Hu4785-2 heavy chain gene (SEQ ID NO: 41) and Hu4785-2 light chain gene (SEQ ID NO: 43) are pcDNAs which are eukaryotic expression vectors. Subcloning into Hu4785-2H / pcDNA (Accession No. KCTC 10440BP) and Hu4785-2K / pcDNA (Accession No. KCTC 10441BP) yielded two plasmids infected with 293EBNA cells (ATCC) (transfection) and infected cells. ELISA was performed with the culture supernatant (transfectant).
먼저 ELISA를 수행하였다. 항원으로는 4-1BB-GST를 사용하였으며, 각 50개의 감염세포의 배양상층액을 사용하였다. 50개 중에서 가장 높은 발현률을 보인 것은 B4 클론이며, 하기 표 5의 ELISA 결과에서 살펴보면 음성대조군보다 약 15배 높은 값을 보이고 있다.First, ELISA was performed. 4-1BB-GST was used as an antigen, and culture supernatants of 50 infected cells were used. Among the 50, the highest expression rate was the B4 clone, which is about 15 times higher than the negative control group when looking at the ELISA results in Table 5 below.
실시예 20:Example 20: H2L2를 이용한 웨스턴 블롯 분석Western blot analysis using H2L2
상기 실시예 18의 불변영역까지 완전히 인간화된 유전자를 진핵세포발현벡터인 pcDNA 또는 pD18에 서브클로닝하여 수득한 플라스미드를, Hu4785-2H/pcDNA + Hu4785-2K/pcDNA 또는 Hu4785-2H/pD18 + Hu4785-2K/pD18 과 같은 조합으로 293EBNA 세포(ATCC)에 감염시키고, 감염된 세포의 배양 상층액을 가지고 항체생성을 웨스턴블롯을 통해 확인하였다. 웨스턴 블롯 과정에 사용된 항원은 4-1BB-GST 이었다.The plasmid obtained by subcloning the fully humanized gene up to the constant region of Example 18 into the eukaryotic expression vector pcDNA or pD18 was Hu4785-2H / pcDNA + Hu4785-2K / pcDNA or Hu4785-2H / pD18 + Hu4785-. 293EBNA cells (ATCC) were infected in the same combination as 2K / pD18, and antibody production was confirmed by Western blot with the culture supernatant of the infected cells. The antigen used in the western blot process was 4-1BB-GST.
도 9는 H2L2를 이용한 웨스턴 블롯 결과사진으로, 레인 1은 Hu4785-2H/pcDNA + Hu4785-2K/pcDNA 감염세포(B4 클론)이고, 레인 2는 Hu4785-2H/pD18 + Hu4785-2K/pD18 감염세포이며, 레인 3은 293EBNA세포-음성대조군이다. 인간화가 완료된 항체가 인간 4-1BB에 잘 결합하는 것을 확인하였다. 9 is a Western blot results using H2L2, lane 1 is Hu4785-2H / pcDNA + Hu4785-2K / pcDNA infected cells (B4 clone), lane 2 is Hu4785-2H / pD18 + Hu4785-2K / pD18 infected cells Lane 3 is the 293EBNA cell-negative control. It was confirmed that the humanized antibody binds well to human 4-1BB.
실시예 21: H2L2의 순수분리Example 21: Pure Separation of H2L2
B4 클론의 배양배지 상층액에서 단백질 G 컬럼(protein G column)을 사용하여 완전히 인간화된 항체를 순수분리하여 SDS-PAGE하였다(도 10 참조).In the culture medium supernatant of the B4 clone, the SDS-PAGE was purely isolated from the fully humanized antibody using a protein G column (see FIG. 10).
실시예 22: 세포증식시험(Cell proliferation assay)Example 22 Cell Proliferation Assay
인간화된 ScFv와 H2L2의 생물학적 기능을 알아보기 위해서 세포증식시험법 (cell proliferation assay)을 실시하였다. To examine the biological functions of humanized ScFv and H2L2, cell proliferation assay was performed.
많은 경우에 있어서는 인간화 후의 항체가 인간화 전의 마우스 항체가 가지고 있던 생물학적 효과를 잃어버리는 경우가 있다. 그러므로 항체의 인간화를 완료한 후에 마우스 항체가 가지고 있던 생물학적 효과를 그대로 가지고 있는지를 증명하는 것이 필수적이다.In many cases, the antibody after humanization loses the biological effect of the mouse antibody before humanization. Therefore, after completing the humanization of the antibody, it is essential to prove that the mouse antibody retains the biological effects it had.
사람의 전혈에서 말초혈액단핵구세포(PBMC)를 분리하고, 각 Ab(마우스4785, Hu4785-2 및 Hu4785 H2L2)를 농도별(0, 1.25, 2.5 및 5㎍/㎖)로 처리하고, [3H] 인코포레이션 결과를 베타 카운터(beta counter)로 측정하였다. 마우스 4785는 인간 4-1BB에 결합하는 항체이다.Peripheral blood mononuclear cells (PBMC) were isolated from human whole blood, and each Ab (mouse 4785, Hu4785-2 and Hu4785 H2L2) was treated at different concentrations (0, 1.25, 2.5 and 5 μg / ml), [ 3 H Inclusion results were measured with a beta counter. Mouse 4785 is an antibody that binds to human 4-1BB.
도 10a는 마우스4785를 농도별로 처리한 것으로서, PBMC의 증식을 용량 의존적으로 억제하는 것을 보이고 있다. 도 10b는 인간화된 Hu4785-2 ScFv를 처리한 것으로서 마우스4785와 같은 경향성을 보이고 있다. 도 10c는 인간화된 Hu4785-2 H2L2를 처리한 것으로서 마우스4785와 같은 경향성을 보이고 있다. 이것은 인간화 후의 항체가 원래 마우스 항체가 가지고 있는 생물학적 효과를 가지는 것을 증명하는 것이다. FIG. 10A shows that the treatment of mouse 4785 by concentration shows dose-dependent inhibition of proliferation of PBMCs. 10B shows the same tendency as the mouse 4785 as treated with humanized Hu4785-2 ScFv. 10C shows the same tendency as the mouse 4785 as treated with humanized Hu4785-2 H2L2. This proves that the antibody after humanization has the biological effect that the original mouse antibody has.
본 발명의 ScFv형태인 인간화 Hu4785-2 및 H2L2형태인 Hu4785-2H/Hu4785-2K은 인체 4-1BB에 대한 결합 친화도가 높으면서 인간의 항체와 유사한 서열을 가지므로, 자가면역질환의 치료제 또는 면역억제제로서 부작용없이 효과적으로 사용될 수 있다. Since the ScFv form of humanized Hu4785-2 and H2L2 form of Hu4785-2H / Hu4785-2K of the present invention have a similar binding affinity to human 4-1BB and have a sequence similar to that of human antibodies, the therapeutic agent or immunity to autoimmune diseases As an inhibitor it can be used effectively without side effects.
