JPH06500460A - Primate hepatocyte cell line endowed with permanent division potential - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] 5. Derived from primary human or chimpanzee hepatocytes, the cells in the cell line contain hepatitis C virus. A cell according to claim 1, which is infected with Virus and characterized by the replication of this virus. system.

64 infected with hepatitis B or hepatitis A virus and characterized by the replication of this virus. A cell line according to claim 1.

7. Oncogenes include SV40 large or small T antigen, adenovirus EIA, 　rnyc.

A cell line according to claim 1, selected from ras, or a combination thereof.

8. The cell line is derived from Chinopantu or human primary hepatocytes, and the oncogene is SV40. 2. The cell line of claim 1, which is a large T antigen.

9. The cell line was derived from human primary hepatocytes, and the oncogene was EIA and myc oncogene. A cell line according to claim 1, which is a combination.

10. After infection of cells with a hepatotropic virus, the permanent dividing ability according to claim III is imparted. culturing the cultured primate hepatocyte cell line and collecting virus particles from the culture medium. A method for producing hepatotropic virus particles comprising:

The specific cell line is derived from human or chimpanzee liver cells, and the virus is Hepatitis C virus. (HCV), the method according to claim 10.

12. By exposing cells in culture to chinopant or human HCV-infected serum. 12. The method of claim 11, wherein the cells are infected with HCV.

13. The cell line is derived from Chinopantu or human primary hepatocytes, and the oncogene is SV4. 0 large T antigen, and the virus is hepatitis C virus. Method.

14. Culture in serum-free medium to grow cell lines without loss of liver-specific function. A method according to claim 10 for carrying out.

15. After the cell is infected with the hepatocyte virus, the permanent dividing ability as described in claim 1 is imparted. cultured primate hepatocyte cell lines, exposed the infected cells to the compound for a selected period of time, and then hepatocellular virus, which consists of assaying cells for inhibition of viral growth in A method of screening compounds for their ability to inhibit the growth of.

16. The assay detects the level of virus-specific nucleic acids present in cell culture. 16. The method of claim 15, comprising:

Summer 7. The cell line is derived from human or chimpanzee liver cells and the virus is Hepatitis C virus. 17. The method according to claim 16, wherein the method is HCV.

18. By exposing cells in culture to chinopant or human HCV-infected serum. 18. The method of claim 17, wherein the cells are infected with I(CV).

19. Culture medium capable of maintaining cells within a cell line in a substantially differentiated state culturing the claimed cell line in a culture medium and then isolating the protein from the culture medium. consisting of albumin, alpha-1-antitrypsin, complement C'4, fibril Nogen, apolipoprotein A-1 and E, transferrin, and plasmid A method for producing a hepatic secretory protein selected from the group consisting of nogens.

20. Claim 19, wherein the protein is fibrinogen or plasminogen. How to put it on.

Specification Primate hepatocyte cell line endowed with permanent dividing potential 1, Field of the invention The present invention relates to a primate hepatocyte cell line endowed with permanent dividing potential and with hepatotropic Using this cell line to culture the virus and produce hepatocyte secreted products Regarding.

2. Literature Bishop (Bi5hoP), J. M., Cell, 42: 23 (1985) .

Chomozynski et al., Anal, Biochem , 162: 159 (+987).

Eichberg, J. Med, Primatol, 1 4: 165-168 (1985).

Innis ([nn1s), M, A, etc., eds, PDRProtoc ols: Methods and Application Guide, Academic Press (1990).

FeLgner, P, L, et al, PNAS, 84:7413 (1987).

Jacob et al., in “Viral Hepatitis and Liver Disease” Proceedings of the International Conference on Liver Diseases (1991, newspaper).

Jacob et al. Hepatology 10: 921-927 (1989).

Jacob et al. J [nfect Dis, 161: 1121-1127 (19 90).

Laewli, U.K., Nature, 227: 680 (1970).

Miller, A, D, Biotechniques 7: 980 (1989).

Sambrook et al., eds, Molecular Cloning, A Lab oratory Manual.

Volumes 1, 2 and 3, 2nd edition Cold Spring Harbor Laboratory Newspaper, Colds Pulling Harbor, New York (1989).

Van de Woude, G.F., et al., eds, Cancer Cells 2: Oncogenes and viral genes, Cold Spring Harborsibodium, Co. Old Spring Harbor, New York, pp. 481-486.

Hepatocytes that are differentiated, capable of infection, and can be well maintained in culture are Human hepatotropic viruses, such as hepatitis A virus (HAV), hepatitis B virus (HVB), also now known as hepatitis E virus (HEV), is transmitted in the intestine. non-A, non-B hepatitis viruses, and also now known as hepatitis C virus (HCV). research and production of parenterally transmitted non-A, non-B hepatitis viruses. It's advantageous.

Such hepatocytes can be used to screen drugs for their effectiveness in suppressing virus growth. enable. Cells may be used for direct production of virus or isolated virus particles. used to obtain fully grown viral protein or peptide fragments from to provide a source of intact, active or attenuated virus particles with respect to You can do something like that.

Recently, the inventors have demonstrated that they allow long-term growth of primary primate hepatocytes in culture in a differentiated state. (Lanhord, 1989). cultured , primary hepatocytes contain several liver-specific secreted proteins, such as albumin, α- 1-antitrypsin, complement C'4, fibrinogen, apolipoprotein A t and E, transferrin, and/or plasminogen for 100 days or more. It is produced during the above culture period. These cells were infected by HCV and in culture It can assist in the replication of the virus. Intact, fully grown HCV virus The use of cultured cells to produce particles has been proposed in the companion PCT patent application “ "Purified Non-A, Non-B Hepatitis" has been reported.

However, one limitation of primary, cultured primate hepatocytes is that differentiated cells cannot be infected. It loses much of its liver-specific function within 3-4 weeks. Therefore new Primate hepatocytes are grown by preparing a cell culture medium and culturing hepatotropic viruses. , must be obtained continuously by infection with a virus. Other constraints on cells are liver Regulates against virus growth when cells are continuously replicated by new cells The problem is to maintain uniform cell properties.

4. Summary of the present invention One major objective of the present invention is to increase the production of hepatotropic viruses over an extended culture period. To provide a permanently dividing primate hepatocyte cell line capable of supporting growth. Is Rukoto.

The present invention, in one aspect, (a) Oncogenes integrated into the cell genome; (b) synthesis of normal hepatic secretory proteins; characterized by its ability to support secretion, and (C) human hepatotropic virus replication. Contains a primate hepatocyte cell line endowed with permanent division potential. In particular, cells Some, i.e. at least three, of the following hepatic secretory products, albumin, alpha-1 -Antotrypsin, complement C4, fibrinogen, apoliboprotein A- 1 and E, transferrin, and plasminogen by stable secretion in culture. It can be characterized as.

In one specific example, the cell line is derived from chinopanzo or human hepatocytes; Infect with hepatitis C virus and assist in the replication of hepatitis C virus. one preferred Oncogenes in chinopantozoan and marlin hepatocyte cell lines endowed with the ability to permanently divide , SV40 large T antigen.

In another specific example, the cell line is derived from human hepatocytes and the oncogene is derived from an adenovirus. A combination of EIA and cellular myc oncogene.

The invention also encompasses methods of producing hepatotropic virus particles. infected with a virus A primate hepatocyte cell line endowed with permanent dividing capacity that preserves the liver-specific functions of the cells. The virus particles produced by the cells are collected from the culture medium under the following conditions. do.

In one preferred embodiment, the cell line is derived from human or chimpanzee hepatocytes; rus is hepatitis C virus (I (CV)).

We also screen compounds for their ability to inhibit the growth of hepatotropic viruses. A method is disclosed. Primates endowed with the above-mentioned permanent division ability by this method The hepatocyte cell line is cultured under conditions that preserve the liver-specific function of the cells. Will the cells After exposure to the test compound, the cultured cells are exposed to the test compound for a selected period of time. The cells are tested for the amount of virus present, generally by assaying for the presence of viral nucleic acid. Ru.

