JPH03284697A - Remedy for japanese cryptmeria pollinosis and diagnostic dna probe therefor - Google Patents

Abstract

NEW MATERIAL:Peptides containing an amino acid sequence represented by the formula, etc., and capable of activation of suppresser.inducer T cell specific to Japanese cryptmeria pollinosis antigen. USE:A remedy for Japanese cryptmeria pollinosis and a raw material of a diagnostic DNA probe therefor. PREPARATION:For example, a peptide of a formula constituting a part of the N-terminal sequence of Japanese cryptmeria pollinosis antigen can be prepared by a chemical synthesis such as the solid phase synthetic method or by a genetic engineering technique, etc. The resultant peptide is added to a T cell fraction and a macrophage fraction respectively separated from peripheral blood of a Japanese cryptmeria pollinosis patient followed by culture. Activation of a suppresser.inducer T cell is analyzed by <3>H-thymidine incorporation activity to recognize that the peptide of the formula activates the suppresser.inducer T cell specific to Japanese cryptmeria pollinosis antigen, thus obtaining the objective peptide effective as a remedy for Japanese cryptmeria pollinosis.

Description

Detailed Description of the Invention <Industrial Application Field> The present invention provides a peptide that activates cells under a cedar pollen antigen-specific suppressor/inducer, and a therapeutic or preventive agent for cedar pollen allergy containing the peptide.

The present invention relates to a DNA probe for testing for cedar pollinosis, and a method for testing cedar pollen allergy using the probe.

<Prior Art> Cedar pollinosis, which is an allergic disease caused by cedar pollen, is known to cause rhinitis, eye and skin inflammation, asthma, and systemic allergic symptoms. In recent years, the number of patients has been increasing rapidly due to the increase in cedar pollen and air pollution, and it is estimated that 10-20% of the patients in Ikeda Ward, where pollen is scattered, are potentially fools.

Currently, there is no essential treatment or prevention method for cedar hay fever.
Symptomatic medicines such as antiallergic drugs are prescribed, but
There are also problems such as side effects, and the development of effective drugs is desired.

Similarly, there are currently two types of testing agents and methods for hay fever, such as antibody titer testing after the onset of symptoms, but no methods have been reported for preventive testing of susceptibility to hay fever. The provision of testing methods is also eagerly awaited.

<Problems to be Solved by the Invention> Accordingly, an object of the present invention is to provide a peptide effective against cedar pollen allergy, a therapeutic or preventive agent for cedar pollinosis containing the peptide, and a cedar pollen allergy test agent and method.

Means for Solving the Problems The present inventors have conducted extensive research to solve the above problems, and have found that Bebuti t', which has a specific structure, activates cedar pollen antigen-specific inhibitory T cells. They discovered that cedar pollen allergy is effective and that cedar pollen allergy can be effectively tested using a specific DNA probe, and have completed the present invention.

That is, the present invention provides a method for treating or preventing cedar pollen allergy containing cedar pollen antigen-specific suppressor/inducer = Bebuti F that activates T cells and the peptide as an active ingredient.
, a DNA probe for cedar pollen allergy testing, and a method for testing cedar pollen allergy using the probe.

Now, the main allergen that causes cedar pollinosis has been identified as a protein with a molecular weight of 40, (100-45, (100) (Yasueda, H, et al.
, J., Allergy Clin, ImmunoL.
71.77-86 (1983)), the N-unsaturated amino acid sequence has been partially determined (Tan1ai, M, et
al.

FEBS 1. etter 239, 329-332 (
1980)) (JP 1156926) 6 Cedar pollinosis is a so-called type I allergy, and its onset is linked to overproduction of IgE type immunoglobulin specific to this allergen. It is also known that there is a genetic predisposition to the onset of the disease, and a close correlation has been suggested with genetic polymorphisms in the HLA-DQ protein (a type of human major histocompatibility antigen).

In other words, cedar pollinosis varies from person to person) ILA-
It is a disease that occurs frequently in people who have a specific A-DQ protein on the surface layer of leukocytes such as macrophages among the D-roproteins.

