JPH11318455A - Human cancer regression antigenic protein - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a polynucleotide molecule useful for the diagnosis and treatment of tumors, autoimmune diseases, etc., by encoding a specific tumor antigenic peptide. SOLUTION: This polynucleotide molecule is selected from the group consisting of (i) a polynucleotide molecule encoding an amino acid sequence represented by the formula, (ii) a polynucleotide molecule encoding a protein in which one or plural amino acids are substituted, deleted, inserted or added in the amino acid sequence represented by the formula, (iii) a polynucleotide molecule comprising a base sequence represented by the formula, (iv) a polynucleotide molecule in which one or plural bases are substituted, deleted, inserted or added in the base sequence represented by the formula and (v) a polynucleotide molecule hybridizable with any of the polynucleotide molecule under stringent conditions. A peptide comprising a part of the protein encoded with the polynucleotide molecule is a tumor antigenic peptide bound to a main histocompatibility gene complex(MHC) class I antigen and recognized with a T cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention belongs to the medical field, and more particularly, to a method for treating cancer or an autoimmune disease, and more particularly to a cancer regression antigen which is regressed by being attacked by cytotoxic T cells and uses the same. It relates to immunotherapy and the like.

[0002] The immune system, especially T
Cells are known to play an important role.
In fact, infiltration of lymphocytes showing cytotoxic activity against tumor cells is observed in human tumors (Arch. Surg. 126: 200-20).
5, 1990), and cytotoxic T cells (CTLs) that recognize autologous tumor cells have been isolated from melanoma (Immunol. T).
oday 8: 385,1987, J.Immunol.138: 989,1987, Int.J.Ca
ncer 52: 52-59, 1992, etc.). The clinical results of melanoma treatment by T cell transfer also suggest the importance of T cells by tumor elimination (J. Natl. Cancer. Inst. 86: 1159, 1994).
.

[0003] CTLs that attack their own tumor cells use a complex in which a tumor antigen peptide binds to a major histocompatibility complex (MHC) class I antigen to form a T cell receptor (TCR).
Recognizes and attacks its own tumor cells. The tumor antigen peptide is produced by synthesizing a tumor antigen (protein) in a cell and then decomposing the peptide in the cytoplasm by a proteosome. On the other hand, M
The HC class I antigen binds to the above-mentioned tumor antigen peptide, moves to transgolgi on the mature side via cis Golgi, and is expressed on the cell surface (clinical immunity 27 (9): 1034-1042, 19
95).

[0004]

2. Description of the Related Art A tumor antigen protein presented on MHC class I antigen on human cancer cells and serving as a target molecule of host T cells was identified by T. Boon in 1991 (Science 254: 16).
43-1647, 1991). This antigen is called a cancer regression antigen because cancer cells expressing this antigen are attacked and regressed by CTL, and is named Melanoma antigen (MAGE) because it was identified from melanoma cells. Subsequently, tumor antigen proteins recognized by CTL were successively identified from melanoma cells and the like. Tumor antigen proteins identified so far are classified into the following four categories according to their origin, structure (presence or absence of mutation) and expression mode (T. Boon et al., J. Exp. Med. 183: 725- 72
9,1996):

[0005] i) Tumor-specific shared antigen (Tumor-Specif
The antigens classified here are expressed only in testis and placenta in normal tissues, and are widely expressed in various types of cancer such as melanoma, head and neck cancer, non-small cell lung cancer, and bladder cancer in tumor tissues. A group of proteins. The tumor antigen proteins in this category include the above-mentioned MAGE, a group of proteins forming a similar family of 12 or more (J. Ex.
p.Med. 178: 489-495, 1993), BAGE (Immunity 2: 167-
175, 1995) and GAGE (J. Exp. Med. 182: 689-698,19).
95), all of which have been identified from melanoma cells. Recently, N which is widely expressed only in melanoma
A17-A was reported. It is translated into a portion corresponding to the intron of the N-acetylglucosaminyltransferase V gene, and the antigen peptide (VLPOVFIRC) is expressed as a cancer regression antigen in an HLA-A2-restricted manner, and is recognized by CTL.

Ii) Differentiation Antigen
s) The tumor antigen proteins classified here are a group of proteins that are expressed in melanocytes in normal tissues and expressed only in melanomas in tumor tissues. These tissue-specific proteins are strongly expressed in tumor cell melanoma, but are not found in other tissue types of cancer (adenocarcinoma or squamous cell carcinoma), so that the tumor antigen specific to melanoma It is considered a protein. Tumor antigen proteins in this category include tyrosinase (J. Exp.
d.178: 489-495, 1993), MART-1 (Proc. Natl. Acad. S.
ci. USA 91: 3515, 1994), gp100 (J. Exp. Med. 17).
9: 1005-1009, 1994), gp75 (J. Exp. Med. 181: 799).
-352, 1995), all of which have been cloned from melanoma cells. In addition, Mela
nA (J. Exp. Med. 180: 35, 1994) was identified but was later found to be the same molecule as MART-1. In addition, since the antigens classified here are also expressed in normal melanocytes, there is a possibility as a target molecule in melanocyte destructive autoimmune disease. Especially MART
-1 / melan-A is considered to be a target molecule in von-Koyanagi-Harada disease (S. Sugita, et al., Int. Immunol. 8:79
9-803, 1996). gp100 may be acting as an in vivo cancer regression antigen because melanoma expressing it is highly sensitive to immunotherapy. Since tumor antigen proteins in this category are not expressed in tumors other than melanoma, they cannot be applied to other tumors.

Iii) Antigens specific to individual tumors (Antige
ns Specific for Individual Tumors) Tumor antigen proteins classified into this region are new cancer-specific antigens associated with genetic changes that occur during the process of normal cells becoming cancerous. Gene changes include point mutations (point
mutation, mutant CDK4 antigen, mutant β-Catenin antigen,
MUM-antigen), alternative open reading frame
(Mutant gp75 antigen) is previously known. Therefore, it is considered that such an antigen is specific to cancer and that specific immunity is easily established. However, on the other hand, each gene change is mostly expressed only in individual tumors or individual tumor cells. Therefore, it has a drawback that its expression frequency is extremely low and it is difficult to apply it clinically as a vaccine molecule for cancer treatment.

Iv) Ubiquitous Antigens An example of a case where an antigen that is ubiquitous as a non-mutant in most normal cells and cancer cells is a CTL cancer recognition molecule is p15. Are known. p15
The molecule has an HLA-A24 binding peptide. p15
Is more strongly expressed in cancer cells than in normal cells.
From that viewpoint, the HER-2 / neu antigen, which is an oncogene protein that is strongly expressed in adenocarcinoma and the like, is also classified as the same. That is, HER-2 / neu has an HLA-A2 binding peptide and is recognized by host killer T cells as a cancer regression antigen. If the antigen classified here is a tumor antigen protein, it is considered to be applicable to a wide range of cancers because it is universally expressed, but due to poor disease specificity, it may cause damage to normal tissues. Yes, and CTL
Possibility of difficulty in induction (due to transformer) is considered.

[0009] MHC-MUC considered to be non-binding
-1 antigen-specific CTL is the same antigen-derived peptide STAPP
AHGV was reported to recognize HLA-A11 restriction, and initial results of clinical trials using the MAGE-3 peptide were reported (M. Marchand, et al., Int. J. Cancer).
r 63: 883-885,1995). These suggest the possibility of developing a cancer vaccine using a cancer regression antigen.

[0010] Most of the antigen peptides identified so far, except for HER-2 / neu, have been found in melanomas, and have not been reported at all in squamous cell carcinomas or adenocarcinomas, which have a high incidence of disease. However, we have recently reported that an HLA2601-restricted cancer antigen peptide is present and recognized by host CTLs from esophageal squamous cell carcinoma (M. Nakao, et al., Cancer Res. 55: 4248-4252,199).
Five). Therefore, it is suggested that squamous cell carcinoma also has a tumor antigen protein encoding a similar antigen peptide. Squamous cell carcinoma is one of the most common cancers in humans, especially squamous cell carcinoma in esophageal and lung cancers is known to be relatively resistant to current chemotherapy and radiation therapy . From this point of view, the development of specific immunotherapy using tumor antigen peptides and the like is expected.