In yet another embodiment, the present invention provides a method for treating hepatic secretory proteins, such as albumin, alpha-1 -Antitrypsin, complement C4, fibrinogen, apoliboprotein A- 1 and E, transferrin, and plasminogen were added to the above permanent cells in culture. It includes a method for isolating and producing a desired protein from cells that have been endowed with this ability.

These and other objects and features of the invention will become apparent from the following detailed description of the invention, which is included in the accompanying drawings. It will become clearer more quickly if you read it together with the drawing.

Brief description of the drawing Figure IA-ID: (IA) Closed cells showing minimal cytoplasm; (IB) Cytoplasmic Spindle-like cells with dilatation, (Ic) flat showing granular and enlarged cytoplasmic areas. Squared cells and (ID) Cuboids showing normal primary hepatocytes with similar morphology in culture. A permanently dividing chimney with a dominant morphology characterized by somatic cells. This is a phase-contrast light micrograph of H. panzee hepatocytes (CHMP); Figure 2A-2Dlt, (2A) U19 retrorow expressing SV40 large T antigen (2B) A plasmid encoding both the SV40 large and small T antigens. (ID, QC) plasmid containing both myc and ras oncogenes, and (ID ) A plasmid containing EIA and myc oncogene confers permanent dividing ability. It will be done. A phase-contrast light micrograph of human liver cells endowed with the ability to permanently divide: Figure 3 shows the electrical energy of total proteins secreted by the CHMP cell line shown at the top of the figure. The electrophoresis pattern is shown, and the number on the left in the figure is the molecular weight (kilogram) of the known probe protein. (in Luton): Figures 4A and 4B show normal chimpanzee hepatocytes (4A) and CIMP1, 20 cells ( 4B) is the gel electrophoresis pattern of the protein secreted by Proteins secreted using antibodies that specifically oppose the proteins indicated by the upper dots in the figure. Prepared by whole volume immunoprecipitation and followed by electrophoresis of precipitated proteins Figure 5 shows a gel of proteins secreted by human hepatocytes endowed with permanent division potential. The electrophoretic pattern is shown and is specific to the protein shown at the top of the figure. Prepared by immunoprecipitation of total secreted protein using a counterantibody and precipitated tracked by protein electrophoresis; Figure 6 shows HCV-infected chimpanzees ( lanes 1-8), and chimpanzee RNA during the acute stage of HCV infection (lanes The chinopan-hepatocyte cell line (C Electrophoresis of PCR (polymerase chain reaction) products of cellular RNA from O cell line) Show a pattern.

Figure 7 shows the results from various CHMP cell lines infected in vitro with HCV (lanes 1- 12 and 14), from the inoculum used to infect cells (lane 13), from Tinopan-liver RNA during the acute stage of HCV infection (lanes 15 and 18, and Electrophoretic patterns of PCR products of RNA from and HCV cloned fragments and FIG. 8 shows the results from control hepatocytes (lanes 6 and 7). from HAV inoculum (lanes 10 and 11), and PCR positive control. (derived from lanes 12 and 13)) tAV-infected permanently dividing cells Electrophoretic patterns of RNA PCR products from a given cell are shown.

Detailed description of the invention ■, permanent division operation In this column, we produce a permanently dividing primate hepatocyte cell line with the following characteristics: Showing how to cheat: (a) Oncogenes integrated into the cell genome: (b) several (at least 3) liver-specific hepatocyte secreted proteins, such as albumin, alpha-1-antitrypsin complement C4, fibrinogen, apoliboprotein A-1 and E, trans Secretion of spherin and plasminogen in culture: and (C) Human hepatotropic viruses, such as hepatitis A virus (HAV), hepatitis B virus virus (HVB), hepatitis E virus (HEV), and hepatitis C virus (HC V) Ability to assist in the reproduction of.

A, cultured primary hepatocytes Deriving or obtaining cell lines endowed with the ability to permanently divide from primary primate hepatocytes. Ru. These hepatocytes have liver-specific functions, especially live liver cells for a culture period of 100 days or more. Cultured under conditions that maintain the ability to produce and secrete specific proteins. for culture A method for preparing primary primate hepatocytes and preserving liver-specific functions for an extended period of time in culture. The culture medium conditions effective for maintaining the , 1989). Easily humans, chimpanzees, humans, marmorated monkeys or other primates. The liver tissues obtained by liver biopsy were washed with cancer cells, and the liver cells were treated with collagen. Remove by treating with water. Wash the cells several times, then approximately 5 ml per 60 ma+ plate. Plate on culture plates at a density of X10' cells.

Hepatocytes are kept in serum-free medium (SFM), which is in a hepatic-differentiated form; It is specifically made to allow cells to grow in culture, and this is a liver-specific Evidenced by continuous production and secretion of heteromeric proteins in culture. certain favorable The culture medium was 10mM HEPES, pH 7,4, 50μg gentamicin, and the following subelements: BGF (epidermal growth factor), insulin, glucagon, BSA (bovine serum albumin), soybean lipid, riluic acid, hydrocortiscin , selenium, cholera toxin, LGF (hepatogenic factor, glycyl-histidyl- lysine tripeptide’), ECGS (endothelial cell growth subplement), trans Ferrin, ethanolamine, prolactin, somatotropin, and TRF (thi Williams medium E supplemented with lotropin (free factor) in the proportions indicated in Example 1. (W!1lE). The sources of these materials are listed elsewhere (Lanho ).

Cells are kept in SFM under standard cell culture conditions. The medium may be added during the culture period, e.g. Changes 24 hours after isolation and every 48 hours thereafter. For example, chino pants are derived from the liver. For some primate hepatocytes that have been 2-4 rounds of replication appear to take place within 7-10 days, and then in culture. They continue to function as liver-specific cells without significant signs of cell replication. Ta For example, in other primate hepatocytes derived from human and monkey liver, primary cells also 2-4 rounds of replication occur in culture, but continued cell replication after that occurs in the original culture. These foci are recognized from the foci in the culture plate, and these foci are The cells undergo replication until they grow in a monolayer on the substrate. These cells in monolayer are still differentiated liver cells, which are produced by continued production and secretion of liver-specific proteins. It is proven that This distinction between different types of cultured primary primate hepatocytes is will be affected. This is because the plan to select cells endowed with the ability to permanently divide is This is because it changes according to the replication behavior of cells during the stage.

Various methods allow cultured primary cells to produce and synthesize liver-specific secreted proteins. It can be used to check the Sodium dodecyl sulfate polyacrylic Analysis of total culture medium and liver-specific by amide gel electrophoresis (SDS PAGE) Two of these methods involve immunoprecipitation using antibodies directed against the present protein. Detection of liver-specific products produced by hepatocytes endowed with permanent division potential as described in Example 3. Generally, primary cells contain serum albumin, α- 1-antitrypsin, complement C'4 apolipoprotein E and A-1, fibril Nogen, plasminogen, transferrin, at least of these proteins Produced in combinations including the three.

B. Permanent cell division The primary cells mentioned above have normal cell-replication control mechanisms of primary cells in culture. Permanent division potential is achieved by integrating effective oncogenes into the cell genome. is given. The sources of various oncogenes and their ability to lift normal cell replication restrictions. The mechanism is described (Bishop). Generally, oncogenes in mammals isolated from viruses that pick up oncogenes from the host genome; Normal cell production - Activated, effective to overcome the inhibition mechanism present in naturally mutated oncogenes that produce unregulated gene products. do. Table 1 below lists some oncogenes that have been described in the literature to date. Ru.