The "old" protein is located on the surface layer of leukocytes such as macrophages and has an antigen-presenting function, and the anal A-DR molecule induces a positive immune response by presenting the antigen to helper T cells, whereas the HLA- (The 10 molecules are thought to control negative immune responses by inducing suppressor T cells; It is said that suppressive T cells are not sufficiently induced and an excessive immune response occurs (Matsushita, S, e
tal, J. Immunol, 138,10
9 (1987), Allergy, 38.726 (
1989) ).

In general, antigen (allergen) proteins are taken up by antigen-presenting cells such as macrophages, and then undergo intracellular digestion and degraded fragments are present on the surface of macrophages.HLA
It binds to proteins and is displayed as an antigen. The antigen-presented fragment is limited to a specific region (T cell epitope) of the antigen protein due to factors such as affinity with the anal protein. Therefore, by administering a partial peptide consisting only of that region, it is possible to enhance or suppress the immune response to the antigen without using the whole antigen, and l1lrban, JL, which has achieved certain results in animal experiments. ,
et al, Ce1159, 257-27H198
9)). This may lead to the creation of specific immunomodulators that do not have side effects when using whole antigens, such as binding with IgE in the case of allergens and subsequent allergic reactions such as release of chemical mediators such as histamine. It was considered. Also, one antigen is helper T.
It is predicted that if helper epitopes recognized by cells and suppressor epitopes recognized by suppressor/inducer T cells exist in different regions, it will be possible to effectively artificially enhance or suppress immunity. be done.

The present inventors identified the sabre-cer epitope of the cedar pollen allergen and administered a peptide in that region or a modified version of it to cedar pollinosis patients in whom sabre-nocer T cells were not induced, and effectively I realized that if I could induce immunosuppression, I could create an essential treatment for cedar pollen allergy, so I started research.

Now, it is not always easy to identify T cell epitopes in antigens. Therefore, research methods include determining the entire amino acid sequence of the antigen and then preparing and searching for many chemically synthesized peptides covering the entire region, or constructing and using genes that express partial sequences of the antigen. . However, such a method has been difficult for the cedar pollen allergen because the amino acid sequence is unknown except for a portion of the N-terminus, and the gene has not been isolated. On the other hand, attempts have been made to estimate the T cell epitope region of a specific antigen from statistical analysis of the T cell epitope structure of various known antigens, and Guillet et al.
The amino acid sequence of the cellular epitope presents it in mouse I-E protein, I-A protein (human HL8-DR
, HLA, -D (corresponding to ), and proposed that the same region is the interaction site between the two.

(5science, 235.865 (198
7) ). Therefore, the present inventors conducted a correlation search with the amino acid sequences of HL and ADQ molecules for the 22 residues of the N-terminal amino acid sequence of cedar pollen A. cedar pollen allergen N
Part of the unsequenced A-DO sequence (residues 182 to 19)
(residue 9) was found to be extremely similar to (residue 9).

HLA-DQβ(1) NPIIVEWRAQ
SESAQSKMH[, A-DIJ& (2)
SPITVEWRAQSESAQSKM(m Lay
Hammar, D. et al., Proc. Natl.
Acad, Sci, IsA, 80.7313 (1983
)) ((2) Boss, J, and Stro
tninger, J.L., Proc.

Natl, Acacl, Sci, USA,
81. 5199 (1984)) In addition, D is Asp
, N is Asn, P is Pro, I is Ile, S is S
er, C is Cys, W! ! Trp, R is A
rg, G is c+, y, A is Ala, Q is Gin, M is Met, K is Lys.

L represents 1, eu, V represents Val, E represents Glu, and T represents Thr.

Consolidation of 9 residues out of 18 residues from cedar pollen antigen sequence #2 to #19 1. Furthermore, Ly opposite to #18 Arg
Considering that they belong to the same basic amino acid group as s, the homology is very high, and Gord and Kar+ehi
sa (Nucreic Ac1d Research
, 10+247-263 (1,982)), the homology score is calculated to be -51. NBRF (N
ational Biomedical Re5ear
Approximately 3 (old, A-D) of 100 various protein sequences registered in datapunk
Qβ was one of the most homologous. The most important factor in the development of cedar pollen allergy,
The abnormally high homology between the amino acid sequence of A-DO and the amino acid sequence of the cedar pollen allergen itself suggests that this region plays an extremely important role in the history of onset or suppression of cedar pollen allergy in the diagnosis and testing of cedar pollen allergy. I thought this was a strong indication. There is genetic polymorphism in the reported sequence of this part of anal ADQβ, and the fact that there are at least two types of sequences suggests that individual differences in the structure of this part are reflected in individual differences in onset. It also suggests the possibility that

