JPH06508140A - Therapeutic composition for bone induction - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Therapeutic composition for bone induction Technical field The present invention relates to the field of osteoinduction (bone growth). Specifically, the present invention provides bone morphogenetic A novel treatment consisting of administering protein and vitamin D compounds to obtain synergistic bone growth Treatment PrescriptionIn healthy individuals, bone growth usually progresses normally and fractures require pharmacological intervention. Treat without sex. Nevertheless, in some cases bones become weak or It will not heal properly. For example, cures occur in older people, transplant patients and those undergoing treatment for chronic lung disease. It progresses slowly in patients on corticosteroid therapy, such as those in patients with cancer. too Another example is osteoporosis. Osteoporosis is common in postmenopausal women and older men It is an abnormal loss of bone tissue. The disorder is associated with a risk of small fractures in the bones, especially the vertebrae. increase. Currently, osteoporosis is caused by calcium, vitamin D1, estrogen or calcium. Mainly due to the supplementation of calcitonin, a hormone that controls the use of lucium in the body. has been treated. Unfortunately, these treatments are only effective against further bone loss. This is a preventative measure. promoting bone formation and/or bone loss more than preventing bone loss; There is a need in the art for treatments that reverse the

(1989) “Bone Morphogenic Proteins and Vitamin D” (bone morphogenetic protein and vitamin D), Nutr [tionReviews, Vol. 47. pp, 364-386 in food and drink We conclude that vitamin D prevents the loss of osteoinductive activity of bone matrix.

Turner, R.T., J., Farley, J., J.Jande rsteenhoven, S.

Epstein, N., H., Bell, J., Bayllnk, (1988 )+Demonstration of’ Reduced Mitogeni c and Osteoinductive Activettes in De Mineralized AIlogenetic Bone Matrix rr oi Vitamin D-def'1cientRats Low mitogenic and osteoinductive activity in demineralized allogeneic bone matrix from depleted rats ), The Journal of Cl1nical Inve Stigation, Inc-Vo1112. pp, 2L2-217 is a vitamin discloses the transplantation of demineralized bone matrix from D-deficient rats to normal rats. Ru. Demineralized bone matrix from vitamin D-deficient rats differs from demineralized bone matrix from normal rats. Ralized bone matrix did not effectively promote osteoinduction.

Sampath, T., S., Weintraub and A., 11. Redd (, (1984) “Extracellular Matrix Protei ns Involves in boneInduction are Vit amin D Dependent” (extracellular matrix protein involved in bone induction) quality is vitamin D dependent).

Blochemcal and Blophysical Re5earch Coavunicat1ons, Vol, 124. pp, 829-835 is normal Demineralized bone matrix from rats and demineralized bone matrix from rickets rats. Disclose studies in which rickets bone matrix did not induce bone growth. However, the orthostatic substrate was induced. The study found that vitamin D was found in the bone matrix of living rats. These results demonstrate that osteoinductive proteins are essential for the production of osteoinductive proteins. It was concluded that

Assigned to the Trustees of the University of California and issued on August 2, 1988 rist U.S. Pat. No. 4,761°471, which has a Osteomorphic floor protein containing BMP factors and BMP-associated proteins with molecular weight Compositions are disclosed. Such factors are used to induce bone formation in mammals. Uses of children and compositions are also disclosed.

Assigned to the Trustees of the University of California and published June 19, 1984. U.S. Pat. No. 4,455,256 to Urist Discloses bone morphogenetic proteins having molecular weights in the 0 Dalton range. .

Various other bone morphogenic acid proteins/factors, osteoinductive factors, osteogenic factors and bone growth Other related proteins/factors are disclosed in the following document: 19901990 KubersalIpath and Rueger U.S. Patent No. 6, Nov. Neer, Pot, No. 4°968.590, dated October 6, 1987. U.S. Pat. No. 4,698.328 to Ts and 5lovik, October 3, 1989. Wang issued on the 1st.

Vozney and Rosen, U.S. Pat. No. 4,877.864; 1989.8 AntOniadeS, Lynch and Vill I published on 29th of May 1affls U.S. Patent No. 4,861,757; issued March 7, 1989. 5eyedin, Thomas.

Benz, Ellngsworth and Armstrong, U.S. Pat. No. 4°810.691; U.S. Patent to Sen, issued February 14, 1989. No. 4,804,744; U.S. of Urist, dated January 3, 1989. Walla Patent No. 4,795°804, issued December 6, 1988 ce, 5sestad, McPherson, Piez and Ross US Patent No. 4.789.663, published on December 6, 1988, by Urist. National Patent No. 4,789.732; 5eye issued on September 27, 1988 din, Thomas.

Benz, Ellingsworth and AArllStrOn, U.S. Pat. 4. No. 774.322; Neer and 5 issued on October 6, 1987 lovik U.S. Patent No. 4,698,328; issued December 9, 1986 U.S. Pat. No. 4,627.982 to Eydin and Thomas; 19 U.S. Patent No. 4,619°989 to Urist, issued October 28, 1986. No. 4,596. of Urist, issued June 24, 1986. No. 574; U.S. Pat. No. 4,56 to Urist, issued January 7, 1986. 3.489, published January 7, 1986 by Nathan.

5eyed i n and Benz U.S. Pat. No. 4,563,350; 198 tirist U.S. Pat. No. 4,526,909, issued July 2, 2005; 5eyedin and Thomas U.S. Special Issue dated February 23, 1984 Urist No. 4.434,894, dated October 13, 1981 U.S. Pat. No. 4,294.753; Bab, published January 3, 1990. European patents of , Muh rad, Gazi and 5hteyer Application No. 349.048; Published March 29, 1989 Chu, Nat. han and 5eyedin European Patent Application No. 309,241, October 1989 Benz, Nathan, Rosen, Dasch and others published on May 11th European Patent Application No. 336,760 of 10 July 1985 Sen European Patent Application No. 145.155 published on date; November 1989 Roos, Burns, Guy and McKnig published on the 16th International Patent Application No. 89/10934 of ht; published on October 19, 1989 0pper*ann.

Kubersampath, Rueger and Ozkaynak international patent application No. 89109787 and No. 89109788; Published on January 14, 1988. International Patent Application No. 8810 of Open Police Ang, Wozney and Rosen Specification No. 0205.

Purpose of invention It is an object of the present invention to provide a method for generating new bone growth in mammals. It is.

Another object of the invention is that the present invention can be used to generate new bone growth in mammals. To provide a pharmaceutical composition containing a safe and effective amount of a vitamin D compound and a safe and effective amount of a vitamin D compound. a combination of osteoinductive extracts comprising an amount of one or more BMPs or one or more BMPs for producing new bone growth in a mammal comprising administering to the mammal Regarding the method.

The present invention provides a safe and effective amount of vitamin D compounds; a safe and effective amount of BMP or one or more B. osteoinductive extract containing MP; The present invention further relates to compositions for producing bone growth.

Detailed description of the invention The present invention provides a safe and effective amount of a vitamin D compound and a safe and effective amount of one or more BMPs or one or more vitamin D compounds. The method consists of administering to a mammal a combination of osteoinductive extracts containing more than one species of BMP. B Treatment with tamin D compounds, BMPs or osteoinductive extracts alone increases bone growth. It turns out that Surprisingly, osteoinductive extract or at least one BMP and Treatment with combined vitamin D compounds can include BMP, osteoinductive extracts or vitamin D compounds. levels of new bone growth that are greater than those obtained with administration of Tamin D compounds alone. I found out more to show. The subjects who require such treatment are not particularly limited, but In fractures (closed and open), non-union fractures, congenital defects, plastic surgery, and tumor removal procedures. As an adjunct, osteoporosis, rheumatoid arthritis, osteoarthritis, septic arthritis, rickets, Histological integration of prosthetic joints and dental implants, periodontal diseases and defects and bone deficiencies and This treatment includes all conditions classified as osteomalacia conditions and diseases. suffering from various diseases.