Table 1 Abbreviation virus fps Fujinami (St, Ferrin) Sarcoma Virus Fujinami ( St, Fe1ine) Sarcoma abbreviation virus Abbreviation virus The oncogene is recombinantly placed into a plasmid that can infect suitable host cells. can be placed. Instead, the oncogene can be transferred to a suitable viral vector, e.g. Cancer genes are present in retroviral (mirror) vectors that can infect host cells. Can be combined with constitutive production of gene products. Carry oncogenes and suckle during culture A variety of plasmid and viral constructs that can be introduced into mammalian cells have been reported. are held in public depositories, such as the American Type Culture Collection. (Rocklawn, MD) or as described in the literature. can be obtained by using recombinant plasmid technology to form Ru. In Example 1 on Permanent Division of Chimpanzee Primary Hepatocytes, and in Macaque Monkey Hepatocytes The SV40 origin of DNA replication in the manner detailed in Example 6 for permanent division of An oncogene for the SV40 large T antigen that lacks binding to is used for permanent division. do. The oncogene was introduced via the 019 retrovirus, and the genome of the virus was Designed for constitutive expression of T antigen. A suitable host for retroviruses, For example, the [19-5 cell line described in Example 1] was grown in culture medium and harvested from it. Can be bacterium.

In the method detailed in Example 5 for immortalization of baboon hepatocytes, four different oncogenes were Alternatively, oncogene combinations are tested for their ability to permanently divide primary cells.

In the first method, cells containing an oncogene directed against the SV40 large T antigen are isolated as described above. infected with U19 retrovirus. In the second to fourth methods, the cells are ras , myc, or various plasmid constructs containing either the EIA oncogene. Expose. The second method uses both large and small SV40 T antigen oncogenes, and The psV3neo plasmid contains the neomycin resistance gene. third party The method uses the plasmid psUc-myc-1 containing the myc oncogene and the ras oncogene. Contains a combination with the plasmid p[IJ　EJ　6.6 containing the gene. Fourth method The plasmid PIAneo containing the EIA oncogene and the above plasmid psVc- Including combination with myc-1. The last method is highly advanced as shown in Example 5. Produce cells with differentiated morphology. On the other hand, the first three methods require further transformation. cells that appear to be more differentiated and less differentiated.

Oncogenes are introduced into primary cells using a variety of vectors. Oncogenes are infectious When contained in a virus vector, such as the 019 retrovirus described above, oncogenetic The offspring are infected with the virus, typically by exposing the cells to the virus for several hours and then inoculating the cells with the virus. The cells are washed to remove free virus. Oncogenes are plasmids If the plasmid is delivered on a host, standard methods for introducing the plasmid into mammalian cells are used.

These include electroporation, and and plasmid uptake in the presence of CaCl2 or ribocollection (ferb Nah). The latter method is preferred. This is because a plasmid with considerable efficiency This is because it allows for introduction and small cell division. Chinopantu and marcus hepatocytes Details of retroviral infection with respect to permanent division are described in Examples 2 and 6, respectively. Ru. Permanent division of baboon hepatocytes with plasmids in the presence of ribocollection in Example 5 Describe it in

In order to introduce oncogenes, hepatocytes are incubated with the oncogene vector several times after introduction of the oncogene vector. At the subconfluent level, which enables the replication of do. The cells are exposed to the oncogene vector, usually for several hours, and then the cells are washed. Free vector is removed and then cultured in SFM. As mentioned above, primate cells 2-4 rounds of replication are performed for the first 7-10 days under the culture conditions described above. this period During the course, the culture medium is changed every 1-3 days.

At the end of the first replication phase, e.g. after 7-10 days of culture, the culture becomes permanently mitotic. Consists of both fed and non fed hepatocytes. In this respect, permanent division potential is conferred. It is necessary to expose the cells to selective pressures that allow selective proliferation of the cells obtained.

To this end, oncogene vectors can contain selectable markers, e.g. antibiotic resistance genes. This gene allows for growth selection in the presence of antibiotics. first 2-4 rounds In the case of chimpanzee liver cells, which tend to stop replicating at the end of their replication, There is no need to rely on biological selection. This is because cells endowed with the ability to permanently divide are This is because the residual, non-replicating primary cells take over. At this time, the cells are permanently Colony byproducts, represented by colonies of cells endowed with the ability to divide, are observed. Expand by culturing for 3-5 weeks until the cells are fully grown. Alternatively, antibiotics can be used at the beginning of replication. added after the step to ensure complete removal of non-immortalized cells from the culture medium.

Primates, such as humans or monkeys, exhibiting continuous growth of primary cells from the focus For hepatocytes, after the first round of replication cells were incubated in the absence of antibiotics for 7-10 days. the first 2-4 rounds of growth or reproduction (or with low levels of antibiotics) Let it grow until it forms. At this point, the cells are then rendered permanently mitotic. to selectively kill primary cells (which contain antibiotic resistance genes) that are not Exposure to antibiotics in sufficient concentrations. Then further cells were observed for colony by-products. Incubate in the presence of antibiotics until Antibiotic resistance genes in cancer gene vectors To prevent premature killing of cells and from dry cells before offspring expression occurs. replication to reduce toxicity to cells during culture by released cell products. Do not expose to antibiotics during the first round.

After obtaining a colony byproduct of cells that are permanently endowed with the ability to divide, the cells are e.g. Split again by collagenase/dispase treatment. The cells are then placed in a suitable vacuum. An attachment medium, for example WME (Williams medium) supplemented with 5% embryonic medium E) and reapply at low density. After 3 hours, the culture medium was changed to SFM and isolated. should allow single colony byproducts. given the ability to permanently divide which then occurs Colonies were identified as having (a) their liver-specific proteins as evidenced by the production of liver-specific proteins; identify cell lines that retain cell differentiation and (b) are infected with hepatotropic viruses. Characterize in order to These characterization methods are discussed in Section ■.

■Characterization of cells endowed with the ability to permanently divide A. Morphology Immortalized cells develop several distinguishable forms, which are derived from liver cells. depending on the primate species used and the oncogene used in the permanent division method.

Figures I A-I D show permanent virus produced by 019 retrovirus permanent division. Four distinct forms found in chimpanzee hepatocytes endowed with the ability to divide show.

Figure IA cells are tightly packed cells representing the smallest cells. has this normal form The cell lines include CHMP5.13, CHMP1, 05, CHMP2. Ol, CH Represented by selected cell lines showing MP 2.06, and 3.12. figure IB cells are spindle-like cells with cytoplasmic extensions. Fine particles with this form The cells are represented by a cell line exhibiting CHIJP5.01.

Figure 1C cells are flattened cells showing granular and enlarged cytoplasmic areas. Ru. Representative cell lines include one indicated CH11P5.03. 4th cell type The cell type has cuboidal cells, which are expressed by the cell line CHMP5.04. As shown, they are morphologically similar to normal primary cultured hepatocytes.

The changes in vine cell morphology produced by the different target genes are shown in Figures 2A-2D. Depicted by the four morphological types shown. Those diagrams are retroviruses (2 A), or humans rendered permanently dividing with one or several oncogene-containing plasmids. A photomicrograph of hepatocytes is shown. In particular, hepatocytes are (2A) SV40 019 retrovirus expressing large T antigen, (2B) SV40 large and small A plasmid encoding both the Mole T antigen (IC) myc and ras oncogenes Plasmid containing both (ID) EIA and myc oncogene Permanent division is conferred by a plasmid that

As can be seen, the T cell lineage (Fig. 2D) has a highly differentiated morphology, whereas other cells The system results in more transformation and less differentiation.

B1 secreted protein According to an important aspect of the invention, immortalized primate hepatocyte cells undergo hepatocyte differentiation. It contains several, i.e., at least three liver-specific secreted proteins. , such as albumin, α-1-antitrypsin, complement C'4, fibrinoid Gen, apoliboprotein A-1 and E,) transferrin, and plasmino -gen, but even smaller liver-specific proteins, such as C-reactive protein, apoptotic protein. Also produces riboprotein a-II, including apoliboprotein C2 and C3. Proven by cellular capacity.