도 1 및 2 는 각각 4785 VH 및 VL의 인간화 뉴클레오타이드 서열과 인간 주형의 아미노산 서열을 비교하여 나타낸 것이고,1 and 2 show a comparison of the humanized nucleotide sequence of 4785 VH and VL with the amino acid sequence of the human template, respectively,
도 3 및 4 는 각각 인간화 4785 VH 및 VL의 영역을 제조하기 위한 PCR 순서를 나타낸 것이고, 3 and 4 show PCR sequences for preparing regions of humanized 4785 VH and VL, respectively,
도 5 는 인간화된 항-h4-1BB ScFv를 항-E 태그 세파로즈를 이용하여 정제한 결과를 나타낸 것이고, 5 shows the results of purifying humanized anti-h4-1BB ScFv using anti-E tag Sepharose,
도 6 은 경쟁적 ELISA를 통한 인간화 항-h4-1BB ScFv의 억제율을 나타낸 것이고,6 shows the inhibition rate of humanized anti-h4-1BB ScFv via competitive ELISA,
도 7 은 인간화된 항-h4-1BB ScFv의 인간 4-1BB 분자와의 결합친화도를 나타낸 것이고,7 shows the binding affinity of humanized anti-h4-1BB ScFv with human 4-1BB molecules,
도 8a 는 인간화된 ScFv의 VH에 리더서열 및 인간 IgG1의 불변영역이 연결된 상태의 중쇄 뉴클레오티드 서열이고,8A is a heavy chain nucleotide sequence in which a leader sequence and a constant region of human IgG1 are linked to VH of a humanized ScFv,
도 8b 는 상기 도 8a의 중쇄 뉴클레오티드 서열에 해당하는 중쇄 아미노산서열이며,Figure 8b is a heavy chain amino acid sequence corresponding to the heavy chain nucleotide sequence of Figure 8a,
도 8c 는 인간화된 ScFv의 VL에 리더서열 및 인간 카파사슬서열이 연결된 상태의 경쇄 뉴클레오티드 서열이고,8C is a light chain nucleotide sequence of a leader sequence and a human kappa chain sequence linked to the VL of the humanized ScFv,
도 8d 는 상기 도 8c의 경쇄 뉴클레오티드 서열에 해당하는 경쇄 아미노산서열이고,8D is a light chain amino acid sequence corresponding to the light chain nucleotide sequence of FIG. 8C,
도 9 는 실시예 20의 Hu4785-2H/Hu4785-2K 유전자 발현을 관찰한 웨스턴블롯결과사진이고,Figure 9 is a Western blot result photograph observing the Hu4785-2H / Hu4785-2K gene expression of Example 20,
도 10 은 순수분리된 인간화된 항체의 SDS-PAGE 사진이고,10 is an SDS-PAGE picture of purely isolated humanized antibody,
도 11a 는 마우스4785의 농도별 처리시 PBMC의 증식억제를 나타낸 도이고,Figure 11a is a diagram showing the inhibition of proliferation of PBMC upon treatment by concentration of mouse 4785,
도 11b 는 인간화된 Hu4785-2 ScFv 처리시 PBMC의 증식억제를 나타낸 도이고,Figure 11b is a diagram showing the inhibition of proliferation of PBMC upon humanized Hu4785-2 ScFv treatment,
도 11c 는 인간화된 Hu4785-2 H2L2 처리시 PBMC의 증식억제를 나타낸 도이다.Figure 11c is a diagram showing the proliferation inhibition of PBMC when humanized Hu4785-2 H2L2 treatment.
<110> IMMUNOMICS CO., LTD. <120> Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition comprising Same <130> DIF-2002-0019 <160> 43 <170> KopatentIn 1.71 <210> 1 <211> 466 <212> PRT <213> Artificial Sequence <220> <223> mouse 4785-heavy chain amino acid sequence <400> 1 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn 85 90 95 Thr Val Tyr Met Gln Leu Asn Ser Pro Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Tyr Cys Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala 115 120 125 Met Glu Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys 130 135 140 Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln 145 150 155 160 Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro 165 170 175 Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val 180 185 190 His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser 195 200 205 Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys 210 215 220 Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val 225 230 235 240 Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val 245 250 255 Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile 260 265 270 Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser Lys Asp 275 280 285 Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His 290 295 300 Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg 305 310 315 320 Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys 325 330 335 Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Ser Gln Val Tyr 355 360 365 Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu 370 375 380 Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp 385 390 395 400 Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile 405 410 415 Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln 420 425 430 Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His 435 440 445 Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro 450 455 460 Gly Lys 465 <210> 2 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> mouse 4785-light chain amino acid sequence <400> 2 Met Arg Phe Ser Ala Gln Phe Leu Gly Leu Leu Leu Leu Cys Phe Gln 1 5 10 15 Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Thr Thr Ser Ala Leu Ser 20 25 30 Ala Ser Leu Gly Asp Arg Val Thr Ile Gly Cys Arg Ala Ser Gln Asp 35 40 45 Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val 50 55 60 Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Arg 85 90 95 Asn Leu Glu Gln Glu Asp Val Ala Thr Tyr Phe Cys Gln Gln Gly Tyr 100 105 110 Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 115 120 125 Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln 130 135 140 Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr 145 150 155 160 Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln 165 170 175 Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg 195 200 205 His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro 210 215 220 Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 <210> 3 <211> 1526 <212> DNA <213> Artificial Sequence <220> <223> mouse 4785-Heavy chain nucleotide sequence <400> 3 atgggatgga gctgtatcat cctcttcttg gtagcaacag ctacaggtgt ccactcccag 60 gtccaactgc agcagcctgg ggctgagctg gtgaggcctg gggcttcagt gaagctgtct 120 tgcaaggctt ctggctacac cttcaccagc tactggataa actgggtgaa gcagaggcct 180 ggacaaggcc ttgagtggat cggaaatatt tatccttctg atagttatac taactacaat 240 caaaagttca aggacaaggc cacattgact gtagacaagt cctccaacac agtttacatg 300 cagctcaaca gcccgacatc tgaggactct gcggtctatt actgtacaag aaacggggtg 360 gagggttacc ctcattacta tgctatggaa tactggggtc aaggaacctc agtcaccgtc 420 tcctcagcca aaacgacacc cccatctgtc tatccactgg cccctggatc tgctgcccaa 480 actaactcca tggtgaccct gggatgcctg gtcaagggct atttccctga gccagtgaca 540 gtgacctgga actctggatc cctgtccagc ggtgtgcaca ccttcccagc tgtcctgcag 600 tctgacctct acactctgag cagctcagtg actgtcccct ccagcacctg gcccagcgag 660 accgtcacct gcaacgttgc ccacccggcc agcagcacca aggtggacaa gaaaattgtg 720 cccagggatt gtggttgtaa gccttgcata tgtacagtcc cagaagtatc atctgtcttc 780 atcttccccc caaagcccaa ggatgtgctc accattactc tgactcctaa ggtcacgtgt 840 gttgtggtag acatcagcaa ggatgatccc gaggtccagt tcagctggtt tgtagatgat 900 gtggaggtgc acacagctca gacgcaaccc cgggaggagc agttcaacag cactttccgc 960 tcagtcagtg aacttcccat catgcaccag gactggctca atggcaagga gttcaaatgc 1020 agggtcaaca gtgcagcttt ccctgccccc atcgagaaaa ccatctccaa aaccaaaggc 1080 agaccgaagg cttcacaggt gtacaccatt ccacctccca aggagcagat ggccaaggat 1140 aaagtcagtc tgacctgcat gataacagac ttcttccctg aagacattac tgtggagtgg 1200 cagtggaatg ggcagccagc ggagaactac aagaacactc agcccatcat ggacacagat 1260 ggctcttact tcgtctacag caagctcaat gtgcagaaga gcaactggga ggcaggaaat 1320 actttcacct gctctgtgtt acatgagggc ctgcacaacc accatactga gaagagcctc 1380 tcccactctc ctggtaaatg atcccagtgt ccttggagcc ctctggtcct acaggactct 1440 gacacctacc tccacccctc cctgtataaa taaagcaccc agcactgcct tgggaccctg 1500 caaaaaaaaa aaaaaaaaaa aaaaaa 1526 <210> 4 <211> 932 <212> DNA <213> Artificial Sequence <220> <223> mouse 4785-light chain nucleotde sequence <400> 4 atgaggttct ctgctcagtt ccttggtctc ctgttgctct gttttcaagg taccagatgt 60 gatatccaga tgacacagac tacatccgcc ctgtctgcct ctctgggaga cagagtcacc 120 atcggttgca gggcaagtca ggaccttagc aatcatttat actggtatca gcagaaacca 180 gatggaactg ttaaactcct gatctactac acatcaagat tacactcagg agtcccatca 240 aggttcagtg gcagtggctc tggaacagat tattctctca ccattaggaa cctggagcaa 300 gaagatgttg ccacttactt ttgccaacag