Based on the above important findings, the present inventors have concluded that (i) the same region of the cedar pollen antigen interacts with the listed regions of the HLA-[IQ molecule and is extremely closely involved in suppressor T cell induction; (ii) Genetic differences between HL and A-DQ sequences are reflected in differences in affinity with cedar pollen antigen sequences, and the genetic differences between HL and A-DQ sequences are reflected in differences in affinity with the cedar pollen antigen sequence. (ji) Extract the suppressor epitope from the cedar pollen antigen, or
If it is further modified to change its affinity with patient-type A-DQ molecules, suppressor T cells can be induced in patients as well as in healthy individuals, and excessive immune responses can be suppressed.
I made this hypothesis and conducted extensive research.

In order to prove this hypothesis, the present inventors examined the above-mentioned old 5ADOβ sequence in a large number of cedar pollen allergy patients and healthy individuals by Southern hybridization. As a result, we have conclusively found that there is a close correlation between the DOβ sequence and susceptibility to cedar pollen allergy.

That is, to put it simply, the above hypothesis has been proven to be correct, and the present invention has been completed.

This finding is effective in diagnosing and predicting the onset of cedar pollen allergy, and will provide extremely important guidelines for the treatment and prevention of cedar pollen allergy.

To reiterate, the present invention provides a peptide that activates cedar pollen antigen-specific suppressor/inducer T cells, a treatment or prevention agent for cedar pollen allergy containing the peptide as an active ingredient, a DNA probe for testing cedar pollen allergy, and a DNA probe using the same. The present invention provides a testing method for cedar pollen allergy.

The structure of the peptide used in the present invention is not particularly limited as long as it has the ability to activate cedar pollen antigen-specific suppressor/inducer 1 cells. but,
It is preferable to use peptides having the following structures (1) to (7).6 Namely, (1) a peptide containing an amino acid sequence represented by the following formula (1).

Formula (1): Asp Asn Pro lie As
p Ser Cys TrpArg Gay As
p Ser Asn Trp Aha Gi
nAsn Arg Met Lys Leu
Ala (2) A peptide containing the amino acid sequence represented by the following number (U).

2 (■): 8sp Ser Pro
Tie Thr Ser Cys TrpAr
g Gly Asp Ser Asn Trp Aha
GlnAsn Arg Met Lys L
eu Ala (3) A peptide comprising an amino acid sequence represented by the following formula (III).

2 (■): 8sp Asr+ Pro I
le Asp Ser Ala TrpArg
Gly Asp Ser Asn Trp
Ala Gin Asn Arg Met
Lys Leu Ala (4) A peptide having an amino acid sequence represented by the following formula (IV).

(IV), 8sn Pro Ile
Asp Ser Cys Trp ArgG
ly Asp Ser Asn trp A
la Gin AsnArg Met (5) A peptide containing a structure in which at least one amino acid residue in the amino acid sequence shown in formulas (1) to (TV) above is replaced with a peptide residue.

For example, two Asn from the N terminus of formula (1) are
In addition, the amino acid sequence from the 9th to 11th positions from the N-terminus, that is, Arg-Gly-Asp, was changed to Lys-AlaSe.
This is the case for peptides containing a structure changed to r.

(6) A peptide containing a continuous portion of the amino acid sequence shown in formulas (1) to (IV) above.

(7) A peptide having one or more amino acids added to the N-terminus and/or C-terminus of the peptide represented by formulas (1) to (IV) above.

(8) A peptide obtained by subjecting the peptides of (1) to (7) above to polyethylene gelcol addition, acetylation, and/or amidation.

The peptide sequences described in (1) to (8) above are the N-terminal sequence of the cedar pollen antigen, the anal A-D (1β sequence) as is, or a slightly modified sequence based thereon.

Now, the peptide that activates the cedar pollen antigen-specific suppressor/inducer T cells of the present invention may be prepared by chemical synthesis such as a solid phase method, or may be prepared by techniques such as genetic engineering. Also good.

