JP5491308B2 - Therapeutic polypeptides, homologues thereof, fragments thereof, and use in modulating platelet-mediated aggregation - Google Patents

Description

(Background technology)
When a blood vessel is damaged, the subendothelial structure is exposed, thereby mediating platelet adhesion through interaction with von Willebrand factor (vWF). vWF forms a cross-link between collagen and platelet receptor glycoprotein Ib (gpIb) in the damaged vessel wall, but this interaction is particularly important under high shear stress conditions. Thrombus is formed and excessive bleeding is prevented (Bennett S, Thromb Haemost (2001) Mar; 85 (3): 395-400 (non-patent document 1)). During normal hemostasis, vessel walls damaged by these processes are wound-healed. However, in pathological conditions, thrombus can be formed by excessive platelet function. The vWF subunit is composed of several homologous domains, each responsible for a different function. vWF interacts with fibrillar collagen through its A3 domain and interacts with the platelet receptor gpIb through its A1 domain. Under normal conditions, platelets and vWF do not interact. However, when vWF binds to collagen at a high shear rate, it is considered that the higher-order structure is changed and binding to the platelet receptor gpIb becomes possible. This reversible adhesion causes the platelets to roll over the damaged area, followed by tight adhesion by collagen receptors on the platelets (gpIa / IIa, gpVI, gpIV, p65, TIIICBP), resulting in platelet activation It becomes. This results in activation of the gpIIb / IIIa receptor, fibrinogen binding and finally platelet aggregation.

Platelet aggregation inhibitors have been isolated from blood-sucking organisms such as leech. Saratins obtained from Hill's medical buildings (Hindo medicinals) are described in: WO 02 / 15919A2; see Cruz CP et al., “Salatin, von Willebrand factor. Dependent platelet adhesion inhibitors reduce platelet aggregation and intimal thickening in a rat carotid endarterectomy model (Saratin, an inhibitor of von Willebrand factor-dependent platelet adhesion, decreases platelet aggregation and intimal hyperplasia in a rat carotid endarterectomy model) "Journal of Vascular Surgery, 2001, 34: 724-729 (Non-Patent Document 2), and Smith TP et al.," Salatin, a collagen-platelet interaction inhibitor, in a venous anastomosis in a dog dialysis connection model Reducing membrane thickening (Saratin, an inhibitor of collagen-platelet interaction, decreases venous anastomotic intimal hyperplasi a in a canine dialysis access model) ”Vasc Endovascular Surg. 200 3 Jul-Aug; 37 (4): 259-69 (non-patent document 3).

  Antibody-based therapeutics have been developed, some of which are currently used for therapy.

  Abbciximab (Chimeric 7E3 Fab, ReoPro, US Pat. No. 6,071,514 (Patent Document 2)), European patent application published, which is a Fab fragment of mouse human chimeric antibody 7E3 that inhibits binding of ligand to platelet gpIIb / IIIa receptor No. 0882453 (Patent Document 3) was approved for use in humans in December 1994 as an adjunct therapy to prevent ischemic complications of percutaneous coronary vascular procedures. The fundamental safety problem associated with gpIIb / IIIa inhibitors is the risk of bleeding. This is because the strong antiplatelet action of these drugs can adversely affect hemostasis.