[0011]

SUMMARY OF THE INVENTION An object of the present invention is to apply to a wide range of tumors such as squamous cell carcinoma, or to a large number of patients with such tumors even if the applicable tumors are limited. Another object of the present invention is to provide a tumor antigen protein, a tumor antigen peptide, and the like which assist in cancer therapy applicable to various tumors while complementing the treatment and diagnosis of the tumor. Also,
On the other hand, tumor antigen proteins highly expressed in tumors are also considered to cause autoimmune diseases by excessively expressing an immune response derived from the tumor antigen proteins also expressed in normal tissues. For example, it has been reported that when melanoma is treated in combination with a chemotherapeutic agent and IL-2, the appearance of vitiligo symptoms is observed (J. Cli
n.Oncol. 10: 1338-1343,1992). This is due to vitiligo symptoms, which are autoimmune disease-like symptoms due to the induction and production of CTLs or antibodies against tumor antigen protein fragment peptides and MHC complexes that appear in melanoma and acting on normal skin tissues. Is thought to have appeared. When an autoimmune disease is caused by excessively eliciting specific immunity derived from a tumor antigen protein, an antisense DNA or antagonist of a tumor antigen peptide that prevents expression of a gene encoding the tumor antigen protein is used. Therapeutic methods that use it to specifically block the immune response are expected.

[0012]

In order to obtain a tumor antigen protein or its corresponding tumor antigen peptide which can be widely applied to the treatment and diagnosis of tumor cells other than melanoma cells, especially squamous cell carcinoma, etc. An attempt was made to identify a tumor antigen protein. The present inventors have performed HLA-A2 from peripheral blood lymphocytes of esophageal cancer patients by a mixed lymphocyte tumor culture method.
402 CTL (KE-4-recognition of restricted tumor antigen peptide)
CTL) was established. This CTL strongly impairs the HLA-A2402-positive esophageal cancer cell line KE-4. Therefore, monkey kidney cell line COS7
The cells were simultaneously transfected with the recombinant plasmid of the cDNA library prepared from the KE-4 cancer cell line and the recombinant plasmid of HLA-A2402 cDNA, and the transfectants were allowed to act on KE-4-CTL cells. Whether the KE-4-CTL cells were activated or not was measured based on the amount of IFN-γ produced and screened. As a result, the gene encoding the tumor antigen protein of the present invention was successfully cloned from tumor cells other than melanoma KE-4.

That is, the present invention relates to (1) SEQ ID NO: 1.
A polynucleotide molecule encoding the amino acid sequence of
(2) a polynucleotide molecule encoding a protein in which one or more amino acids have been substituted, deleted, inserted or added in the amino acid sequence of SEQ ID NO: 1,
(3) a polynucleotide molecule consisting of the nucleotide sequence of SEQ ID NO: 1, (4) a polynucleotide molecule having one or more bases substituted, deleted, inserted or added in the nucleotide sequence of SEQ ID NO: 1, and (5) The above (1) to
A polynucleotide molecule selected from the group consisting of polynucleotide molecules that hybridize under stringent conditions to any of the polynucleotide molecules of (4), wherein the polynucleotide molecule comprises a part of a protein encoded by the polynucleotide molecule. A polynucleotide molecule that is a tumor antigen peptide whose peptide binds to major histocompatibility complex (MHC) class I antigen and is recognized by T cells; a tumor antigen protein encoded by the polynucleotide molecule of the present invention; Tumor antigen peptide or a derivative thereof, which is a partial peptide of a tumor antigen protein and is recognized by T cells by binding to an MHC class I antigen; a medicament containing the tumor antigen protein or a tumor antigen peptide of the present invention or a derivative thereof; Tumor antigen protein or tumor anti Peptides or antibodies against derivatives thereof; oligonucleotide molecule encoding a tumor antigen peptide or its derivative of the present invention, preferably the nucleotide sequence encoding the tumor antigen protein is SEQ ID NO: 1
The oligonucleotide molecule having a sequence complementary to the nucleotide sequence in the coding sequence of the polynucleotide molecule encoding the tumor antigen protein of SEQ ID NO: 1 or its 5 ′ non-coding sequence, or the oligonucleotide molecule thereof. Chemically modified products; pharmaceuticals containing the polynucleotide or the oligonucleotide molecule of the present invention or the chemically modified product thereof; plasmids having the polynucleotide or the oligonucleotide molecule of the present invention; and transformation transformed with the plasmid of the present invention. About the body.

[0014]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The meaning of the terms used in the present specification will be clarified, and embodiments of the present invention will be described. The polynucleotide molecule of the present invention encodes a novel tumor antigen protein, and (1) SEQ ID NO:
A polynucleotide molecule encoding the amino acid sequence of 1,
(2) a polynucleotide molecule encoding a protein in which one or more amino acids have been substituted, deleted, inserted or added in the amino acid sequence of SEQ ID NO: 1,
(3) a polynucleotide molecule consisting of the nucleotide sequence of SEQ ID NO: 1, (4) a polynucleotide molecule having one or more bases substituted, deleted, inserted or added in the nucleotide sequence of SEQ ID NO: 1, and (5) The above (1) to
(4) a polynucleotide molecule selected from the group consisting of a polynucleotide molecule that hybridizes under stringent conditions to any of the polynucleotide molecules, and a peptide consisting of a part of a protein encoded by the polynucleotide molecule;
Tumor antigen peptide that binds to major histocompatibility complex (MHC) class I antigen and is recognized by T cells.

[0015] The polynucleotide molecule of the present invention can be in the form of DNA or RNA.
DNA and synthetic DNA are included. DNA and RN
A can be single-stranded or double-stranded, and if single-stranded, can include both sense and antisense strands.

A polynucleotide molecule in which a part of a certain base sequence has been substituted, deleted, inserted or added is Molecula
r Cloning: A Laboratory Manual 2nd edition Vol. 1-3 Sam
brook, J. et al., Cold Spring Harber Labolatory Pres.
s Publication New York 1989, etc., and can be produced, for example, by site-directed mutagenesis or PCR. The polynucleotide molecules of the present invention also include these mutant polynucleotide molecules. Such a mutant polynucleotide molecule includes, for example, a polynucleotide molecule in which one or more bases are substituted, deleted, inserted or added in the base sequence of SEQ ID NO: 1. The polynucleotide molecule of the present invention also includes "a polynucleotide molecule which hybridizes to the polynucleotide molecule of the present invention under stringent conditions". Taking a DNA molecule as a representative example of the polynucleotide molecule, a “DNA molecule that hybridizes to a DNA molecule under stringent conditions” can be obtained, for example, by the method described in the aforementioned Molecular Cloning. Here, “hybridize under stringent conditions” means, for example, 6 × SSC, 0.5% S
After heating at 42 ° C. in a solution of DS and 50% formamide, a positive hybridizing signal was still observed under the conditions of washing at 68 ° C. in a solution of 0.1 × SSC and 0.5% SDS. To be performed.

[0017] The tumor antigen protein of the present invention is a protein encoded by the polynucleotide molecule.

"A tumor antigen peptide which is recognized by T cells by binding a peptide consisting of a part of the protein encoded by the polynucleotide molecule of the present invention to an MHC class I antigen" is defined as at least 7 consecutive tumor antigen proteins. , Preferably 7 to 10, and particularly preferably 9 partial peptides consisting of a continuous amino acid sequence, which, when bound to the cell surface MHC class I antigen and presented on the cell surface, A peptide capable of transmitting a signal to a T cell that specifically binds to the T cell when bound thereto, that is, capable of forming a conjugate with an MHC class I antigen recognized by the T cell. The “bond” here is a non-covalent bond.

Methods for confirming that a peptide binds to MHC class I antigen and is recognized by T cells include, for example, endogenous expression of the peptide in appropriate cells or external addition (pulsing) of the peptide. To present the peptide on the cell surface by binding to MHC class I antigens, and then act on the peptide-presenting cells with tumor antigen protein-specific T cells. And a method for measuring cytokines (interferon α, TNFα, and cytokines produced by CTL). Also,
As a method for measuring the damage of peptide presenting cells, ⁵¹ Cr
A method using a peptide-presenting cell labeled with can also be used. Here, CTL is preferably used as a T cell to be recognized.

The tumor antigen protein or tumor antigen peptide according to the present invention can be identified, for example, as follows. First, to identify them, a set of MHC-class I allele-matched tumor cells and CTLs that attack the cells are prepared. Then the MH of the tumor cells
The tumor antigen peptide bound to the C class I antigen is acidified and extracted, and various peptides separated by high performance liquid chromatography can be used for cells expressing the antigen-presenting MHC but not expressing the tumor antigen protein. (Eg, B cells of the same patient), a tumor antigen peptide is identified by examining the CTL response, and the sequence is determined using mass spectrometry or the like. By this method, gp100 can be isolated from melanoma cells.
And a tumor antigen peptide derived from Pme117 having the same molecule as that described above (Science 264: 716-719, 1994).