As used herein, a “safe and effective amount” is defined as a “safe and effective amount” within the scope of sound medical judgment Sufficient to induce a significant positive change in the condition being treated (in terms of risk ratio) However, it refers to amounts of a compound or composition that are sufficiently low to avoid serious side effects. Ru. A safe and effective amount of the compound or composition depends on the specific condition being treated, Patient age and physical condition, severity of symptoms, duration of treatment, nature of combined therapy used The specific compound or composition, the specific pharmaceutically acceptable carrier and excipient utilized. It will vary depending on similar factors that are within the knowledge and expertise of the physician.

As used herein, "fracture reduction" refers to surgical or manual procedures to restore the fracture to its normal anatomical relationship. Experience the repair of fractures using steps.

As used herein, "B-IP" refers to bone morphogenetic protein.

As used herein, "q, s," means appropriate amount.

All percentages used herein are by weight unless otherwise noted. .

“Local treatment” used here includes fractures (closed and open). (open) treatment, non-union fracture treatment, congenital defect treatment , tumor removal procedures, tissue integration of prosthetic joints, and dental procedures as adjunct treatments to plastic surgery. This includes the tissue incorporation of implants and the treatment of periodontal diseases and defects.

The “systemic treatment” used here includes osteoporosis, rheumatoid arthritis, osteoarthritis, Includes treatment of diseases classified as bloody arthritis, rickets and bone deficiency symptoms and diseases.

All dose ranges used herein for systemic treatment are per kg of mammalian body weight. Expressed as dry weight of active agent.

All dose ranges for topical treatment used herein are based on the mineralized tissue being treated. It is expressed as dry weight of active agent per surface area C-.

As used herein, "mineralized tissue" refers to bones and teeth.

vitamin D compound One ingredient required by the method of the invention is a vitamin D compound. used here “1 vitamin D compound (1 vitamin D compound) vitamin D2), cholecalciferol (vitamin D3) and their biological activities. There are various metabolites and precursors. Preferably 0 Especially limited as a vitamin D compound Vitamin D2 (SigIla, St. Louis, MO), Vita MinD3 (Sigma, St. Louis, MO), 1α-hydroxyvitamin D]] α-fluorovitamin D 3-deoxy3ゝ　3゛ Sea 1,25-dihydroxyvitamin D 25-human 3ゝ Fuxi 5.6-transvitamin D 25-hydro 3ゝ Oxyvitamin D 25-Hydroxyvitamin D3 [Ho2ゝ Horf'man LaRoche), 1, 25- Dihydroxyvitamin D 24.25-dihydroxyvitamin D Tamin D 24.25-dihydroxyvitamin D32 (Hoffmann-Laroche) and 1,25-dihydroxyvitamin D3 [Duwa 7- (Duphar), Veenendaal, The Netherlands]. preferably vitamins Compound D is 25-hydroxyvitamin D 25-hydroxyvitamin 2 D　1.25-dihydroxyvitamin D　24゜3・　2゛ 25-dihydroxyvitamin D 24.25-dihydre 2ゝ selected from Roxyvitamin D3 and 1,25-dihydroxyvitamin D3, Preferred is 1,25-dihydroxyvitamin D3. Other useful in this invention Vitamin D compounds are well known to those skilled in the art, and are not particularly limited, but each is for reference only. As disclosed by the following U.S. Patent Specification: 1990, which is incorporated herein by reference. DeLuca and Kwjecinski U.S. Patent Issued November 13th No. 4,970.203; DeLuca, dated May 22, 1990; Kutner, Perlman and 5chnoes, U.S. Pat. No. 4,927.8 No. 15; Published August 15, 1989 DeLuca, Ikekawa and Tanaka U.S. Pat. No. 4,857°518, July 25, 1989. DeLuca published by.

Kutner, Perlsan and Set+r+oes U.S. Pat. No. 4,85 1°401, published July 25, 1989 by DeLuca.

Ikekawa and Tanaka U.S. Pat. No. 4,851,400; 1989 DeLuca, Kutner, published July 11, 2013.

Perlian, Phelps, 5chnoes and 5lcjnskj US special License No. 4゜847.012; Daae issued on March 28, 1989. DeLuca and Pierce, U.S. Pat. No. 4,816,417; 1988 DeLuca, published on September 6th.

5chnoes, 5icinski and Tanaka, U.S. Pat. No. 4,769° No. 181; DeLuca, published July 5, 1988.

Lee and 5chnoes U.S. Pat. No. 4,755,329: January 1988 DeLuca, published on the 12th, 5chnoes.

5icinski and Tanaka, U.S. Pat. No. 4,719,205; 198 DeLuca, published January 12, 8, 5chnoes.

5icinski and Tanaka, U.S. Pat. No. 4,719,204; 198 DeLuca, I kekawa, published on January 5, 1988.

Ostrem and 5chnoes U.S. Pat. No. 4,717,721; 19 DeLuca, published August 25, 1987, 5chnoes.

5iejnski and Tanaka U.S. Pat. No. 4,689,180:198 DeLuca, lkekawa, published October 28, 2006.

Kobayashi and Tanaka U.S. Pat. No. 4,619,920; 19 DeLuca, published June 10, 1986.

U.S. Patent No. 4,59 to Ikekawa, Kobayashl and Tanaka 4゜No. 192, published on May 13, 1986 by DeLuca and 5chn OES U.S. Pat. No. 4,588,716; issued May 13, 1986. DeLuca, Ikekava and Tanaka, U.S. Pat. No. 4,588, No. 528; Published January 14, 1986 DeLuca, Ikekav a, U.S. Pat. No. 4,564,474 to Kobayashi and Tanaka DeLuca, Lee, published November 26, 1985.

Phelps and 5chnoes, U.S. Pat. No. 4,555,364; 1985 DeLuca, Lee, published November 19, 2013.

Phelps and 5chnoes, U.S. Pat. No. 4,554,106; 1985 DeLuca, Ikekawa, published November 11, 2013.

KObayash and Tanaka U.S. Pat. No. 4,552.698, 1 DeLuca, Lee and 5chnoe, dated April 23, 985 No. 4,512,925, issued March 19, 1985. eLuca, 5chnoes.

5icinski and Tanaka, U.S. Pat. No. 4,505,906; 198 DeLuca, I kekava, published on March 5, 2013.

Kobayash and Tanaka, U.S. Pat. No. 4,502.991, 1 DeLuca, published February 19, 985.

Ikekava, Kobayashi and Tanaka, U.S. Pat. No. 4,50 Chu, No. 0°460, published November 6, 1984.

DeLuca, Kabakofr and 5chnoes, U.S. Pat. No. 4,481° No. 198; DeLuca, published July 24, 1984.

Hart and 5chnoes, U.S. Pat. No. 4,461.766; 19845. DeLuca, Paaren, published on May 15th.

5chnoes and 5aith U.S. Pat. No. 4,448,726; 1984 DeLuca, Morzycki and 5chnoes, dated May 15th. U.S. Patent No. 4. No. ’448,721; D issued on January 31, 1984 eLuca, Jorgensen and 5chnoes, U.S. Pat. No. 4,428 , No. 946; Published October 25, 1983 DeLuca, Ikek awa.

Kobayashi and Tanaka U.S. Pat. No. 4,411,833; 19 DeLuca, 5chnoes and Wichwa, dated January 4, 1983. U.S. Pat. No. 4,367.177, issued November 9, 1982 eLuca, Ikekava.

Kobayashf and Tanaka U.S. Pat. No. 4,358.406; 19 DeLuca, published July 6, 1982.

Jorgensen and Schnoes U.S. Pat. No. 4,338,312; 1 DeLuca, Hamer, published July 6, 982.

U.S. Pat. No. 4,338,250 to Paaren and 5chnoes; 1982 DeLuca, Fivizzanf, published June 22, 2013.