  Mouse monoclonal antibodies are directed against the vWF A1 domain (US Patent Application Publication No. 2002 / 0028204A1 (Patent Document 4), US Patent No. 6,280,731 (Patent Document 5), and International Publication No. 00/10601 (Patent Document 6). )), And its active conformation (US Pat. No. 6,251,393 (Patent Document 7)). In vivo efficacy is described below: Kageyama S, et al., “Effect of a humanized monoclonal antibody to von Willebrand factor in a canine model of coronary arterial thrombosis) ”, Eur J Pharmacol. 2002 May 17; 443 (1-3): 143-9 (Non-patent Document 4),“ Anti-human vWF monoclonal antibody, AJvW-2 Fab is bleeding in dogs Anti-human vWF monoclonal antibody, AJvW-2 Fab, inhibits repetitive coronary artery thrombosis without bleeding time prolongation in dogs ”Thromb Res., 2001 Mar 1; 101 ( 5): 395-404 (Non-Patent Document 5) and “Anti-human von willebrand monoclonal antibody AJvW-2 prevents thrombosis and neointimal formation after balloon injury in guinea pigs (Anti-human von willebrand) facto r monoclonal antibody AJvW-2 prevents thrombus deposition and neointima formation after balloon injury in guinea pigs), Arterioscler Thromb Vasc Biol. 2000 Oct; 20 (10): 2303-8 (non-patent document 6)). AJvW-2 inhibited high shear stress-induced human platelet aggregation but had no effect on low shear stress-induced platelet aggregation.

  The baboon effect of the murine antibody 82D6A3 raised against the A3 domain of human vWF has been described in: WO 02/051351; and Dongmei Wu et al., “Anti-human vWF monoclonal antibody. Inhibition of the von Willebrand (VWF) -collagen interaction by an antihuman VWF monoclonal antibody results in abolition of in vivo arterial platelet thrombus formation in baboons) ”, Hemostasis, thrombosis and vascular biology, 2002, 99: 3623-3628 (Non-patent Document 7).

  Antibody 6B4 is a monoclonal antibody (MoAb) raised against purified human gpIb. MoAb 6B4 inhibits ristocetin-induced and botrocetin-induced vWF-dependent human platelet aggregation reactions. MoAb 6B4 further prevents shear stress-induced adhesion of human platelets to collagen I. When injected into baboons, intact IgG and its F (ab ′) (2) fragment caused thrombocytopenia almost immediately. The cause is whether bivalent F (ab ′) (2) mediated platelet cross-linking or Fc: Fc receptor interaction mediated activation of platelet aggregation (WO0110911). (Patent Document 9), Cauwenberghs N. et al., Arteriosclerosis, Thrombosis and Vascular biology, 2000, 20: 1347 (Non-Patent Document 8), and further, for example, Cadroy Y et al., Blood, 1994, 83: 3218-3224 ), Becker BH et al., Blood, 1989, 74: 690-694 (Non-Patent Document 10), Ravanat C. et al., Thromb. Haemost. 1999, 82: 528a (see Non-Patent Document 11). Injection of Fab fragments into baboons prior to thrombosis inhibited platelet deposition on high collagen bovine pericardium. However, it was observed that further thrombosis was not inhibited by injecting Fab fragments after the thrombus was left to form. The expression yield of the Fab molecule is very low and its production method is very labor intensive.

International Publication No. 02 / 15919A2 U.S. Patent No. 6,071,514 European Patent Application No. 0882453 US Patent Application Publication No. 2002 / 0028204A1 U.S. Patent No. 6,280,731 International Publication No. 00/10601 U.S. Patent No. 6,251,393 International Publication No. 02/051351 International Publication No.0110911

Thromb Haemost (2001) Mar; 85 (3): 395-400 Journal of Vascular Surgery, 2001, 34: 724-729, Vasc Endovascular Surg. 2003 Jul-Aug; 37 (4): 259-69 Eur J Pharmacol. 2002 May 17; 443 (1-3): 143-9 Thromb Res., 2001 Mar 1; 101 (5): 395-404 Arterioscler Thromb Vasc Biol. 2000 Oct; 20 (10): 2303-8 Hemostasis, thrombosis and vascular biology, 2002, 99: 3623-3628 Arteriosclerosis, Thrombosis and Vascular biology, 2000, 20: 1347 Blood, 1994, 83: 3218-3224, Blood, 1989, 74: 690-694 Thromb. Haemost. 1999, 82: 528a

(Object of the present invention)
The aim of the present invention is to treat vWF, vWF A1 domain, activated vWF A1 domain, vWF A3 domain for the treatment of conditions that need to regulate platelet-mediated aggregation and overcome the problems of the prior art Providing a polypeptide comprising one or more single domain antibodies to gpIb and / or collagen, homologues of the polypeptide, and / or functional portions of the polypeptide. Further, methods for producing said polypeptides, methods for coating instruments with such polypeptides and using them in medical procedures (eg, PCTA, stenting), methods and kits for screening for agents that modulate platelet-mediated aggregation And a diagnostic kit for diseases associated with platelet-mediated aggregation.