Preferably, the secreted protein is produced at a rate approximately relative to its concentration in serum.

That is, large hepatic secreted proteins in plasma, such as albumin, Chitrypsin and transferrin are produced by cells endowed with the ability to permanently divide. These are large secreted proteins produced, and small proteins in plasma are produced during cell culture. It is a minute protein produced.

The presence of liver-specific secreted proteins in the cell culture medium is confirmed by various methods. be able to. Close cell morphology (CHMP5.1 3, CHMPl, 05, CHMP2.01, CHMP2.06, and CHMP 3.11), flat cell morphology (CHMP5.13), and cuboidal cell morphology ( C)t! Hepatocyte cultures exhibiting 1lP5.04) were cultured with [0 comethionine and Radiolabeled proteins from the culture medium are fractionated by 5PS-PAGE. Figure 3 shows the number Figure 3 shows autoradiography of culture-medium proteins from different CHMP cell lines. child The large proteins detected by the analysis were albumin (67Kd) and alpha Develops a molecular size corresponding to 1-antitrypsin (54Kd). rhinoceros The marker (molecular weight expressed in kilodaltons) is phosphorylase B (93K d), serum albumin (67Kd), ovalbumin (43Kd), carbonyl Cumanbitrase (30Kd), trypsin inhibitor (20Kd), and lysoti (14Kd). Details of the method are given in Example 3.

Secreted proteins in the culture medium are deposited, for example, by the immunoprecipitation method detailed in Section 3. can be identified in a polar manner. In this case, a culture medium containing radiolabeled proteins and , in many different primates, such as humans, React with antibodies endowed with long-lasting ability. The immunospecifically bound protein is then is released from the antibody and then analyzed by 5DS-PAGE as detailed in Example 3. Fractionate. Identification of immunoprecipitated proteins is shown at the top in Figures 4A and 4B. first time The appearance of secreted proteins obtained from hepatocytes (Fig. 4A) is similar to that of CHMP1 and 20 cell lines. Very similar to the protein observed (Fig. 4B), the permanent postmitotic liver-specific function, In other words, it shows a highly differentiated state.

A similar immunoprecipitation method was used to identify secreted proteins expressed in several CHMP cell lines. Use to decide. The results are summarized in Table 2. “+” in the table indicates , normal expression, meaning expression comparable to that observed in primary culture: “ This “indication indicates low expression: “-”indication indicates no expression: and “NT” indicates not tested. vinegar.

Some of the systems, as exemplified by CHMPl, 20, Expresses most of the protein. Apoliboprotein A-1 and The expression levels of B2-microglobulin and prealbumin are the same as those of B2-microglobulin and prealbumin. is elevated, but similar to the levels observed during primary cultures.

Complement C'4 is detected in all cell lines; however, the related chain alpha or gamma 1 or 2 is not detected by precipitation with the respective antibodies. C - No reactive proteins are detected in all cell lines. CHMP5.01 is although it still expresses several other plasma proteins, including apoE, albumin Lacks expression. One cell line that clearly lacks differentiated hepatocyte function is CH MP2.03, which is the only α-1 antitrypsin in the liver-specific protein. It produces.

Possible cellular accumulation of plasma proteins that occurs based on the transformation status of the culture in question There is no attempt to find out. No resemblance to the determined human hepatocellular carcinoma cell line has been investigated to date. No alpha-fetoprotein was detected in all primate hepatocyte cell lines tested. .

Similar protein-identification studies were performed in permanently mitotic humans as described in Example 6. It is carried out using human cells. Figure 5. After fractionation by SDS in lane A. , indicates the total secreted protein present in the culture medium. Migration on gel The identification of several hepatic secreted proteins based on the distance between the two is shown on the left of lane 1. radiation Immunoprecipitation of sex-labeled cultured proteins and subsequent separation by 5DS-PAGE The image shows apoliboprotein E and A-1, pre-albumin, and platinum as seen. Sminogen, complement C'4, transferrin, alpha-1 antitrypsin, and The relative amounts of various proteins, including albumin, are shown.

C9 oncogene expression A similar immunization technique that detects oncogene products in the culture medium permanently activates cells. It is assayed for oncogene expression by a precipitation method. For example, chin, Large T antigen product of the 019 oncogene used to render liver cells permanently dividing to the CHMPs endowed with permanent division potential reported in Table 2 as shown on the right side of the table. Cells are individually identified by immunoprecipitation of T antigen.

Table 2 Primates 1.20 1.33 2.02 2.03 2.05 3.01 4. 03 4.07 5.01 Albumin ++++-+++++- α1α trypsin + ＋＋＋＋＋＋＋＋Apo A-1＋＋＋＊ − Book −++ − AboE +++++-**10++ β, - Micro + + + + + + + + + C'4 + + + * + + + + +CRR+ −−−−−−−−− Fibrinogen + +++-+-++-Plasminogen +--*--- −−*Prealbumin + +10*−−−+**Transferrin + + + 　−　＊＋＋＋＋Immunoprecipitation of liver-specific plasma proteins +=normal expression *=low expression m = no expression N, T, = not tested Some of the systems investigated, such as those exemplified by CHIIPl, 20, Expresses most of the protein. Expression of apoliboprotein A-1 and E in many cell lines. The current level is due to increased β,-microglobulin and prealbumin expression levels. expression levels similar to those observed in primary cultures.

Complement C4 is detected in all cell lines, but not in the associated M (alpha or cancer). M) 1 or 2 species are not detected by precipitation with the respective antibodies. C-reactivity Protein is not detected in all cell lines. C) IMP5.01 has ApoE still expresses several other plasma proteins, including, but lacks albumin expression . One cell line that clearly lacks differentiated hepatocyte function is CHMP2.03. , which produces only α-1 antitrypsin in liver-specific proteins.

Possible cellular accumulation of plasma proteins that occurs based on the transformation status of the culture in question There is no attempt to find out. No resemblance to the determined human hepatocellular carcinoma cell line has been investigated to date. No α-fetoprotein is detected in all primate hepatocyte cell lines tested.

Alternatively, the presence of oncogenes in cells endowed with the ability to permanently divide may be due to cellular genetic extinction. can be directly determined by PCR amplification of oncogene sequences in the compound.

D. Infectivity caused by hepatocyte virus. Another important property of the permanently dividing primate hepatocytes of the present invention is their affinity for human liver. It is the ability to support the replication of sexual viruses. This allows the cell line to contain active hepatitis viruses. The virus is then infected with a mature virus, preferably in culture medium. production of particles indicating that they can be replicated in the culture medium.

One hepatitis virus of particular interest because of its importance as a blood-fatogen is The ability of CHMPm cells to assist in HCV infection is demonstrated from the studies reported in Example 4. be done.

At this time, CHMP cells (prepared using the permanent dividing ability of uninfected chimpanzee hepatocytes) ) and CU cells (similarly prepared from HCV-infected chimpanzee hepatocytes) chimpanzees known to contain HCV, as detailed in Example 4. Culture both in G-plasma. At 11 days post-infection, culture fluid was harvested for analysis. do.

To confirm the presence of HCV in infected cells, total RNA from the cells was analyzed by PCR method. Then, amplify using a probe having a known HCV sequence. Details are given in Example 4. do.

Figure 6 shows gel analysis of PCR products from HCV-infected CU cell lines.

Lanes 1-8 are CU1. CU3. CD4. CU5. CD6. C. U8. There are CU9 and CuI2. Lane 9i;! , during the acute phase of HCVC infection. Chinopan-Cari 98 is a positive control for liver RNA, and the CURNA sample It is treated the same as a file. Lanes 10 and 11 are CDNA and PCR negative Controls demonstrate the absence of contamination during the PCR assay. Lane 12 is the size This is lambda DNA cut with Hindu as a marker. lane 5 (C[J6) and 9 (PCR positive control, showing positive reaction. All The lane has a low band, indicating the primate used in the PCR reaction.

