KR0171629B1 - Rapid assays for amplification products - Google Patents

Rapid assays for amplification products Download PDF

Info

Publication number
KR0171629B1
KR0171629B1 KR1019930702136A KR930702136A KR0171629B1 KR 0171629 B1 KR0171629 B1 KR 0171629B1 KR 1019930702136 A KR1019930702136 A KR 1019930702136A KR 930702136 A KR930702136 A KR 930702136A KR 0171629 B1 KR0171629 B1 KR 0171629B1
Authority
KR
South Korea
Prior art keywords
nucleic acid
primer
acid sequence
labeled
polymerase chain
Prior art date
Application number
KR1019930702136A
Other languages
Korean (ko)
Other versions
KR930703464A (en
Inventor
아아르 링크 존
아아르 거디밴드 삿야나라야나
에이취 켄턴 존
Original Assignee
리차아드 제이 마세이
아이젠 인코포레이팃드
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US79260291A priority Critical
Priority to US792,602 priority
Application filed by 리차아드 제이 마세이, 아이젠 인코포레이팃드 filed Critical 리차아드 제이 마세이
Priority to PCT/US1992/009943 priority patent/WO1993010267A1/en
Publication of KR930703464A publication Critical patent/KR930703464A/en
Application granted granted Critical
Publication of KR0171629B1 publication Critical patent/KR0171629B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Abstract

하기 단계로 구성되는, 폴리머라제 연쇄 반응 또는 다른 프라이머 유도 반응의 증폭 생성물에서 관심있는 핵산 서열을 검출하는 방법 : (a) 폴리머라제 연쇄 반응 혼합물 또는 다른 프라이머 유도 반응 혼합물 내로 (i) 그의 3' 말단에서 또는 (ii) 그의 3' 및 5' 말단에서 전기화학발광할 수 있는 화합물로 표식된 관심있는 상기 핵산 서열에 상보적인 적어도 하나의 핵산 서열을 혼입하고; A method for detecting a nucleic acid sequence of interest in an amplification product of the polymerase chain reaction or other primer induced reaction consisting of following steps: (a) polymerase chain reaction mixture or other primer induced reaction mixture his 3 'end into (i) in or (ii) incorporating the complementary at least one nucleic acid sequence to the nucleic acid sequence of interest with a marker compound which can emit light in the electrochemical his 3 'and 5' terminal and; (b) 폴리머라제 연쇄 반응 또는 다른 프라이머 유도 반응을 수행하고; (B) performing a polymerase chain reaction or other primer reaction is induced; 및 (c) 표식된 증폭 생성물의 전기화학발광을 측정한다. And (c) measuring the electrochemical luminescence of the labeled amplification product.

Description

[발명의 명칭] [Title of Invention]

증폭 생성물에 대한 빠른 분석 Quick analysis of the amplification products

[발명의 분야] [Field of the Invention]

본 발명은 증폭된 핵산 서열의 검출 또는 정량에 관한 것이다. The present invention relates to the detection or quantification of the amplified nucleic acid sequence. 더욱 구체적으로, 본 발명은 빠른, 일-단계, 동종 분석으로 폴리머라제 연쇄 반응의 증폭 생성물에서 관심있는 핵산 분석물의 검출 또는 정량에 관한 것이다. More particularly, the present invention provides a quick, one-step relates to, homologous nucleic acid analysis or quantitative analysis detected the water of interest in the amplification product of a polymerase chain reaction.

몇몇 간행물은 본 출원에서 괄호내 아라비아 숫자로 언급했다. Several publications are cited in this application as my Arabic numerals in parentheses. 이들 참고문헌의 상세한 인용은 상세한 설명 끝부분에 특허청구범위에 바로 앞서 기재한다. Detailed citation of these references is described in the immediately preceding claims, the end of the Detailed Description. 이들 참고문헌은 본 발명이 관여하는 최신 기술을 설명한다. The reference describes the latest technology to which the invention is involved.

[발명의 배경] Background of the Invention

질병 상태 및 감염원을 찾아내기 위한 핵산 혼성 방법의 사용은 빠르게 변하고 있는 기술이다(1). The use of nucleic acid hybrid method for finding the source of infection and disease state that is rapidly changing technology (1). 이들 방법은 임상 실험실에서 허가받을 목적으로, 단순한 비방사성 포맷을 많이 채택하여 왔다(2,3). These methods have been adopted by many in order to receive approval in the clinical laboratory, simple, non-radioactive format (2,3). 이들 분석은 원하는 민감도를 얻기 위해 화학 발광 또는 효소 라벨, 또는 이들의 조합물을 사용한다(4). The analysis uses a chemiluminescent, or enzymatic label, or a combination thereof to achieve the desired sensitivity (4). PCR에 의해 제공되는 빠른 샘플 제조는 빠르고 단순한 분석을 전개시킬 가능성을 제공한다. Rapid sample preparation offered by PCR offers the possibility of developing a quick and simple analysis.

[핵산 증폭 방법들] - the nucleic acid amplification method;

데옥시리보핵산(DNA)과 같은 핵산이 자가-복제(self-replication) 동안 자기 자신의 주형으로서 역할할 수 있음은 잘 알려져 있다. Deoxyribonucleic acid is a nucleic acid such as (DNA) party - that can serve as a template for its own replication (self-replication) are well known. 두가닥 또는 이중 핵산이 그 성분인 한 가닥으로 분리될 수 있는 것 또한 잘 알려져 있다. The two double stranded nucleic acid or to that can be separated into a single strand of the ingredients it is also well known. 이들 특성은 폴리머라제 연쇄 반응(PCR)에 의한 시험관내 핵산 서열의 변형 및 증폭을 허용토록 개발되었다. These properties have been developed allowing ever modified and amplified in vitro nucleic acid sequence by polymerase chain reaction (PCR).

PCR은 반대편 가닥과 혼성되고 관심있는 목표 폴리뉴클레오티드 서열상의 부분에 접하도록 고안된 두개의 올리고뉴클레오티드 프라이머를 사용하는, 시험관내, 핵산 서열의 효소-기재 복제이다. PCR is opposite strand and is mixed using two oligonucleotide primers designed so as to contact the portions on the target polynucleotide sequence of interest, the enzyme in vitro, a nucleic acid sequence - a replication substrate. 반복성 주기 동안 핵산은, 통상적으로 열 변성에 의해 가닥 분리되고, 프라이머가 한가닥 주형과 혼성되고 (열 순환이 사용된다면 어닐링으로서), 그리고 DNA 폴리머라제(DNA 프라이머 확장에 대한 DNA 주형) 또는 역전사효소(DNA 프라이머 확장에 대한 리보핵산 또는 RNA 주형, 또는 DNA 프라이머 확장에 대한 DNA 주형)와 같은 효소가 주형상의 프라이머를 확장시킨다. The nucleic acid for repetitive cycles, typically being separated stranded by thermal denaturation, the primers are mixed with gang mold (as annealed if a heat cycle used), and DNA polymerase (DNA template to DNA primer extension) or reverse transcriptase ( an enzyme such as a DNA template) for a template ribonucleic acid, or RNA, or a DNA primer extension to the DNA primer extension extends the primer of the primary shape. 새로 합성된 가닥을 포함하여, 두가닥(플러스 및 마이너스) 모두 가닥 분리 단계에 의해 각각 양쪽 프라이머 확장을 위한 주형으로서 유용하게 만들어진다. Including newly synthesized strands, two strands (plus and minus) it is made to be useful both as a template for both primers respectively by the strand separation step expansion. 두개의 프라이머를 가진, 그 결과 각 순환마다 플러스 및 마이너스 사슬이 복제되기 때문에, 각 순환마다 주형내 핵산 복사수(플러스 및 마이너스 가닥 모두)가 지수적으로 증가한다(그러므로 용어 연쇄 반응이 사용됨). With two primers, and as a result is because the positive and negative chain clone for each cycle, each cycle can copy the template in a nucleic acid (both the plus and minus strands) it is increased exponentially (and therefore used the term chain reaction). 결과 핵산 이중사슬이 사용된 특이 프라이머의 말단에 상응하는 종결부를 가질 것이다. Results will have end portions corresponding to the ends of the double-stranded nucleic acid using the specific primers. PCR에 의해 시험관 내에서 핵산 서열을 증폭하고 검출하고 또는 그렇지 않으면 변형하는 것이 가능하다. If by PCR amplifying a nucleic acid sequence in vitro, and detecting and or not it is possible to strain.

PCR을 위한 프라이머의 제조는 증폭되어야 할 또는 검출되어야 할 핵산 가닥(플러스 및 마이너스 주형 모두)의 말단서열이 알려져 있을 것을 요구한다(5). The preparation of primers for PCR is required to have a terminal sequence of the nucleic acid strand to be detected or to be amplified (both positive and negative mold) is known (5). 서열정보는 관심있는 핵산 말단의 직접 서열화에 의해, 또는 폴리펩티드 말단의 서열화에 의해 유도될 수 있으며 상응하는 복제 올리고뉴클레오티드 프라이머를 생산한다. Sequence information can be derived by sequencing the nucleic acid by direct sequencing of the terminal of interest, or a polypeptide and a corresponding terminal oligonucleotide to clone it produces oligonucleotide primer. 최적 프라이머 크기는 전형적으로 길이로 약 20-30 염기이나 작용가능한 프라이머는 특이 환경에서 더 작거나 클 수 있다. Optimal primer size is typically about 20-30 bases in length as possible and the function primers may be smaller or larger in the specific environment. 공지된 바와 같이, 프라이머 크기가 감소함에 따라 프라이머가 관심있는 서열상의 계획되지 않은 위치에 혼성될 가능성이 증가한다. As is known, it is likely to be mixed in an unplanned position on the primer sequence that is of interest increased as the primer size decreases. 계획되지 않은 혼성은 바라는 생성물 증폭의 중단 및 보다 작은 크기 또는 바라지 않는 프라이머 삽입물을 가진 생성물의 생성을 유도할 수 있다. Unplanned hybrid can lead to downtime and smaller size or want the generation of the product with the primer of the implant does not amplify desired product. 그러므로, PCR을 위한 두개의 최적 프라이머의 선택은 실행할 때마다 관심있는 서열과의 계획되지 않은 혼성을 피할 것을 요구한다. Therefore, the selection of two optimal primers for PCR are required to avoid unplanned hybrid of the sequence of interest each time it runs.