Alternatively, unlike the method of directly identifying a tumor antigen peptide as described above, there is also a method of determining a gene encoding a tumor antigen protein and further identifying the corresponding tumor antigen peptide. This involves cloning a gene encoding a tumor antigen protein using molecular biology techniques. A cDNA is prepared from a tumor cell, and the cDNA is transferred to cells (eg, COS cells, etc.) that do not express a tumor antigen protein.
The gene is transfected together with the antigen gene to transiently express them, and the screening is repeated by the reactivity of CTL against the gene to isolate the gene encoding the tumor antigen protein. By this method, the above MA
GE, tyrosinase, MART-1, gp100, gp
75 genes have been cloned.

Based on the information of the tumor antigen gene,
The following method is used for estimating and identifying the tumor antigen peptide presented by binding to the C class I antigen. First, fragments of genes encoding tumor antigen proteins of various sizes are prepared by PCR, exonuclease, restriction enzymes, etc., and cells that do not express the tumor antigen protein together with the antigen-presenting MHC class I antigen gene (for example, COS cells, etc.) ) Is transiently expressed by transfection, and the region containing the tumor antigen peptide is limited by the reactivity of CTL. Thereafter, the peptide is synthesized, and the cells that express the antigen-presenting MHC class I antigen but do not express the tumor antigen protein are pulsed. Similarly, the tumor antigen peptide can be identified by examining the CTL response (J. Exp.Med. 176: 1453, 1992, J. Exp.Med.
179: 24,759, 1994).

Further, HLA-A1, -A0201, -A0205, -A11, A3
1, -A6801, -B7, -B8, -B2705, -37, -Cw0401, -C
With regard to the types of MHC class I antigens such as w0602, the regularity (motif) of the sequence of the peptide presented by binding has been known (seminars in IMMUNOLOGY 5: 81-94, 199).
3), referencing it to examine tumor antigen peptide candidates,
A method in which the peptide is bound and confirmed in the same manner as described above is also used (Eur.J. Immunol, 24: 759, 1994, J. Exp.
ed. 180: 347, 1994).

In the present invention, in the amino acid sequence of SEQ ID NO: 1, 9 is presented by binding to the HLA-A24 antigen.
When the candidate of the tumor antigen peptide was examined with reference to the motif of the mer, the peptides P1 to P10 shown in SEQ ID NOs: 2 to 11 are listed as the candidate of the tumor antigen peptide (Table 1). From the viewpoint of CTL reactivity, P2 (SEQ ID NO: 3), P3 (SEQ ID NO: 4),
8 (SEQ ID NO: 9), P9 (SEQ ID NO: 10) and P
The peptide of 10 (SEQ ID NO: 11) is preferred, and the peptide of P9 is more preferred.

[0025]

[Table 1]

The peptide determined in this manner can be produced by a method known in ordinary peptide chemistry. For example, "Peptide Synthesis", Interscie
nce, New York. 1996, "The Proteins", Vol. 2, Academi
c Press Inc., New York. 1976, “Peptide Synthesis”, Maruzen Co., Ltd., 1975, “Basic and Experimental Peptide Synthesis”, Maruzen Co., Ltd., 1985, and the like. That is, either the liquid phase method or the solid phase method can be selected for synthesis depending on the configuration of the C-terminal site, and the liquid phase method is more preferable. That is, a peptide can be produced by appropriately protecting and deprotecting a functional group of an amino acid with an appropriate protecting group, and binding the amino acid by one or several residues. The protective group for the functional group of the amino acid is described in, for example, the above-mentioned book describing peptide chemistry.

As used herein, the term "derivative of the tumor antigen peptide of the present invention" refers to a peptide in which one or more of the amino acid sequences of the tumor antigen peptide of the present invention have been substituted, deleted, inserted or added. means. A preferred derivative is a tumor antigen peptide in which the epitope region involved in binding to CTL is intact and amino acid residues involved in binding to MHC class I antigen are substituted, deleted, inserted or added. And more preferably a derivative thereof in which only one amino acid residue is substituted (Immunol. 84: 298-303, 1995). Since such a derivative can strongly bind to the MHC class I antigen while maintaining the binding property to CTL as it is, it can be applied as a more useful tumor antigen peptide.

Such a derivative is, for example, Molecular Cl
oning: A Laboratory Manual 2nd edition Vol. 1-3 Sambroo
k, J. et al., Cold Spring Harber Labolatory Press
NewYork can be prepared by the method described in 1989,
It can be prepared by a method such as site-directed mutagenesis or PCR.

Accordingly, the tumor antigen peptide of the present invention or a derivative thereof is encoded by the oligonucleotide molecule of the present invention described below.

In the “derivative of the present invention”, the amino or carboxyl group of the tumor antigen peptide of the present invention or a derivative obtained by substituting, deleting, inserting or adding some amino acid residues of the peptide is modified. Derivatives are also included.

Examples of the modifying group for the amino group include an acyl group. Specific examples include an alkanoyl group having 1 to 6 carbon atoms, an alkanoyl group having 1 to 6 carbon atoms substituted by a phenyl group, and an alkanoyl group having 5 to 6 carbon atoms. And a carbonyl group substituted with 7 cycloalkyl groups, an alkylsulfonyl group having 1 to 6 carbon atoms, and a phenylsulfonyl group.

Examples of the carboxyl-modifying group include an ester group and an amide group. Specific examples of the ester group include an alkyl ester group having 1 to 6 carbon atoms,
Examples thereof include an alkyl ester group having 0 to 6 carbon atoms and a cycloalkyl ester group having 5 to 7 carbon atoms substituted with a phenyl group. Specific examples of the amide group include an amide group and an alkyl group having 1 to 6 carbon atoms. An amide group substituted by one or two, an phenyl group-substituted alkyl group having 0 to 6 carbon atoms, an amide group substituted by one or two, a 5- to 7-membered amide group including nitrogen atom Amide groups forming a ring azacycloalkane, and the like.

The present invention further provides a medicine containing the tumor antigen protein or tumor antigen peptide of the present invention or a derivative thereof. The tumor antigen protein and the tumor antigen peptide of the present invention can be administered together with an adjuvant so as to effectively establish cellular immunity, or can be administered in the form of particles. As an adjuvant,
Those described in the literature (Clin. Microbiol. Rev. 7: 277-289, 1994) can be applied. In addition, exogenous antigen peptides such as liposome preparations, particle preparations bound to beads having a diameter of several μm, and lipid (lipid) -bound preparations can be efficiently presented as antigens to MHC class I antigens. Any method of administration is used. Further, a method of administering antigen-presenting cells such as dendritic cells or microphages pulsed with a tumor antigen peptide or cells into which DNA encoding a tumor antigen protein has been introduced can also be considered. The dosage of the tumor antigen protein and tumor antigen peptide of the present invention in the formulation can be appropriately adjusted depending on the disease to be treated, the age of the patient, body weight, etc., and is usually 0.0001 mg to 1000 mg, preferably 0.001 mg to 1000 mg. It is preferably administered once every few days to several months.

The "antibody" against the tumor antigen protein or tumor antigen peptide or a derivative thereof according to the present invention is described, for example, in Antibodies; A Laboratory Manual, Lane.
D. et al., Published by Cold Spring Harber Laboratory Press New York 1989, etc. to recognize tumor antigen protein by immunizing a suitable animal with a suitable method using a tumor antigen protein or a fragment peptide thereof. Or an antibody that neutralizes the activity of the antibody can be easily prepared. Uses of the antibody include affinity chromatography, screening of a cDNA library, immunological diagnostic methods, pharmaceuticals and the like. Immunological diagnostic methods include immunoblotting and radioimmunoassay (RI
A), enzyme immunoassay (ELISA), fluorescence or luminescence measurement, and the like.

The present invention further relates to an oligonucleotide molecule encoding the tumor antigen peptide of the present invention or a derivative thereof. The oligonucleotide molecules of the present invention can be in the form of DNA or RNA, where DNA includes cDNA, genomic DNA and synthetic DNA. DNA and
RNA can be single-stranded or double-stranded, and if single-stranded, can include both sense and antisense strands.