U.S. Pat. No. 4.3 of Paaren, 5chnoes and Wlchllann 36° No. 193; DeLuca, published February 2, 1982.

Frank, Paaren and 5chnoes, U.S. Pat. No. 4,313.9 No. 42; DeLuca, published December 22, 1981.

U.S. patents of Paaren, 5chnoes, Tanaka and Wichmann No. 41307.231; DeLuca dated December 22, 1981 , Ikekawa, Morisaki, Oshida, 5chnoes and T anaka U.S. Patent No. 4,307,025; issued December 15, 1981. DeLuca, Ikekava, Kobayashi and Tanaka No. 4,305,880: D, issued October 27, 1981. eLuca.

Fivizzani, Paaren and 5chnoes U.S. Pat. No. 4,2 No. 97°289; DeLuca, published September 29, 1981.

U.S. Pat. No. 4,292,250 to Levan and 5chnoes; 1981 DeLuca, Hamer, published May 5th.

U.S. Pat. No. 4,265,822 to Paaren and 5chnoes; 1981 DeLuca, Flvizzani, published April 28, 2013.

U.S. Pat. No. 4,264,513 to Napoli and 5chnoes; 1981 DeLuca, Napo If, published on April 21, 2013.

U.S. Patent No. 4,263,214 to Onfsko and 5chnoes: 1981 DeLLICA, ESvelt and 5chnoes issued on April 7th DeLu U.S. Pat. No. 4,260,804, issued April 7, 1981 U.S. Patent No. 4,260 to Hataer, Paaren and 5chnoes , No. 549; Published March 3, 1981 DeLuca, Ikekaw a, Morisakj.

U.S. Pat. No. 4,254,045 to Oshlda and Tanaka: 1981 US reissue of DeLuca, Lam and 5chnoes dated March 3rd Patent No. 30,538; DeLuca, issued February 3, 1981. I kekava, Kobayas old and Tanaka US patent! 4,2 No. 48.791, November 18, 1980 DeLuca, Ham. U.S. Patent No. 4,234,495 to Er, Paaren and 5chnoes; 1 DeLuca, Napo Li, published October 28, 1980.

0nisko and 5chnoes U.S. Pat. No. 4,230,627:1980 Published October 21, 2013 Alper, DeLuca.

5chnoes and Tanaka U.S. Pat. No. 4,229,359:1980 DeLuca, Napo I, published October 21, 2013.

U.S. Pat. No. 4,229.358 to 0nisko and 5chnoes; 1980 DeLuca, Napo If, published on October 21, 2013.

U.S. Pat. No. 4,229,357 to Onlsko and Schnoes; 1980 DeLuca, I kekawa, published on October 7, 2016.

Kobayashi, 5chnoes and Tanaka, U.S. Pat. No. 4,22 No. 6°788; DeLuca, published October 7, 1980.

U.S. Patent No. 4,226°78 to Napoli, 0nisko and 5chnoes No. 7; Alper, published September 23, 1980.

DeLuca, 5chnoes and Tanaka U.S. Pat. No. 4,224,23 DeLuca, No. 1, September 23, 1980.

U.S. Patent No. 4,224 to Napol i, Onjsko and 5chnoes No. 230; DeLuca, published September 16, 1980.

U.S. Patent No. 4,223.1 to Schnooes and Wich++an DeLuca No. 31, published August 12, 1980.

0nisko and 5chnoes U.S. Pat. No. 4,217,288:1980 DeLuca, Esvel and 5chnoe, published June 24, 2013. No. 4,209,634, issued May 13, 1980. eLuca, Hamer.

U.S. Patent No. 4,202.829 to Paaren and 5chnoes: 1980 DeLuca, I kekawa, published May 6, 2013.

Kobayashi, 5chnoes and Tanaka U.S. Pat. No. 4.201 No. 881; DeLuca issued on April 1, 1980.

Ikekava, Kobayashi, 5chnoes and Tanaka's U.S. Patent No. 4°196.133; DeL issued March 25, 1980 uca, Hamer, Paaren and 5chnoes, U.S. Patent No. 4°195 ．． No. 027; Published February 12, 1980 DeLuca, Napoit , 0niski and 5chnoes, U.S. Pat. No. 4,188,345; 197 DeLuca, Law and 5chnoes, published September 16, 2015 U.S. Patent No. 3.906.014. References Useful in the Invention and These References Other vitamin D compounds disclosed in 4-Homovitamin D; Cyclopentanovitamin D: Hydroxylated 26-Homovitamin D Tamin D; 1α-Hydroxyvitamin D: 1-Hydroxyvitamin D: 1α-Hydroxyvitamin D; Droxyvitamin D; 1α, 25-dihydroxy-222-dehydroxyvitamin Mine D; 26°26.26,27.27-pe/tafluoro-1α-hydroxy- 27-medoxyvitamin D; 2α-fluorovitamin D3; 1,24-dihydre Roxy-Δ22-vitamin D; 23.23-difluoro-25-hydroxyvitamin D Tamin D3: 1-hydroxy-3,5-cyclovitamin D; 23.23-diflu Oro-1α,25-dihydroxyvitamin D; 1,23-dihydroxyvitamin D; Hydroxyvitamin D; 23,23-difluoro-1α,25-dihydro Xibixivitamin D23,23-difluoro-25-hydroxyvitamin D ;26,26°26.27,27.27-hexafluoro-1α,25-dihyde Roxico I/sterol; 23,25-dihydroxyvitamin D; 26,26 ,26,27,27゜27-hexafluoro-1α,25-dihydroxycoreca Luciferol; 1α, 25-dihydroxy-2β-fluorovitamin D, 2 4-Fluoro-25-hydroxycholecalciferol: 5,6-transvita Mine D, 1α-hydroxy-25-keto-27-norcholecalciferol; fluorovitamin D; lα-hydroxy-2β-fluorocholecalciferol; 3-deoxy-1α-hydroxycholecalciferol; 25-hydroxy-2 6,26,26,27,27,27-hexafluorocholecalciferol; α -Hydroxy-3゜5-cyclovitamin D; 25-hydroxycholecalcifero 24,24-difluoro-1α,25-dihydroxycholecalciferro Le: Calcifnirol; 25-hydroxycholecalciferol-26.23-lac ton, 24.24-difluoro-1α,25-dihydroxycholecalciferro 24,24-difluoro-25-hydroxycholecalciferol; 3,5 -Cyclovitamin D; 3-deoxy-α-hydroxycholecalciferol Ru. Other vitamin D compounds useful in the present invention include Th e Handbook or Vitallins, L. J. Machlin, E. d. .

Mercel Dekker, Inc. Further what was disclosed in (19g4) include. Among the vitamin D compounds useful in the present invention disclosed in this reference are Without limitation, 1,25-dihydroxyvitamin D,3-deoxy-1,25-di Hydroxyvitamin D127-True 25-Hydroxyvitamin D3, 26.2 7-pisno-25-hydroxy vitamin D3, 24-true 25-hydroxy Vitamin D3, 25-hydroxyvitamin D, 1.25-dihydroxyvitamin D,1α-hydroxyvitamin D3 and 25-fluoro-1α-hydroxyvitamin There is Min D3.

A safe and effective amount of a vitamin D compound in combination with at least one BMP or at least It is administered in combination with an osteoinductive extract containing one BMP.

The preferred dose range for administration of vitamin D compounds for systemic therapy is approximately 1 ng. ~ about IB, preferably about 10 ng - about 500 μg1, more preferably about 20 ng ~ It is about 10 μg.

For topical treatment purposes, the dosage range of vitamin D compounds is from about 1 ng to about IB, preferably about 10 to about 500 ng, more preferably about 10 to about 50 ng, most preferably about 10 to about 50 ng. Also preferably about 20 to about 30 ng.