Now, a purified product of peptide that activates cedar pollen antigen-specific suppressor/inducer T cells may be administered as is, or it may be administered in a form containing a stabilizer such as serum albumin or an excipient such as mannitol. May be used.

Now, as an active ingredient in cedar hay fever treatment or prevention agent,
Peptides that activate cedar pollen antigen-specific suppressor/inducer T cells are usually added at 0.01-1 (10%,
Preferably 0. (15-50%, more preferably 0.5%
It is sufficient to contain up to 5.0%.

As mentioned again, there is no problem when the cedar pollen therapeutic agent of the present invention contains a stabilizer such as serum albumin or an excipient such as mannitol.

Thus, according to the present invention, the above-mentioned peptide, which has been found to activate cedar pollen antigen-specific Zabre-nocer inducer T cells, is specific to people with cedar pollen allergy, where Vprenocer-1 cells are not sufficiently induced. It can be used to induce targeted immunosuppression.

That is, this is because suppressor/inducer T cells activate suppressor T cells. The most suitable method of administration is nasal, but transdermal, oral, ophthalmic, injection, etc. can also be used. When administered as a preventive agent before the pollen scattering period, it is effective in preventing the onset of symptoms, and is also effective for those who have lost symptoms after the onset of symptoms. Although the dosage t varies depending on the symptoms, it is usually sufficient to administer 0.01 to 1.0 g per day for adults. In addition, just to be sure, the peptide according to the present invention satisfies safety requirements.

Next, regarding the DNA probe and testing method for testing for cedar pollen allergy, the present inventors discovered a DNA probe that tests the gene sequence of 1kaA-DOβ and established a testing method using it. It is.

That is, the DNA probe of the present invention contains human histocompatibility antigen l.
DNA probe for testing the A-DOβ gene sequence, specifically human histocompatibility antigen HLA-DQβ sequence, 2 history or Asn, 183rd Pro, 184th lie, 1
85th Thr or lIc186th l-1 νa
1, a DNA probe that hybridizes with the 187th Glu sequence.

Specifically, a DNA probe for cedar pollen allergy testing is exemplified by a DNA probe having the following sequences 2 (V) to (VIII).
The A probe may be used.

Formula (V): CCT CCA GAG
CCCCATC formula (VI): CCT
CCA GAA CCCCATC formula (VI)
: CCCATCACCGTG GAGT formula (Vil
): CCCATCATCGTGGAG
T formula (V) is the 182nd Se of HL A -D Qβ
DNA probe containing r residue, formula (VI) is I(LA-
A DNA probe containing the 182nd Asn residue of DQβ, a DNA probe containing the 185th Thr residue of formula (VII) A-DQβ, and (VIII) ILA
- A DNA probe containing the 185th lie residue of DllIβ.

Of course, any DNA probe used in the present invention may be used as long as it has the above-mentioned DNA sequence and has the property of hybridizing to human histocompatibility antigen. For example, a DNA probe containing the DNA sequences shown in (V) to (VIII) may be used, or a DNA probe consisting of a part of the DNA sequence may be used.

However, it is preferable to use DNA probes having the sequences shown in 2 (~1) to (VIII) above.

Usually, for testing, one of the two DNA probes of the formula (
V) and a probe of formula (VI) or a combination of probes of formula (VI)
Testing can be performed using any combination of probes of formulas (V) and (VIII), but preferably probes of formulas (V) to
If all probes of (VIII) are used for testing, the accuracy will be even higher.

Now, this kind of genetic testing is used to test for genetic diseases, cancer, etc.
It is widely used for diagnosis and can be carried out in laboratories equipped with normal experimental equipment, such as clinical laboratories of medical institutions.

In the method for testing cedar pollen allergy using the DNA probe of the present invention, L7 DNA extracted from appropriate cells or tissues collected from a subject may be used as the genetic testing material. Note that DNA can be extracted from cells and tissues by any conventional method, such as "Molecular Clonin".
g” (J, Sambrook and T.

Maniat is ed, Co1d Sp
ring Harbor Lab, tlsA(
1979) pp. 280) can be applied. Next, the extracted DNA may be digested with an appropriate restriction enzyme, subjected to agarose gel electrophoresis, and transferred onto a filter to use as a filter for Southern hybridization, as described in the same book. Also, PCR
(Polymerase Chain Reaction
Using the method n), starting from a small amount of biopsy sample, it is convenient to efficiently amplify and use only the DNA sequence of interest, such as a specific region of the anal A or -DQβ gene. For the PCR method, see “PCR Technology” ()
I.