An oligonucleotide molecule in which a part of a certain base sequence has been substituted, deleted, inserted or added can be subjected to site-directed mutagenesis or PC
It can be manufactured by the R method or the like. The oligonucleotide molecules of the present invention also include these mutant oligonucleotide molecules. Such a mutant oligonucleotide molecule includes, for example, an oligonucleotide molecule in which one or more bases are substituted, deleted, inserted or added in the base sequence of SEQ ID NO: 1. The oligonucleotide molecules of the present invention also include "oligonucleotide molecules that hybridize to the oligonucleotide molecules of the present invention under stringent conditions". Taking a DNA molecule as a typical example of an oligonucleotide molecule, "DNA
Hybridizes under stringent conditions to the molecule
The `` DNA molecule '' can be obtained, for example, under the same conditions as for the polynucleotide molecule.Here, the term `` hybridizes under stringent conditions '' means, for example,
The conditions described for the polynucleotide molecule are mentioned.

Further, by expressing a DNA encoding the tumor antigen protein or tumor antigen peptide of the present invention, it becomes possible to produce a large amount of tumor antigen protein or tumor antigen peptide.

The expression of DNA to produce a protein can be carried out, for example, based on a number of books and documents such as the above-mentioned Molecular Cloning. Want to express
A translation initiation codon is added upstream of the DNA and a translation stop codon is added downstream, and a control gene such as a promoter sequence (eg, trp, lac, T7, SV40 early promoter) for controlling transcription is added, and an appropriate vector ( For example, pBR322, pUC19, pSV.SPORT1
To produce an expression plasmid that replicates and functions in the host cell.

Next, the expression plasmid is introduced into a suitable host cell to obtain a transformant cell. Examples of the host cell include prokaryotic organisms such as Escherichia coli, unicellular eukaryotic organisms such as yeast, and multicellular eukaryotic cells such as insects and animals. Examples of a method for introducing a gene into a host cell include a calcium phosphate method, a DEAE-dextran method, and an electric pulse method. The transformant produces the target protein by culturing in a suitable medium. The protein obtained as described above can be isolated and purified by a general biochemical method.

Transformants transformed with these plasmids of the present invention are also included in the scope of the present invention.

The present invention further relates to a medicament containing the polynucleotide molecule or the oligonucleotide molecule of the present invention or a chemically modified product thereof. The “medicine” containing the polynucleotide molecule or the oligonucleotide molecule of the present invention can treat or prevent a tumor by, for example, administering the DNA of the present invention to a tumor patient or the like. Methods for administering the DNA of the present invention and introducing it into cells include methods using viral vectors and other methods (Nikkei Science, April 1994, pp. 20-45, Monthly Pharmaceutical Affairs, 36 (1) 2
3-48 (1994), Experimental Medicine Special Edition, 12 (15), (1994), and references cited therein) can be applied.

Examples of the method using a viral vector include retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poxvirus, poliovirus, and Sindbis virus.
Examples include a method of incorporating the DNA of the present invention into an RNA virus or a DNA virus and introducing the DNA virus. Among them, a method using a retrovirus, an adenovirus, an adeno-associated virus, a vaccinia virus, or the like is particularly preferable.

Other methods include a method of directly administering an expression plasmid intramuscularly (DNA vaccine method), a liposome method, a lipofectin method, a microinjection method, a calcium phosphate method, and an electroporation method. And the liposome method are preferred.

[0044] Plasmids having these polynucleotide molecules or oligonucleotide molecules of the present invention are also included in the scope of the present invention.

In order for the gene encoding the tumor antigen peptide of the present invention to actually act as a medicament, an in vivo method of directly introducing the gene into the body, and a method of collecting certain cells from humans and exchanging the genes outside the body There is an ex vivo method to introduce cells into the body and return the cells to the body (Nikkei Science, 1994
April, 20-45, Monthly Pharmaceutical Affairs, 36 (1) 23-48 (1994), Experimental Medicine Special Edition, 12 (15), (1994), and references cited therein). In vivo methods are more preferred.

When administered by the in vivo method, it can be administered by an appropriate route depending on the disease, symptom and the like to be treated. For example, it can be administered to a vein, artery, subcutaneous, intramuscular, and the like. When administered by the in vivo method, for example, the preparation may be in the form of a liquid or the like, but is generally an injection containing the DNA of the present invention as an active ingredient, and if necessary, a conventional carrier may be used. May be added. Also,
The DNA-containing liposome or membrane-fused liposome (such as Sendai virus (HVJ) -liposome) of the present invention can be in the form of a liposome preparation such as a suspending agent, a freezing agent, and a centrifugal concentrated frozen agent.

The content of the DNA of the present invention in the preparation can be appropriately adjusted depending on the disease to be treated, the age and weight of the patient, etc., and usually 0.0001 mg to 100 mg of the DNA of the present invention.
It is preferably from 0.001 mg to 10 mg, and is preferably administered once every several days to several months.

The present invention further provides an oligonucleotide molecule comprising a coding sequence of a polynucleotide molecule encoding a tumor antigen protein having the amino acid sequence of SEQ ID NO: 1 or a sequence complementary to the base sequence in the 5 'non-coding sequence thereof. Or a chemically modified form thereof. Preferably, a DNA or RN consisting of 9 or more nucleotides having a sequence complementary to the nucleotide sequence in the polynucleotide sequence consisting of the nucleotide sequence of SEQ ID NO: 1 (structural gene portion) or its 5 ′ non-coding sequence.
A. Such DNA or RNA is a double-stranded DN
DNA of the antisense strand of A or its antisense strand
RNA corresponding to DNA and consisting of 9 or more bases (hereinafter referred to as antisense oligonucleotide).

This antisense oligonucleotide is
For example, it is produced as DNA based on the nucleotide sequence of the gene encoding the tumor antigen protein of the present invention,
By incorporating the DNA into the gene expression plasmid in the antisense orientation, the corresponding RNA can be easily produced.

This antisense oligonucleotide is
Although it may be a sequence complementary to any of the coding portion and the 5 ′ non-coding portion of the cDNA which is the gene of the present invention, it is preferably a transcription initiation site, a translation initiation site, a 5 ′ untranslated region, and an exon. It is desirable that the sequence be complementary to the boundary region with the intron or the 5'CAP region.

The “chemically modified oligonucleotide molecule” refers to a chemically modified product that can enhance the translocation of DNA or RNA into cells or the stability in cells, and includes, for example, phosphothioate and phosphothioate. Derivatives such as dithiothioate, alkyl phosphotriester, alkyl phosphonate, alkyl phosphoamidate ("Antisense
RNA and DNA "WILEY-LISS, 1992, p. 1-50). This chemically modified product can be produced according to the same literature.

The expression of a gene encoding a tumor antigen protein can be controlled by using the antisense oligonucleotide of the present invention or a chemically modified product thereof. By reducing the production of tumor antigen protein by this method, an autoimmune disease can be treated or prevented. A medicament containing such an antisense oligonucleotide is also included in the present invention.

When the antisense oligonucleotide is administered as it is, a preferable length of the antisense oligonucleotide is, for example, 5 to 200 bases.

When the antisense oligonucleotide is incorporated into an expression plasmid, the preferable length of the antisense oligonucleotide is, for example, 10
0 bases or more, preferably 300 bases or more, more preferably 500 bases or more.

When the antisense oligonucleotide is incorporated into an expression plasmid, the method for introducing the antisense oligonucleotide into cells includes, for example, the method described in Experimental Medicine, Vol. And the like. The expression plasmid of the antisense oligonucleotide is prepared by ligating the gene of the present invention so that the gene of the present invention is transcribed in the reverse direction behind the promoter, that is, in the 3 ′ to 5 ′ direction, using a normal expression vector. Can be easily manufactured.

[0056] A plasmid having such an antisense oligonucleotide is also included in the present invention. When the antisense oligonucleotide or its chemically modified product is administered as it is, it should be mixed with a stabilizer, buffer, solvent, etc., and then used together with antibiotics, anti-inflammatory agents, anesthetics, etc. Can also. The formulation thus produced can be administered in various ways. Preferably, the administration is made daily or every few days to every few weeks. In order to avoid such frequent administration, it is also possible to prepare a sustained release mini-pellet preparation and implant it near the affected part. Alternatively, it is also possible to gradually and continuously administer to a patient using an osmotic pump or the like. The usual dose is adjusted so that the concentration at the site of action is 0.1 nM-10 μM.