Preferably, administration is for a period of from 1 day to 6 months, more preferably from about 1 week to about 1 month. It will be done. Preferably, administration is from about 1 time per month to about 5 times per day, more preferably about 1 time per day. It is carried out approximately once per week to approximately once per day.

bone morphogenetic protein In one embodiment of the invention, the vitamin D compound causes new bone growth in the mammal. It is administered in combination with one or more BMPs to achieve the desired effect. These BMPs are BM P-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BlvlP-7.

Preferably BMP-1, BMP-2, BMP-3, BMP-4, BM BMP selected from the group consisting of P-5, BMP-6 and BMP-7. A safe and effective amount is administered in combination with a vitamin D compound.

A preferred dose range for administration of BMP for systemic therapy is from about 1 pg to about 10 0 μg, preferably about 1 ng to about 10 μg, more preferably about Long to about 2.0 μg. It is 5 μg.

For topical treatment purposes, a preferred dose range for B-IP is about 1 pg to about 10 0 μg, more preferably about 1.5 to about 90 μg, preferably about 1.8 to about 75 μg g, more preferably from about 2.0 to about 50 μg1, even more preferably from about 2.2 to about 2 5μg1 more preferably about 2.3 to about 10μg1 most preferably about 2.5 to about 5μg1 It is μg.

Preferably, the dosage range is at least about 2.5 μg.

Preferably, administration is for a period of from 1 day to 6 months, more preferably from about 1 week to about 1 month. It will be done. Preferably, administration is from about once per month to about 5 times per month, more preferably about once per month. It is carried out approximately once per week to approximately once per day.

“BMP-1” used here is a DNA sequence consisting of SEQ 10 NO:L. refers to the peptide encoded by the sequence.

“BMP-20” used here is a DNA consisting of SEQ 10 NO:2 refers to the peptide encoded by the sequence.

'BMP-3' used here is a DNA sequence consisting of SEQ 10 NO:3. refers to the peptide encoded by the sequence.

“BMP-4” used here is a DNA sequence consisting of SEQ ID NO: 4. refers to the peptide encoded by the sequence.

“BMP-5” used here is a DNA sequence consisting of SEQ 10 NO:5. refers to the peptide encoded by the sequence.

“B M P-6” used here consists of SEQ ID NO: 6 Refers to a peptide encoded by a DNA sequence.

“B~IP-7” used here is a DN consisting of SEQ ID NO near. refers to the peptide encoded by the A sequence.

'A', 'To', 'G' and 'C' used here are adenine, thymine, Relating to nucleotides containing guanine and cytosine.

Osteoinductive extract Another component of the invention is an osteoinductive extract. “Osteoinductive” used here Extracts' include, but are not limited to, BMP-1, BMP-2, BMP-3, B One or more types including MP-4, BMP-5, BMP-6 and BMP-7 means a chemical extract of bone containing various bone morphogenetic proteins, in which case each B.M. P has a molecular weight of about 28,000 to about 40,000 daltons.

The 28,000 to 40,000 dalton molecular weight range is related to the B M P dimer weight. do. Preferably, the molecular weight of the dimer is between about 30,000 and about 34,000 dollars. It is. The BM P dimer consists of two monomers, each with approximately 14,000 0 to about 20,000 Daltons, preferably about 15,000 to about $17,000 It has a molecular weight of tons.

A preferred method of obtaining osteoinductive extracts is as follows: A~8 week old Long-Evans rats [Charles River -Charles River Laboratories , Wilmington, MA). Cut the skin at the ankle. Both tibiae were removed and soaked in cold water. I can put it in. The bone is rinsed with distilled water to remove non-bone tissue (tissue outside the bone mass).

Air dry the bones. Osterizer (0sterizer) Oster Coomercial, Milwaukee.

Wl) Grind the bones by placing them in a blender with water and ice. with a blender Set to “liquify” speed and continue adding bones. Mix the blended substances for a few minutes. and let it settle. Decant the liquid layer. Place the solid layer on a stir plate and add distilled water. Add and wash. Continue washing with distilled water until clean. Distilled water becomes clear Then add ice and stir. 1mM phenylmethylsulfonyl fluoride (PM SF) Add 1 ml. Wash for 1 hour, adding ice frequently. Repeat the second water wash. return. Place the sample in an ice water bath on a stir plate. Degrease with absolute ethanol , and then degreased twice with ethyl ether. Spread the bone material on a glass bird dish . Air dry the bone fragments overnight.

- Weigh the bone fragments after drying overnight. Sieve (USA standard fist sieve series) , Newark Wire C1othC o, ), :, - Arc, N #40 sieve retains particles larger than 425 μm, #1 70 sieve retains particles larger than 90 μm] to remove bone particles in the range of 90 to 425 μm. isolate. Add dry ice to the bone particles for 1 minute while keeping the material cold. Kake Micro Mill [Scienceware Bell Art] ・Products (Scienceware Be1-Art Products) , Bequanock, NJ) to crush particles larger than 425 μm. The total amount recovered is the first for bone. Particles of 425 μm or more are sieved and micromilled until they become 2/3 or more of the initial weight. Repeat the crushing step knob. Store particles at 4°C until next step. So far Weigh the isolated particles. 0.6N HCI 25il per gram of particles Add. Stir vigorously for 2 hours at 4°C. After 2 hours, stop stirring and allow the particles to settle. let

Decant the HCI. Add fresh 0.6 NI (C1) and stir again for 2 hours.

Decant the HCI, add fresh 0.6N HCl a third time and stir for 2 hours. Ru.

Decant the MCI and rinse with distilled water. Regarding the presence of HCI using Lidmus paper Check the pH of the water. Continue rinsing with distilled water until the pH is approximately 5-5.5. Ru. Rinse the bone particles three times with ethanol. Stir, allow to settle, and remove supernatant.

Rinse the bone particles three times with ethyl ether as above. Dry overnight on a glass plate let The dried bone particles are called "acid mineralizable particles."

After drying overnight, the acid film mineralized particles are detanned/refined as described below. Weigh the substance. 1 gram of substance, 4M guanidine MCI, pH 6.4, Add solution 301 of 10 μM Tris and 1.0 μM PMSF to the bone material in the beaker. I can do it. Extract for 16 hours at 4° C. with vigorous stirring. After 16 hours of extraction Stop stirring and allow the material to settle. Pour off the guanidine solution and save. Fresh Extract the material a second time for 6-7 hours using guanidine MCI solution. Ru. After extraction, pour out the solution and combine with the previously stored solution. Then the bone particles Demineralizes and deproteinizes.

in distilled water at 4°C using 5C1+m dialysis tubing (3500 molecular weight cutoff). Dialyze the stored guanidine MCI solution against. Lyophilize the substance after dialysis , the lyophilized material was dissolved in 4M urea-0.05M Tris-0.1M NaC at pH 7.4. 1. The dissolved material was combined with heparin-agarose in a conical centrifuge tube. Mix and mix overnight on a low cheetah at 4°C. Heparin-Agaro Pour the solution slurry into the column. 4M urea at pH 7.4, 0.05M Tris, 0. Wash with 1 column volume of 1M NaCl buffer. Collect fractions.

3 column volumes of 4M urea, 0.05M Tris, 0.2M NaCl buffer at pH 7.4 Wash with the amount. 4M urea, 0.05M Tris, 0.75M NaC at pH 7.4 The material is removed stepwise over 13 column volumes. Second sump/l/rough filter (10,000 molecular weight cutoff) equipped with 501 Amicon Concentrator [Amicon Corporation (A Micron Corp., Danvers, MA) to approximately 4=5+nl.

BCA C bicinchoninic acid) protein assay reagent [Pieree ), Rockford, IL) for tongue/liquid concentrations, pH 7, 4M guanidine-0.01M Tris (3500 molecular weight / throat-off dialysis tube) Dialyze with tube). Sephacryl S-200 column Pour the substance into the container and collect the fractions. Fraction containing the main protein peak Dialyze against 1M acetic acid and test for activity.