ggttatacgc ttccgtacac gttcggaggg 360 gggaccaagc tggaaataaa acgggctgat gctgcaccaa ctgtatccat cttcccacca 420 tccagtgagc agttaacatc tggaggtgcc tcagtcgtgt gcttcttgaa caacttctac 480 cccaaagaca tcaatgtcaa gtggaagatt gatggcagtg aacgacaaaa tggcgtcctg 540 aacagttgga ctgatcagga cagcaaagac agcacctaca gcatgagcag caccctcacg 600 ttgaccaagg acgagtatga acgacataac agctatacct gtgaggccac tcacaagaca 660 tcaacttcac ccattgtcaa gagcttcaac aggaatgagt gttagagaca aaggtcctga 720 gacgccacca ccagctcccc agctccatcc tatcttccct tctaaggtct tggaggcttc 780 cccacaagcg acctaccact gttgcggtgc tccaaacctc ctccccacct ccttctcctc 840 ctcctccctt tccttggctt ttatcatgct aatatttgca gaaaatattc aataaagtga 900 gtctttgcac ttgaaaaaaa aaaaaaaaaa aa 932 <210> 5 <211> 244 <212> PRT <213> Artificial Sequence <220> <223> Hu4785-2 clone amino acid sequence <400> 5 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Trp Ile Asn Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe 50 55 60 Lys Asp Lys Val Thr Met Thr Val Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala Met Glu Tyr 100 105 110 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Pro 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln 130 135 140 Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr 145 150 155 160 Cys Arg Ala Ser Gln Asp Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln 165 170 175 Lys Pro Gly Glu Ile Val Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu 180 185 190 His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205 Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220 Phe Cys Gln Gln Gly Tyr Thr Leu Pro Tyr Thr Phe Gly Gly Thr Lys 225 230 235 240 Leu Glu Ile Lys <210> 6 <211> 732 <212> DNA <213> Artificial Sequence <220> <223> Hu4785-2 clone nucleotide sequence <400> 6 caggtccaac tggtgcagtc tggggctgag gtgaaaaaac ctggggcttc agtgaagctg 60 tcttgcaagg cttctggcta caccttcacc agctactgga taaactgggt gaggcagagg 120 cctggacaag gccttgagtg gatcggaaat atttatcctt ctgatagtta tactaactac 180 aatcaaaagt tcaaggacaa ggtcacaatg actgtagaca catccacatc aacagtttac 240 atggagctca gcagcctgag atctgaggac actgcggtct attactgtac aagaaacggg 300 gtggagggtt accctcatta ctatgctatg gaatactggg gtcaaggaac ctcagtcacc 360 gtctcctcag gcggcggcgg cccaggcggc ggcggctcag gcggcggcgg ctcagatatc 420 cagatgacac agtctccatc ctccctgtct gcctctgttg gagacagagt caccatcact 480 tgcagggcaa gtcaggacct tagcaatcat ttatactggt atcagcagaa accaggtgaa 540 attgttaaac tcctgatcta ctacacatca agattacact caggagtccc atcaaggttc 600 agtggcagtg gctctggaac agattttacg ctcaccattt cctccctgca gccagaagat 660 ttcgccactt acttttgcca acagggttat acgcttccgt acacgttcgg agggaccaag 720 ctggaaataa aa 732 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> linker primer containing XhoI recognition site <400> 7 ctcgagtttt tttttttt 18 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> G-1U : sense primer of mouse Ig G1 <400> 8 gaactctgga tccctgtcca 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> G-1D : antisense primer of mouse Ig G1 <400> 9 tgcaaggctt acaaccacaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> K-1U : sense primer of mouse kappa CH1 domain <400> 10 atcttcccac catccagtga 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> K-1D : antisense primer of mouse kappa CH1 domain <400> 11 cgtccttggt caacgtgag 19 <210> 12 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-2U : sense primer for humanized 4785 heavy chain variable region <400> 12 caggtccaac tgswgcagyc tggggctgag gtgaaaaaac ctggggcttc agtgaagstg 60 tcttgcaagg 70 <210> 13 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-3U : sense primer for humanized 4785 heavy chain variable region <400> 13 agtgaagstg tcttgcaagg cttctggcta caccttcacc agctactgga taaactgggt 60 gargcagrsg 70 <210> 14 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-4U : sense primer for humanized 4785 heavy chain variable region <400> 14 taaactgggt gargcagrsg cctggacaag gccttgagtg gatcggaaat atttatcctt 60 ctgatagtta 70 <210> 15 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-5U : sense primer for humanized 4785 heavy chain variable region <400> 15 atttatcctt ctgatagtta tactaactac aatcaaaagt tcaaggacar ggycacaatg 60 actgtagaca 70 <210> 16 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-6U : sense primer for humanized 4785 heavy chain variable region <400> 16 ggycacaatg actgtagaca catccacatc aacagtttac atggagctca gcagcctgag 60 atctgaggac 70 <210> 17 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-7U : sense primer for humanized 4785 heavy chain variable region <400> 17 gcagcctgag atctgaggac wctgcggtct attactgtac aagaaacggg gtggagggtt 60 accctcatta 70 <210> 18 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-8U : sense primer for humanized 4785 heavy chain variable region <400> 18 gtggagggtt accctcatta ctatgctatg gaatactggg gtcaaggaac ctyagtcacc 60 gtctcctca 69 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-6D : antisense primer for humanized 4785 heavy chain variable region <400> 19 tgaggagacg gtgactragg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-1U: sense primer for humanized 4785 heavy chain variable region <400> 20 caggtccaac tgswgcagyc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-1D : antisense primer for humanized 4785 heavy chain variable region <400> 21 csyctgcytc acccagttta 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-3D : antisense primer for humanized 4785 heavy chain variable region <400> 22 tgtctacagt cattgtgrcc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-9U : sense primer for humanized 4785 heavy chain variable region <400> 23 ggycacaatg actgtagaca 20 <210> 24 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-2U : sense primer for humanized 4785 light chain variable region <400> 24 gatatccaga tgacacagwc tmcatcctcc ctgtctgcct ctgttggaga cagagtcacc 60 atcacttgca 70 <210> 25 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-3U : sense primer for humanized 4785 light chain variable region <400> 25 cagagtcacc atcacttgca gggcaagtca ggaccttagc aatcatttat actggtatca 60 gcagaaacca 70 <210> 26 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-4U : sense primer for humanized 4785 light chain variable region <400> 26 actggtatca gcagaaacca grtrrarctg ttaaactcct gatctactac acatcaagat 60 tacactcagg 70 <210> 27 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-5U : sense primer for humanized 4785 light chain variable region <400> 27 acatcaagat tacactcagg agtcccatca aggttcagtg gcagtggctc tggaacagat 60 tttacgctca 70 <210> 28 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-6U : sense primer for humanized 4785 light chain variable region <400> 28 tggaacagat tttacgctca ccatttcctc cctgcagcca gaagatttcg ccacttactt 60 ttgccaacag 70 <210> 29 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-6U : sense primer for humanized 4785 light chain variable region <400> 29 ccacttactt ttgccaacag ggttatacgc ttccgtacac gttcggasrg gggaccaagc 60 tggaaataaa a 71 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-1U : sense primer for humanized 4785 light chain variable region <400> 30 gatatccaga tgacacagwc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-1D : antisense primer for humanized 4785 light chain variable region <400> 31 tggtttctgc tgataccagt 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-3D : antisense primer for humanized 4785 light chain variable region <400> 32 tgagcgtaaa atctgttcca 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-8U : sense primer for humanized 4785 light chain variable region <400> 33 ctggaacaga ttttacgctc a 21 <210> 34 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-6D : antisense primer for humanized 4785 light chain variable region <400> 34 ttttatttcc agcttggtcc cctccgaacg tgtacggaag cgtataaccc tgttggcaaa 60 agtaagtgg 69 <210> 35 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> 4785 VH SfiI-U : sense primer of 4785 heavy chain variable region contaning SfiI recognition site <400> 35 actgcggccc agccggccat ggcccaggtc caactgswgc agyctgg 47 <210> 36 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 4785 VL NotI-D : antisense primer of 4785 light chain variable region containing NotI recogniton site <400> 36 gagtcattct cgacttgcgg ccgcttttat ttccagcttg gtcccctc 48 <210> 37 <211> 84 <212> DNA <213> Artificial Sequence <220> <223> 4785VH-Linker-VL : linker sequence to bridge between 4785 heavy chain variable region and light chain variable region <400> 37 cctyagtcac cgtctcctca ggcggcggcg gctcaggcgg cggcggctca ggcggcggcg 60 gctcagatat ccagatgaca cagw 84 <210> 38 <211> 466 <212> PRT <213> Artificial Sequence <220> <223> Heavy chain amino acid sequence <400> 38 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn 85 90 95 Thr Val Tyr Met Gln Leu Asn Ser Pro Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Tyr Cys Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala 115 120 125 Met Glu Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys 130 135 140 Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln 145 150 155 160 Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro 165 170 175 Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val 180 185 190 His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser 195 200 205 Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys 210 215 220 Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val 225 230 235 240 Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val 245 250 255 Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile 260 265 270 Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser Lys Asp 275 280 285 Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His 290 295 300 Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg 305 310 315 320 Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys 325 330 335 Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Ser Gln Val Tyr 355 360 365 Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu 370 375 380 Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp 385 390 395 400 Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile 405 410 415 Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln 420 425 430 Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His 435 440 445 Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro 450 455 460 Gly Lys 465 <210> 39 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> light(kappa) chain amino acid sequence <400> 39 Met Arg Phe Ser Ala Gln Phe Leu Gly Leu Leu Leu Leu Cys Phe Gln 1 5 10 15 Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Thr Thr Ser Ala Leu Ser 20 25 30 Ala Ser Leu Gly Asp Arg Val Thr Ile Gly Cys Arg Ala Ser Gln Asp 35 40 45 Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val 50 55 60 Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Arg 85 90 95 Asn Leu Glu Gln Glu Asp Val Ala Thr Tyr Phe Cys Gln Gln Gly Tyr 100 105 110 Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 115 120 125 Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln 130 135 140 Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr 145 150 155 160 Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln 165 170 175 Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg 195 200 205 His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro 210 215 220 Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 <210> 40 <211> 473 <212> PRT <213> Artificial Sequence <220> <223> Hu4785-2H:heavy chain amino acid sequence of humanized monoclonal antibody <400> 40 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Trp Ile Asn Trp Val Arg Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asp Lys Val Thr Met Thr Val Asp Thr Ser Thr Ser 85 90 95 Thr Val Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala 115 120 125 Met Glu Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Ser 130 135 140 Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr 145 150 155 160 Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro 165 170 175 Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val 180 185 190 His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser 195 200 205 Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile 210 215 220 Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Ser 225 230 235 240 Leu Ser Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 245 250 255 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 260 265 270 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 275 280 285 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 290 295 300 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 305 310 315 320 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 325 330 335 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 340 345 350 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 355 360 365 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met 370 375 380 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 385 390 395 400 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 405 410 415 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 420 425 430 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 435 440 445 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 450 455 460 Lys Ser Leu Ser Leu Ser Pro Gly Lys 465 470 <210> 41 <211> 1422 <212> DNA <213> Artificial Sequence <220> <223> Hu4785-2H:heavy chain nucleotide sequnce of humanized monoclonal antibody <400> 41 atgggatgga gctgtatcat cctcttcttg gtagcaacag ctacaggtgt ccactcccag 60 gtccaactgg tgcagtctgg ggctgaggtg aaaaaacctg gggcttcagt gaagctgtct 120 tgcaaggctt ctggctacac cttcaccagc tactggataa actgggtgag gcagaggcct 180 ggacaaggcc ttgagtggat cggaaatatt tatccttctg atagttatac taactacaat 240 caaaagttca aggacaaggt cacaatgact gtagacacat ccacatcaac agtttacatg 300 gagctcagca gcctgagatc tgaggacact gcggtctatt actgtacaag aaacggggtg 360 gagggttacc ctcattacta tgctatggaa tactggggtc aaggaacctc agtcaccgtc 420 tcctcagcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caaaagcacc 480 tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg 540 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag 600 tcctcaggac tctactccct cagcagcgtg gtgaccgtgc cctccagcag cttgggcacc 660 cagacctaca tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caaaaaaagt 720 ttgagtccca aatcttgtga caaaactcat acttgcccgc cgtgcccggc tccggaactc 780 ctggggggac cgtcagtctt cctcttcccc ccaaaaccca aggacaccct catgatctcc 840 cggacccctg aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag 900 ttcaactggt acgtggacgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag 960 cagtacaaca gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg 1020 aatggcaagg agtacaagtg caaggtctcc aacaaagccc tcccagcccc catcgagaaa 1080 accatctcca aagccaaagg gcagccccga gaaccacagg tgtacaccct gcccccatcc 1140 cgggaggaga tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctatccc 1200 agcgacattg ccgtggagtg ggagagcaat gggcagccgg agaacaacta caagaccacg 1260 cctcccgtgc tggactccga cggctccttc ttcctctata gcaagctcac cgtggacaag 1320 agcaggtggc agcaggggaa cgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1380 cactacacgc agaagagcct ctccctgtcc ccgggtaaat ga 1422 <210> 42 <211> 232 <212> PRT <213> Artificial Sequence <220> <223> Hu4785-K: light chain amino acid sequence of humanized monoclonal antibody <400> 42 Met Arg Phe Ser Ala Gln Phe Leu Gly Leu Leu Leu Leu Cys Phe Gln 1 5 10 15 Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 