[0057] A medicament containing such an antisense oligonucleotide or a chemically modified product thereof is also included in the present invention.

[0058]

EXAMPLES The present invention will be described in more detail with reference to the following Examples, which should not be construed as limiting the present invention.

Reference Example 1 Cytotoxic T cell (CTL) cell line against esophageal cancer cell line
Established a 67-year-old male esophageal cancer patient peripheral blood lymphocytes by lymphocyte tumor mixed culture method in the presence of interleukin-2 for about 60
The cells were cultured for 5 days in a 5% carbon dioxide (95% air) incubator. Meanwhile, culture after 28 days were analyzed cytotoxic ability against various cancer cells of T cells to proliferate in culture frequent in ⁵¹ Cr release assay and IFN-gamma assay. As a result, culture 3
T cells from day 9 to day 49 are mainly CD8-positive killer T cells, and HLA-A240 among MHC class I antigens.
2 It was found to show restricted CTL activity. HLA-A240
2 Among the positive cancer cells, squamous cell carcinoma KE-4 cell line (M.Na
Kao et al., Cancer Research 55, 4248-4252, 1995) showed the highest sensitivity to the CTL. Therefore, a large amount of the CTL (named KE-4-CTL) was stored in a liquid nitrogen-containing cell cryopreservation tank to prepare for cloning of a cancer regression antigen gene recognized by the CTL.

Reference Example 2 Preparation of Recombinant Plasmid of HLA-A2402 cDNA According to the teachings of Nakao et al., Cancer Res. 55: 4248-252 (1995), the HLA-A2402 cDNA derived from KE-4 cells was used as an expression vector pCR3.
(Manufactured by INVITROGEN) to produce a recombinant plasmid.

[0061]Reference Example 3 Preparation of KE-4 cell cDNA library Use mRNA purification system (Pharmacia Biotech)
Total RNA fraction from KE-4 cells according to the attached protocol
Separation and poly (A) by oligo (dT) column ⁺mRNA
Preparation was performed. Superscript plasmid over mRNA
Using the system (manufactured by GIBCO BRL) and attached protocol
Therefore, connect Not1 adapter and Sal1 adapter at both ends.
After preparing the ligated cDNA, this cDNA was transformed into the expression vector pSV-
SPORT1 (GIBCO BRL) restriction enzymes Not 1 and Sal
Ligation was performed to obtain a recombinant plasmid. this
Use the recombinant plasmid with Gene Pulser (Bio-Rad)
With 25μF, 200Ω, 2.5kV
E. coli Electromax DH10B / p3^TMCell (GIBCO B
RL) and contains ampicillin (50μg / ml)
LB medium (1% bactotryptone^TM, 0.5% NaCl, pH7.3)
The transformant into which the recombinant plasmid has been introduced
Selected.

Reference Example 4 Quantification of Interferon-γ Interferon-γ (IFN-γ) was quantified by enzyme immunoassay (ELISA). An anti-human IFN-γ mouse monoclonal antibody was adsorbed as a primary antibody to a 96-well microplate, and nonspecific binding was blocked with bovine serum albumin. Then, IFN-γ in the specimen was allowed to bind to the antibody. Next, an anti-human IFN-γ rabbit polychloride antibody was bound as a secondary antibody, and a peroxidase-labeled anti-rabbit immunoglobulin donkey antibody was further bound. After that, TMBZ (tetramethylbenzidine) was reacted as a color former, and 2N H after a ₂ SO ₄ to stop the reaction by adding an equal volume,
The absorbance (450 nm) was measured. This was quantified by comparing with a value obtained from a standard IFN-γ.

Example 1 Screening of Tumor Antigen Protein Gene First, a recombinant plasmid DNA was recovered from the pool of transformants prepared in Reference Example 3. Ampicillin (50μg
/ Ml) in a 96-well U-bottom microplate containing LB medium containing 100-200 transformants per well, and after culturing, a portion of the transformant was added to 0.3 ml of TYGPN medium (FM) per well.
Ausubel et al., CURRENT PROTCOLS IN MOLECULARBIOLOG
Y, John Wiley & Sons, Inc.)
Transfer to the bottom microplate and incubate at 37 ° C for 48 hours,
The remaining microplates of the LB medium were stored frozen. TYGP
Recombinant plasmid DNA of transformant cultured in N medium
Is the alkaline dissolution method (FM Ausubel
Ed., CURRENT PROTCOLS IN MOLECULAR BIOLOGY, John
Wiley & Sons, Inc.). The recombinant plasmid DNA recovered by isopropanol precipitation was
10 mM Tris, 1 mM EDTA, pH 7.4 containing ng / ml RNase
Suspended in solution.

Next, the recombinant plasmid prepared above
DNA and the recombinant plasmid of HLA-A2402 cDNA prepared in Reference Example 2 were transferred to COS7 cells (Gluzan, Y. Cell, 23: 175-182, 19).
81) Simultaneously transfect by the lipofectin method. Add 1 × 10 ⁴ COS7 cells per well of a 96-well flat-bottom microplate and include 100 μl of 10% FCS
The cells were cultured for one day in RPMI medium. KE for about 100 transformants
100 ng of the HLA-A2402 cDNA recombinant plasmid prepared in Reference Example 2 was added to 25 μl of the -4 cDNA recombinant plasmid, and 25 μl of a lipofectin reagent (Lipofectamine, GIBCO-BRL) diluted about 100-fold was added. . 50 μl of the obtained mixture (fusion suspension of liposome and recombinant plasmid) was added to the cultured COS7 cells, and double transfected. Two transfectants were prepared. Transfectants were cultured for 48-72 hours at 37 ° C., after which the culture was removed and 1 × 10 ⁴ KE-4 cells per well
Add CTL and add 100 μl 10% human serum and 50 U / ml IL
The cells were cultured at 37 ° C. for 16 to 24 hours in a culture solution containing -2. The culture was collected and IFN-γ was measured by ELISA.

Next, about 8 groups in which high IFN-γ production was confirmed by ELISA, about 100 transformants of the corresponding cryopreserved recombinant KE-4 cDNA recombinant plasmid were used.
Further screening is performed using a pool of ~ 200 clones / well as follows. The transformant pool was cultured in an LB (containing 50 μg / ml) medium for about 6 hours, and the culture was spread on a plate of LB agar medium containing ampicillin (50 μg / ml) and cultured for 1 day. The obtained single colonies, 200 colonies in each group, a total of 8 × 200 colonies were transferred to each well of a 96-well microplate,
The cells were cultured in the same manner as described above under the condition that one transformant per well was used, and the recombinant plasmid DN of KE-4 cDNA was used.
A was prepared. KE-4 cDN is obtained by the same method as above.
The recombinant plasmid of A and the recombinant plasmid of HLA-A2402 cDNA were double-transfected into COS7 cells, followed by mixed culture with KE-4-CTL, and the culture produced by the reaction of KE-4-CTL. IFN-γ in the solution was quantified and a positive plasmid was selected. By this operation, a KE-4 cell cDNA recombinant plasmid clone reacting with KE-4-CTL was selected and named SART-2. For SART-2, the same operation was repeated once more to obtain IFN-γ by KE-4-CTL.
Production was confirmed.

Example 2 Determination of Nucleotide Sequence of Tumor Antigen Gene An LB medium containing 500 ml of ampicillin (50 μg / ml) was used for each transformant SART-2 having a recombinant plasmid into which the cDNA of the tumor antigen gene was inserted. 14-16 at 37 ° C
After culturing for an hour, the cells were collected by centrifugation. PL from bacterial cells
The recombinant plasmid was recovered according to the ASMID MAXI kit (QIAGEN). The cDNA is integrated at the site between the SP6 and T7 RNA polymerase promoter sequences. Therefore, the literature (DNA
4: 165, 1985), the SP6 and T7 promoter primers were synthesized. Next, SP6
The promoter primer or T7 promoter primer is used in combination with Fluore-dATP LabelingMix (Pharmacia Biotech) and AutoRead Sequencing Kit (Pharmacia Biotech) to perform dideoxy sequencing reaction, using a fluorescent DNA sequencer (Pharmacia Biotech), The cDNA base sequence was determined from both ends. The full length of the base sequence of SART-2 cDNA was determined to be 3998 base pairs, and was as shown in SEQ ID NO: 1. Also, SA
The amino acid sequence having the longest open reading frame deduced from the nucleotide sequence of RT-2 cDNA was set to SEQ ID NO: 1.
And FIG.