Combine the active fractions from gel filtration and add 6M urea, 25mM vinegar, pH 4.6. Dialyze against 3 changes of sodium chloride. The dialysate was equilibrated with the same buffer. Pour into a column of ruboxymethyl Sepharose (CM-Sepharose). column was washed with 6M urea, pH 4.6, 25mM sodium acetate, and diluted with 0-0.5M Na Elute activity using a C1 gradient. Dividing fractions with respect to protein concentration and subjected to sodium dodecyl sulfate gel electrophoresis. Main tannori quality beak starts The activities present in the previous and subsequent 7 fractions are pooled for further purification.

The pooled CM-Sepharose fractions were diluted three times each with 1% acetic acid. Dialysis takes 4 hours. The dialysate was lyophilized and the protein pellet was adjusted to pH 7, 4 of 6M urea, 0.5M NaCl, dissolved in 25aM sodium phosphate 301 let Applying the sample to a column of zinc-charged chelated Sepharose; Equilibrate with the above buffer. The column was washed with the above buffer and then adjusted to pH 7.4. of 6M urea, 0.5ki NaCl, 25mM sodium phosphate to 9H4, 6M urea, 0.5M NaCl, eluted with a gradient to 251M sodium acetate. let A portion of each fraction was labeled with I and analyzed by SDS gel electrophoresis. Ru. A portion (100 μg) of each fraction was combined with 400 μg of elution buffer and Dialyze against % acetic acid and test for activity. Highly purified molecular weight range (Mr) 25~ The 40kD peptide is tested in an osteoinduction assay.

A safe and effective amount of the osteoinductive extract is administered in combination with a vitamin D compound. Whole body treatment For therapeutic purposes P, the osteoinductive extract administered is preferably from about 1 pg to about 10 Mg. Preferably an amount of about 1 ng to about 10 μg, more preferably about 10 ng to about 2.5 μg. It is preferable that at least one type of BMP is included.

For local treatment purposes, the osteoinductive extract administered is about 1 pg to about 100 μg; More preferably about 1.5 to about 90 μg1, preferably about 8 to about 75 μg1 Preferably from about 2.0 to about 50 μg5, even more preferably from about 2.2 to about 25 μg, More preferably an amount of about 2.3 to about 10 μg, most preferably about 2.5 to about 5 μg. It is preferable that at least one type of BMP is included. Preferably, the dosage range is small. The total amount is approximately 2.5 μg.

Preferably, administration is for a period of from 1 day to 6 months, more preferably from about 1 week to about 1 month. It will be done. Preferably, administration is from about 1 time per month to about 5 times per day, more preferably about 1 time per day. It is carried out approximately once per week to approximately once per day.

Pharmaceutically acceptable carrier Vitamin D compounds, osteoinductive extracts or BMPs may be delivered in pharmaceutically acceptable carriers. It may also be administered separately. The term “pharmaceutically acceptable carrier” is used herein. is one or more compatible solids or liquids suitable for administration to humans or lower animals. means filler diluent or encapsulating material. The term “compatibility” used here The term refers to interactions that, under normal conditions of use, would substantially reduce the pharmaceutical efficacy of the pharmaceutical composition. It is understood that the components of the pharmaceutical compositions can be mixed with the compounds of the invention and with each other so that means. Pharmaceutically acceptable carriers may of course be used for the human being treated or lower. be of sufficient (high zero purity and sufficiently low toxicity) to make them suitable for administration to animals. Must be.

Some examples of substances that serve as pharmaceutically acceptable carriers are lactose, glucose, Sugars such as sugar and sucrose; starches such as corn starch and potato starch Pun; cellulose and sodium carboxymethyl cellulose, ethyl cellulose its derivatives such as cellulose acetate: powdered tragacanth; malt: gelatin: Talc: stearic acid; magnesium stearate; calcium sulfate, peanuts Vegetable oils such as oil, cottonseed oil, sesame oil, olive oil, corn oil and theobroma oil: Propylene glycol, glycerin, sorbitol, mannitol and polyethylene Polyols such as lene glycol; sugars; alginic acid; pyrogen-free water - isotonic solutions: Phosphate buffer - cocoa butter (suppository base); such as Tνeens Emulsifiers; other non-toxic compatible substances used in pharmaceutical formulations. sodium lauryl sulfate Wetting agents and lubricants such as thorium and coloring agents, flavoring agents, excipients, tabletting agents, and stabilizers. , antioxidants and preservatives may also be present. Other compatible excipients and active agents (e.g. For example, NSA I drugs; analgesics; muscle relaxants) are also pharmaceutically acceptable for use in the compositions of the present invention. may be included in accepted carriers.

For example, local anesthetics known in the industry [e.g., benzyl alcohol; Novocaine (N lidocaine] may be included in a pharmaceutically acceptable carrier. .

Additional examples of carriers include collagen, demineralizing particles, ceramics and metals. Talic implant material, collagen membranes and bone grafts (syngeneic or allogeneic) There is.

The selection of a pharmaceutically acceptable carrier for use with a compound of the invention is determined by the Determined by the given method. A preferred mode of administering compounds of the invention is injection. , oral administration, topical oral administration, and nasopharyngeal administration or a combination of modes (i.e., bone-induced administration by injection). vitamin D compounds) in vitamin D extracts and oral administration. If the compound is injected For example, a preferred pharmaceutically acceptable carrier is sterile saline.

Pharmaceutically acceptable carriers suitable for oral administration include tablets and capsules. There are some things. Pass as a pharmaceutically acceptable carrier suitable for topical oral administration Some are suitable for ta, gel and liquid formulations. Pharmaceutically acceptable drugs suitable for nasopharyngeal administration Carriers include those suitable for layering, spraying, misting and powdering.

Separate pharmaceutically acceptable carriers may be used in combination with each active ingredient of the present invention or may be used alone. Pharmaceutically acceptable carriers may be used in conjunction with the active ingredient mixtures of the present invention.

In either case, the pharmaceutically acceptable carrier should be of a practical size and dosage. used in sufficient concentrations to form a binary relationship. Pharmaceutically acceptable carrier is preferably from about 0.1 to about 99.99999% by weight of the pharmaceutical composition of the invention as a whole. preferably about 50 to about 99.999%, most preferably about 75 to about 99.9%. Ru.

All specific oral and injectable carriers useful in the present invention are incorporated herein by reference. Published August 30, 1983 U.S. Pat. No. 4,401,663 to Buckwalter et al.: 19841 No. 4,424,205 to LaHann et al., issued May 31; 1 U.S. Pat. No. 4, Buckval et al., issued April 12, 984, No. 443,473; LaHann et al., U.S., published January 15, 1984. Patent No. 4,493,848. Representative pharmaceutical compositions of the invention are shown in the examples below. has been done.

Pharmaceutically suitable for oral administration, topical administration, nasopharyngeal administration and production of unit dosage forms for injection Acceptable carriers are well known in the art. Their selection is suitable for the purpose of the present invention. Depends on secondary considerations such as immaterial taste, cost and/or shelf stability can be carried out without difficulty by those skilled in the art. Pharmaceutically acceptable compounds useful in the compositions of the invention These carriers are described in more detail below.

A. Oral dosage form Preferably, the vitamin D compound is administered in oral dosage form. drug tablets, capsules various oral formulations, including solid forms such as granules, bulk powders and microcapsules. shapes can be used. These oral forms contain safe and effective amounts, usually at least about 0.5%, preferably or about 1% to about 10% of a compound of the invention. Tablets may contain suitable binders, lubricants, Surfactants, diluents, disintegrants, colorants, flavoring agents, preservatives, fluidizing agents and melting agents. It can be compressed, enteric coated, sugar coated or film coated.