Figure 7 shows gel analysis of PCR products from HCV-infected CHMP cell lines. Re 1-12 Ha, Husband #C)tMPl, 21.1.22.1.23.1.24.1 ．． 25.1.26.1.27.1.28.1.29.1.30゜1.31 and 1 ．． 32 is shown. Lane 13 was used to infect both CU and CHMP cell lines. PCR analysis of the inoculum. Lane 14 is CHMP2.02゜Lane 1 5.18 and 19 are PCR positive controls. Lanes 15 and I8 are shown in Fig. Xl98 liver RNA as described in 6. Lanes 16 and 17 are respectively CDNA and PCR negative control.

Lane 19 shows the HCV cognate for the PCR primers used in this assay. PCR positive sequence consisting of gel-purified bands from cloned fragments Troll. Lane 20 contains I (indI [[digested Iamba DNA.

Positive reactions are used to infect CHMP1, 27 and 2.02 cell lines. The inoculum and positive control were obtained using each of the following. be negatively controlled A negative result indicates that no contamination occurred during the PCR reaction.

Of the 20 CU and CHMP cell lines thus tested, three were susceptible to HCV. Indicates permission to print and copy. The cell line was CHMP1, 27. CI (MP2 ．． 02 and CD6. This cell line meets two criteria for cells of the present invention. selected for: (a) secretion of liver-specific proteins; and (b) hepatitis virus infection. ability to assist.

These results demonstrate that the permanently-competent cell lines of the present invention are infected with HCV and that HCV Production of HCV for use in diagnostics and vaccines to support the replication of V. used in infected patients and to test inhibition-like antiviral compounds of HCV replication. The use of cell lines is indicated.

Infection of permanently competent primate hepatocytes by HAV was reported in Case 7. Shown in research. Example 7 shows HAY infection in chimese monkey hepatocytes endowed with the ability to permanently divide. and growth. After culturing cells with HAV inoculum, total cellular RNA was extracted from HAV- Analyze by PCR using probes with specific sequences. Figure 8 shows H.C.V. - Shows gel analysis of PCR products from infected CJSI cell lines. Lane l is PCR negative control; lanes 2-5 are uninfected CJSI cells; lanes 2-5 are uninfected CJSI cells; Areas 6 and 7 are HAV-infected CJS with nucleic acid 5 examined by PCR. I cell line; lanes 8 and 9 are used for CJSI infection in lanes 4 and 5. HAV negative inoculum: lanes IO and 11 are inocula for lanes 6 and 7. lane 12 is a weak PCR positive control; Link 13 has strong PCR positive control. Positive control is positive, negative control control is negative, uninoculated cells are negative, inoculated cells are positive, and the The inoculum is positive. As can be seen, one cell line, CJSI, to HAV Therefore, it becomes infected.

Permanently-enabled hepatocytes of the present invention can be used with other hepatocytes for viral replication in the cells. infectious viruses, such as HBV, and enteric non-A and non-B hepatitis. can be infected by a virus. The above method does not allow hepatitis virus replication during culture. A relatively small number of permanently mitotically activated primate hepatocytes can assist in producing occurs at a frequency that allows its selection from among the possible cell lines.

■、Usefulness A. Virus particle production As mentioned above, the cells endowed with the ability to permanently divide according to the present invention are infected with human hepatotropic virus, For example, it can be infected with a hepatitis virus and aid in the replication of that virus. therefore Cells can be used to produce such viruses in culture. For example, forever HCV virus was isolated using chinopant or human hepatocytes endowed with long-term division potential. particles can be produced. using various primate hepatocytes, including marmorated hepatocytes. can be used to produce HAV particles.

In a general way, a permanently dividing cell that can support the replication of hepatotropic viruses. A given hepatocyte cell line can be infected with virus R in infected cells as described above, for example. Selected by NA detection. Infect cell lines with viruses and generally as described above. culturing cells with plasma from humans infected with the virus in question. infect by. Cellular virus infection was performed using virus-specific virus infection as described in Example 3. PCR methods for detecting sexual RNA, or the culture medium itself is primary or permanently dividing. This can be confirmed by showing that hepatocytes that have been given the ability to become infected are susceptible to infection. Wear.

Virus particles in the culture medium can be isolated by a variety of methods used. Wear. Companion PC regarding “purified non-8, non-B hepatitis virus” In one method, detailed in the T application, culture media harvested from infected cells are The soil was first clarified by low-speed centrifugation (30 min, 12,000 x g). , then overlaying the clear material with discontinuous 20 and 68 sucrose layers; 3. Centrifuge at high speed (131,000xg) for 8 hours. At the 20/60 interface The material was collected, diluted in buffer, and then washed for 68 cycles at 16:00 M at 154,000 x g. Centrifuge for I seconds through the g sugar cushion. The material at the interface is determined by PCR method and electron Contains the desired HCV particles as shown by microscopic analysis. similar centrifuge The separation method is suitable for obtaining other hepatitis virus particles in purified or ex-vessel form. use

Optionally, viral particles can be treated with permanently dividing anti-viral antibodies, such as A monoclonal antibody prepared against virus particles is deposited onto a solid support. Culture supernatant by affinity chromatography method used to capture isolated from.

The isolated virus particles can be used in a vaccine with reduced pathogenicity and inactivated form. It can be used in diagnostic compositions or as diagnostic agents. or virus particles for use in vaccine compositions or as diagnostic agents. Can be sub-fractionated into white.

B. Drug screening According to the present invention, selected hepatotropic viruses are rendered permanently dividing. to identify drug compounds that are effective in inhibiting virus growth in hepatocytes. used in drug screening methods to In this way, infected cells can be cultured. exposed to the test compound, typically over a selected drug concentration range. Inhibition time generally 6-48 hours. The cells or viruses obtained from the cells are then The particles are examined for virus levels.

Permanent mitotic potential provides a general method for characterizing virus levels in infected cells. The detection of HCV infection in isolated chimpanzee hepatocytes is described in Example 3. child , total RNA is stranded with a standard polymerase using known virus-specific sequences. isolated from infected cells for amplification by reaction (PCR) method. RNA level can be qualitatively determined, for example, by dot-blot-hybridization. It is possible (sampletsuk).

Virus levels are determined qualitatively by measuring levels of virus-specific cell-surface antigens. do. U.S. Patent No. 4. m, 245, HCV-infected hepatocytes Among them, IgM monoclonal antibodies that specifically oppose cell surface antigens have been described. It is. The level of antibody binding to cells can be determined, e.g., by specifically targeting the first binding antibody. Can be characterized by a standard enzyme immunoassay using an anti-enzyme-labeled antibody. I can do it.

In vivo testing is based on measured inhibition of virus growth in infected and treated cells. It is possible to identify compounds that are likely to be similar candidates.

C1 secretory protein production One of the important features of the permanently mitotic cell lines of the present invention is that they contain liver-specific secretory proteins. white, such as albumin, α-1-antitrypsin, complement C°4, fibrino apoliboprotein A-1 and E,) transferrin, and plasmino This is the ability to contain As mentioned above, different permanently mitotically enabled cells Some variations in the types and levels of various serum proteins synthesized by the cell system There is a change. This is a highly specific protein-synthetic specific cell that is permanently mitotically activated. cells can be identified for use in the production of selected serum proteins. Ru.

Cells that have been endowed with permanent division potential are placed in a suitable growth medium, e.g. The cells are grown on the above-mentioned SFM medium. Selected secreted proteins are added to the culture medium. It is obtained from the ground and isolated from the culture medium by standard protein self-isolation techniques.