20 25 30 Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp 35 40 45 Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln Lys Pro Gly Glu Ile Val 50 55 60 Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Gly Tyr 100 105 110 Thr Leu Pro Tyr Thr Phe Gly Gly Thr Lys Leu Glu Ile Lys Thr Val 115 120 125 Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys 130 135 140 Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg 145 150 155 160 Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn 165 170 175 Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser 180 185 190 Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys 195 200 205 Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr 210 215 220 Lys Ser Phe Asn Arg Gly Glu Cys 225 230 <210> 43 <211> 699 <212> DNA <213> Artificial Sequence <220> <223> Hu4785-2K:light chain nucleotide sequence of humanized monoclonal antibody <400> 43 atgaggttct ctgctcagtt ccttggtctc ctgttgctct gttttcaagg taccagatgt 60 gatatccaga tgacacagtc tccatcctcc ctgtctgcct ctgttggaga cagagtcacc 120 atcacttgca gggcaagtca ggaccttagc aatcatttat actggtatca gcagaaacca 180 ggtgaaattg ttaaactcct gatctactac acatcaagat tacactcagg agtcccatca 240 aggttcagtg gcagtggctc tggaacagat tttacgctca ccatttcctc cctgcagcca 300 gaagatttcg ccacttactt ttgccaacag ggttatacgc ttccgtacac gttcggaggg 360 accaagctgg aaataaaaac tgtggctgca ccatctgtct tcatcttccc gccatctgat 420 gagcagttga aatctggaac tgcctctgtt gtgtgcctgc tgaataactt ctatcccaga 480 gaggccaaag tacagtggaa ggtggataac gccctccaat cgggtaactc ccaggagagt 540 gtcacagagc aggacagcaa ggacagcacc tacagcctca gcagcaccct gacgctgagc 600 aaagcagact acgagaaaca caaagtctac gcctgcgaag tcacccatca gggcctgagt 660 tcgcccgtca caaagagctt caacagggga gagtgttag 699<110> IMMUNOMICS CO., LTD. <120> Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition comprising Same <130> DIF-2002-0019 <160> 43 <170> KopatentIn 1.71 <210> 1 <211> 466 <212> PRT <213> Artificial Sequence <220> Mouse 4785-heavy chain amino acid sequence <400> 1 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn 85 90 95 Thr Val Tyr Met Gln Leu Asn Ser Pro Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Tyr Cys Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala 115 120 125 Met Glu Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys 130 135 140 Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln 145 150 155 160 Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro 165 170 175 Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val 180 185 190 His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser 195 200 205 Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys 210 215 220 Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val 225 230 235 240 Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val 245 250 255 Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile 260 265 270 Thr Leu Thr Pro Lys Val Thr Cys Val Val Asp Ile Ser Lys Asp 275 280 285 Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His 290 295 300 Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg 305 310 315 320 Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys 325 330 335 Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Ser Gln Val Tyr 355 360 365 Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu 370 375 380 Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp 385 390 395 400 Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile 405 410 415 Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln 420 425 430 Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His 435 440 445 Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro 450 455 460 Gly lys 465 <210> 2 <211> 234 <212> PRT <213> Artificial Sequence <220> Mouse 4785-light chain amino acid sequence <400> 2 Met Arg Phe Ser Ala Gln Phe Leu Gly Leu Leu Leu Leu Cys Phe Gln 1 5 10 15 Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Thr Thr Ser Ala Leu Ser 20 25 30 Ala Ser Leu Gly Asp Arg Val Thr Ile Gly Cys Arg Ala Ser Gln Asp 35 40 45 Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val 50 55 60 Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Arg 85 90 95 Asn Leu Glu Gln Glu Asp Val Ala Thr Tyr Phe Cys Gln Gln Gly Tyr 100 105 110 Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 115 120 125 Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln 130 135 140 Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr 145 150 155 160 Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln 165 170 175 Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg 195 200 205 His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro 210 215 220 Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 <210> 3 <211> 1526 <212> DNA <213> Artificial Sequence <220> Mouse 4785-Heavy chain nucleotide sequence <400> 3 atgggatgga gctgtatcat cctcttcttg gtagcaacag ctacaggtgt ccactcccag 60 gtccaactgc agcagcctgg ggctgagctg gtgaggcctg gggcttcagt gaagctgtct 120 tgcaaggctt ctggctacac cttcaccagc tactggataa actgggtgaa gcagaggcct 180 ggacaaggcc ttgagtggat cggaaatatt tatccttctg atagttatac taactacaat 240 caaaagttca aggacaaggc cacattgact gtagacaagt cctccaacac agtttacatg 300 cagctcaaca gcccgacatc tgaggactct gcggtctatt actgtacaag aaacggggtg 360 gagggttacc ctcattacta tgctatggaa tactggggtc aaggaacctc agtcaccgtc 420 tcctcagcca aaacgacacc cccatctgtc tatccactgg cccctggatc tgctgcccaa 480 actaactcca tggtgaccct gggatgcctg gtcaagggct atttccctga gccagtgaca 540 gtgacctgga actctggatc cctgtccagc ggtgtgcaca ccttcccagc tgtcctgcag 600 tctgacctct acactctgag cagctcagtg actgtcccct ccagcacctg gcccagcgag 660 accgtcacct gcaacgttgc ccacccggcc agcagcacca aggtggacaa gaaaattgtg 720 cccagggatt gtggttgtaa gccttgcata tgtacagtcc cagaagtatc atctgtcttc 780 atcttccccc caaagcccaa ggatgtgctc accattactc tgactcctaa ggtcacgtgt 840 gttgtggtag acatcagcaa ggatgatccc gaggtccagt tcagctggtt tgtagatgat 900 gtggaggtgc acacagctca gacgcaaccc cgggaggagc agttcaacag cactttccgc 960 tcagtcagtg aacttcccat catgcaccag gactggctca atggcaagga gttcaaatgc 1020 agggtcaaca gtgcagcttt ccctgccccc atcgagaaaa ccatctccaa aaccaaaggc 1080 agaccgaagg cttcacaggt gtacaccatt ccacctccca aggagcagat ggccaaggat 1140 aaagtcagtc tgacctgcat gataacagac ttcttccctg aagacattac tgtggagtgg 1200 cagtggaatg ggcagccagc ggagaactac aagaacactc agcccatcat ggacacagat 1260 ggctcttact tcgtctacag caagctcaat gtgcagaaga gcaactggga ggcaggaaat 1320 actttcacct gctctgtgtt acatgagggc ctgcacaacc accatactga gaagagcctc 1380 tcccactctc ctggtaaatg atcccagtgt ccttggagcc ctctggtcct acaggactct 1440 gacacctacc tccacccctc cctgtataaa taaagcaccc agcactgcct tgggaccctg 1500 caaaaaaaaa aaaaaaaaaa aaaaaa 1526 <210> 4 <211> 932 <212> DNA <213> Artificial Sequence <220> <223> mouse 4785-light chain nucleotde sequence <400> 4 atgaggttct ctgctcagtt ccttggtctc ctgttgctct gttttcaagg taccagatgt 60 gatatccaga tgacacagac tacatccgcc ctgtctgcct ctctgggaga cagagtcacc 120 atcggttgca gggcaagtca ggaccttagc aatcatttat actggtatca gcagaaacca 180 gatggaactg ttaaactcct gatctactac acatcaagat tacactcagg agtcccatca 240 aggttcagtg gcagtggctc tggaacagat tattctctca ccattaggaa cctggagcaa 300 gaagatgttg ccacttactt ttgccaacag ggttatacgc ttccgtacac gttcggaggg 360 gggaccaagc tggaaataaa acgggctgat gctgcaccaa ctgtatccat cttcccacca 420 tccagtgagc agttaacatc tggaggtgcc tcagtcgtgt gcttcttgaa caacttctac 480 cccaaagaca tcaatgtcaa gtggaagatt gatggcagtg aacgacaaaa tggcgtcctg 540 aacagttgga ctgatcagga cagcaaagac agcacctaca gcatgagcag caccctcacg 600 ttgaccaagg acgagtatga acgacataac agctatacct gtgaggccac tcacaagaca 660 tcaacttcac ccattgtcaa gagcttcaac aggaatgagt gttagagaca aaggtcctga 720 gacgccacca ccagctcccc agctccatcc tatcttccct tctaaggtct tggaggcttc 780 cccacaagcg acctaccact