Suitable solvents, preservatives, emulsifiers, suspending agents, diluents and sweeteners for liquid oral dosage forms. , aqueous and non-aqueous solutions, emulsions, suspensions containing melting agents, colorants and flavoring agents; There are solutions and/or suspensions that are reconstituted from non-boiled granules. Preferred for oral administration Carriers include gelatin and propylene glycol. Compounds of the invention Pharmaceutically acceptable carriers and excipients that may be used in formulating oral dosage forms containing Specific examples of formulations published September 2, 1975 are incorporated herein by reference. Robert, US Pat. No. 3,903,297. solid Techniques and compositions for making oral dosage forms are described by Marsha, incorporated herein by reference. l　l　.

"5 solid oral dosage form".

Modern Pharmaceuticals, Vol. 7 (Banker and R. (edited by Hodes).

359-427 (1979). Tablets (compressed, formulated and molded), Techniques and compositions for manufacturing capsules (hard and soft gelatin) and pills are for reference only. RelIington's PharrAceutical incorporated herein 5sciences (edited by Arthur 0so1), 1553-1593 ( 1980).

B8 topical oral dosage form As used herein, “topical oral carrier” refers to a carrier for the ingredient of interest; Rather than being administered topically into the oral cavity, kept there for a while, and then taken down. Forming a composition that is largely expelled. Such compositions include toothpaste and toothpaste. toothpaste, mouthwash, mouth spray, preventive paste, dental treatment solution, biogel or other sustained release products.

The components of the topical oral carrier are suitable for administration to the oral cavity of humans or lower animals; each other and the other ingredients, particularly the vitamin D compounds and Compatible with osteoinductive extract or BMP. For this reason, the preferred topical oral carrier is Toothpaste, tooth gel, toothpaste, mouthwash, mouth spray, preventive paste, dental procedures Provides desirable characteristics for solutions etc. The topical oral carrier of the present invention can be prepared by a skilled practitioner. Ingredients typically used in such compositions are well known in the art. This kind of growth The ingredients are not particularly limited, but include anti-caries agents, anti-plaque agents, anti-tartar agents, tooth polishing agents, surfactants, etc. sex agents, flavoring agents, sweeteners, binders, humectants, thickeners, buffering agents, preservatives, colorants and There are pigments, ethanol and water.

A preferred composition of the invention is in the form of a 1a toothpaste. The ingredients of such 'a toothpaste are Normal tooth polishing agent (about 10 to about 50%), surfactant (about 0.5 to about 10%), thickener agent (approximately 0.1 to approximately 5%), humectant (approximately 10 to approximately 55%), flavoring agent (approximately 0.04 to approximately 55%), (approximately 2%), sweeteners (approximately 0.1 to approximately 3%), colorants (approximately 0.01 to approximately 0.5%) and There is water (about 2 to about 45%). Such toothpastes contain one or more anti-caries agents (fluoride). (approximately 0.05 to approximately 0.3% as oxide ions), anti-tartar agent (approximately 0.1 to approximately 13%) and an anti-plaque agent (about 0.1 to about 5%).

Other preferred compositions of the invention are mouthwashes and mouth sprays. This kind of washing The ingredients of oral fluids and mouth sprays include water (approximately 45% to approximately 95%) and ethanol (approximately 0%). ~25%), humectant (approximately 0~50%), surfactant (approximately 0.01~7%) , flavoring agents (about 0.04% to about 2%), sweetening agents (about 0.1% to about 3%), and coloring agents (about 0.001 to about 0.596). Such mouthwashes and mouth sprays are 1 Anti-caries agent (approximately 0.05 to approximately 0.3% as fluoride ion), anti-calculus agent (from about 0.01 to about 3%) and antiplaque agents (from about 0.1 to about 5%).

Other preferred compositions of the invention are dental solutions. The ingredients of such dental solutions include Usually water (about 90 to about 99%), preservative (about 0.01 to about 0.5%), thickener (about 0 to about 5%), flavoring agent (about 0.04 to about 296), sweetener (about 0.1 to about 396) ) and surfactants (about 0 to about 5%).

The "topical oral carrier" used herein is impregnated with the active ingredient of the present invention and It also refers to fibers, strips or tubes that are inserted or embedded in the jacket.

Such compositions of the invention may be incorporated by reference into the previously disclosed instructions, which are incorporated herein by reference. It can be easily obtained by a person skilled in the art according to the following references and related well-known techniques: Golub, McNamara & Ram, published May 19, 1987. aI! urthy U.S. Patent No. 4,666.897: November 4, 1987 Baker European Patent Application No. 244,118A1 published in 1988 Kametaka, Miyazaki, Hayash released on October 19th i, Handa & Kaieda European Patent Application No. 286,802A2; Ad dy, M.L., Rawle, R., Handley, H., Nevian & J. Coventry.

”The development and in vitro evaluation tion　acrylfc　5trips　and　dialysis　t local drug delivery” (Development and in vitro evaluation of acrylic strips and dialysis tubes), Jou rnal of’ Perjodon to l ogy, Vo I, 5 3 (1982), pp, 693-698 H Goodson.

J, M,, A, D, Haf’l’ajee & S, S, 5ocransky, ”Perlodontal therapy by 1 local deliverer y　ortetracycline- (periodontal Therapy), Journal of'C11nical Periodontolo gy, Vol. 6 (1979), pp. 83-92; Goodson, J., D. , Holborov, R., Dunn, P., Hogan & S., Dunham.

”Monolithic tetracyclfne containing fibers for controlled delivery to per iodontal pockets” (for controlled delivery to periodontal pockets) Fiber containing lithic tetracycline), Journal orPe rt odontology, Vo l, 54 (19H), I)L 575-579; Dunn, R,, J.

Gibson, B., Perkins, J., Goodson & L. Laufe. , -Fibrousdelivery 5ysteIIs f’or anti Microb! at agents (fiber delivery system for antibacterial agents), Polyme r　5science　and　Technology, Vol.

32 (1985), pp. 47-59; Dunn, R., J., Gibson, B. , Perkins, J.

Goodson & L, Laufe, -Fibrous delivery systems forantis+1crobial agents” (antibacterial fiber delivery system for drugs).

Polymer Materfal 5science Engineering , Vol. 51 (1984).

pp, 28-31; 01anof'f, L. & J. Anderson, -Co. ntrolled release or tetracycline-III: A physfologjca! pharsacokinetic mode l orthe pregnant rat” (controlled release of tetracycline) 111 = Physiological pharmacokinetic model of pregnant rats), Journal of' Pharmacoktnetjcs and Biopharmaceuti cs, Vol. 8 (1980), pp. 599-820; E I kayai, RC.

M,Friedman,^,5tabholz,A,5oskolne,M,5 ela & L, Golub.

”5ustained release device contact+ng 5j nocycloneror 1 local treatment of’ periodontal (formerly 5ease) (minocycli for local treatment of periodontal diseases) controlled release device), Journal or Controlled Re 1ease, Vol. 7 (198g>, pp.

231-236; Goodson, J., Multicenter evaluation ation oftetracycline river therapy, 1 ．． Experimental Design” (tetracycline fiber therapy) Multicenter evaluation of law, 1. Experimental Design) Journal of Den tal Re5 search.

Vol, 8g (1989), p, L97: References cited therein C8 Injection shape The active ingredients of the invention are also useful when injected. Is it safe to show bone growth activity? The dosage of the active ingredients of this invention that will be effective will depend on the specific condition being treated, the severity of the condition, and the severity of the condition. , the duration of treatment, the specific mixture of compounds used and their concentrations, and the particulars of the attending physician. Any drug compound, depending on similar factors within special knowledge and expertise. varies commensurate with the reasonable benefit/risk ratio associated with the use of the product. In addition, less Used when only local or slight bone growth is desired even at low doses; On the other hand, higher doses may also be used when systemic or significant bone growth is desired. Ru.

Methods and materials for manufacturing injections are Remington'5 Pharaaceut jcal 5 sciences, 17ed, 1985. Chapter 85. p.

1518, the disclosures of which are incorporated herein by reference in their entirety. . Preferably, the injectable composition is an aqueous solution.

Aqueous solutions include water (preferably about 80% to about 99.999%), a suitable solubilizing agent, and various type of acid and an antimicrobial agent. Some solubilizers are known There is.