Using the Gene Works database, the base sequence described in SEQ ID NO: 1 was searched. as a result,
The SART-2 gene was located on the long arm of chromosome 6 (6q22).

Example 3 Identification of Active Fragment of SART-2 Clone From the SART-2 cDNA obtained in Example 2, C
A fragment of the gene encoding the truncated mutant tumor antigen protein was generated. Recombinant plasmid DN containing this fragment
A and the recombinant plasmid of HLA-A2402 cDNA prepared in Reference Example 2 were double-transfected into COS7 cells by the method described in Example 1, and the amount of IFN-γ production was measured by ELISA. The obtained results indicate the average value of triplicate, and there was a significant difference (p <0.05) in the reactivity to the negative control in which an unrelated gene was double-transfected with the HLA-A2402 gene. (FIG. 3).

From FIG. 3, it can be seen that the C-terminal deletion mutant tumor antigen protein has a higher IF than the full-length SART-2 tumor antigen protein.
The amount of N-γ production decreased, and the degree of the decrease suggested that the tumor antigen peptide of SART-2 was present on the N-terminal side and the C-terminal side.

Regarding the type of MHC class I antigen of HLA-A24, the regularity (motif) of the sequence of the peptide presented by binding has been found (seminars in IMMUNOLOL).
OGY5: 81-94, 1993), and the candidate tumor antigen peptides were examined with reference to them. Ten peptides P1 to P10 (SEQ ID NOs: 2 to 11) shown in Table 1 were identified as candidate tumor antigen peptides. Was listed as

The peptide was synthesized by a conventional method, added to a culture solution of RPMI640 supplemented with 10% FCS to a final concentration of 10 μg / ml, and pulsed into COS7 cells transfected with HLA-A2402 cDNA. The tumor antigen peptide was identified by examining the amount of -γ production (FIG. 4).

As shown in FIG. 4, P2 (SEQ ID NO: 3), P3
(SEQ ID NO: 4), P8 (SEQ ID NO: 9), P9 (SEQ ID NO: 10) and P10 (SEQ ID NO: 11) are active, and among these, P9 was shown to be the most active.

Example 4 Identification of HLA-A2402 Restriction of Tumor Antigen Protein A plasmid vector containing different amounts (0 to 400 ng / well) of the SART-2 gene was used to prepare a fixed amount (100 ng / well) of HLA-A2.
Whether or not KE-4-CTL responded to COS7 cells double-transfected with 402 cDNA or HLA-A2601 cDNA in a dose-dependent manner was examined by examining the amount of IFN-γ production (FIG. 5).

As shown in FIG. 5, the SART-2 tumor antigen protein is
HLA-A2402 was shown to be restrictive.

[0075]

EFFECTS OF THE INVENTION A drug for activating antitumor immunity using the tumor antigen protein and the tumor antigen peptide of the present invention, and a drug for treating an autoimmune disease using an antibody against the tumor antigen protein of the present invention and the like. And a medicament containing DNA encoding a tumor antigen protein, and a method for diagnosing a tumor or an autoimmune disease.

[0076]