gttgcggtgc tccaaacctc ctccccacct ccttctcctc 840 ctcctccctt tccttggctt ttatcatgct aatatttgca gaaaatattc aataaagtga 900 gtctttgcac ttgaaaaaaa aaaaaaaaaa aa 932 <210> 5 <211> 244 <212> PRT <213> Artificial Sequence <220> <223> Hu4785-2 clone amino acid sequence <400> 5 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Trp Ile Asn Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn Gln Lys Phe 50 55 60 Lys Asp Lys Val Thr Met Thr Val Asp Thr Ser Thr Ser Thr Val Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala Met Glu Tyr 100 105 110 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Pro 115 120 125 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln 130 135 140 Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr 145 150 155 160 Cys Arg Ala Ser Gln Asp Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln 165 170 175 Lys Pro Gly Glu Ile Val Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu 180 185 190 His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp 195 200 205 Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr 210 215 220 Phe Cys Gln Gln Gly Tyr Thr Leu Pro Tyr Thr Phe Gly Gly Thr Lys 225 230 235 240 Leu Glu Ile Lys <210> 6 <211> 732 <212> DNA <213> Artificial Sequence <220> <223> Hu4785-2 clone nucleotide sequence <400> 6 caggtccaac tggtgcagtc tggggctgag gtgaaaaaac ctggggcttc agtgaagctg 60 tcttgcaagg cttctggcta caccttcacc agctactgga taaactgggt gaggcagagg 120 cctggacaag gccttgagtg gatcggaaat atttatcctt ctgatagtta tactaactac 180 aatcaaaagt tcaaggacaa ggtcacaatg actgtagaca catccacatc aacagtttac 240 atggagctca gcagcctgag atctgaggac actgcggtct attactgtac aagaaacggg 300 gtggagggtt accctcatta ctatgctatg gaatactggg gtcaaggaac ctcagtcacc 360 gtctcctcag gcggcggcgg cccaggcggc ggcggctcag gcggcggcgg ctcagatatc 420 cagatgacac agtctccatc ctccctgtct gcctctgttg gagacagagt caccatcact 480 tgcagggcaa gtcaggacct tagcaatcat ttatactggt atcagcagaa accaggtgaa 540 attgttaaac tcctgatcta ctacacatca agattacact caggagtccc atcaaggttc 600 agtggcagtg gctctggaac agattttacg ctcaccattt cctccctgca gccagaagat 660 ttcgccactt acttttgcca acagggttat acgcttccgt acacgttcgg agggaccaag 720 ctggaaataa aa 732 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> linker primer containing XhoI recognition site <400> 7 ctcgagtttt tttttttt 18 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> G-1U: sense primer of mouse Ig G1 <400> 8 gaactctgga tccctgtcca 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> G-1D: antisense primer of mouse Ig G1 <400> 9 tgcaaggctt acaaccacaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> K-1U: sense primer of mouse kappa CH1 domain <400> 10 atcttcccac catccagtga 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> K-1D: antisense primer of mouse kappa CH1 domain <400> 11 cgtccttggt caacgtgag 19 <210> 12 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-2U: sense primer for humanized 4785 heavy chain variable region <400> 12 caggtccaac tgswgcagyc tggggctgag gtgaaaaaac ctggggcttc agtgaagstg 60 tcttgcaagg 70 <210> 13 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-3U: sense primer for humanized 4785 heavy chain variable region <400> 13 agtgaagstg tcttgcaagg cttctggcta caccttcacc agctactgga taaactgggt 60 gargcagrsg 70 <210> 14 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-4U: sense primer for humanized 4785 heavy chain variable region <400> 14 taaactgggt gargcagrsg cctggacaag gccttgagtg gatcggaaat atttatcctt 60 ctgatagtta 70 <210> 15 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-5U: sense primer for humanized 4785 heavy chain variable region <400> 15 atttatcctt ctgatagtta tactaactac aatcaaaagt tcaaggacar ggycacaatg 60 actgtagaca 70 <210> 16 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-6U: sense primer for humanized 4785 heavy chain variable region <400> 16 ggycacaatg actgtagaca catccacatc aacagtttac atggagctca gcagcctgag 60 atctgaggac 70 <210> 17 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-7U: sense primer for humanized 4785 heavy chain variable region <400> 17 gcagcctgag atctgaggac wctgcggtct attactgtac aagaaacggg gtggagggtt 60 accctcatta 70 <210> 18 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-8U: sense primer for humanized 4785 heavy chain variable region <400> 18 gtggagggtt accctcatta ctatgctatg gaatactggg gtcaaggaac ctyagtcacc 60 gtctcctca 69 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-6D: antisense primer for humanized 4785 heavy chain variable region <400> 19 tgaggagacg gtgactragg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-1U: sense primer for humanized 4785 heavy chain variable region <400> 20 caggtccaac tgswgcagyc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-1D: antisense primer for humanized 4785 heavy chain variable region <400> 21 csyctgcytc acccagttta 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-3D: antisense primer for humanized 4785 heavy chain variable region <400> 22 tgtctacagt cattgtgrcc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785H-9U: sense primer for humanized 4785 heavy chain variable region <400> 23 ggycacaatg actgtagaca 20 <210> 24 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-2U: sense primer for humanized 4785 light chain variable region <400> 24 gatatccaga tgacacagwc tmcatcctcc ctgtctgcct ctgttggaga cagagtcacc 60 atcacttgca 70 <210> 25 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-3U: sense primer for humanized 4785 light chain variable region <400> 25 cagagtcacc atcacttgca gggcaagtca ggaccttagc aatcatttat actggtatca 60 gcagaaacca 70 <210> 26 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-4U: sense primer for humanized 4785 light chain variable region <400> 26 actggtatca gcagaaacca grtrrarctg ttaaactcct gatctactac acatcaagat 60 tacactcagg 70 <210> 27 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-5U: sense primer for humanized 4785 light chain variable region <400> 27 acatcaagat tacactcagg agtcccatca aggttcagtg gcagtggctc tggaacagat 60 tttacgctca 70 <210> 28 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-6U: sense primer for humanized 4785 light chain variable region <400> 28 tggaacagat tttacgctca ccatttcctc cctgcagcca gaagatttcg ccacttactt 60 ttgccaacag 70 <210> 29 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-6U: sense primer for humanized 4785 light chain variable region <400> 29 ccacttactt ttgccaacag ggttatacgc ttccgtacac gttcggasrg gggaccaagc 60 tggaaataaa a 71 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-1U: sense primer for humanized 4785 light chain variable region <400> 30 gatatccaga tgacacagwc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-1D: antisense primer for humanized 4785 light chain variable region <400> 31 tggtttctgc tgataccagt 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-3D: antisense primer for humanized 4785 light chain variable region <400> 32 tgagcgtaaa atctgttcca 20 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-8U: sense primer for humanized 4785 light chain variable region <400> 33 ctggaacaga ttttacgctc a 21 <210> 34 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Hu4785L-6D: antisense primer for humanized 4785 light chain variable region <400> 34 ttttatttcc agcttggtcc cctccgaacg tgtacggaag cgtataaccc tgttggcaaa 60 agtaagtgg 69 <210> 35 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> 4785 VH SfiI-U: sense primer of 4785 heavy chain variable region contaning SfiI recognition site <400> 35 actgcggccc agccggccat ggcccaggtc caactgswgc agyctgg 47 <210> 36 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 4785 VL NotI-D: antisense primer of 4785 light chain variable region containing NotI recogniton site <400> 36 