Examples of such solubilizers are: urea compounds (e.g. urea, urea, surfactants (e.g., Tween, Span, sodium deoxycholate); Pluronics); cellulosic agents (e.g. boxymethylcellulose): carbohydrates (e.g. sorbitol, mannitol) ; vitamin B (e.g. nicotinamide); xanthine derivatives; alcohol (e.g. For example, benzyl alcohol). Examples of acids that can be used include: acid, galacturonic acid, fumaric acid, quinticic acid, acetic acid, citric acid and lacturonic acid. Polyionic acid. Types of antimicrobial agents that can be used are: phenylmercuric nitrate, Merosal, pensetonilam chloride, benzalkonium chloride, phenol, creso alcohol and chlorobutanol.

Industry-known local anesthetics (e.g., benzyl alcohol novocaine, lidocaine) ) may also be included.

Preferably, the osteoinductive extract and BMP are administered in injectable form.

The following examples include two preferred embodiments (1) that fall within the scope of the present invention. do. The examples are presented singly for illustrative purposes and should be construed as limitations on the invention. Rather, its many variations are possible without departing from its spirit and scope1. be.

Kasayu 1. Injectable compositions containing osteoinductive extracts for bone fracture repair.

Oral compositions containing 25-dihydroxyvitamin D3 (using conventional mixing techniques) It is manufactured by mixing the following ingredients.

BM P composition BMP-1 0.04 1,25-dihydroxyvitamin D 30.01 Corn starch 18.49 Lactose 63. QO 0.1 cc of the BMP composition is injected into the fracture site at the time of fracture reduction and once daily thereafter. 1 , 100 μg of 25-dihydroxyvitamin D3 composition 24 hours before fracture reduction. Thereafter, the drug is administered orally once a day. BMP and 1,25-dihydroxyvitamin D is preferably administered over a period of 7 days until the desired repair is achieved.

belly Injectable compositions for fracture repair can be prepared by combining the following ingredients using conventional mixing techniques: Manufactured by.

Ingredients Weight% of composition BMP-20,04 25-Hydroxyvitamin D 20.01NaCI O, 09 Sterile water for injection q, s.

100.00 0.1 cc of the composition at the time of fracture reduction and then once daily until desired repair is achieved. Inject at the site of the fracture.

Example II+ Compositions for inducing bone growth after reshaping surgery utilize conventional mixing techniques. It is manufactured by mixing the following ingredients.

Ingredients Weight% of composition BMP-30,04 1,25-dihydroxyvitamin D 20.0LNaCl 0,90 Sterile water q, s. 100.00 Directly onto the bone surface 0.1 cC of the composition per C surface area of the surgically reshaped bone. Deposit.

Example IV Compositions to promote healing and form a stronger bond between natural bone and prosthesis is prepared by combining the following ingredients using conventional mixing techniques.

Broiled weight% of composition 24.25-dihydroxyvitamin D 30.0 + natural bone surface immediately adjacent to the prosthesis 0.1 cc of the composition per area C is deposited directly onto the natural bone.

Heeee Topical oral carrier compositions for periodontal therapy can be prepared using conventional mixing techniques to: Manufactured by mixing the ingredients.

100.00 0.1 composition per exposed tooth after the patient has been treated using conventional periodontal surgery. Deposit cc at the surgical site.

The soft tissue flap is then sutured to close the surgical site. This treatment was lost due to disease. Useful for repairing the alveolus and supporting bone in the periodontal tissue.

Example ■1 Injection composition containing BMP-2, 3, 4 and 5 and 1.25- for the treatment of osteoporosis Oral compositions containing dihydroxyvitamin D3 are prepared using conventional mixing techniques. Manufactured by mixing the following ingredients.

BMP-20,001 8MP-30,001 8MP-40,001 8MP-50,001 Nail O,900 Sterile water q, s.

100.000 1.25-dihydroxyvitamin D 30.01 Corn starch 18.49 Lactose 63.00 Talc 1g, 00 Stearic acid 0.50 100.00 Inject 1 cc of the BMP composition intravenously once a day. 1,25-dihydroxyvitamin 50 mg of D3 composition was given orally within 1 hour of osteoinductive extract injection and then once daily. give

Osteoinductive extract and 1,25-dihydroxyvitamin D3 administered over 7 days do.

Example Vl+ Compositions for inducing bone growth in pseudarthrosis fractures utilize conventional mixing techniques Manufactured by mixing the following ingredients. The term “pseudounion fracture” used here is correct. Always refers to a fracture that has not healed.

Ingredients Weight% of composition BMP-40,004 1,25-dihydroxyvitamin D 30.01 acid demineralized bone particles 90. 00O NaC1O,900 Sterile water for injection q, s.

Too, oo.

During fracture reduction, a sufficient amount of the above composition is deposited directly into the pseudarthrosis site, thereby reducing the bone defect. make up for losses.

array list (1) General information: (i) Applicant: 5TONE, ROGERL.

(1. Title of the invention: number of osteoinductive therapeutic formulation (fit) sequences (lv) Correspondence address: (A) Address: The, Brocter, End, Gamble, Company. (B) Street: L1810 East Miami River Road (C) City Herring Natty (D) State Niobio (E) Country: U, S, A.

(F)ZIP:45239-8707 (V>Computer readable form: (^) Media type: Floppy disk (B) Computer: IBN PC Compatible (C) Operation System: PC-DO8/MS-D6S (D) Software: Patent In Release si, o.

Version $1.25 (vj) Current application data: (A) Number of applications: (B) Date of application: (C) Classification: (viii) Agent information: (A) Name: Corstanje, BrahIIIJ.