계획되지 않은 혼성을 피하기 위한 프라이머 서열의 합리적 선택은 잘 공지되어 있다. Rational selection of primer sequence to avoid unplanned hybrid is well known. 연산방식(algorithms)이 공지되어 있으며, 이로써 숙련공은 제안된 프라이머 서열을 (알려진)전체 주형 서열과 분석 혼합물내 존재하는 것으로 알려진 어떤 다른 서열에 비교할 수 있다. Operation methods (algorithms) are known, and thus skilled workers can be compared to any other sequences known to be present in the (known) the proposed primer sequences to the entire template sequence analysis mixture.

관심있는 핵산 서열의 반대편 가닥 말단 부분을 결정하고 이에 혼성될 수 있는 2개의 프라이머를 제조할 필요성은 유니버셜 프라이머에 의해 피해질 수 있을 것이다. Determining the terminal portion of the opposite strands of the nucleic acid sequence of interest and the need to manufacture two primers, which may be mixed thereto could be avoided by the universal primer. 존재하는 모든 DNA 서열은 유니버셜 프라이머 결합 위치를 수용하고 유니버셜 프라이머에 의해 증폭될 것이다. All DNA sequences present will receive a universal primer binding site and will be amplified by the universal primer.

PCR 증폭은 폴리뉴클레오티드 서열 라이브러리(library)로부터 새로운 유전자 서열을 분리하기 위해 사용되고 있다. PCR amplification has been used to isolate new gene sequences from a polynucleotide sequence library (library). 새로운 유전자는 또한 새로운 유전자 서열 부분을 혼입하는 충분히 상보적인 프로브(probe)에 의해 분리되어질 수 있으나, 이러한 프로브 분리 방법은 PCR에 의해 제공되는 민감도를 결여한다. The new gene, but also can be separated by a sufficiently complementary probe (probe) to incorporate the new gene sequence portion, such a probe separation methods lack the sensitivity provided by PCR.

PCR에 기초한 선행 기술 분석에서, 5' 말단에서 라벨링된 핵산 프로브는 관심있는 핵산 분석물과 혼성하기 위해 사용되어 왔다. In the prior art, analysis based on the PCR, a nucleic acid probe labeled at the 5 'end it has been used to hybrid with a nucleic acid of interest in the analyte. 이들 프로브는 종종 이들의 표지되지 않은 3' 말단에서 폴리머라제 연쇄 반응으로 들어가므로 의사(擬似) 결과를 초래하게 된다. These probes are often because it into the polymerase chain reaction from the 3 'end thereof be labeled that results in a doctor (擬 似) results. 선행 기술 분석은 또한 이종, 즉, 분리 분석이다. Prior art analysis is also two kinds, that is, separate analysis. 그렇기 때문에 그들은 시간 소비적이고 수반된 많은 세척 단계는 분석 샘플의 오염 가능성이 생기게 한다. Therefore, they involve a number of washing steps and time consumption is causing the contamination of the assay sample.

[라벨링된 핵산 서열의 검출] [Detection of the labeled nucleic acid sequences;

많은 방법 및 시스템이 생화학적 및 생물학적 기질내 관심있는 핵산 분석물의 검출 및 정량을 위해 개발되고 있다. Many methods and systems have been developed for biochemical and biological substrates of interest within the nucleic acid analyte detection and quantification. 전형적으로 관심있는 핵산 분석물의 존재는 관심있는 분석물에 결합된 프로브에 부착된 관찰가능한 라벨 의 존재 또는 부재에 의해 지시된다. Typically the presence of the nucleic acid of interest analysis is indicated by the presence or absence of an observable label attached to the binding to an analyte of interest probe. 특히 관심은 광화학적, 화학적 및 전기 화학적 방법을 통해 발광하도록 만들어질 수 있는 라벨들이다. Of particular interest are labels which can be made to emit light through photochemical, chemical, and electrochemical methods.

광발광(photoluminescence)은 물질이 전자선을 흡수할 때 물질이 발광하도록 유도되는 법이다. Light emission (photoluminescence) method is derived materials to emit light when the material is absorbing the electron beam. 형광 및 인광은 광발광의 종류이다. Fluorescence and phosphorescence are types of photoluminescence. 화학 발광(chemiluminescent) 방법은 에너지의 화학적 전이에 의해 발광종의 창출을 일으킨다. Chemiluminescence (chemiluminescent) method causes the creation of luminescent species by chemical transfer of energy. 전기화학 발광(electrochemiluminescence)은 전기화학적으로 발광종의 창출을 일으킨다. Electrochemiluminescense (electrochemiluminescence) causes the creation of the luminescent species electrochemically.

전기화학 발광(ECL) 분석 기술은 화학 발광 기술상의 진보이다. Electrochemical luminescence (ECL) analysis technique is an advanced technical chemiluminescence. 그들은 관심있는 분석물의 존재 및 농도에 대해 민감하고 정확한 측정을 제공한다. They provide a sensitive and accurate measurement for the presence and concentration of interest analysis. 상기 기술에서, 항온처리된 샘플은 발광을 개시하기 위해 전압계 작동 전극에 노출된다. In the above technique, the sample incubation is exposed to a voltmeter working electrode in order to start light emission. 적절한 화학적 환경에서, 상기 전기화학발광은 특정시간에 특정방식으로 작동전극상에 가한 전압에 의해 개시된다. In an appropriate chemical environment, the electro-chemiluminescence is initiated by a voltage inputted to the working electrode in a specific manner at a given time. 라벨에 의해 생성된 빛을 측정하는데, 이는 분석물의 존재 또는 양을 가리킨다. For measuring the light produced by the label, which indicates the presence or amount of the analyte. 상기 ECL 기술의 완전한 설명을 위해, PCT 공고 출원번호 US 85/01253(WO 86/02734), PCT 공고 출원번호 US 87/00987(WO 87/06706) 및 PCT 공고 출원번호 US 88/03947(WO 89/04302)를 참조한다. For a complete description of the ECL technology, PCT Publication Application Nos. US 85/01253 (WO 86/02734), PCT Publication Application No. US 87/00987 (WO 87/06706) and PCT Publication Application No. US 88/03947 (WO 89 see / 04 302). 상기 출원의 개시는 참고로 통합되었다. Initiation of the application are incorporated by reference.

분석과정동안 분리 단계와 함께 및 없이 전기화학발광 분석을 수행하는 것 및 정확하고 민감한 측정이 가능토록 분석물의 다른 농도에서 시그널 변조를 최대화하는 것이 가능하다. To perform the analysis process separation steps Electrochemiluminescense analysis without and with the over and it is possible to accurately and maximize the signal modulation at different concentrations of the analyte ever sensitive measurement is possible.

PCT 공고 출원 번호 US 89/04919(WO 90/05301)는 불활성 마이크로미립 물질이 분석 시스템의 결합 반응물 중 하나에 특이하게 결합되는 발광현상에 근거하여 민감하고 특이한 결합 분석 방법을 설명한다. Publication PCT Application No. US 89/04919 (WO 90/05301) describes a sensitive and specific binding assay methods based on a luminescent phenomenon in which the micro particulate inert material specifically binds to one of the binding reactants of the assay system. 분석은 이종(하나 또는 그 이상의 분리 단계) 분석 포맷으로 수행되고 가장 유익하게는 동종(비분리) 분석 포맷으로 사용될 수 있다. Analysis can be used heterogeneous (one or more separation steps) assay format is carried out most advantageously homogeneous (non-separation) assay format.

발광은 특이 결합 상대와 결합하였던 또는 결합하지 않았던간에, 전압계 작동 전극에 라벨 화합물을 노출시킴으로써 유도된 전기화학 발광(ECL)으로부터 발생한다. Light emission is caused from the electrochemical luminescence (ECL) induced by exposing, the label compound to a voltmeter between the working electrode was not bonded or who combined with specific binding partner. ECL 반응성 혼합물은 빛을 발생시키기 위해 특정시간에 특정방식으로 작동 전극에 가한 전압에 의해 빛을 방출하도록 조절가능하게 개시된다. ECL reactive mixture is started to be controlled to emit light by a voltage inputted to a working electrode at a particular time in a particular manner to generate light.

미합중국 특허 출원 제 267,509 호 및 미합중국 특허 출원 제 266,914 호는 바람직한 분석 조성물에 관한 것이다. U.S. Patent Application No. 267 509 and U.S. Patent Application No. 266 914 relates to a preferred composition analysis. 이들 출원의 개시는 참고로 통합된다. Disclosure of these applications is incorporated by reference.

미합중국 특허 출원 제 267,234 호, 미합중국 특허 제 5,061,445 호 및 미합중국 특허 출원 제 744,890 호는 ECL-기재 분석의 실행을 위한 바람직한 장치를 설명한다. U.S. Patent Application No. 267 234, U.S. Patent No. 5,061,445 and U.S. Patent Application No. 744 890 describes a preferred arrangement for the execution of the ECL- base analysis. 미합중국 특허 출원 일련번호 제 652.427 호는 ECL-기재 분석을 실행하기 위한 바람직한 방법 및 장치를 설명한다. U.S. Patent Application Serial No. No. 652.427 describes a preferred method and apparatus for performing the described analysis ECL-. 여기서 또한 참고로 통합된, 이들 모든 출원의 개시는 조사 및 임상 세팅에서 수행되는 다양한 분석에서 분석물의 극히 적은 양의 정량 및 검출을 허용한다. Here also the reference, those disclosed in all the application integration allows a variety of very small amounts of analyte analysis and quantification detection are performed in the research and clinical settings to.

[발명의 목적] [Purpose of the Invention

폴리머라제 연쇄 반응 또는 다른 프라이머 유도 증폭으로 증폭된 핵산에 대한 분석을 빠르게 수행하기 위한 방법을 제공하는 것이 본 발명의 주요목적 이다. It is a primary object of the present invention to provide a method for rapidly performing the analysis of the nucleic acid amplification by polymerase chain reaction or other amplification primer derived.

폴리머라제 연쇄 반응으로 증폭된 관심있는 핵산에 대한 민감하고 믿을만한 동종 분석을 빠르게 수행하기 위한 방법을 제공하는 것이 본 발명의 또 다른 관련된 목적이다. It is another related object of the invention to provide a method for sensitively and quickly perform a reliable analysis of the same kind of interest in the amplified nucleic acid by polymerase chain reaction.

선행 기술 분석과 관련된 샘플 오염 및 세척 단계를 피하는 분석을 제공하는 것이 본 발명의 또 다른 목적이다. It is another object of the present invention to provide an analysis to avoid sample contamination and washing steps associated with the prior art analysis.

5' 프로브의 사용과 관련된 의사 결정 및 문제를 피하는 분석을 제공하는 것이 본 발명의 부가적이고 관련된 목적이다. 5 'to the additional and related object of the invention to provide an analysis to avoid decision making and problems related to the use of the probe.