gagtcattct cgacttgcgg ccgcttttat ttccagcttg gtcccctc 48 <210> 37 <211> 84 <212> DNA <213> Artificial Sequence <220> <223> 4785VH-Linker-VL: linker sequence to bridge between 4785 heavy chain variable region and light chain variable region <400> 37 cctyagtcac cgtctcctca ggcggcggcg gctcaggcgg cggcggctca ggcggcggcg 60 gctcagatat ccagatgaca cagw 84 <210> 38 <211> 466 <212> PRT <213> Artificial Sequence <220> <223> Heavy chain amino acid sequence <400> 38 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Arg 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Trp Ile Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn 85 90 95 Thr Val Tyr Met Gln Leu Asn Ser Pro Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Tyr Cys Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala 115 120 125 Met Glu Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys 130 135 140 Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala Ala Gln 145 150 155 160 Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro 165 170 175 Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val 180 185 190 His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser 195 200 205 Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val Thr Cys 210 215 220 Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Val 225 230 235 240 Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu Val 245 250 255 Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr Ile 260 265 270 Thr Leu Thr Pro Lys Val Thr Cys Val Val Asp Ile Ser Lys Asp 275 280 285 Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His 290 295 300 Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe Arg 305 310 315 320 Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn Gly Lys 325 330 335 Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Ser Gln Val Tyr 355 360 365 Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser Leu 370 375 380 Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu Trp 385 390 395 400 Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro Ile 405 410 415 Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val Gln 420 425 430 Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu His 435 440 445 Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser Pro 450 455 460 Gly lys 465 <210> 39 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> light (kappa) chain amino acid sequence <400> 39 Met Arg Phe Ser Ala Gln Phe Leu Gly Leu Leu Leu Leu Cys Phe Gln 1 5 10 15 Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Thr Thr Ser Ala Leu Ser 20 25 30 Ala Ser Leu Gly Asp Arg Val Thr Ile Gly Cys Arg Ala Ser Gln Asp 35 40 45 Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val 50 55 60 Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Arg 85 90 95 Asn Leu Glu Gln Glu Asp Val Ala Thr Tyr Phe Cys Gln Gln Gly Tyr 100 105 110 Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 115 120 125 Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln 130 135 140 Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr 145 150 155 160 Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln 165 170 175 Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg 195 200 205 His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro 210 215 220 Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 <210> 40 <211> 473 <212> PRT <213> Artificial Sequence <220> <223> Hu4785-2H: heavy chain amino acid sequence of humanized monoclonal antibody <400> 40 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys 20 25 30 Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Trp Ile Asn Trp Val Arg Gln Arg Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Asn Ile Tyr Pro Ser Asp Ser Tyr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Asp Lys Val Thr Met Thr Val Asp Thr Ser Thr Ser 85 90 95 Thr Val Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Thr Arg Asn Gly Val Glu Gly Tyr Pro His Tyr Tyr Ala 115 120 125 Met Glu Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Ser 130 135 140 Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr 145 150 155 160 Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro 165 170 175 Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val 180 185 190 His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser 195 200 205 Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile 210 215 220 Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Ser 225 230 235 240 Leu Ser Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 245 250 255 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 260 265 270 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 275 280 285 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 290 295 300 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 305 310 315 320 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 325 330 335 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 340 345 350 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 355 360 365 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met 370 375 380 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 385 390 395 400 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 405 410 415 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 420 425 430 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 435 440 445 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 450 455 460 Lys Ser Leu Ser Leu Ser Pro Gly Lys 465 470 <210> 41 <211> 1422 <212> DNA <213> Artificial Sequence <220> <223> Hu4785-2H: heavy chain nucleotide sequnce of humanized monoclonal antibody <400> 41 atgggatgga gctgtatcat cctcttcttg gtagcaacag ctacaggtgt ccactcccag 60 gtccaactgg tgcagtctgg ggctgaggtg aaaaaacctg gggcttcagt gaagctgtct 120 tgcaaggctt ctggctacac cttcaccagc tactggataa actgggtgag gcagaggcct 180 ggacaaggcc ttgagtggat cggaaatatt tatccttctg atagttatac taactacaat 240 caaaagttca aggacaaggt cacaatgact gtagacacat ccacatcaac agtttacatg 300 gagctcagca gcctgagatc tgaggacact gcggtctatt actgtacaag aaacggggtg 360 gagggttacc ctcattacta tgctatggaa tactggggtc aaggaacctc agtcaccgtc 420 tcctcagcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caaaagcacc 480 tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg 540 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag 600 tcctcaggac tctactccct cagcagcgtg gtgaccgtgc cctccagcag cttgggcacc 660 cagacctaca tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caaaaaaagt 720 ttgagtccca aatcttgtga caaaactcat acttgcccgc cgtgcccggc tccggaactc 780 ctggggggac cgtcagtctt cctcttcccc ccaaaaccca aggacaccct catgatctcc 840 cggacccctg aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag 900 ttcaactggt acgtggacgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag 960 cagtacaaca gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg 1020 aatggcaagg agtacaagtg caaggtctcc aacaaagccc tcccagcccc catcgagaaa 1080 accatctcca aagccaaagg gcagccccga gaaccacagg tgtacaccct gcccccatcc 1140 cgggaggaga tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctatccc 1200 agcgacattg ccgtggagtg ggagagcaat gggcagccgg agaacaacta caagaccacg 1260 cctcccgtgc tggactccga cggctccttc ttcctctata gcaagctcac cgtggacaag 1320 agcaggtggc agcaggggaa cgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1380 cactacacgc agaagagcct ctccctgtcc ccgggtaaat ga 1422 <210> 42 <211> 232 <212> PRT <213> Artificial Sequence <220> <223> Hu4785-K: light chain amino acid sequence of humanized monoclonal antibody <400> 42 Met Arg Phe Ser Ala Gln Phe Leu Gly Leu Leu Leu Leu Cys Phe Gln 1 5 10 15 Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 20 25 30 Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp 35 40 45 Leu Ser Asn His Leu Tyr Trp Tyr