8, Er1ich ed, 5tockton Pr
This is easily accomplished by following the method described. The obtained amplified DNA fragment can be similarly used for hybridization by adsorbing it on a filter directly or after agarose gel electrophoresis. By adding the above-mentioned DNA probe labeled with an appropriate label to these filters and performing hybridization, it is possible to test for the presence or absence of a target sequence in a DNA sample and for homology. Furthermore, a method in which the base sequence is determined by sea fencing the PCR amplified DNA directly or after cloning can also be applied. These can be carried out by the methods described in the experimental book above.

Hereinafter, the present invention will be explained based on examples.

[Example 1] Peripheral blood was collected from cedar pollen allergy patients and sensitized healthy subjects.
After separating the T cell fraction and the macrophage fraction using a conventional method, the two were mixed and incubated in a culture dish for 101 minutes. ? 1 synthetic peptide and anti-anal A-DR antibody for 24 hours. Sable induced by peptide2.・Sir Inch 1-Sir T
Cell activation was measured by 3) i-,-thymidine uptake activity (Table 1). These activations are anti-anal A-
DQ, anti-CD4
(Proteins present on the surface layer of m-cells and involved in activation Q) Each antibody did not cause light damage, and Sugi antigen and synthetic Sugibebuti F activated one cell of a healthy individual more strongly than T cells derived from a patient. However, it can be said that the activation of suppressor/inducer T cells is detected. The results are summarized in Table 11.
Ta.

peptide Additive-free cp-.

P-I P-2 P-3 P-4 Table 3 - Healthy subjects 29OCP and 890 510 2 (10 (14) 0 460 patients 340 CPM 10 3 (10 3 (10 770 4 (10) KLA between CP-ODNPIDSCWRGDSNWAgN
CP-I DNPITSCWRGDSN QNRM
KLACP-2DNPIDSAWRFDSN-8flN
RMKLACr"-3NPIDSCWRGDSNEnpachi[
1lNR Gate CP-to4 AcNPIDSCWR
GDSN-8[]NRM Nao, CP-1, CP-2, CP
'-3, CP-4 to cp-.

This is a synthetic peptide with some modifications based on the structure of

[Example 2] After blood was collected from the subject, white blood cells were separated or UJ cavity mucosal cells were collected with a bamboo skewer as a cell sample, and D
NA was extracted. Human 1 (LA-DQβ
Two oligonucleotides chemically synthesized based on the gene sequence, CGTGGAGACGTCTACACCTGC and GCCCAGCCCGAGGAAGATCAG, were added and a PCR reaction was performed to amplify a 660 base DNA fragment sandwiched between the bicameral rows of the human anal A-DOβ gene. After agarose gel electrophoresis, the same DNA fragment was transferred to a pv leaf filter, and a hybridization reaction was performed by adding the following oligonucleotide probe containing 32p nucleotides.

Probe 1; CCTCCAGAGCCCCATC Probe 2; CCTCCAGAACCCCATC Probe 3, CCCATCACCGTGGAGT)
Loaf 4; CCCATCATCGTGGAGT
Probe '1 and probe 2 are anus A-DO respectively.
Probe 3 and probe 4 correspond to a sequence containing a Ser residue at position 182 of β (part of the sequence in (2) above) and a sequence containing an Asn residue (part of the sequence in (1) above). These correspond to a sequence containing the 185th Thr residue (a part of the sequence in (2) above) and a sequence including a lie residue (a part of the sequence in (1) above), respectively. Hybridization is l MN
The filter and probe were reacted overnight at 48°C in a reaction solution having the composition of aCI/1% SDS/IQ% dextran sulfate. After reaction 6X SSC (0.9M
The filter was washed at room temperature with NaCl, 0.09 M sulfur citrate, and subjected to autoradiography to determine the strength of hybridization. Under these conditions, the above-mentioned single base difference in the DNA sequence could be distinguished. Table 2 shows the results of 53 patients with cedar pollen allergy and 45 healthy individuals who showed no symptoms.