[발명의 요약] SUMMARY OF THE INVENTION

통상적 분석에서 사용되는 많은 세척 단계 및 프로브의 첨가에 의해 소비되는 시간 및 오염을 피하는 증폭된 DNA에 대한 빠른 미분리 분석에 의해 이들 목적은 달성된다. Many washing steps and their purpose by the rapid non-separation analysis of the amplified DNA to avoid the contamination and time consumed by the addition of a probe used in the conventional analysis is achieved.

올리고뉴클레오티드 프라이머는 결합 모이어티 또는 검출가능한 라벨에 결합되고 올리고뉴클레오티드 프로브는 결합 모이어티 또는 검출가능한 라벨로 3' 또는 3' 및 5' 말단에서 라벨링되어, 그 결과 결합 모이어티 및 검출가능한 라벨 둘다가 프라이머 및 프로브 혼합물 내에 존재한다. Oligonucleotide primer coupled to the possible binding moiety or detection label oligonucleotide probe is labeled at the 3 'or 3' and 5 'terminal as a possible binding moiety or detection label, and the result bond moiety and a detectable label both present in the primer and probe mixture. 이러한 프로브 및 프라이머의 혼합물은 PCR 또는 다른 프라이머 유도 반응 혼합물 내로 도입되고, 그 결과 혼합물은 개질된 프라이머의 첨가시에 반응을 위해 완전하다. A mixture of such a probe and primer is introduced into a PCR or other primer induced reaction mixture, the resultant mixture is complete for reaction on addition of the modified primer. 3' 또는 3'5' 라벨링된 포지자는 PCR 산물 내로 혼입되지 않으므로 5' 라벨링된 프라이머와는 달리 혼성에 대한 그들의 특이성을 유지한다. 3, unlike the 'or 3'5' labeled opposite who is not incorporated into the PCR product of 5 'labeled primer maintain their specificity for the hybrid. 이들 PCR/혼성으로부터의 샘플은 그리고나서 스트렙타비딘 비드의 현탁액 내로 샘플링되고 직접 ECL 분석기 내에 위치한다. Samples from these PCR / hybrid is then sampled into a suspension of streptavidin beads located in the direct ECL analyzer. 이러한 빠른 샘플 조작은 전형적 혼성분석에 수반되는 세척 단계를 피한다. This rapid sample manipulation avoids the three steps involved in typical hybrid analysis.

[도면의 간단한 설명] BRIEF DESCRIPTION OF THE DRAWINGS

제1도는 빠른 일단계 분석에 대한 분석 포맷이다. First turning the assay format for rapid one step assay.

제2도는 HIV1 gag에 대한 분석, 빠른 일단계 분석이다. The second turning is analyzed, rapid one-step analysis of the HIV1 gag.

제3도는 낭포성 섬유 유전자(cystic fibrosis gene)에 대한 분석, 빠른 일단계 분석이다. The analysis is a fast one-step analysis of the cystic fiber gene (cystic fibrosis gene) 3 degrees.

제4도는 합성 낭포성 섬유 유전자에 대한 그의 특이성을 증명하는 분석이다. 4 is a turning analysis to prove its specificity for synthetic cystic fiber gene.

제5도는 정상 인간 샘플내 낭포성 섬유 유전자에 대한 분석이다. The fifth is to turn analysis of the normal human cystic fiber sample within the gene.

제6도는 노오쓰 캐롤라이나(North Carolina) 대학으로부터의 인간 샘플내 낭포성 섬유 유전자에 대한 분석이다. The sixth turning the analysis of human samples within cystic fiber gene from the furnace Otsu Carolina (North Carolina) University.

[발명의 상세한 설명] [Detailed Description of the Invention]

[정의] [Justice]

발명을 보다 명확히 이해하기 위해, 일부 용어를 하기와 같이 정의한다: In order to more clearly understand and to practice the invention, it is defined as follows for some of the terms:

뉴클레오티드는 4개의 염기중 하나: 아데닌(adenine), 시토신(cytosine), 구아닌(guanine), 및 티민(thymine) (DNA) 또는 우라실(uracil) (RNA), + 당 (DNA에 대해서는 데옥시리보스, RNA에 대해서는 리보스), +포스페이트이다. Nucleotide is one of four bases: adenine (adenine), cytosine (cytosine), guanine (guanine), and thymidine (thymine) (DNA) or uracil (uracil) (RNA), + per (oxy used for DNA, ribose, for the RNA is ribose), + phosphate. DNA 중합 반응을 위한 단량체를 제공하기 위해, 전형적으로 4개의 데옥시뉴클레오티드 트리포스페이트 모두가 필요하다. In order to provide monomers for the DNA polymerization reaction, it is typically required with all four deoxynucleotide triphosphates. 본원에서 정의된 뉴클레오티드는 주형상에서의 폴리머라제의 작용을 개선하기 위해 사용되는 5-메틸-dCTP 및 7-데자-dGTP(7-deaza-dGTP)와 같은 개질된 염기도 또한 포함할 수 있다. A nucleotide as defined herein may comprise a 5-methyl, such as deja -dCTP and 7 -dGTP (7-deaza-dGTP) is used to improve the action of polymerase on a template modification also basicity. 본원에서 사용된 용어 뉴클레오티드는 증폭된 서열의 선택적 결합에 제공하기 위해, 증폭하는 동안 프라이머 내로 또는 프라이머 확장 산물 내로 직접 혼입될 수 있는 아미노-7-dUTP(Clontech, Palo Alto, California) 및 바이오틴-21-UTP 및 디곡시제닌(digoxigenin)(Indiana, Indianapolis, Boehringer Mannheim 으로부터의 디곡시제닌-11-UTP) 및 바이오틴에 연결된 염기도 또한 포함한다. The term nucleotide as used herein is to provide for selective binding of amplified sequences, amplification can be directly incorporated into a primer or into a primer extension product amino -7-dUTP (Clontech, Palo Alto, California), which during and biotin -21 -UTP and digok when angiogenin (digoxigenin) (Indiana, Indianapolis, Boehringer Mannheim when digok from Janine -11-UTP) and basicity coupled to biotin is also included.

올리고뉴클레오티드는 적어도 두개의 뉴클레오티드로 형성된 서열이다. The oligonucleotide is a sequence formed of at least two nucleotides. 폴리뉴클레오티드는 긴 올리고뉴클레오티드이고 RNA 또는 DNA일 수 있다. A polynucleotide may be a long oligonucleotide is RNA or DNA. 용어 올리고뉴클레오티드는 일반적으로 보다 작은 핵산 사슬을 정의하기 위해 당업계에서 사용되고 폴리뉴클레오티드는 일반적으로 DNA 또는 RNA 염색체 또는 이의 단편을 포함하여, 보다 긴 핵산 사슬을 정의하기 위해 당업계에서 사용된, 본원에서의 이런 용어 사용은 특별히 언급하지 않는 한 크기를 제한 혹은 기술하려는 것은 아니다. The term oligonucleotide industry used in the art to generally define a smaller nucleic acid chain with a polynucleotide generally, including DNA or RNA chromosomes or fragments thereof, in the, herein used in the art to define a longer nucleotide chain the use of these terms is not intended to limit or describe the size, unless otherwise specified.

용어 핵산은 상기 언급한 바와 같은 개질된 염기를 가지거나 갖지 않은 DNA 또는 RNA 염색체 또는 이의 단편을 포함하는, 임의 길이의 폴리 뉴클레오티드를 말한다. The term nucleic acid refers to a polynucleotide of any length, including non-modified nucleotide branches or without DNA or RNA chromosomes or fragments thereof as mentioned above.

서열(즉, 서열, 유전자 서열, 폴리뉴클레오티드 서열, 핵산 서열)은 5' 에서 3' 방향으로 읽혀 내려가는 폴리뉴클레오티드 가닥내 존재하는 실제 열거된 염기(리보스 또는 데옥시리보스)를 말한다. Refers to a sequence (i.e., sequence, genetic sequence, polynucleotide sequence, nucleic acid sequence) is the actual enumerated bases (ribose or deoxyribose) present in the polynucleotide down direction is read as "at 3 '5 strands.

첫번째 뉴클레오티드 서열에 대한 상보체는 첫번째 서열과 왓슨-크릭 혼성(Watson-Crick hybridization)에 의해 짝지워질 염기로 이루어진 두번째 서열인 것으로 잘 알려져 있다. Complement of the first nucleotide sequence is the first sequence that is Watson-known to be a second sequence consisting of base pairs deleted by Creek hybrid (Watson-Crick hybridization). 즉, 데옥시 리보핵산(DNA) 서열 5'-ATGC 3'에 대한 상보체는 5'-GCAT 3'로 잘 알려져 있다. I.e., deoxyribonucleic acid (DNA) sequence 5'-ATGC 3 'is a complement of the 5'-GCAT 3' is well known to. 이중 또는 두가닥 DNA의 경우, 두가닥의 각각은 다른 것에 대해 상보적으로 또한 상보적인 짝으로 설명된다. For a dual or two-stranded DNA, each of the two strands are described as complementary to the complementary pair also over the other. 용어 상보체 및 반상보체도 또한 사용될 수 있다. The term complement and complement platen may also be used. RNA로의 전사가 진행되는 이중 DNA 가닥을 구별키 위해, 전사가닥은 일반적으로 플러스로 서술되고 그의 상보체는 마이너스로 서술되고(또는 + 및 -), 또는 전사 가닥은 센스 가닥(sense strand)으로 그의 상보체는 안티센스(antisense)로 서술된다. To distinguish the double strand of DNA that is transferred to RNA proceeds key, transfer strands is generally described as plus and its complement is described as a negative (or + and -), or transcription strand is His in the sense strand (sense strand) complement is described in an antisense (antisense). 상보적인 모든 염기 쌍을 가진 다른 것에 각각 혼성된 두개의 가닥은 각각 서로 100% 상보적이다. Two strands, each being mixed with the other complementary to all base pairs complementary to each other are each 100%. 5%의 비상보적인 염기를 가진, 각각 다른 것과 혼성되는 두 가닥은 95% 상보적이다(또는 두가닥이 95% 상보성을 가진다). Emergency beam of the two strands to be mixed with each other as a base, 5% to 95% is complementary (or the two strands have 95% complementarity).