The following example describes a specific method for producing permanently mitotically endowed primate hepatocytes, and details. A specific method for characterizing cell morphology, cell products and viral infectivity is shown.

The examples serve as a detailed illustration of the invention and are not limiting.

A, Cultured primary chimpanzee hepatocytes were housed in a primate facility. 5 year old chimpanzee (Pan froglodytes Animals obtained from Tx266) were previously infected with hepatitis A virus, hepatitis B virus, and ruta hepatitis virus, non-A, non-B hepatitis virus, or human immunodeficiency virus. Not exposed. Liver wedge biopsy described by Eichberg Do it as you like. Hepatocytes were cultured in liver cells as described in (Lanhord, 1989). Isolate by standard tumor flow and collagenase treatment.

In this example and other examples below, the serum-free medium (SFM) composition is listed below. 10d HEPES, pH 7,4,2,75mg/a+, with supplements such as Basal medium supplemented with l NaHCOs and 50°C g/n+l gentamicin. Use the ground. Among the media listed in Table 3, Williams medium E (WME) is Serves as a basal medium. WME is currently the preferred basal medium for serum-free media. However, other commercially available media compositions can be expected to yield satisfactory results. Ru. For example, Dulbecco's modified Eager medium and Ham Fl! Medium (Saras) Table 3. It produces satisfactory results when supplemented with the supplements listed therein.

EGF 100 ng/ml Insulin 10μg/ml Glucagon 4μg/ml BSA 0.5 1G/ml Linoleic acid 5 μg/ML Hydrocortiscine 10-’M Selenium 10-@M Cholera toxin 2 ng/ml LGF 20 ng/ml Transferrin 5 μg/ml Ethanolamine 10-@M Prolactin 100 ng/ml Softtropin μg/ml TRF 10-@M To prepare the medium, add the supplements to WBJE 500 in a sterile plastic bottle. m1 in the following amounts as shown in Table 3: 5ml 50mg/ml BSA (serum albumin), 500μ g/+nl linoleic acid 0.5 ml 5 mg/ml insulin 0.5 ml 5 mg/ml Insulin 5 mg/ml) Lanceferrin, and 5 μg /ml selenium ([TS) 50μ + 10-’M Hydrocortiscin 5μm 200μg/ml Choleratoki Thin 0.5ml' 100μg/ml EGF (Epidermal Growth Factor) 50μ I 10-2M ethanolamine 0.5 ml l mg/ml somatotropy 50 μm 1 mg/ml prolactin 0.5 ml to-’M Chirotro Pin free hormone 50μm 200μg/ml LGF (liver growth factor, i.e. , glycyl-histidyl-lysine) l ml 2.0 MG/ml glucagon WME containing L-glutamine and NaHCO-free and manufactured by Haselton Research Brod., Inc. (Denver, Pennsylvania). ) to purchase from. Supplements containing growth factors and hormones are available from Sigma (St. , Missouri) or Collaborative Research (Bedford,) Massachusetts ) can be obtained from

Dissociation and subsequent passaging of primary cells was performed using phosphate buffered saline (PBS, Collagenase/dispase (Berry) at a concentration of 100 μg/ml in pH 7°2 (Mannheim) solution. After dissociation, Williams medium E (5% A 5-fold excess of 5% fetal calf serum in FBS/W&IE) is added to the solution. cells Pellet at 50xg for 6 min and resuspend in a minimum volume of 5% FBS/WME. , 37°C, 10% CO8 for 2-3 hours.

Cells are maintained in SFM and changed at 2 day intervals.

Under the culture conditions described, primary cells are highly differentiated as evidenced by cell morphology. characteristics of hepatocytes, and albumin, α-1-antitrypsin, complement C'4 , fibrinogen, apolipoprotein A-1 and E,) transferrin, and produces and secretes several liver-specific secretory proteins, including liver and plasminogen. maintain the ability to Characteristics and stability of primary cultured cells are reported by the inventors. (Lanhod, 1989).

The U19-5 cell line that essentially produces the 019 amphoteric retrovirus is Drs. P, S, Jat and P, A, 5harp, M, r, T, (Cambridge (Germany, Mass.).

Retroviral structures have been described in detail (Jat). The structure is responsible for DNA replication. This produces a large T antigen that is defective in binding to the SV40 origin.

The 019-5 cell line was grown in DMEM medium (Da Lubetzko modified minimal medium, obtained from Gibco, Grand Island, New York. - York) under standard culture conditions (Jat, 1986). culture medium were collected at 24-hour intervals and placed in a 0.45 μm film before being used to infect primary hepatocyte cultures. filter (Amicon, Beverly, Massachusetts).

The secondary fusion culture of primary hepatocytes (Example 1) was grown in polybrene (Polybrene" One day after adding 1 ml of 019-5 culture medium to the cells in the presence of μg/ml - Infect by application. The coating density is determined by the number of rounds of cell division after oncogene introduction. This is the very thing that causes this. - After overnight incubation, cells were washed 3 times with II/ME. The cells are kept in SFM until colony by-products are observed, typically about 1 month post-infection.

The cells were grown in culture medium of G418 (gesticin, G[BCO) (400 μg/ml). and select for G148 resistance. The cells were then phosphate-buffered. iooμg in a saline solution (PBS, pH 7,2) at 370FC for 10 min. by collagenase/disbase (Boehringer Mannheim) at a concentration of /ml. Process. After dissociation, 5% fetuses were placed in Williams medium E (5% FBS/WME). Add a 5-fold excess of subject serum to the solution. Pellet cells at 50xg for 6 min, Resuspend in a minimum volume of 10% FBS/WME at 37°C, 10% CD, 2-3% Allow time to adhere. Cells were plated at low cell density to isolate single colony byproducts. , secondary cloning. Differences in morphological appearance of over 70 out of over 100 colonies Collect based on. The cell is a designated CHMP cell and is a designated CHMP cell. series, for example CHllPl, 21. CHMPl, 22, etc.

A. Morphological characteristics Cell lines endowed with the ability to permanently divide, with several differences, are the observed morphology. . The four dominant forms are shown in the photomicrograph (225x magnification) in Figure IA-ID as described above. seen in

B1 secreted protein Tight cell shape! I(CH1lP5.13. CHMPl, 05. CHM P2.01. CHMP2.06, and CHMP3゜11), flat cell shape (CHMP5.13), and cuboidal cell morphology (C) rMP5.04). Hepatocyte cultures were incubated for 48 hours at 100-250 μci (“S”)-methionine c, 800Ci/mmo1. [CN, Costa Mesa, California] do. Aliquots of culture medium from each cell line were collected according to standard procedures (Laenry). Sodium dodecyl sulfate in 0.1% SO3, 12% acrylamide Fractionate by polyacrylamide gel electrophoresis (SDS-PAGE). gel was developed on Kodak XAR-5 film at -70°C for 2 days and is shown in Figure 3. result. Most of the proteins detected in this analysis are albumin (67Kd) and has a molecular size corresponding to alpha 1-antitrypsin (54Kd) Ru. The size marker (molecular weight expressed in kilodaltons) was determined by the size marker (molecular weight expressed in kilodaltons) 93Kd), serum albumin (67Kd), ovalbumin (43Kd), rubonic anhydrase (30Kd), trypsin inhibitor (20Kd), and It is lysozyme (14Kd).

In other studies, normal chimpanzee primary hepatocytes (Example 1) and CHMP1, 20 cell lines The proteins secreted by Ru. Human serum albumin, α-1-antitrypsin, apolipoprotein A- 1 and E, β-2 microglobulin, complement C'4, C-reactive protein, fibril against nogen, prealbumin, plasminogen, and transferrin. Antibodies are available from Calbiochem (San Diego, California).