[Sequence List] SEQ ID NO: 1 Sequence length: 3998 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Origin Organism name: human (Homo sapiens) Tissue type: esophagus Characteristic of cancer tissue sequence Characteristic symbol: CDS Location: 150..3023 Method for determining characteristics: P sequence: CCGGGAGCCC GGGCGCCCTG GAGTGAGGAG GACCGGGAGC TGGCTCTGGA GGCTGCGGAG 60 GCGACGCCGG AGAGAACGAA GCCTCGGCTG GGAGTCGA TGA TGTTCGATCGATGTTGGTCGATGTC GGG GCT 173 Met Arg Thr His Thr Arg Gly Ala 5 CCC AGT GTG TTT TTC ATA TAT TTG CTT TGC TTT GTG TCA GCC TAC ATC 221 Pro Ser Val Phe Phe Ile Tyr Leu Leu Cys Phe Val Ser Ala Tyr Ile 10 15 20 ACC GAC GAG AAC CCA GAA GTT ATG ATT CCC TTC ACC AAT GCC AAC TAC 269 Thr Asp Glu Asn Pro Glu Val Met Ile Pro Phe Thr Asn Ala Asn Tyr 25 30 35 40 GAC AGC CAT CCC ATG CTG TAC TTC TCC AGG GCA GAA GTG GCG GAG CTG 317 Asp Ser His Pro Met Leu Tyr Phe Ser Arg Ala Glu Val Ala Glu Leu 45 50 55 CAG CTC AGG GCT GCC AGC TCG CAC GAG CAC ATT GCA GCC CGC CTC ACG 365 Gln Leu Arg Ala Ala Ser Ser His Glu His Ile Ala Ala Ala Arg Leu Thr 60 65 70 GAG GCT GTG CAC ACG ATG CTG TCC AGC CCC TTG GAA TAC CTC CCT CCC 413 Glu Ala Val His Thr Met Leu Ser Ser Pro Leu Glu Tyr Leu Pro 75 80 85 TGG GAT CCC AAG GAC TAC AGT GCC CGC TGG AAT GAA ATT TTT GGA AAC 461 Trp Asp Pro Lys Asp Tyr Ser Ala Arg Trp Asn Glu Ile Phe Gly Asn 90 95 100 AAC TTG GGT GCC TTG GCA ATG TTC TGT GTG CTG TAT CCT GAG AAC ATT 509 Asn Leu Gly Ala Leu Ala Met Phe Cys Val Leu Tyr Pro Glu Asn Ile 105 110 115 120 GAA GCC CGA GAC ATG GCC AAA GAC TAC ATG GAG AGG ATG GCA GCG CAG 557 Glu Ala Arg Asp Met Ala Lys Asp Tyr Met Glu Arg Met Ala Ala Gla 125 130 135 CCT AGT TGG TTG GTG AAA GAT GCT CCT TGG GAT GAG GTC CCG CTT GCT 605 Pro Ser Trp Leu Val Lys Asp Ala Pro Trp Asp Glu Val Pro Leu Ala 140 145 150 CAC TCC CTG GTT GGT TTT GCC ACT GCT TAT GAC TTC TTG TAC AAC TAC 653 His Ser Leu Val Gly Phe Ala Thr Ala Tyr Asp Phe Leu Ty r Asn Tyr 155 160 165 CTG AGC AAG ACA CAA CAG GAG AAG TTT CTT GAA GTG ATT GCC AAT GCC 701 Leu Ser Lys Thr Gln Gln Glu Lys Phe Leu Glu Val Ile Ala Asn Ala 170 175 180 TCA GGG TAT ATG TAT GAA ACT TCA TAC AGG AGA GGA TGG GGA TTT CAA 749 Ser Gly Tyr Met Tyr Glu Thr Ser Tyr Arg Arg Gly Trp Gly Phe Gln 185 190 195 200 TAC CTG CAC AAT CAT CAG CCC ACC AAC TGT ATG GCT TTG CTC ACG GGA 797 Tyr Leu His Asn His Gln Pro Thr Asn Cys Met Ala Leu Leu Thr Gly 205 210 215 AGC CTA GTC CTG ATG AAT CAA GGA TAT CTT CAA GAA GCC TAC TTA TGG 845 Ser Leu Val Leu Met Asn Gln Gly Tyr Leu Gln Glu Ala Tyr Leu Trp 220 225 230 ACC AAA CAA GTT CTG ACC ATC ATG GAG AAA TCT CTG GTC TTG CTC AGG 893 Thr Lys Gln Val Leu Thr Ile Met Glu Lys Ser Leu Val Leu Leu Arg 235 240 245 GAG GTG ACG GAT GGC TCC CTC TAT GAA GGA GTT GCG TAT GGC AGC TAC 941 Glu Val Thr Asp Gly Ser Leu Tyr Glu Gly Val Ala Tyr Gly Ser Tyr 250 255 260 ACC ACT AGA TCA CTC TTC CAA TAC ATG TTT CTC GTC CAG AGG CAC TTC 989 Thr Thr Arg Ser Leu Phe Gln Tyr Met Phe Le u Val Gln Arg His Phe 265 270 275 280 280 AAC ATC AAC CAC TTT GGC CAT CCG TGG CTT AAA CAA CAC TTT GCA TTT 1037 Asn Ile Asn His Phe Gly His Pro Trp Leu Lys Gln His Phe Ala Phe 285 290 295 ATG TAT AGA ACC ATC CTG CCA GGG TTT CAA AGG ACT GTG GCT ATT GCG 1085 Met Tyr Arg Thr Ile Leu Pro Gly Phe Gln Arg Thr Val Ala Ile Ala 300 305 310 GAC TCA AAT TAC AAC TGG TTT TAT GGT CCA GAA AGC CAA TTA GTG TTC 1133 Asp Ser Asn Tyr Asn Trp Phe Tyr Gly Pro Glu Ser Gln Leu Val Phe 315 320 325 CTT GAT AAA TTT GTC ATG CGT AAT GGC AGT GGT AAC TGG CTA GCT GAC 1181 Leu Asp Lys Phe Val Met Arg Asn Gly Ser Gly Asn Trp Leu Ala Asp 330 335 340 CAA ATC AGA AGG AAC CGT GTG GTG GAA GGT CCA GGA ACA CCA TCC AAA 1229 Gln Ile Arg Arg Asn Arg Val Val Glu Gly Pro Gly Thr Pro Ser Lys 345 350 355 360 GGG CAG CGC TGG TGC ACT CTG CAC ACA GAA TTT CTC TGG TAT GAT GGC 1277 Gly Gln Arg Trp Cys Thr Leu His Thr Glu Phe Leu Trp Tyr Asp Gly 365 370 375 AGC TTG AAA TCG GTT CCT CCT CCA GAC TTT GGC ACC CCT ACA CTG CAT 1325 Ser Leu Lys Ser Va l Pro Pro Pro Asp Phe Gly Thr Pro Thr Leu His 380 385 390 TAT TTT GAA GAC TGG GGT GTC GTG ACT TAT GGA AGT GCA CTA CCT GCA 1373 Tyr Phe Glu Asp Trp Gly Val Val Thr Tyr Gly Ser Ala Leu Pro Ala 395 400 405 GAA ATC AAT AGA TCT TTC CTT TCC TTC AAG TCT GGA AAA CTG GGG GGA 1421 Glu Ile Asn Arg Ser Phe Leu Ser Phe Lys Ser Gly Lys Leu Gly Gly 410 415 420 CGT GCA ATA TAT GAC ATT GTC CAC AGA AAC AAA TAC AAA GAT TGG ATC 1469 Arg Ala Ile Tyr Asp Ile Val His Arg Asn Lys Tyr Lys Asp Trp Ile 425 430 435 440 AAA GGA TGG AGA AAT TTT AAT GCA GGG CAT GAA CAT CCT GAT CAA AAC 1517 Lys Gly Trp Arg Asn Phe Asn Ala Gly His Glu His Pro Asp Gln Asn 445 450 455 TCA TTT ACT TTT GCT CCC AAT GGT GTG CCT TTC ATT ACT GAG GCT CTG 1565 Ser Phe Thr Phe Ala Pro Asn Gly Val Pro Phe Ile Thr Glu Ala Leu 460 465 470 TAC GGG CCA AAG TAC ACC TTC TTC AAC AAT GTT TTG ATG TTT TCC CCA 1613 Tyr Gly Pro Lys Tyr Thr Phe Phe Asn Asn Val Leu Met Phe Ser Pro 475 480 485 GCT GTG TCA AAG AGC TGC TTT TCT CCC TGG GTG GGT CAG GTC ACA GAA 1661 Ala Val Ser Lys Ser Cys Phe Ser Pro Trp Val Gly Gln Val Thr Glu 490 495 500 GAC TGC TCA TCA AAA TGG TCT AAA TAC AAG CAT GAC CTG GCA GCT AGT 1709 Asp Cys Ser Ser Lys Trp Ser Lys Tyr Lys His Asp Leu Ala Ala Ser 505 510 515 520 TGT CAG GGG AGG GTG GTT GCA GCA GAG GAG AAA AAT GGG GTG GTT TTC 1757 Cys Gln Gly Arg Val Val Ala Ala Glu Glu Lys Asn Gly Val Val Phe 525 530 535 535 ATC CGA GGA GAA GGT GTG GGA GCT TAT AAC CCC CAG CTC AAC CTG AAG 1805 Ile Arg Gly Glu Gly Val Gly Ala Tyr Asn Pro Gln Leu Asn Leu Lys 540 545 550 AAT GTT CAG AGG AAT CTC ATC CTC CTA CAT CCA CAG CTG CTT CTC CTT 1853 Asn Val Gln Arg Asn Leu Ile Leu Leu His Pro Gln Leu Leu Leu Leu 555 560 565 GTA GAC CAA ATA CAC CTG GGA GAG GAG AGT CCC TTG GAG ACA GCA GCG 1901 Val Asp Gln Ile His Leu Gly Glu Glu Glu Ser Pro Leu Glu Thr Ala Ala 570 575 580 AGC TTC TTC CAT AAT GTG GAT GTT CCT TTT GAG GAG ACT GTG GTA GAT 1949 Ser Phe Phe His Asn Val Asp Val Pro Phe Glu Glu Thr Val Val Asp 585 590 595 595 600 GGT GTC CAT GGG GCT TTC ATC AGG CAG AGA GAT G GT CTC TAT AAA ATG 1997 Gly Val His Gly Ala Phe Ile Arg Gln Arg Asp Gly Leu Tyr Lys Met 605 610 615 TAC TGG ATG GAC GAT ACT GGC TAC AGC GAG AAA GCA ACC TTT GCC TCA 2045 Tyr Trp Met Asp Asp Thr Gly Tyr Ser Glu Lys Ala Thr Phe Ala Ser 620 625 630 GTG ACA TAT CCT CGG GGC TAT CCC TAC AAC GGG ACA AAC TAT GTG AAT 2093 Val Thr Tyr Pro Arg Gly Tyr Pro Tyr Asn Gly Thr Asn Tyr Val Asn 635 640 645 645 GTC ACC ATG CAC CTC CGA AGT CCC ATC ACC AGG GCA GCT TAC CTC TTC 2141 Val Thr Met His Leu Arg Ser Pro Ile Thr Arg Ala Ala Tyr Leu Phe 650 655 660 ATA GGG CCA TCT ATA GAT GTT CAG AGC TTC ACT GTC CAC GGA GAC TCT 2189 Ile Gly Pro Ser Ile Asp Val Gln Ser Phe Thr Val His Gly Asp Ser 665 670 675 680 CAG CAA CTG GAT GTG TTC ATA GCC ACC AGC AAA CAT GCC TAC GCC ACA 2237 Gln Gln Leu Asp Val Phe Ile Ala Thr Ser Lys His Ala Tyr Ala Thr 685 690 695 TAC CTG TGG ACA GGT GAG GCC ACA GGA CAG TCT GCC TTT GCA CAG GTC 2285 Tyr Leu Trp Thr Gly Glu Ala Thr Gly Gln Ser Ala Phe Ala Gln Val 700 705 710 ATT GCT GAT CGT CAC AAA AT T CTG TTT GAC CGG AAT TCA GCC ATC AAG 2333 Ile Ala Asp Arg His Lys Ile Leu Phe Asp Arg Asn Ser Ala Ile Lys 715 720 725 AGC AGC ATT GTC CCT GAG GTG AAG GAC TAT GCT GCT ATT GTG GAA CAG 2381 Ser Ser Ile Val Pro Glu Val Lys Asp Tyr Ala Ala Ile Val Glu Gln 730 735 740 AAC TTG CAG CAT TTT AAA CCA GTG TTT CAG CTG CTG GAG AAG CAG ATA 2429 Asn Leu Gln His Phe Lys Pro Val Phe Gln Leu Leu Glu Lys Gln Ile 745 750 755 760 CTG TCC CGA GTC CGG AAC ACA GCT AGC TTT AGG AAG ACT GCT GAA CGC 2477 Leu Ser Arg Val Arg Asn Thr Ala Ser Phe Arg Lys Thr Ala Glu Arg 765 770 775 CTG CTG AGA TTT TCA GAT AAG AGA CAG ACT GAG GAG GCC ATT GAC AGG 2525 Leu Leu Arg Phe Ser Asp Lys Arg Gln Thr Glu Glu Ala Ile Asp Arg 780 785 790 ATT TTT GCC ATA TCA CAG CAA CAG CAG CAG CAA AGC AAG TCA AAG AAA 2573 Ile Phe Ala Ile Ser Gln Gln Gln Gln Gln Gln Ser Lys Ser Lys Lys 795 800 805 AAC CGA AGG GCA GGC AAA CGC TAT AAA TTT GTG GAT GCT GTC CCT GAT 2621 Asn Arg Arg Ala Gly Lys Arg Tyr Lys Phe Vla Asp Ala Val Pro Asp 810 815 820 ATT TTTT GCA CAG ATT GAA GTC AAT GAG AAA AAG ATT AGA CAG AAA GCT 2669 Ile Phe Ala Gln Ile Glu Val Asn Glu Lys Lys Ile Arg Gln Lys Ala 825 830 835 840 CAG ATT TTG GCA CAG AAA GAA CTA CCC ATA GAT GAA GAT GAA GAA ATG 2717 Gln Ile Leu Ala Gln Lys Glu Leu Pro Ile Asp Glu Asp Glu Glu Met 845 850 855 AAA GAC CTT TTA GAT TTT GCA GAT GTA ATA TAC GAG AAA CAT AAA AAT 2765 Lys Asp Leu Leu Asp Phe Ala Asp Val Thr Tyr Glu Lys His Lys Asn 860 865 870 GGG GGC TTG ATT AAA GGC CGG TTT GGA CAG GCA CGG ATG GTG ACA ACT 2813 Gly Gly Leu Ile Lys Gly Arg Phe Gly Gln Ala Arg Met Val Thr Thr 875 880 885 ACA CAC AGC AGG GCC CCA TCA CTG TCT GCT TCC TAT ACC AGG TTG TTC 2861 Thr His Ser Arg Ala Pro Ser Leu Ser Ala Ser Tyr Thr Arg Leu Phe 890 895 900 CTG ATT CTG AAC ATT GCT ATT TTC TTT GTC ATG TTG GCA ATG CAA CTG 2909 Leu Ile Leu Asn Ile Ala Ile Phe Phe Val Met Leu Ala Met Gln Leu 905 910 915 920 ACT ACT TAT TTC CAG AGG GCC CAG AGC CTA CAT GGC CAA AGA TGT CTT TAT 2957 Thr Tyr Phe Gln Arg Ala Gln Ser Leu His Gly Gln Arg Cys Leu Tyr 925 930 935 GCA GTT CTT CTC ATA GAT AGC TGT ATT TTA TTA TGG TTG TAC TCT TCT 3005 Ala Val Leu Leu Ile Asp Ser Cys Ile Leu Leu Trp Leu Tyr Ser Ser 940 945 950 TGT TCC CAA TCA CAG TGT TAGCACTGAAGCGTATA Cys Ser Gln Ser Gln Cys 955 CATTTTGTGA TCACAAGAGT CTATGCAAAA AAAAAAATTT CTTTACCCCA GATTATCAGA 3110 TTTTTTTCCC TCAGATTCAT TTTAACAAAT TAAGGGAAGA TATTTTGACA CAAGAAAGCA 3170 GGAACGTGGA GAAATTGGAG CAGGAAAAGA AATTATCAAA GCAATAGAAA TAGCTTGGTG 3230 GTCCTATGGT GTTTTTGGAA GTATTTGGCA TTGCTAATTG AGCAGTCCAT ATAGTACTAC 3290 TTTTAGAAGA AACAAAAAGT CTATTTTTTA AAGTAATGTT TTTTCTTATG AGAAAAAGGT 3350 TTAGATAGAA TTGGGTTTTA TTAATATTAA TTTAATGCTA TTAGCAATTT CCATATACTA 3410 TATTGTGGAA AAGACTGAAG AATACAATTC TGAGAAATAT AAAAAAATTT TAATGGTATA 3470 CTCATGTTGA AAGATAAATG TTGCTAAGTC CTGGTATGAT GGTGTGAGCT TCCTTGGGGA 3530 AGTACTTCTT GAGTTATGTA ACTAACATAGAGA TGTTTTACTA CAGATCTGGA TGACTATAGATATAGAGATAGATAGATATGATAGATAGATAGATAG GT CTCTGCACAC ATATGCTTGG 3710 TTACTTGCAT GCATTCATTG GTTGTTCAAT AAGTGAGATG ATTACAGATA ATACTGTATT 3770 TTCCTTATAT GGAAAACCGT TATAGACCCA ATAACAACTA AACCTTTCAA AAGAAAATAT 3830 TTTCTATTAT GAATGTTGAT TTTCATACCA AAGAAGATGG AGAGTCTAAA ATTTGGATAT 3890 GATTCTTATG TTTTTTTAAT AGAAAACCTT CTTCAAGTTT ATTTTCCTAA ATAAACATCA 3950 TAATTGTGAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAA 3998