폴리뉴클레오티드 서열사이의 유사성(Homology) 은 각각이 서열사이의 서열 유사성의 점도를 말한다. Similarity (Homology) between polynucleotide sequences refers to the viscosity of the sequence similarity between the respective sequences. 서열이 동일한 두 가닥은 100% 서열 유사성을 가진다. The two strands have the same sequence have 100% sequence homology. 서열의 5%가 다른 두 가닥은 95% 서열 유사성을 가진다. Two strands of 5% of the sequence is different has a 95% sequence similarity. 서열 5%가 다른 두 가닥은 95% 서열 유사성을 가진다. Two strand SEQ ID NO: 5% of the other has a 95% sequence similarity. 가닥 A 및 B 사이의 유사성의 정도가 클수록 B의 상보체와 A사이의 상보성이 커진다. The greater the degree of similarity between strands A and B, the greater the complementarity between A and the complement of B.

프로브(probe)는 관심있는 목표 핵산 서열에 상보적인 서열을 갖는 한가닥 또는 두가닥 핵산이고, 또한 프로브-목표 이중사슬의 측정을 가능케하는 몇가지 부가적인 특성을 가진다. Probe (probe) is having a sequence complementary to the target nucleic acid sequence of interest in gangs or two stranded nucleic acid, and probe has several additional features which allow for the measurement of target double-stranded. 숙련공은 만일 프로브 및/또는 목표가 두가닥이면, 두 가닥 핵산은 혼성이 일어나기 전에 가닥 분리가 일어나야만 한다는 것을 이해할 것이다. Artisan will appreciate that ten thousand and one probe and / or the target is double stranded, double-stranded nucleic acid strands are only separated before the hybrid happen.

프로브는 부착된 태그(tag) 또는 라벨(label)에 의해 검출될 수 있도록 된다. The probe is to be detected by an attached tag (tag) or label (label). 프로브에 연결된 태그나 라벨은, 원칙적으로, 형광 또는 발광 태그, 동위원소의(즉, 방사성 동위원소 또는 자기 공명) 라벨, 염색 라벨, 효소 라벨, 항체에 의해 검출가능한 항원 결정자(antigenic determinant), 또는 스트렙타비딘으로 피복된 비드와 같은 또다른 결합 모이어티가 프로브에 특이적으로 결합할 수 있게끔하는 바이오틴과 같은 결합 모이어티를 포함할 수 있다. Tags or labels attached to the probe, in principle, a fluorescent or luminescent tags, and isotopes (i. E., A radioisotope or magnetic resonance) label, dye label, an enzyme label, antigen-maker (antigenic determinant) can be detected by an antibody, or streptavidin a streptavidin another binding moiety, such as the coated beads in can include binding moieties, such as biotin, which itgekkeum can specifically bind to the probe. 라벨링된 또는 태그 붙은 프로브-목표 이중 사슬이 형성될 때, 이 이중사슬은 태그 또는 라벨의 특징적인 특성에 의해 검출될 수 있다. Attached to labeled or tagged probe - target when the double-stranded form, a double chain can be detected by the characteristic properties of the tag or label. 라벨 모이어티를 지닌 프로브는 라벨에 의한 검출을 가능케하는 혼성 및 이중 사슬 형성을 통해 라벨링된 모이어티를 갖는 목표물에 의해 포획된다. A probe having a label moiety is captured by the target having a labeling moiety through the hybrid and double-stranded form which allows detection by the label.

프라이머는 관심있는 서열 부분에 상보적인 올리고뉴클레오티드의 비교적 짧은 단편이다(관심있는 서열은 더 긴 핵산 서열내 하위단편일 수 있다). Primer is a relatively short segment of oligonucleotide complementary to the sequence part of interest (the sequence of interest may be in a longer nucleic acid sequence within the sub-fragments). 프라이머는 결과적으로 생기는 확장 산물의 5'-말단을 나타낸다. Primer represents a 5 'end of the resultant extension products. 주형 가닥 상 위의 관심있는 서열에 대해 이의 3'-말단에서 상보적인 프라이머는, 주형에 대한 혼성시 폴리머라제가 이러한 3'-말단에서 작용하도록 한다. Complementary to the primer at the 3'-end thereof to the sequence of interest above the template strand is to be mixed during polymerase I function in this 3'-end of the template. 프라이머도 또한 결합 모이어티 또는 검출가능한 라벨로 그의 5' 말단에서 개질될 수 있다. Primers may also be modified at its 5 'end with a binding moiety or detectable label.

가닥분리는 두가닥 또는 이중 핵산이 두 개의 상보적인 한가닥 폴리뉴클레오티드로 전환하는 것을 말한다. Strand separation refers to two nucleic acids or double-stranded conversion of two complementary polynucleotide gangs. 분리 방법은 효소 매개 분리(예컨대, 효소 헬리케이즈(helicase)에 의해 (5)), 물리적-화학적 분리(pH, 이온 농도, 등등) 및 열 변성으로도 알려져있는 열 분리를 포함하는 공지된 기술을 사용한다. Separation method, physical enzyme mediated separation (5 by, for example, enzyme helicase (helicase)) - a known technique, including chemical separation (pH, ionic concentration, etc.) and heat-denatured, also known as thermal separation use. 열 변성(또한 멜팅(melting)으로 언급됨)은 두가닥 폴리뉴클레오티드(완전히 또 부분적으로 이중사슬)를 폴리뉴클레오티드를 보유하는 용액의 온도를 상승시킴으로써 적어도 두개의 한가닥 폴리뉴클레오티드로 분리하는 것이다. (Also referred to as melting (melting)) thermal denaturation is to separate into at least two gangs of polynucleotide by raising the temperature of the solution holding that polynucleotide two polynucleotide strands (completely again partially double-stranded).

혼성은 상보적인 한 가닥 핵산으로부터 두 가닥 또는 이중 핵산의 형성을 말한다. Hybrid means the formation of a two-stranded or double-stranded nucleic acid from complementary one. 혼성은 DNA-DNA, DNA-RNA 또는 RNA-RNA를 형성하기 위한 충분히 상보적인 한 가닥 DNA 및/또는 RNA사이에서 일어난다. Hybrid occurs between DNA-DNA, DNA-RNA, or fully complementary to the single strand RNA to form an RNA-DNA and / or RNA.

RNA의 시험관내 증폭은 DNA 폴리머라제에 의해 촉매된다. In vitro amplification of RNA it is catalyzed by a DNA polymerase. 많은 종류의 DNA 폴리머라제가 당업계에 공지되어 있다. La many types of DNA polymerase I are known in the art. 그들은 일반적으로 프라이머가 어닐링된 한 가닥 주형을 사용하여 두가닥 DNA 서열의 합성을 촉매하는 공통된 특성을 공유한다. They typically use a template strand primer is annealed and share a common property of catalyzing the synthesis of double-stranded DNA sequence. 대부분의 유기체로부터 추출된 DNA폴리머라제는 핵산의 열변성을 위해 요구되는 온도에서는 불활성이 된다. The DNA polymerases extracted from most organisms is the temperature required for the thermal denaturation of the nucleic acid becomes inactive. 즉, 각 열 주기 시작시 효소의 교체 또는 열 불활성화를 방지할 수 있는 인자의 첨가가, 만일 열에 민감한 효소가 사용된다면 필요하다. That is, the addition of a factor to avoid the replacement or heat inactivation of the enzyme during each heat cycle begins, it is necessary, if ten thousand and one heat-sensitive enzymes are used. 본 발명 뿐만 아니라 시험관 내 PCR에 바람직한 DNA 폴리머라제는 고온에서 살아가는 유기체로부터 유도되고 그러므로 열 내성이 있고, 즉 그러므로 이중 DNA를 변성시키는 온도에서 적절한 촉매 활성을 유지하는 것들이다. As well as the present invention in vitro the preferred DNA polymerase for PCR I are those derived from a living organism at a high temperature, and therefore maintain the proper catalyst activity at the temperature at which heat resistance is, and that is therefore a double modified DNA.

DNA 폴리머라제에 의해 촉매되는 반응은 당업계에 공지되어 있고 본원에서는 DNA 폴리머라제 반응으로 언급된다. The reaction catalyzed by DNA polymerase is known in the art and the present application is referred to as a DNA polymerase reaction. 반응은 일부 또는 모든 4개의 데옥시리보뉴클레오티드 트리포스페이트, 프라이머 (바람직하게는, 과량의 물 내에서) 및 원형 가닥 분리를 위한 수단이 필요하다. The reaction requires a means for some or all of the four deoxy ribonucleotide triphosphates, primers and circular strand separation (preferably, in an excess of water). 가닥 분리는 바람직하게 어닐링(annealing)과 변성 온도 사이의 열 주기에 의해 달성된다. Strand separation is preferably achieved by thermal cycling between annealing (annealing) and the denaturation temperature. 역전사효소는 DNA에서 DNA로의 복제 뿐만 아니라 RNA에서 DNA 복제를 모두 매개하는 것으로 공지되어 있다. Reverse transcriptase is known to replicate as well as to the DNA in the DNA-mediated DNA replication in both the RNA. 그러므로 현재 공지된 꽤 많은 효소가 연쇄반응을 촉매할 것이다. Therefore, the catalyst will be pretty much the chain reaction are known.

전기화학 발광(ECL) 라벨은 전기화학적으로 작용시에 발광종이 되도록 만들어질 수 있는 것들이다. Electrochemical luminescence (ECL) labels are those that can be made to emit light when the paper acts electrochemically. 상기 ECL 라벨은 바드(Bard) 일동 및 마세이(Massey) 일동에 의해 PCT 공고 출원에 서술되어 있다(PCT US 85/02153, WO 86/02734 및 PCT US 87/00987, WO 87/06706). The ECL label Bard (Bard), and all members maseyi (Massey) are described in PCT Publication filed by Nitto (PCT US 85/02153, WO 86/02734, and PCT US 87/00987, WO 87/06706).

용어 검출 및 정량은 측정으로도 언급되고, 정량이 기준 조성물 및 보정물의 제조를 요구함은 물론이다. Terms detection and quantitation are referred to also as a measure, quantify requiring the preparation of the reference composition and bojeongmul. FIG.

ECL 장치 ECL 분석기는 전기화학 발광을 근거로한 분석을 수행하기 위한 임의의 기구이다. ECL ECL analyzer apparatus is any apparatus for performing the analysis on the basis of electrochemical luminescence.

[상세한 설명] [details]

증폭된 핵산 서열에 대한 개선된 빠른 비-분리 분석은 3' 또는 3'5' 전기화학발광 라벨을 가진 올리고뉴클레오티드를 사용하여 개발되었다. Improved quick ratio for the amplified nucleic acid sequence-separation assay was developed to raise with the electrical chemiluminescent labeling the 3 'or 3'5' using the nucleotide. 3' 또는 3'5' 라벨을 가진 올리고뉴클레오티드는 PCR 또는 다른 프라이머 유도 반응에서 프라이머로서 작용할 수 없다. 3 'or 3'5' oligo nucleotide having a label can not act as primers in a PCR reaction or other primer derived. 그들은 과량의 증폭된 핵산에 대한 혼성을 위해 이용가능한 증폭 방법의 말렵에까지 남아있게 된다. They will remain far malryeop possible amplification methods used for hybrid for the excess of the amplified nucleic acid.