(B) Registration number: 34,804 (ix) Telecommunications information: (A) Phone + 513-245-2858 (B) Fax: 513-741 -3012 (2) Information regarding SEQ ID NO: l: (1) Sequence characteristics: (A) Length: 2487 base pairs (B) Type: Nucleic acid (C) Chain nature: two (D) Topology: Straight chain (11) Molecule type: cDNA (xt) Array notation fi: SEQ ID NO:1:ACCGCCACCT nCCATCGn CG Ding QAGAACA TCCAGCCAGG GCAGG AGTAT MCTTCCTGA V80 AGATGGAGCCTCAG(,AGGTGGAGTCCCTGGGGG AGACCTA TGACTTCGACAGCATCATGb840 TGCAGTTTGA CTTCmQAG ACA (&AGGGCA ATGA TGTGTG CMGTAC(,ACTTCGTG[,AGf 1980 TGCGCAGTGG ACTCACAGCT GACTCCAAGCTGCA TGGCAA GTTCTGTGGT TCTGAGAAGb2Q4゜ AGTAAAQAG GGACCCCTCCGTCCTGC2487(2)S Information regarding EQ ID NO:2: (1) Sequence characteristics: (A) Length: 1547 base pairs (B) Type: Nucleic acid (C) Rust resistance: 2 pieces (D) Topology: Straight chain (11) Molecule type: cDNA (xl) Sequence description: SEQ ID NO: 2:GAGAAGGAGG AGG CAAAGAA AM; GAACGGA CATrCGGTCCTTGCGCC AGG TCCTTMACCQ40 AcAGTmTCCATGTCGACCi CTCmCAAT GGACGTG TCCCCGCGTGCTT CTrAGACGGA 30O ACTCTMGAT　TCCTAAGGCA　Tll;CTGTGTCCCCGA CAGAAC Ding CAGTGCTATCTC ATGCTGs 1440 ACCTTGACcAGAATGAAAAG GTTGTATTAA AGAA CTATCA GGACATGGTr GTGG^GGGTs I 5oO (2) Information regarding SEQ ID NO:3: (i) Sequence characteristics: (A) Length: 1774 base pairs (B) Type: Nucleic acid (C) Rust resistance: 2 pieces (D) Topology: Straight chain (11) Molecule type: cDNA (xl) Sequence notation g: SEQ ID NO: 3: GCMCACGGT TCG CAGCm CGGGCGCCAQ CAGCAGAAAACTCTrGAAAG A AMGGACTGT 66K ATATCTTCAA TCTGACATCG CTAACCAAGT CTG AAAACAT mGTcTGcc ACACTGTATr@720 C-cho GGCAAAGA ACTCAmGA ATGCnAA-cho T CAAT 1 774(2) Information regarding SEQ ID NO: 4: (i) Sequence characteristics: (A) Length: 1751 base pairs (B) Type: Nucleic acid (C) Chain nature: two (D) Topology: Straight chain (it)Molecular type: cDNA (xi) Sequence description: SEQ IDN0:4:CCCAGG+IACCAGTG AAAACT CTGCTrTrCG TrTCCTCTrr AACCTCA GCA GCATCCCTfA 840 QAACGAGGTG ATCTCCTCTG CAQAGCTTCG GCT CTTCCGG GAGCAGGTGG ACCAGGGGCbC900 cACTTTTTATTT 1751 (2) Information regarding SEQ ID NO: 5: (1) Sequence characteristics: (^) Length + 2153 base pairs (B) Type/nucleic acid (C) Chain nature: two (D) Topology/linear chain (II) Molecule type/cDNA (Xi) Sequence description: SEQ ID No.: CTGGTATATT TGTG CCTGCT GGAGGTGGAA TTAACAGTAA GAAGGAG AM GGGATTGAAs 60 GGACAGATAT ATATTCCMCACCMGGTGCAGATCAG CAT　AGATCTGTGA　TTCAGAAATC24O TGACCAATGA AGAAAATCCT GMGAGTCGG AGTA CTCAGT MGCGCATCCTTGGCAGMG 1O20 AGACCACAGG GGCAAGAAAG GGATACCAG CCT CTCCCAA　TGGCTATCCT　CGTCGCAT`C1080 TAAGGTTTAT GGCTGCAATA AAAAGCATACTTTTC AQACAA ACA (aAAAAAA AM 2153 (2) SEQ ID Information regarding NOXS: (1) Sequence characteristics: (A) Length: 2923 base pairs CB) Type: Nucleic acid (C) Chain nature: two (D) Topology: Straight chain (11) Molecule type: cDNA (xl) Sequence description: SEQ ID NO: B: nccTcMcG ACGCG GACAT GGTCATGAGCTTTGTGAACCTGGTGcAGTA CGACMGGAG 84O TrCTCCCCTCGTCAGCGACA CCACMAGAG TTCAA CTrCA＾CTTATCCCA GATTCCTQAG X00 GTCCACGTGCGCACCACCAG GTCAGCCTCCAGCCG GCCCCQACAACAGAG TCGTAATCGC'@1320 TTGTTAGTAA ATAGGQAAAA TMTCTCAAA GGAG TTAAAT GTATTCTTGG CTAJμGGATb2100 (2) Information regarding SEQ 10 NO Near: (1) Sequence characteristics: (A) Length: 1448 base pairs (B) Type: Nucleic acid (C) Chain nature: two (D) Topology: Straight chain (11) Molecule type: cDNA (xl) Sequence description: SEQ ID NO Near: GTGACCCAGCGGCG CGGACG　GCCGCCTGCCCCCTCTGCCA　CCTGGGGC GG TGCGGGCCCG@60 GCCTGTMGA AGCACcACCT GTATGTCAGCTTCCc AGACCTGGHCTGHCA GGACTGQ^TC1P40 ATCGC (IccTG MGGCTACGCCGCCCTACTGTQA GGGGG AGTGTGCCTTCCCTCTGAACP200 The invention has been described herein with respect to certain preferred embodiments and examples. obvious burr ation will be obvious to those skilled in the art. Therefore, the present invention is not directed to that. International search report below ―・DagmarFRANK international search report Continuation of front page (81) Designated countries EP (AT, BE, CH, DE.

DK, ES, FR, GB, GR, IT, LU, MC, NL, SE), 0A (BF , BJ, CF, CG, CI, CM, GA, GN, ML, MR, SN, TD, TG. ), AU, BB, BG, BR, CA, C3, FI, HU, JP.

KP, KR, LK, MG, MN, MW, No, PL, RO, RU , S.D.

Claims (16)

[Claims] 1. a. A safe and effective amount of a vitamin D compound: b. BMP-1, BMP-2, BMP -3, BMP-4, BMP-5, BMP-6 and BMP-7 a safe and effective amount of BMP; and c. a safe and effective amount of a pharmaceutically acceptable carrier; A composition for generating new bone growth in a mammal in need of treatment comprising: 2. The safe and effective amount of vitamin D compound is about 30 ng to about 10 μg, and if BMP is low, 2. The composition of claim 1, wherein the amount is about 2.5 μg. 3. Vitamin D compounds include vitamin D2, vitamin D3, and 1a-hydroxybicuminum. D3, 1a-fluorovitamin D3, 3-deoxy-1,25-dihydroxy Vitamin D3, 25-hydroxy-5,6-transvitamin D3, 25-hydro Roxyvitamin D2, 25-hydroxyvitamin D3, 1,25-dihydroxy Vitamin D2, 24,25-dihydroxyvitamin D2, 24,25-dihydro Selected from the group consisting of hydroxyvitamin D3 and 1,25-dihydroxyvitamin D3 3. The composition of claim 2. 4. Claim 3, wherein the vitamin D compound is 1,25-dihydroxyvitamin D3. The composition described in . 5. 5. The composition of claim 4, wherein the pharmaceutically acceptable carrier is an injectable carrier. thing. 6. 5. The pharmaceutically acceptable carrier of claim 4, wherein the pharmaceutically acceptable carrier is a topical oral carrier. Composition. 7. BMP is a component of the osteoinductive extract, and the osteoinductive extract includes BMP-1, BM From P-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7 Any one of claims 2 to 7, comprising one or more BMPs selected from the group consisting of Compositions as described. 8. Safe and effective amounts of vitamin D compounds such as BMP-1, BMP-2, BMP-3, B safety selected from the group consisting of MP-4, BMP-5, BMP-6 and BMP-7; A mammal in need of treatment comprising administering to the mammal a total effective amount of BMP in combination. A method for generating new bone growth in animals. 9. The safe and effective amount of vitamin D compound is about 1 ng to about 1 mg, and the safe and effective amount of BMP is about 1 ng to about 1 mg. 9. The method of claim 8, wherein the amount is about 1 pg to about 100 [mu]g. 10. The safe and effective amount of vitamin D compound is about 30 ng to about 10 μg, the safety of BMP 10. The method of claim 9, wherein the effective amount is at least about 2.5 μg. 11. Vitamin D compounds include vitamin D2, vitamin D3, and 1a-hydroxyvitamin. Mine D3, 1a-fluorovitamin D3, 3-deoxy-1,25-dihydroxy Civitamin D3, 25-hydroxy-5,6-transvitamin D3, 25-hydroxy Droxyvitamin D2, 25-hydroxyvitamin D3, 1,25-dihydroxy Civitamin D2, 24,25-dihydroxyvitamin D2, 24,25-dihydro Selected from the group consisting of Roxyvitamin D3 and 1,25-dihydroxyvitamin D3. 11. The method of claim 10. 12. Claim wherein the vitamin D compound is 1,25-dihydroxyvitamin D3. 11. The method described in 11. 13. 12. The person according to claim 11, wherein the vitamin D compound and BMP are administered by injection. Law. 14. 12. Administration of the vitamin D compound and BMP is topical or oral. the method of. 15. Claim 11, wherein the vitamin D compound is administered orally and the BMP is administered by injection. The method described in. 16. BMP is a component of the osteoinductive extract, and the osteoinductive extract contains BMP-1, B MP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7? Any one of claims 8 to 15, comprising one or more BMPs selected from the group consisting of The method described in section.