Immunoprecipitation is performed according to published procedures (Jacob, 1989). easy The labeled medium was added to protein A agarose beads (BRL, Getty Bar). at 4°C using antibodies specific for binding of various plasma proteins to Culture for 16 hours. Wash beads three times to remove unbound proteins and remove bound proteins. is eluted with 5DS-gel electrophoresis sample buffer. Sample 1 as described above. Analyze by 2% 5DS-PAGE and fluorography. immunoprecipitated Protein identification is shown at the top of the figure. Similar to secreted proteins obtained using primary hepatocytes The phase is very similar to that observed for the C) [MPl, 20 cell line; exhibit liver-specific functions, i.e., a highly differentiated state, after permanent mitotic potential. .

In the third study, C) l&IP cell line 1.20.1.33.2.02.2.03. 2.05.3.01.4.03.4.07°5.01 when the culture is 80-90% thawed. If compatible, culture in the presence of 153-methionine as described above for 48 hours.

The culture medium from each cell line was treated with the permanently competent anti-human serum described above. Immunoprecipitate with a protein antibody, plus an antibody that specifically opposes α-fetoprotein. . Immunoprecipitated proteins were separated by 5DS-PAGE, and the gel was autoradiographed. Expand through graphics. Table 2 above shows the expression levels from representative CHMP cell lines. compared the plasma proteins observed during normal primary cultures. Stop and show. The “10” symbol in the table indicates normal expression, i.e. observed during primary culture. The expression is comparable to that expressed by: “*” symbol is low expression; “-” symbol is expression None: and “NT” means not tested.

C1 oncogene expression CHMP cell line 1.20.1.33.2.02.2.03.2.05.3.01 ．． 4.03.4.07.5.01, respectively, as a synthetic 019 provirus T antigen/virus. Investigate the existence of the omycin gene. This is done under standard digestion conditions with the restriction enzyme Ba n) Performed by digesting whole cell nucleic acids with It (Maniatis). This digestion is retro In the viral plasmid construct, BanH [5V40T antigen gene placed between sites] release a child. Hybridize multiple proviral inserts into the neomycin gene. decision can be made based on the This is because one Ban1 ([the part is near This is because the effect is shown depending on the cell arrangement. Digested nucleic acids are converted into 1% natural agaro Separate by electrophoresis on a base gel. to capillary transfer to nitrocellulose membrane Afterwards, bake the filter for 2 hours at 80"C. Hybridization to neomycin. 0.0, O1% Denhardos (De) containing 1% SDS and IM NaCl. nhardts) solution (Denhard) at 65°C. 5V40T antigen and The plasmid construct psV3neo containing the omycin gene sequence was nicked into translation and use a hybridization probe. The method is usually Following the technique of (Sampletsk, Southern). nick trans radio controlled p Hybridases to sV3neo probe each of the cell lines, fixed and 1-Methionine-labeled cell lysate using immunoprecipitation with anti-T antigen antibody Investigate the presence of T antigen in the sample.

As shown on the right side of Table 3, T antigen is present in each cell line endowed with the ability to permanently divide. A. Virus culture Permanent chimpanzee liver derived from HCV-infected primary hepatocytes Cells are prepared substantially as described in Example 2, but with lymphocytosis during acute one-stage HCV infection. We use hepatocytes obtained from a liver biopsy of a patient. Cell lines are designated C It is a U cell.

C) Some IIMP and CU cell lines were incubated with collagen-coated 25c. under normal conditions (37 °C, 10% CO2 atmosphere) in SFM on a Maria flask. Cultivate. When a culture reaches a level of 90% confluence, it is designated as containing HCV. inoculate chimpanzee plasma, which is known to have

The inoculum was administered to three chimpanzees (x7.x268, and x174) containing no other infectious agents. do not. Dilute the plasma 5-fold in SFM and add 1 ml to the culture medium. 3 o'clock After incubation at 37°C for 30 minutes, another 3 ml of SFM was added to the culture medium and the culture was continued for 16 hours. Let's go. Wash the culture three times with WME, remove the inoculum, and add SFM. Medium 1 Change the culture every other day and collect the raw culture for analysis 11 days after infection.

B, RN^ Characteristics evaluation Cells were washed three times with phosphate buffered saline (PBS) and cellular RNA was extracted. and purified using standard GITC extraction procedures (Chomondzinski). cells 4M guanidine isothiocyanate, 0,18% 2-mercaptoethanol, and Lyse with a solution containing 0.5% sarkosyl and 0.5% sarkosyl. Acidify the cell lysate several times. After extraction with phenol-chloroform-isoamyl alcohol, the RNA was extracted with Precipitate with sopropatol. Resuspend the purified RNA in water and separate each sample. 1/10 of the pull was used for polymerase chain reaction (PCR) amplification to obtain HCV RN Detect A genome.

PCR is carried out using standard methodology (Innis), the first step is to carry out the eDNA reaction. As a result, the reaction converts the DNA copy of HCV RNA into a reverse transcriber. The oligomacroretide primer used in the study here is prepared using Represents 6A that complements strains of HCV. 4 used for cDNA and PCR Two primers were derived from the putative unstructured region of HCV designated NS3; The columns are as follows.

5B S’ GATGCTGTCTCCAGGACTCM 3゜6B 5’A ACAGCGCCCAGTCTGTAGCAG 3゜These primers The sequence is derived from the sequence of a cDNA clone of a strain of HCV (Jaco b). A portion (1/4) of the cDNA reaction mixture was combined with Tag polymerase and oligo PCR dissociated for 35 cycles using polymeric nucleotide primers SA and 6A. It is. Part (1150) of the first round of PCR was used with primers 5B and 6B. used for the second round of PCR using

Figure 6 shows gel analysis of PCR products from HCV-infected CU cell lines. figure 7 shows gel analysis of PCR products from HCV-infected CHMP cell lines. . Gel results show primarily baboon hepatocytes endowed with permanent division potential. The plasmid plAneo containing the adenovirus EIA oncogene was derived from Drs, E, Rnley and Ni, v Ruyama, Cancer, Depar tmeut of Biology, Massachusetts Institute Tute of Technology. The plasmid structure is It is listed (van de unde). +Plasmid psU carrying the nyc oncogene c myc-1 was obtained from the American Type Culture Collection (Rock Lorne, Maryland), ATC CoNo. 41029.

Plasmid pUJ EJ6.6 containing the ras oncogene is an American type plasmid. Also obtained from the Lucher Collection and identified by TACC No. 41028 be done.

Primary baboon hepatocytes were donated to the Southwest Foundation for Biomesocal Research. It is prepared from a 2-year-old female baboon that was housed in Andonio, Texas. liver cells , obtained from a liver wedge biopsy and cultured in SFM as detailed in Example 1. Form stable primary hepatocytes. Primary hepatocytes retain liver-specific functions for a few months in culture. This is determined by the ability to secrete liver-specific proteins.

The U19 retrovirus or plasmid containing the selected oncogene was by retrovirus in the case of retroviruses or by ribophage in the case of plasmids. According to the manufacturer's protocol by Kushicon (BRL, Gettys) Berg, MD) into cells. Easy ribofection, each plasmids, such as ρSUc myc-15 μg and pA1 metatubula plasmids. 5 μg of plasmid DNA in 1.5 ml of serum-free medium (SFM) 5 μg and added to 60 mm cultures of secondary fused baboon hepatocytes. cormorant. The mixture is incubated with cells for 6-16 hours, then the medium is washed away.

Cells were maintained in SFM for 7-1B days, then 0418 (100-400 μg/ ml) is kept in SFM for 2 weeks. Then in a single colony pas, pH 7.2 Collagenase/disparza (vegetable) at a concentration of 100 μg/ml for 10 min 37 -Ringer Mannheim) solution. After dissociation, Williams medium E Add a 5-fold excess of 5% fetal calf serum in (5% FBS/WME) to the solution.