이 프로브 시스템을 이용하는 분석은, 프로브가 써모사이클러(thermocycler) 프로그램 내에서 혼성할 수 있기 때문에 빠르다. Analysis using a probe system, is faster, because the probe can be mixed in the thermo between clusters (thermocycler) program. 결합 현상을 검출하기 위해 ECL 기술을 사용함으로써 외부 세척 또는 다른 조작에 대한 필요를 피한다. By using ECL technology to detect binding phenomenon and avoid the need for an external cleaning or other operations. 물론, 세척단계는 임의로 사용될 수 있다. Of course, wash steps may optionally be used. 이들 분석 포맷은 첨가물을 분리 첨가를 해야하고 오염 문제를 각오해야 할 필요성을 제거한다. The assay format can be added to the separated additives and eliminates the need to be prepared to pollution problems. 주로 PCR 반응과 관련하여 하기에 서술하였지만, 발명은 임의의 프라이머 유도 반응에서도 사용될 수 있다. Although described below primarily in connection with PCR reactions, the invention can be used in any primer induced reaction.

이전에 기술된 PCR 프로토콜(6, 7)의 사용에 기초하여 HIV1 gag 유전자 및 인간 낭포성 섬유 유전자의 검출을 위한 분석이 하기에 서술된다. Based on the use of the previously PCR protocols (6,7) it is described in the HIV1 gag gene and the analysis described below is for the detection of human cystic fiber gene. 또한 낭포성 섬유증 상태를 시험한 15명 환자 샘플의 연구도 서술된다. Further study of 15 patients samples tested for cystic fibrosis condition is also described. 사용된 샘플은 5 정상인, 508 삭제에 대해 5 이형접합(heterogeneous)인 및 508 삭제에 대해 5 동종접합(homogeneous)인 것이다. The sample is from 5 normal, 5 homozygous (homogeneous) for 5 heterozygosity (heterogeneous) of 508 and 508 deleted for deleting used.

바람직한 실시양태에서 발명은 하기 단계로 구성되는, 폴리머라제 연쇄반응 또는 다른 프라이머 유도 증폭 반응의 생성물에서 관심있는 핵산 서열을 검출하는 방법으로 이루어진다: (a) 폴리머라제 연쇄반응 또는 다른 프라이머 유도 반응 혼합물 내로 전기화학 발광할 수 있고 관심있는 핵산 서열에 상보적인 하기 일반식을 가진 적어도 하나의 라벨링된 핵산 서열을 혼입하고: Takes place in a preferred embodiment the invention provides a method of detecting a nucleic acid sequence of interest in the product of the polymerase chain reaction or other primer derived amplification reaction, consisting of following steps: (a) into the polymerase chain reaction or other primer induced reaction mixture be light emitting electrochemical and complementary to the nucleic acid sequence of interest incorporated into the at least one nucleic acid sequence labeled with the following formula and:

여기서 M은 루테늄, 오스뮴 또는 레늄이고 R 1 , R 2 , R 3 , R 4 , R 5 및 R 6 는 동일하거나 다르고 각각 H, 1-4 탄소원자의 알킬 또는 링커기이고, NA는 이의 3'말단에서 비피리딜기 중 하나에 또는 이의 3' 및 5' 말단에서 두개의 비피리딜기에 연결된 상기 핵산서열이고, n은 1 또는 2 이다; Wherein M is ruthenium, osmium or rhenium, and R 1, R 2, R 3 , R 4, R 5 and R 6 are the same or different and each H, alkyl or 1-4 carbon linker's group, NA is its 3 'end and in the nucleic acid sequence associated with the two groups in a non-bipyridyl flutes 3 'and 5' end of one or a group-, n is 1 or 2;

(b) 폴리머라제 또는 다른 프라이머 유도 반응을 수행하고; (B) performing a polymerase or other primer induced reaction;

(c) 상기 라벨링된 증폭 생성물의 전기화학발광을 측정한다. (C) measures the electrochemical luminescence of the labeled amplified product. 특히 바람직한 실시양태에서, 많은 수의 3' 라벨링된 핵산 서열이 프라이머 유도 반응 내에 혼입된다. In a particularly preferred embodiment, the number of 3 'labeled nucleic acid sequences are incorporated into the primer derivation reaction.

[실시예] EXAMPLES

[방법론(Methodology)] [Methodology (Methodology)]

응용 바이오시스템 380B DNA 합성기(Applied Biosystems 380B DNA synthesizer) 상에서 올리고뉴클레오티드를 합성하고 클론테크(Clontech)로부터 아미노 변형제를 사용하여 5' 또는 3' 아미노기로 관능화하였다(10). Applied Biosystems 380B DNA synthesizer (Applied Biosystems 380B DNA synthesizer) oligonucleotide was synthesized using the nucleotide and amino modifier from Clontech (Clontech) functionalized with 5 'or 3' amino group on the screen (10). HIVI gag 유전자 PCR 분석에 대해 특이한 올리고뉴클레오티드는 SK 38 프라이머 (ATAATCCACCTATCCCAGTAGGAGAAAT) SK 39 프라이머 (TTTGGTCCTTGTCTTATGTCCAGAATGC) 및 이전에 기술된 것과 같은 SK 19 프로브 (ATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTAC)이다(6). HIVI gag gene PCR analysis for unique oligonucleotide 38 nucleotides SK primer is (ATAATCCACCTATCCCAGTAGGAGAAAT) SK 39 primer (TTTGGTCCTTGTCTTATGTCCAGAATGC) and before the same as that described in SK 19 probe (ATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTAC) (6). tag-NHS를 사용하여 프로브 SK 19의 3' 및 5' 양쪽말단에 라벨링하였다. Using the tag-NHS was labeled at the 3 'and 5' at both ends of the probe 19 SK. 낭포성 섬유 유전자의 경우, 올리고뉴클레오티드는 프라이밍을 위해 CFF(GACTTCACTTCTAATGATGA) 및 CFR(CTCTTCTAGTTGGCATGCT)이다. For cystic fiber gene, the oligonucleotide is a CFF (GACTTCACTTCTAATGATGA) and CFR (CTCTTCTAGTTGGCATGCT) for priming. 프로브는 정상 세포에 대해 CFN2 (GAAACACCAAAGATGATATT)이고 508 삭제에 대해 CFD2 (AACACC-AATGATATTTTCTTT) 이다. The probe is CFN2 (GAAACACCAAAGATGATATT) and CFD2 (AACACC-AATGATATTTTCTTT) for 508 drops against normal cells. 이들을 Ru(bpy) 3 2+ 의 N-히드록시 숙신이미드 에스테르로 아미노기를 통해 3' 및 3'5'부위에서 라벨링하였다(8, 9, 11). Them to Ru (bpy) through an amino group as a N- hydroxysuccinimide ester of 3 2+ were labeled at 3 'and 3'5' sites (8, 9, 11). 프라이머 SK 39 및 CFF는 각각 라벨링되지 않은 SK 38 및 CFR 을 가진 증폭 반응 내에서 5' 바이오틴화된 프라이머이다. Primer SK 39 and CFF is a 5 'biotinylated primers in the amplification reaction with the SK and 38 CFR non-labeling, respectively. 비-특이 올리고뉴클레오티드 람다 1(GAAASTGTGCTGACCGGACATGAAAATGAG)도 또한 합성하고 바탕 시그널에 대한 조절로서 사용되기 위해 3'-말단에서 라벨링하였다. Non-oligonucleotide specificity oligonucleotide lambda 1 (GAAASTGTGCTGACCGGACATGAAAATGAG) was also synthesized and labeled at the 3'-end to use as a control for background signals. 올리고뉴클레오티드는 0.3m NaCl 내 Biogel P6 컬럼 크로마토그래피에 의한 라벨링을 위해 제조되고 제외된 올리고뉴클레오티드 피크의 침전이 따른다. Oligonucleotide is an oligonucleotide prepared for labeling by Biogel P6 column chromatography in 0.3m NaCl and precipitation of the excluded oligonucleotide peak follows. 전형적으로, 0.1 μ몰의 올리고뉴클레오티드는 pH 7.4, 80% 디메틸 설폭시드/오스페이트 완충 염수 내에서 0.5 μ몰의 ORIGEN 라벨과 반응한다. Typically, 0.1 μ mol of oligo nucleotides are reacted with 0.5 μ mole of ORIGEN Label in pH 7.4, 80% dimethyl sulfoxide / agarose sulfate buffered saline. 올리고뉴클레오티드의 바이오틴화는, 라벨링을 위해 50% 디메틸 설폭시드 내 바이오틴 X-NHS(Clontech)를 사용하는 것을 제외하곤 본질적으로 상기와 같이 수행된다. Oligonucleotide biotinylated in nucleotides, except for using a 50% dimethylsulfoxide in biotin-X-NHS (Clontech) for labeling is intrinsically carried out as described above. 라벨링된 올리고뉴클레오티드는 에탄올로 침전되고 혼입되지 않은 라벨을 제거하기 위해 세척된다. Oligonucleotide-labeled nucleotides are washed in order to remove the label and the precipitation with ethanol is not incorporated. 시스템의 특이성을 시험하기 위해 사용된 합성 낭포성 섬유 서열은 하기와 같다. The synthetic cystic fiber sequences used to test the specificity of the system is as follows. 정상 서열, CF 정상; Normal sequence, CF normal; GACTTCACTTCTAATGATGATAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAA-TATAGATACAGAAGCGAGCATGCCAACTAGAAGAG; GACTTCACTTCTAATGATGATAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAA-TATAGATACAGAAGCGAGCATGCCAACTAGAAGAG; 및 돌연변이 서열 CF D508; And mutant sequences CF D508; GACTTCACTTCTAATGATGATAAAGAAA ATATCATTG-GTGTTTCCTATGATGAATATAGATACAGAAGCGAGCATGCCAACTAGAAGAG. GACTTCACTTCTAATGATGATAAAGAAA ATATCATTG-GTGTTTCCTATGATGAATATAGATACAGAAGCGAGCATGCCAACTAGAAGAG.