-Sacrilege 2 -+1111β sequence to anus, Fool Healthy person (+)/(+) 5 16(1
)/(2) 34 27 Here, for example, (1)/(1) indicates that both chromosomes have a gene encoding the sequence (1). As shown in the results, people with the chromosome type (2)/(2), which is extremely rare in healthy individuals, have a significantly higher frequency in patients, and conversely, they have a higher frequency in healthy individuals (1)/ There are very few patients with type (1). This suggests that the sequence (2) is more likely to cause hay fever sensitivity than the sequence (1), and in particular, people with type (2)/(2) have an extremely high probability of developing hay fever. It was clear that he was suffering from the disease.

The amino acid abbreviations in the text represent the following amino acids.

A: 8Ia, C; Cys, D;
8sp, E; Glu, G; Gly
, l;He,,K;Lys,l,;Leu
.

M;Met, N;^sn, P;Pro, Q;
Gln, R; 8rg, S; Ser,
, T; Thr, V; ~'al.

W; Trp <Effect> A peptide that activates cedar pollen antigen-specific suppressor/inducer T cells and a drug containing this peptide as an active ingredient are used to treat cedar pollen, which has been unable to be fundamentally treated until now. It is considered to be effective in the treatment and prevention of the disease. Furthermore, the DNA probe of the present invention is effective in testing for cedar pollen allergy.

Claims (18)

[Claims] (1) A peptide that activates cedar pollen antigen-specific suppressor/inducer T cells. (2) The peptide according to claim (1), comprising an amino acid sequence represented by the following formula (I). Formula (I): [There is a gene sequence] (3) The peptide according to claim (1), comprising an amino acid sequence represented by the following formula (II). Formula (II): [There is a gene sequence] (4) The peptide according to claim (1), comprising an amino acid sequence represented by the following formula (III). Formula (III): [There is a gene sequence] (5) The peptide according to claim (1), which comprises an amino acid sequence represented by the following formula (IV). Formula (IV): [There is a gene sequence] (6) Claims (1) to (5) include a structure in which at least one position in the amino acid sequence represented by formulas (I) to (IV) is substituted with one amino acid residue or peptide residue. peptide. (7) The peptide according to claims (1) to (5), which comprises a continuous part of the amino acid sequence represented by formulas (I) to (IV). (8) The peptide according to any one of claims (1) to (7), which has been chemically modified by addition of polyethylene glycol, acetylation, and/or amidation. (9) A therapeutic or preventive agent for cedar pollen allergy containing the peptides according to claims (1) to (8) as active ingredients. (10) A DNA probe for testing the gene sequence of human histocompatibility antigen HLA-DQβ. (11) The DNA probe according to claim (10), which has a base sequence represented by the following formula (V). Formula (V): CCTCCAGAGCCCCCATC (12) The DNA probe according to claim (10), which has a base sequence represented by the following formula (VI). Formula (VI): CCTCCAGAACCCCCATC (13) The DNA probe according to claim (10), which has a base sequence represented by the following formula (VII). Formula (VII): CCCATCACCGTGGAGT (14) The DNA probe according to claim (10), which has a base sequence represented by the following formula (VIII). Formula (VIII): CCCATCATCGTGGAGT (15) A cedar pollen allergy testing method characterized by using the DNA probe according to claims (10) to (14). (16) The testing method according to claim (15), characterized in that a DNA probe represented by the following formula (V) and a DNA probe represented by the formula (VI) are used in combination. Formula (V): CCTCCAGAGCCCCCATC Formula (VI)
:CCTCCAGAACCCCATC (17) The testing method according to claim (15), characterized in that a DNA probe represented by the following formula (VII) and a DNA probe represented by the formula (VIII) are used in combination. Formula (VII): CCCATCACCGTGGAGT formula (VI
II): CCCATCATCGTGGAGT (18) DNA probe represented by the following formula (V),
DNA probe represented by formula (VI), DNA probe represented by formula (VII) and D represented by formula (VIII)
16. The DNA probe according to claim 15, wherein the DNA probe is used in combination with an NA probe. Formula (V): CCTCCAGAGCCCCCATC Formula (VI)
:CCTCCAGAACCCCATC formula (VII): CC
CATCACCGTGGAGT formula (VIII): CCCAT
CATCGTGGAGT