Gln Gln Lys Pro Gly Glu Ile Val 50 55 60 Lys Leu Leu Ile Tyr Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Gly Tyr 100 105 110 Thr Leu Pro Tyr Thr Phe Gly Gly Thr Lys Leu Glu Ile Lys Thr Val 115 120 125 Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys 130 135 140 Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg 145 150 155 160 Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn 165 170 175 Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser 180 185 190 Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys 195 200 205 Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr 210 215 220 Lys Ser Phe Asn Arg Gly Glu Cys 225 230 <210> 43 <211> 699 <212> DNA <213> Artificial Sequence <220> <223> Hu4785-2K: light chain nucleotide sequence of humanized monoclonal antibody <400> 43 atgaggttct ctgctcagtt ccttggtctc ctgttgctct gttttcaagg taccagatgt 60 gatatccaga tgacacagtc tccatcctcc ctgtctgcct ctgttggaga cagagtcacc 120 atcacttgca gggcaagtca ggaccttagc aatcatttat actggtatca gcagaaacca 180 ggtgaaattg ttaaactcct gatctactac acatcaagat tacactcagg agtcccatca 240 aggttcagtg gcagtggctc tggaacagat tttacgctca ccatttcctc cctgcagcca 300 gaagatttcg ccacttactt ttgccaacag ggttatacgc ttccgtacac gttcggaggg 360 accaagctgg aaataaaaac tgtggctgca ccatctgtct tcatcttccc gccatctgat 420 gagcagttga aatctggaac tgcctctgtt gtgtgcctgc tgaataactt ctatcccaga 480 gaggccaaag tacagtggaa ggtggataac gccctccaat cgggtaactc ccaggagagt 540 gtcacagagc aggacagcaa ggacagcacc tacagcctca gcagcaccct gacgctgagc 600 aaagcagact acgagaaaca caaagtctac gcctgcgaag tcacccatca gggcctgagt 660 tcgcccgtca caaagagctt caacagggga gagtgttag 699
Claims (16)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2003-0018621A KR100500283B1 (en) | 2003-03-25 | 2003-03-25 | Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition Comprising Same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2003-0018621A KR100500283B1 (en) | 2003-03-25 | 2003-03-25 | Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition Comprising Same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20040083918A KR20040083918A (en) | 2004-10-06 |
KR100500283B1 true KR100500283B1 (en) | 2005-07-11 |
Family
ID=37367560
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR10-2003-0018621A KR100500283B1 (en) | 2003-03-25 | 2003-03-25 | Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition Comprising Same |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR100500283B1 (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10174122B2 (en) | 2017-01-06 | 2019-01-08 | Eutilex Co., Ltd. | Anti-human 4-1BB antibodies and uses thereof |
US10570371B2 (en) | 2014-03-12 | 2020-02-25 | Eutilex Co., Ltd. | Methods for isolating and proliferating autologous cancer antigen-specific CD8+T cells |
US20210228696A1 (en) * | 2018-07-23 | 2021-07-29 | Magenta Therapeutics, Inc. | Use of anti-cd137 antibody drug conjugate (adc) in allogeneic cell therapy |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100694508B1 (en) * | 2005-05-24 | 2007-03-13 | 울산대학교 산학협력단 | A composition comprising HBBK4 antibody for the treatment of cancer and the immunotherapic method for treating cancer using thereby |
ES2679994T3 (en) * | 2005-08-11 | 2018-09-03 | Arpi Matossian-Rogers | Peptides related to TCR-V-BETA for the treatment and diagnosis of autoimmune disease |
BR112019014991A2 (en) * | 2017-01-20 | 2020-04-07 | Magenta Therapeutics Inc | compositions and methods for the suppression of cd137 + cells |
MX2019009967A (en) | 2017-02-24 | 2019-12-02 | Macrogenics Inc | Bispecific binding molecules that are capable of binding cd137 and tumor antigens, and uses thereof. |
CN110357961B (en) * | 2018-04-10 | 2022-08-23 | 无锡智康弘义生物科技有限公司 | Anti-human 4-1BB monoclonal antibody, preparation method and application thereof |
WO2019196868A1 (en) | 2018-04-10 | 2019-10-17 | Wuxi Biologics (Shanghai) Co., Ltd. | A monoclonal antibody against human 4-1bb, method for preparing the same, and use thereof |
-
2003
- 2003-03-25 KR KR10-2003-0018621A patent/KR100500283B1/en active IP Right Grant
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10570371B2 (en) | 2014-03-12 | 2020-02-25 | Eutilex Co., Ltd. | Methods for isolating and proliferating autologous cancer antigen-specific CD8+T cells |
US10801011B2 (en) | 2014-03-12 | 2020-10-13 | National Cancer Center | Methods for isolating and proliferating autologous cancer antigen-specific CD8+ T cells |
US10174122B2 (en) | 2017-01-06 | 2019-01-08 | Eutilex Co., Ltd. | Anti-human 4-1BB antibodies and uses thereof |
US10919972B2 (en) | 2017-01-06 | 2021-02-16 | Eutilex Co., Ltd. | Anti-human 4-1BB antibodies and uses thereof |
US11859004B2 (en) | 2017-01-06 | 2024-01-02 | Eutilex Co., Ltd. | Anti-human 4-1BB antibodies and uses thereof |
US20210228696A1 (en) * | 2018-07-23 | 2021-07-29 | Magenta Therapeutics, Inc. | Use of anti-cd137 antibody drug conjugate (adc) in allogeneic cell therapy |
Also Published As
Publication number | Publication date |
---|---|
KR20040083918A (en) | 2004-10-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP7019198B2 (en) | C5 Antibodies and Methods for Prevention and Treatment of Complement-Related Diseases | |
KR102163001B1 (en) | Antibodies recognizing alpha-synuclein | |
CA2508660C (en) | Antibodies against pd-1 and uses therefor | |
JP4804357B2 (en) | Modified anti-CD52 antibody | |
CN110035773B (en) | Novel anti-CTLA 4 antibodies | |
AU751064B2 (en) | Antibodies against human CD40 | |
TWI373343B (en) | Antibodies that bind human interleukin-18 and methods of making and using | |
FI117975B (en) | Immunoglobulins lacking light chains | |
TWI339209B (en) | Human antibodies that bind human il-12 and methods for producing | |
CN111995674B (en) | anti-COVID-19 virus neutralizing antibody mhC3, humanized antibody and application thereof | |
CN107207588B (en) | Antibodies against TAU and uses thereof | |
CN109134652B (en) | Pan-ELR+CXC chemokine antibodies | |
CN111801354B (en) | Monoclonal antibodies and methods of use thereof | |
SG189456A1 (en) | Novel anti-dr5 antibody | |
AU2015366363B2 (en) | Application of binding molecule for specific binding of precursor for brain-derived neurotrophic factor | |
JP2016040322A (en) | Modified antibodies and method for production of the same | |
KR100500283B1 (en) | Humanized Monoclonal Polypeptide Specific for Human 4-1BB Molecule and Pharmaceutical Composition Comprising Same | |
KR101809761B1 (en) | Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof | |
US20240076382A1 (en) | CD1a ANTIBODIES AND USES THEREOF | |
WO2020139175A2 (en) | Humanized antibodies against the beta chain region of the trbv9 family of human tcr and methods for the use thereof | |
CN116789820A (en) | Development and application of novel immunomodulator | |
US9688757B2 (en) | Bi-specific affinity reagents for cell-lineage-specific TNF-alpha neutralization | |
AU778551B2 (en) | Novel peptide and screening method by using the same | |
TW202302638A (en) | Materials and methods for targeting regulatory t cells for enhancing immune surveillance | |
CN117396511A (en) | Bispecific antibodies targeting CD47 and PD-L1 and methods of use thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20130628 Year of fee payment: 9 |
|
FPAY | Annual fee payment |
Payment date: 20140630 Year of fee payment: 10 |
|
FPAY | Annual fee payment |
Payment date: 20150630 Year of fee payment: 11 |
|
FPAY | Annual fee payment |
Payment date: 20160630 Year of fee payment: 12 |
|
FPAY | Annual fee payment |
Payment date: 20180903 Year of fee payment: 14 |
|
FPAY | Annual fee payment |
Payment date: 20190625 Year of fee payment: 15 |