HIV1 gag 유전자에 대한 PCR은 75ng(7.5pmol)의 바이오틴화된 SK39 및 75ng(7.5pmol)의 SK38 및 1.25ng의 SKl9를 함유하는 25㎕ 반응 부피를 사용하여 본질적으로 (6)에 서술된 바와 같이 수행된다. PCR for the HIV1 gag gene, using the biotinylated SK39 and 25㎕ reaction volume containing SKl9 of SK38 and 1.25ng of 75ng (7.5pmol) of 75ng (7.5pmol) as described in essentially 6 is performed. 펄킨 엘머 써모사이클러(Perkin Elmer Thermocycler) 상에서 사용되는 열주기는 하기와 같다; Equal to the thermal cycle used on peolkin Elmer Thermo between clusters (Perkin Elmer Thermocycler); 95℃ 1분, 60℃ 1분, 회전수는 40이다. 1 minutes 95 ℃, 1 bun 60 ℃, rotation speed is 40. 이는 60℃ 30분 주기가 뒤따른다. This is followed by a 30 minutes 60 ℃ period.

낭포성 섬유 유전자 또는 합성 유전자를 위한 폴리머라제 연쇄 반응은 75ng(7.5pmol)의 CFR 및 75ng(7.5pmol)의 바이오틴화된 CFF 및 3' 또는 3'5'말단에서 라벨링된 5ng의 CFN2 또는 CFD2를 함유하는 25㎕ 반응 부피를 사용하여 본질적으로 (7)에 서술된 바와 같이 수행한다. Polymerase chain reactions for the cystic fiber gene or a synthetic gene for the CFF biotinylated and the 3 'or 3'5' with 5ng CFN2 or CFD2 labeled at the end of the CFR and 75ng (7.5pmol) of 75ng (7.5pmol) use 25㎕ containing reaction volumes to be performed as described in the essentially (7). 낭포성 섬유 분석을 위한 주기 조건은 94℃ 1분, 55℃ 2분, 72℃ 2분의 30 주기이다. Cycle conditions for the cystic fiber assay is 30 cycles of 1 min 94 ℃, 55 ℃ 2 min, 2 min 72 ℃. 이는 98℃ 5분, 65℃ 30분의 주기가 뒤따른다. This is followed by a period of 5 minutes 98 ℃, 65 ℃ 30 minutes. 합성 유전자는 단일 복제 유전자에 대한 정상적인 인간 DNA내 농도, 즉 DNA ㎕ 당 3×10 5 를 모사한 농도에서 사용됐다. Synthetic gene was used in a simulation for normal human DNA concentration, i.e., 3 × 10 5 per ㎕ DNA for single copy gene levels. 연어 정자 DNA는 이들 합성 유전자 증폭 반응에서 비특이 DNA로서 사용되었다. Salmon sperm DNA was used as a non specific DNA in these synthetic gene amplification reactions.

PCR/혼성 주기 후에, ECL 분석기 상의 240 ㎕ ECL 분석 완충용액 내 15㎕ 의 2.8㎛ 스트렙타비딘으로 피복된 자기 비드(Dynal, Great Neck, NY)를 2㎕ 샘플에 첨가하고 15분 동안 항온 처리하고, ECL 분석하였다. After PCR / hybrid cycle, the addition of the magnetic beads (Dynal, Great Neck, NY) coated with 240 ㎕ ECL analysis buffer Dean 2.8㎛ streptavidin within 15㎕ on the ECL analyzer to 2㎕ sample and incubated for 15 minutes It analyzed ECL. 낭포성 섬유 분석의 경우에는, 30% 포름아미드/오리진(ORIGEN) 분석 완충용액 240㎕ 를 샘플에 첨가하였다. For cystic fiber analysis, a 30% formamide / origin (ORIGEN) analysis 240㎕ buffer solution was added to the sample.

[실시예 1] Example 1

[빠른 일 단계 분석에 대한 분석 포맷] [Assay format for rapid one-step analysis]

바이오틴화된 프라이머 및 라벨링되지 않은 프라이머를 사용하여 PCR 반응을 진행하였다. By using a biotinylated primer and non-labeled primers was performed with the PCR reaction. PCR 열주기는 정상적으로 40주기 동안 진행된다. PCR thermal cycle is run for 40 cycles normally. 열주기 말렵에 혼성을 위해 연장된 항온처리를 하였다. It was the incubated extended for a hybrid heat cycle malryeop. 그리고나서, 마지막 항온 처리 주기 말렵에 샘플을 비드에 결합시키기 위해 준비하고, 샘플을 취하여 ECL 분석기상에서 상온에서 결합을 위해 비드에 첨가하였다(15분). Then, by taking the preparation, the samples in order to combine the samples in the last incubation period malryeop the beads were added to the beads for binding at room temperature on the ECL analyzer (15 minutes). 그리고나서, 전기화학발광을 분석하였다. Then, we analyzed the electrochemical luminescence. 분석 포맷은 제1도에 도시되어 있다. Assay format is illustrated in Figure 1.

[실시예 2] Example 2

[HIV1 gag에 대한 분석, 빠른 일 단계 분석] [Analysis of the HIV1 gag, rapid one step analysis;

SK19 3'5' 라벨링된 프로브를 포함하는 HIV1 gag 특이 프라이머로 35주기 동안 PCR을 진행하였다. SK19 3'5 'HIV1 gag containing the labeled probe was carried out the PCR for 35 cycles with specific primers. 양성 HIV1 DNA 샘플은 펄킨 엘머 세튜스킷트(Perkin Elmer Cetus Kit)에서 제공되는 표준의 희석물이었다. Positive HIV1 DNA sample was diluted with water, the standard offered in three tyuseu peolkin Elmer kit (Perkin Elmer Cetus Kit). PCR 샘플 2㎕을 스트렙타비딘 비드에 첨가하고 15분 동안 진탕시키면서 항온처리한 후 ECL 분석기를 사용하여 전기화학 발광을 분석하였다. It was added to PCR samples 2㎕ on streptavidin beads and then incubated with shaking for 15 minutes were analyzed electrochemical luminescence using ECL analyzer.

결과는 제2도에 도시되어 있다. The results are illustrated in Fig. 제2도는 HIV1 gag 유전자의 빠른 분석을 위한 단순화된 PCR 분석을 나타낸다. Second turn represents a simplified PCR assay for rapid analysis of the HIV1 gag gene. 이 능력은 부분적으로 ECL 시스템 및 ECL-기재 분석 포맷에 기인한다. This ability is due in part to the ECL system and ECL- described assay format. 본 ECL 시스템은 구체적으로 (i) PCR의 가혹한 처리에 버틸 수 있는 안정한 라벨, (ii) ECL의 특성 때문에 외부세척에 대한 필요가 제거되는 분석 양식 (iii) 방사성에 뒤지지 않는 분석물의 검출에 대한 민감도를 제공한다. The ECL system specifically, (i) PCR stable label, (ii) ECL sensitivity characteristics due to the analysis that is comparable to radioactive Analysis form (iii) that requires a removal of an external cleaning water detection that can withstand the harsh treatment of the It provides.

HIV1 gag 연구에 대한 결과는, 거의 노력 없이도 복사수의 검출이 12.5 복사까지 내려감을 나타내었다. Results for the HIV1 gag study showed a little down trying to copy without the detection of copy number of 12.5. 빠른 스크리닝 시스템에 대한 이 방법론의 유용성은 분명하며 개선된 열 주기 성능과 함께, 보다 낮은 복사수의 검출을 허용케한다. Quick screening usefulness of this methodology for the system is clear and with improved thermal cycle performance, and Kane could allow detection of lower copy.

[실시예 3] Example 3

[낭포성 섬유 유전자에 대한 분석, 빠른 일 단계 분석] [Analysis of the gene cystic fibrous, fast one-step analysis]

본 발명의 분석은 낭포성 섬유 유전자내 508 코돈(codon) 삭제에 대한 경우처럼 정상 유전자와 비교하여 거의 돌연변이체가 없는 유전자를 판별하기 위해 사용된다. Analysis of the present invention is used to determine gene mutations with little body as compared to the normal gene as is the case for deletion cystic fiber 508 codons (codon) within the gene. 분석은 정상적인 피험자의 태반 세포주로부터의 인간 DNA와 합성 유전자를 사용하여 시험되었다. Assay was tested using human DNA and the synthetic gene from the placenta cell lines of normal subjects.

3'5'라벨링된 CFN2를 포함하는 낭포성 섬유 특이 프라이머로 30 주기 동안 PCR을 진행했다. 3'5 'cystic fiber comprising a labeled CFN2 proceeded to PCR for 30 cycles with specific primers. DNA 샘플은 인간 세포주(헬라(HeLa), 8)로부터 단리된 DNA의 희석물이었다. DNA samples were dilutions of DNA isolated from a human cell line (HeLa (HeLa), 8). PCR 샘플 2㎕를 스트렙타비딘 비드에 첨가하고 15분간 진탕시키면서 항온처리한 후 ECL 분석기를 사용하여 전기화학발광에 대해 분석하였다. After the addition of the PCR samples 2㎕ the streptavidin beads and shaking 15 minutes incubation and analyzed for electrochemical luminescence using ECL analyzer.

분석 결과는 제3도에 도시되어 있다. The results are shown in FIG. 3. 낭포성 섬유 유전자에 대한 분석의 성공 및 기대했던대로 1ng 이하의 인간 DNA내 유전자의 검출이 가능하도록 하는 시스템의 민감도가 증명된다. The sensitivity of the system to be successful, and the detection of human DNA in the genes of more than 1ng, as expected, the analysis of the cystic fibrous gene is to be proved.

[실시예 4] Example 4

[그 특이성을 증명하는 합성 낭포성 섬유 유전자에 대한 분석] [Analysis of the synthetic gene cystic fibrous prove its specificity]

낭포성 섬유 유전자에 대한 본 발명의 특이성을 조사하기 위해 각각 정상 유전자 서열 및 508 삭제를 포함하는 돌연변이체 유전자 서열을 포함하는 두 합성 서열을 생성하였다. Two synthetic sequence containing the mutant gene sequence, each of which includes the normal gene sequence and 508 removed in order to investigate the specificity of the invention for the cystic fiber gene was generated. 이들 유전자 표본을, 증폭되어야 할 낭포성 섬유 서열의 특성에 관해서 의심없이 혼성 반응의 특이성을 결정하기 위해 인간 DNA에서 밝혀진 농도로 희석하였다. The sample was diluted gene, the human DNA found in a concentration with respect to the nature of the cystic fiber sequences can be amplified to determine the specificity of the mixed reaction without doubt.