Pellet the cells at 50xg for 6 min and re-incubate in a minimum volume of 5% FBS/WME. Suspend and deposit under 10% CO2 at 37°C for 2-3 hours. single colony byproduct Various cancer genes have been identified from Select cell lines that exhibit the gene. Cells are designated BH cells and designated cell line numbers, such as BHIA, BH3A, etc.

B, cell morphology Phase contrast micrographs of living cells on collagen-coated plastic surfaces. Cell lines were photographed and representative cell types are shown in Figures 2A-2D. The different forms are , obtained when different oncogenes were used to confer permanent division potential on baboon liver cells. This shows the form. Figure 2A shows cells endowed with the ability to permanently divide with 019 retrovirus. Figure 2B shows the system BHIA, and both the SV40 large and small T antigens are encoded. The cell line BH6A has been rendered permanently competent with the plasmid pSV3neo. Figure 2C shows a plasmid that encodes myc and ras oncogenes and is permanently mitotic. Figure 2D shows the cell line BH5A given the myc and IEIA oncogenes. The cell line BH3A is shown permanently endowed with a plasmid encoding BH3A.

C0 secreted protein The permanently endowed baboon cell line BH3A was subjected to procedures substantially as described in Example 2. Therefore, we will investigate secreted proteins. Easily collect 25cm flasks of BH3A cells was labeled with 2SS-methionine for 24 hours, and the labeled medium was harvested and clarified. . The cleared medium is immediately analyzed by 5DS-PAGE. Regarding immunoprecipitation, 300 μg of labeled medium was incubated for 16 hours with specific liver proteins as described in Example 2. Incubation with protein A agarose liver protein containing bound 1gG antibodies directed against Ru. After washing three times to remove unbound protein, the protein was subjected to SDS gel electrophoresis. The beads were eluted using a buffer solution and the eluted material was separated by 5O3-PAGE. image and analyze by autogeography. Figure 5 is produced by a cell line. The abbreviations at the top of the diagram indicate the pattern of hepatic secretion. E and AI, prealbumin, β-microglobulin, C-reactive protein , complement C'4, transferamine, alpha-1-antitrypsin, and albumin It's about the. BH3A cell line cells - reactive proteins extraplate liver - specific proteins It produces all of the following.

Liver wedge biopsies are performed on monkeys. A liver wedge of about 5gm is probed. Perfuse with collagenase using the method. Collagen-coated viable hepatocytes Brimaria Blate (Fashion, Lincoln Burke, New Chassis) ) to apply on top. Primary hepatocytes are maintained in SFM medium as described in Example 1.

Hepatocytes were permanently inoculated with 019 retrovirus using the procedure described in Example 2. Gives cleft ability. Several cell lines containing one designated CJSI are characterized by their differentiation. It is shown to maintain liver function. It is the secretion of several liver-specific proteins into the cell culture medium. It is proved by.

double HAV infectivity of a permanently mitotically endowed marinosus cell line. The marmorated monkey hepatocyte cell line CJSI was grown into a collagen-coated 1979725 cm2 flask. Grow as described above in SFN on Sco. When the culture reaches 90% confluence, it and HAV strain HM175 (D', Marie Estes, Peyroll School of Medicine, (obtained from Ston, Texas). Virus stock in SFM Dilute 5 times and add to culture medium. Cultures were incubated with the inoculum for 3 hours at 37°C; Then 5 ml of SFMI is added to the culture medium and the culture is continued for 16 hours. Culture solution 3 times Wash with WME to remove residual inoculum and change to SFM. Change the medium every other day. Then, collect the culture solution 10 days after infection.

Total cellular RNA was isolated as described above and samples were prepared for PCR analysis by Dr. Transport to Estes. PCR was performed on 5% RNA samples as described above. PCR Runs are analyzed on a 1.5% Seakem agarose gel. Figure 8 is , gel analysis of PCR products from HAV-infected CJSI cell lines as described above. shows.

Although the invention has been described with respect to specific cell lines and infectious agents, it is applicable to other primates, For example, hepatocytes from humans and other hepatotropic viruses, such as hepatitis B, can be used in the present invention. It is obvious that it can be used for

l　Ja　5.13 2°-1tsu l@l-2,01 4! At TL Onkaku, 2/06 Eight Twenty- FIG. 4A 20- FIG. 48 Eight 1i FIG.8 Copy and translation of written amendment) Submission form (Article 184-8 of the Patent Act) October 2, 1992

Claims (20)

[Claims] 1. (a) Oncogene integrated into the cell genome; (b) Albumin, α-1-alpha antitrypsin, complement C'4, fibrinogen, apolipoprotein A1 and at least one selected from the group consisting of E, transferrin, and plasminogen. Secretion of three hepatocyte-secreted proteins in culture; as well as (c) characterized by the ability to support replication by human hepatotropic viruses; , a primate hepatocyte cell line endowed with the ability to permanently divide. 2. The relative proportion of such secreted proteins produced by cells in primate serum is A cell line according to claim 1, which is similar in relative proportion to that found. 3. Cells contain albumin, α-1-antitrypsin, and apolipoprotein white-E. 3. The cell line of claim 2, which secretes fibrinogen. 4. Derived from primary chimpanzee hepatocytes, the cells in the cell line are infectious and cause hepatitis. C virus and assists in the replication of this virus. Cell lines listed. 5. Derived from primary human or chimpanzee hepatocytes, the cells in the cell line contain hepatitis C virus. virus and assists in the replication of this virus. Cell system. 6. infected with hepatitis B or hepatitis A virus and assists in the replication of this virus. The cell line according to claim 1. 7. Oncogenes include SV40 large or small T antigen, adenovirus EIA. The cell according to claim 1, selected from myc, ras, or a combination thereof. system. 8. The cell line was derived from chimpanzee or human primary hepatocytes, and the oncogene was SV40. 2. The cell line of claim 1, which is a large T antigen. 9. The cell line was derived from primary baboon hepatocytes, and the oncogenes were EIA and myc oncogenes. A cell line according to claim 1, which is a combination. 10. After infection of a cell with a hepatotropic virus, the permanent dividing ability according to claim 1 is imparted. culture of a primate hepatocyte cell line and collect virus particles from the culture medium. A method for producing hepatotropic virus particles comprising: 11. The cell line is derived from human or chimpanzee liver cells and the virus is Hepatitis C virus. 11. The method according to claim 10, wherein the method is HCV. 12. by exposing cells in culture to chimpanzee or human HCV-infected serum. 12. The method of claim 11, wherein the cells are infected with HCV. 13. The cell line was derived from chimpanzee or human primary hepatocytes, and the oncogene was SV4. 0 large T antigen, and the virus is hepatitis C virus. Method. 14. Culture liver monospecific cells in serum-free medium to grow cell lines without loss of function. 11. The method of claim 10. 15. After the cell is infected with the hepatocyte virus, the permanent dividing ability according to claim 1 is imparted. cultured primate hepatocyte cell lines, exposed the infected cells to the compound for a selected period of time, and then hepatocellular virus, which consists of assaying cells for inhibition of viral growth in A method of screening compounds for their ability to inhibit the growth of. 16. Assay detects the level of virus-specific nucleic acid present in cell culture 16. The method of claim 15, comprising: 17. The cell line is derived from human or chimpanzee liver cells and the virus is Hepatitis C virus. 17. The method according to claim 16, wherein the method is HCV. 18. by exposing cells in culture to chimpanzee or human HCV-infected serum. 18. The method according to claim 17, wherein the cells are infected with HCV. 19. A culture medium capable of maintaining cells within a cell line in a substantially differentiated state culturing the cell line according to claim 1 in the culture medium, and then isolating the protein from the culture medium. consisting of albumin, alpha-1-antitrypsin, complement C'4, fibril Nogen, apolipoprotein A-1 and E, transferrin, and plasmid A method for producing a hepatic secretory protein selected from the group consisting of nogens. 20. Claim 19, wherein the protein is fibrinogen or plasminogen. How to put it on.