SEQ ID NO: 2 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

SEQ ID NO: 3 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

SEQ ID NO: 4 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

SEQ ID NO: 5 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

SEQ ID NO: 6 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

SEQ ID NO: 7 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

SEQ ID NO: 8 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

SEQ ID NO: 9 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

SEQ ID NO: 10 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

SEQ ID NO: 11 Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide

[Brief description of the drawings]

FIG. 1 shows the amino acid sequence (single letter designation) of SART-2 cDNA and the longest open reading frame deduced therefrom.

FIG. 2 is a schematic diagram showing the structure of the SART-2 gene. ORF indicates an open reading frame.

[FIG. 3] FIG. 3 shows that IFN-
It is the graph which measured the amount of (gamma) production by ELISA. In the figure, NC indicates a negative control.

FIG. 4 is a graph showing the amount of IFN-γ production measured by ELISA using the putative HLA-A24 binding peptides shown in Table 1.

FIG. 5 is a graph showing that the tumor antigen protein encoded by the SART-2 gene is HLA-A2402 restricted.

Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI C07K 14/47 C07K 16/18 16/18 C12P 21/02 F C12N 5/10 G01N 33/574 A C12P 21/02 A61K 37/02 ADU / / G01N 33/574 C12N 5/00 B (C12N 15/09 ZNA C12R 1:91) (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1:91)

Claims (11)

[Claims] (1) a polynucleotide molecule encoding the amino acid sequence of SEQ ID NO: 1, (2) one or more amino acids are substituted, deleted, inserted or added in the amino acid sequence of SEQ ID NO: 1 (3) a polynucleotide molecule comprising the nucleotide sequence of SEQ ID NO: 1, (4) a polynucleotide molecule comprising the base sequence of SEQ ID NO: 1,
In one base sequence, a polynucleotide molecule in which one or more bases are substituted, deleted, inserted or added, and (5) a polynucleotide molecule which is stringent to any one of the polynucleotide molecules (1) to (4) A polynucleotide molecule selected from the group consisting of a polynucleotide molecule that hybridizes under conditions, wherein the peptide comprising a portion of the protein encoded by the polynucleotide molecule comprises a major histocompatibility complex (MHC) class I A polynucleotide molecule that is a tumor antigen peptide that binds to an antigen and is recognized by T cells. 2. A tumor antigen protein encoded by the polynucleotide molecule according to claim 1. 3. An oligonucleotide molecule comprising a part of the polynucleotide molecule according to claim 1, wherein the MHC is
Oligonucleotide molecules encoding tumor antigen peptides that are recognized by T cells by binding to class I antigens. 4. The oligonucleotide molecule according to claim 3, which encodes a tumor antigen peptide comprising at least 7 consecutive amino acid residues in the amino acid sequence of SEQ ID NO: 1. 5. An oligonucleotide molecule comprising a coding sequence of a polynucleotide molecule encoding a tumor antigen protein having the amino acid sequence of SEQ ID NO: 1 or a sequence complementary to a base sequence in a 5 ′ non-coding sequence thereof, or a chemistry thereof. Modification. 6. A tumor antigen peptide encoded by the oligonucleotide molecule according to claim 3 or 4, or a derivative thereof. 7. A pharmaceutical comprising the tumor antigen protein according to claim 2 or the tumor antigen peptide according to claim 6 or a derivative thereof. 8. An antibody against the tumor antigen protein according to claim 2 or the tumor antigen peptide according to claim 6 or a derivative thereof. 9. The polynucleotide molecule according to claim 1, wherein
A medicament comprising the oligonucleotide molecule according to claim 3 or 4, or the oligonucleotide molecule according to claim 5, or a chemically modified product thereof. 10. A plasmid having the polynucleotide molecule according to claim 1 or the oligonucleotide molecule according to any one of claims 3 to 5. 11. A transformant transformed by the plasmid according to claim 10.