3' 라벨링된 프로브 CFN2 및 CFD2를 포함하는 낭포성 섬유 특이 프라이머로 30 주기 동안 PCR을 진행하였다. 3 'The PCR was performed for 30 cycles with the cystic fiber-specific primers containing the labeled probes CFN2 and CFD2. DNA 샘플은 연어 정자 DNA로 만들어지는 합성 DNA의 희석물이었다. DNA samples were dilutions of synthetic DNA made with salmon sperm DNA. PCR 샘플 2㎕를 15㎍의 스트렙타비딘 비드에 첨가하고 15분 동안 진탕시키면서 항온처리한 후 ECL 분석기를 사용하여 전기화학 발광에 대해 분석했다. Adding PCR samples 2㎕ to streptavidin beads 15㎍ and then incubated with shaking for 15 minutes were analyzed for electrochemical luminescence using ECL analyzer.

제4도에 도시된 결과는 정상 또는 돌연변이 유전자를 특이적으로 검출하는 분석 활성을 보인다. The results shown in Figure 4 looks at the activity analysis for detecting a normal or mutant gene specifically. 이 빠른 분석 포맷은 재빠른 검출과 밀접히 상관된 서열의 구별을 가능케한다. This rapid assay format makes it possible to distinguish a sequence of correlated closely and quick detection.

[실시예 5] Example 5

[정상 인간 샘플내 낭포성 섬유 유전자에 대한 분석] - analysis of normal human samples within the cystic fibrous gene]

3'5' 라벨링된 프로브 CFN2 및 CFD2를 포함하는 낭포성 섬유 특이 프라이머로 30주기 동안 PCR을 진행했다. 3'5 'cystic fiber containing labeled probes CFN2 and CFD2 proceeded to PCR for 30 cycles with specific primers. DNA 샘플은 개인 융모막(Sigma Ltd)로부터 단리된 인간 DNA의 개인 샘플이다. DNA samples are individual samples of Human DNA isolated from individual chorionic (Sigma Ltd). PCR 샘플 2㎕를 15ng의 스트렙타비딘 비드에 첨가하고 15분 동안 진탕시키면서 항온처리한 후 ECL 분석기를 사용하여 전기화학발광에 대해 분석했다. Adding PCR samples 2㎕ to streptavidin beads of 15ng, and then incubated with shaking for 15 minutes were analyzed for electrochemical luminescence using ECL analyzer.

[실시예 6] Example 6

[노오쓰 캐롤라이나(North Carolina) 대학으로부터의 인간 샘플내 낭포성 섬유 유전자에 대한 분석] [No-Otsu Carolina (North Carolina) analysis of human samples within the cystic fiber gene from the university;

실시예 6 으로부터의 자료는 노오쓰 캐롤라이나로부터의 인간 DNA 샘플 한 세트를 분석함으로써 확증되었는데, 여기에서 각 샘플이 이전 방법(7)과 비교하여 본 발명의 방법을 사용하여 정확하게 분석되었다. Examples of materials from 6 were confirmed by analyzing human DNA samples inset from the furnace Otsu Carolina, each sample where the analyzed accurately by using the method of the invention compared to previous methods (7). 자료는 변덕스러운 PCR 및 샘플 DNA 농도 다양성에 기인하여 넓은 범위의 시그널을 보이나, 바탕의 일관성에 의해 CFN2 프로브로 얻은 시그널에 의한 정상 유전자의 존재 및 CFD2 프로브로의 돌연변이체 유전자의 존재를 기록할 수 있다. Data volatile PCR and the sample DNA concentration look for a wide range signals due to diversity, it is possible to record the presence of the mutant gene of the normal presence of the gene and CFD2 probe by the signal obtained with the CFN2 probe by the consistency of the ground have. 이들 연구에서 샘플 15는 가장 낮은 시그널을 제공하나 여전히 상당하게 비-특이 프로브 시그널보다 위이다. Is above the specific probe signals - Sample 15 in these studies is the one still provides a low signal to a non-significant. 자료는 제6도에 도시되어 있다. The data is shown in Figure 6.

3' 라벨링된 프로브 CFN2, CFD2 및 비 특이 프로브(람다1)을 포함하는 낭포성 섬유 특이 프라이머로 30 주기 동안 PCR을 진행하였다. 3 'The PCR was performed for 30 cycles with the cystic fiber-specific primers containing the labeled probes CFN2, CFD2, and a non specific probe (lambda 1). DNA 샘플은 0.5 내지 2.5㎍/㎕의 인간 DNA의 개인 샘플이었고, 이들 각각의 1㎕ 는 PCR에서 사용되었다. DNA samples were individual samples of Human DNA of 0.5 to 2.5㎍ / ㎕, each of these 1㎕ was used in PCR. PCR 샘플 2㎕을 15㎍의 스트렙타비딘에 첨가하고 15분 동안 진탕시키면서 항온처리한 후 ECL분석기를 사용하여 전기화학발광에 대해 분석했다. It was added to PCR samples 2㎕ on streptavidin of 15㎍ and then incubated with shaking for 15 minutes were analyzed for electrochemical luminescence using ECL analyzer.

Claims (5)

  1. 하기 단계로 구성되는, 폴리머라제 연쇄반응 또는 다른 프라이머 유도 반응의 증폭 생성물에서 관심있는 핵산 서열을 검출하는 방법: (a) 폴리머라제 연쇄 반응 혼합물 또는 다른 프라이머 유도 반응 혼합물 내로 (i) 3' 말단에서 또는 (ii) 3' 및 5' 말단에서 전기화학 발광할 수 있는 화합물로 라벨링된, 관심있는 핵산 서열에 상보적인 하나 이상의 핵산 서열을 혼입하고, (b) 폴리머라제 연쇄 반응 또는 다른 프라이머 유도 반응을 수행한 다음; A method for detecting a nucleic acid sequence of interest in an amplification product of the polymerase chain reaction or other primer induced reaction consisting of following steps: (a) into a polymerase chain reaction mixture or other primer induced reaction mixture (i) 3 'at the ends or (ii) a complementary mixing at least one nucleic acid sequence and, (b) polymerase chain reaction or other primer induced response in the 3 'and 5' end to, the interested nucleic acid sequence labeled with a compound capable of emitting light electrochemical perform the following; (c) 라벨링된 증폭 생성물의 전기화학 발광을 측정한다. (C) measures the electrochemical luminescence of the labeled amplification product.
  2. 제1항에 있어서, 다수의 3' 라벨링된 핵산 서열이 프라이머 유도 반응 내에 혼입되는 방법. The method of claim 1, wherein the number of 3 'labeled nucleic acid sequences are incorporated into the primer derivation reaction.
  3. 하기 단계로 구성되는, 폴리머라제 연쇄 반응 또는 다른 프라이머 유도 반응의 증폭 생성물에서 관심있는 핵산 서열을 검출하는 방법: (a) 폴리머라제 연쇄 반응 혼합물 또는 다른 프라이머 유도 반응 혼합물 내로 (i) 3' 말단에서 또는 (ii) 3' 및 5' 말단에서 하기식의 전기 화학-발광할 수 있는 화합물로 라벨링된, 관심있는 핵산 서열에 상보적인 하나 이상의 핵산 서열을 혼입하고: A method for detecting a nucleic acid sequence of interest in an amplification product of the polymerase chain reaction or other primer induced reaction consisting of following steps: (a) into a polymerase chain reaction mixture or other primer induced reaction mixture (i) 3 'at the ends or (ii) 3 'and 5' of the formula in electrochemical end-mixed with at least one nucleic acid sequence complementary to, the nucleic acid sequence of interest labeled with a compound capable of emitting light, and:
    (여기서 M은 Ru, Os 및 Re 으로 구성되는 군으로부터 선택되고, L 1 , L 2 및 L 3 는 동일하거나 다르며 각각은 (Wherein M is selected from the group consisting of Ru, Os and Re, L 1, L 2 and L 3 are the same or different and each is
    이며, 여기서 R 1 및 R 2 는 동일하거나 다르며 각각은 H, 1-4개 탄소원자의 알킬기 또는 상기 핵산에 대한 링커이다); , Where R 1 and R 2 are the same or different and each is H, a linker for a 1-4 alkyl group or the nucleic acid more carbon atoms); (b) 폴리머라제 연쇄 반응 또는 다른 프라이머 유도 반응을 수행한 다음; (B) performing a polymerase chain reaction or other primer reaction following induction; (c) 라벨링된 증폭 생성물의 전기화학발광을 측정한다. (C) measures the electrochemical luminescence of the labeled amplification product.
  4. 하기 단계로 구성되는 폴리머라제 연쇄 반응 또는 다른 프라이머 유도 반응의 증폭 생성물에서 관심있는 핵산 서열을 검출하는 방법: (a) 폴리머라제 연쇄 반응 혼합물 또는 다른 프라이머 유도 반응 혼합물 내로 (i) 3' 말단에서 또는 (ii) 3' 및 5' 말단에서 전기화학 발광할 수 있는 화합물로 라벨링된, 관심있는 핵산 서열에 상보적인 하나 이상의 핵산 서열을 혼입하고; A method for detecting a nucleic acid sequence of interest in an amplification product of a polymerase chain reaction or other primer induced reaction consisting of following steps: (a) polymerase chain reaction mixture or into the other primer induced reaction mixture (i) 3 'at the ends, or (ii) 3 'and 5' complementary to the incorporation of one or more nucleic acid sequence to, the nucleic acid sequence of interest labeled with a compound capable of emitting light in the electrochemical terminus; (b) 폴리머라제 연쇄 반응 또는 다른 프라이머 유도 반응을 수행하고; (B) performing a polymerase chain reaction or other primer reaction is induced; (C) 라벨링된 증폭 생성물을 농축 및 세척한 다음; (C) concentrating and washing the labeled amplification product, and then; (d) 라벨링된 증폭 생성물의 전기화학발광을 측정한다. And (d) measuring the electrochemical luminescence of the labeled amplification product.
  5. 하기 단계로 구성되는, 프라이머 유도 반응의 증폭 생성물에서 관심있는 핵산 서열을 검출하는 방법: (a) 프라이머 유도 반응 혼합물 내로, 3' 말단에서 라벨링된 화합물로 라벨링된, 관심있는 핵산 서열에 상보적인 하나 이상의 핵산 서열을 혼입하고; A method for detecting a nucleic acid sequence of interest in an amplification product of primers derived reaction consisting of following steps: (a) into the primer derivation reaction mixture, 3 'labeled compound labeled at the ends, complementary to the one of interest nucleic acid sequence mixing the above nucleic acid sequence, and; (b) 프라이머 유도 반응을 수행한 다음; (B) performing a primer derived next reaction; (c) 라벨링된 증폭 생성물을 측정한다. And (c) measuring the labeled amplification product.
KR1019930702136A 1991-11-15 1992-11-13 Rapid assays for amplification products KR0171629B1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US79260291A true 1991-11-15 1991-11-15
US792,602 1991-11-15
PCT/US1992/009943 WO1993010267A1 (en) 1991-11-15 1992-11-13 Rapid assays for amplification products

Publications (2)

Publication Number Publication Date
KR930703464A KR930703464A (en) 1993-11-30
KR0171629B1 true KR0171629B1 (en) 1999-02-01

Family

ID=25157463

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1019930702136A KR0171629B1 (en) 1991-11-15 1992-11-13 Rapid assays for amplification products

Country Status (13)

Country Link
EP (1) EP0567635B1 (en)
JP (1) JP2788786B2 (en)
KR (1) KR0171629B1 (en)
AT (1) AT193558T (en)
AU (1) AU658962B2 (en)
CA (1) CA2100159C (en)
DE (2) DE69231124T2 (en)
DK (1) DK0567635T3 (en)
ES (1) ES2146215T3 (en)
GR (1) GR3033605T3 (en)
IL (1) IL103754A (en)
WO (1) WO1993010267A1 (en)
ZA (1) ZA9208839B (en)

Families Citing this family (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE69327326D1 (en) * 1992-07-24 2000-01-20 Univ South Australia Adelaide Reproduction and detection process
DE69333991D1 (en) * 1992-11-27 2006-05-04 Canon Kk Method and probe for detecting nucleic acids
AU700055B2 (en) * 1993-09-22 1998-12-17 Bioveris Corporation Rapid nucleic acid assay
US5952172A (en) 1993-12-10 1999-09-14 California Institute Of Technology Nucleic acid mediated electron transfer
US5824473A (en) 1993-12-10 1998-10-20 California Institute Of Technology Nucleic acid mediated electron transfer
US5591578A (en) 1993-12-10 1997-01-07 California Institute Of Technology Nucleic acid mediated electron transfer
US6071699A (en) 1996-06-07 2000-06-06 California Institute Of Technology Nucleic acid mediated electron transfer
US6028190A (en) 1994-02-01 2000-02-22 The Regents Of The University Of California Probes labeled with energy transfer coupled dyes
US5869255A (en) 1994-02-01 1999-02-09 The Regents Of The University Of California Probes labeled with energy transfer couples dyes exemplified with DNA fragment analysis
US5547861A (en) * 1994-04-18 1996-08-20 Becton, Dickinson And Company Detection of nucleic acid amplification
CA2145719C (en) * 1994-04-18 1998-06-30 James G. Nadeau Detection of nucleic acid amplification
GB9408607D0 (en) * 1994-04-29 1994-06-22 Dynal As Assay
EP0684239B1 (en) * 1994-05-26 2003-12-10 Canon Kabushiki Kaisha A method for detecting a target substance in a sample, utilizing pyrylium compound
EP0777749B1 (en) * 1994-08-19 2002-10-30 PE Corporation (NY) Coupled amplification and ligation method
CA2219891C (en) * 1995-05-05 2002-01-29 The Perkin-Elmer Corporation Methods and reagents for combined pcr amplification and hybridization probing assay
JP3418622B2 (en) * 1995-08-14 2003-06-23 アボツト・ラボラトリーズ All-in-one nucleic acid amplification assays
WO1997021832A1 (en) * 1995-12-08 1997-06-19 Evotec Biosystems Gmbh Process for determination of low concentration of nucleic acid molecules
EP0876510B1 (en) * 1995-12-22 2008-05-07 Dade Behring Marburg GmbH Homogeneous amplification and detection of nucleic acids
AU1565397A (en) 1995-12-22 1997-07-17 Behringwerke Aktiengesellschaft Detection of differences in nucleic acids
US5830712A (en) * 1996-02-06 1998-11-03 Allelix Biopharmaceuticals Inc. Selective template deletion method
EP0892856B1 (en) * 1996-03-01 2005-11-09 E.I. Du Pont De Nemours And Company A method for the amplification and detection of a nucleic acid fragment of interest
US6444423B1 (en) 1996-06-07 2002-09-03 Molecular Dynamics, Inc. Nucleosides comprising polydentate ligands
CA2270633A1 (en) * 1996-11-05 1998-05-14 Clinical Micro Sensors Electrodes linked via conductive oligomers to nucleic acids
US7045285B1 (en) 1996-11-05 2006-05-16 Clinical Micro Sensors, Inc. Electronic transfer moieties attached to peptide nucleic acids
US6096273A (en) 1996-11-05 2000-08-01 Clinical Micro Sensors Electrodes linked via conductive oligomers to nucleic acids
US7160678B1 (en) 1996-11-05 2007-01-09 Clinical Micro Sensors, Inc. Compositions for the electronic detection of analytes utilizing monolayers
US7014992B1 (en) * 1996-11-05 2006-03-21 Clinical Micro Sensors, Inc. Conductive oligomers attached to electrodes and nucleoside analogs
US7381525B1 (en) 1997-03-07 2008-06-03 Clinical Micro Sensors, Inc. AC/DC voltage apparatus for detection of nucleic acids
US6013459A (en) 1997-06-12 2000-01-11 Clinical Micro Sensors, Inc. Detection of analytes using reorganization energy
US6485901B1 (en) 1997-10-27 2002-11-26 Boston Probes, Inc. Methods, kits and compositions pertaining to linear beacons
WO1999037819A2 (en) 1998-01-27 1999-07-29 Clinical Micro Sensors, Inc. Amplification of nucleic acids with electronic detection
US6686150B1 (en) 1998-01-27 2004-02-03 Clinical Micro Sensors, Inc. Amplification of nucleic acids with electronic detection
US6365346B1 (en) 1998-02-18 2002-04-02 Dade Behring Inc. Quantitative determination of nucleic acid amplification products
US6290839B1 (en) 1998-06-23 2001-09-18 Clinical Micro Sensors, Inc. Systems for electrophoretic transport and detection of analytes
US6761816B1 (en) 1998-06-23 2004-07-13 Clinical Micro Systems, Inc. Printed circuit boards with monolayers and capture ligands
US6740518B1 (en) 1998-09-17 2004-05-25 Clinical Micro Sensors, Inc. Signal detection techniques for the detection of analytes
WO2000024941A1 (en) 1998-10-27 2000-05-04 Clinical Micro Sensors, Inc. Detection of target analytes using particles and electrodes
US6833267B1 (en) 1998-12-30 2004-12-21 Clinical Micro Sensors, Inc. Tissue collection devices containing biosensors
US6942771B1 (en) 1999-04-21 2005-09-13 Clinical Micro Sensors, Inc. Microfluidic systems in the electrochemical detection of target analytes
AU779220B2 (en) 1999-07-26 2005-01-13 Clinical Micro Sensors, Inc. Sequence determination of nucleic acids using electronic detection
US6232104B1 (en) 1999-08-17 2001-05-15 Dade Behring Inc. Detection of differences in nucleic acids by inhibition of spontaneous DNA branch migration
JP2001153870A (en) * 1999-11-25 2001-06-08 Hitachi Software Eng Co Ltd Hybridization device, case, supporting body, and labeled reagent

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0737464B2 (en) * 1986-04-30 1995-04-26 イゲン,インコーポレーテッド Electro-chemiluminescence Atsu Say
DE69028325T2 (en) * 1989-01-19 1997-04-17 Behringwerke Ag Nucleic acid amplification using a single primer
CA2033692A1 (en) * 1990-01-25 1991-07-26 Wilhelm Bannwarth Energy transfer systems

Also Published As

Publication number Publication date
WO1993010267A1 (en) 1993-05-27
CA2100159A1 (en) 1993-05-16
IL103754D0 (en) 1993-04-04
EP0567635B1 (en) 2000-05-31
AU3141293A (en) 1993-06-15
ES2146215T3 (en) 2000-08-01
EP0567635A4 (en) 1998-03-11
IL103754A (en) 1997-04-15
AT193558T (en) 2000-06-15
DE69231124D1 (en) 2000-07-06
JP2788786B2 (en) 1998-08-20
ZA9208839B (en) 1993-05-13
CA2100159C (en) 2003-01-21
KR930703464A (en) 1993-11-30
GR3033605T3 (en) 2000-10-31
DK0567635T3 (en) 2000-09-25
EP0567635A1 (en) 1993-11-03
DE69231124T2 (en) 2001-02-15
AU658962B2 (en) 1995-05-04
JPH06507316A (en) 1994-08-25

Similar Documents

Publication Publication Date Title
EP1427852B1 (en) Single nucleotide amplification and detection by polymerase
US6391558B1 (en) Electrochemical detection of nucleic acid sequences
US7037687B2 (en) Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
EP0300796B1 (en) Amplification method for polynucleotide assays
US5527670A (en) Electrochemical denaturation of double-stranded nucleic acid
US5312527A (en) Voltammetric sequence-selective sensor for target polynucleotide sequences
Wu et al. The effect of temperature and oligonucleotide primer length on the specificity and efficiency of amplification by the polymerase chain reaction
US6210891B1 (en) Method of sequencing DNA
JP5095888B2 (en) Detection of mutations within genes with specific LNA primers
US6376191B1 (en) Microarray-based analysis of polynucleotide sequence variations
US5476769A (en) Method for assays of nucleic acid, a reagent combination and a kit therefor
ES2136059T5 (en) Detecting a nucleic acid sequence or a change therein.
EP2341151B1 (en) Methods for determining sequence variants using ultra-deep sequencing
US5728526A (en) Method for analyzing a nucleotide sequence
JP2856804B2 (en) Catalytic hybridization system for nucleic acid sequence detection based on activity as a cofactor for a catalytic reaction to cleave the labeled complementary nucleic acid probe
AU770217B2 (en) Ligation assembly and detection of polynucleotides on solid-support
US6180408B1 (en) Fluorescence polarization in nucleic acid analysis
US6361940B1 (en) Compositions and methods for enhancing hybridization and priming specificity
US6280954B1 (en) Arrayed primer extension technique for nucleic acid analysis
EP0777747B1 (en) Nucleotide sequencing method
AU624601B2 (en) Amplification and detection of nucleic acid sequences
US5541313A (en) Single-stranded labelled oligonucleotides of preselected sequence
EP0478319B1 (en) Gene detection method
US6358679B1 (en) Methods for external controls for nucleic acid amplification
EP1368489B1 (en) Asynchronous primed pcr

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20071017

Year of fee payment: 10

LAPS Lapse due to unpaid annual fee