(Outline of the present invention)
Single domain antibodies have been generated that specifically recognize target molecules involved in the first and subsequent steps of platelet aggregation. This provides an effective and safe antithrombotic drug.

  One embodiment of the invention is a polypeptide construct comprising at least one single domain antibody against any of vWF, vWF A1 domain, activated vWF A1 domain, vWF A3 domain, gpIb, or collagen.

  Another embodiment of the present invention is that a single domain antibody against the A1 domain of activated vWF specifically recognizes activated vWF conformation at the site of thrombus formation, but circulating vWF inactivators A polypeptide construct as described above that does not bind.

  Another embodiment of the present invention is a polypeptide construct as described above further comprising at least one single domain antibody against one or more serum proteins.

  Another embodiment of the present invention is the above polypeptide construct, wherein said at least one serum protein is either serum albumin, serum immunoglobulin, thyroxine binding protein, transferring, or fibrinogen, or a fragment thereof. is there.

  Another embodiment of the present invention provides a polypeptide construct as described above, wherein at least one single domain antibody against one or more serum proteins corresponds to a sequence represented by any of SEQ ID NOs: 16-19 and 49-61 Is the body.

  Another embodiment of the invention is a polypeptide construct as described above corresponding to the sequence represented by any of SEQ ID NOs: 13-15 and 42-45.

  Another embodiment of the present invention is a polypeptide construct as described above, wherein at least one single domain antibody is a humanized sequence.

  Another embodiment of the present invention is a polypeptide construct as described above, wherein at least one single domain antibody corresponds to the sequence represented by any of SEQ ID NOs: 38-41 and 42-45.

  Another embodiment of the invention is a polypeptide construct as described above corresponding to the sequence represented by any of SEQ ID NOs: 8-12, 20-22, 32-34, and 42-47.

  Another embodiment of the present invention is a polypeptide construct as described above, wherein the at least one single domain antibody is a camelid VHH antibody.

  Another embodiment of the present invention is the above, wherein the at least one single domain antibody corresponds to a sequence represented by any of SEQ ID NOs: 1-7, 23-31, 35-37, and 62-65. A polypeptide construct.

  Another embodiment of the present invention is a polypeptide construct as described above, wherein said single domain antibody is a homologous sequence, functional part, or functional part of a homologous sequence of a full-length single domain antibody.

  Another embodiment of the present invention is the above polypeptide construct, wherein the polypeptide construct is a homologous sequence of the polypeptide construct, a functional part thereof, or a homologous sequence of the functional part thereof.

  Another embodiment of the invention is a nucleic acid encoding the polypeptide construct described above.

  Another embodiment of the invention is a composition comprising the above polypeptide construct and at least one thrombolytic agent for simultaneous, fractional or sequential administration to a subject.

  Another embodiment of the present invention is the above composition, wherein said thrombolytic agent is any of staphylokinase, tissue plasminogen activator, streptokinase, single chain streptokinase, urokinase, and acylplasminogen-streptokinase complex. is there.

  Another embodiment of the present invention provides the above polypeptide construct, the above nucleic acid, or the above composition for use in the treatment, prevention, and / or alleviation of a disease associated with platelet-mediated aggregation or dysfunction thereof. It is.

  Another embodiment of the present invention provides a polypeptide construct as described above for the preparation of a medicament for treating, preventing and / or alleviating a disease associated with platelet-mediated aggregation or dysfunction thereof, Use of nucleic acids or the above composition.

  Another embodiment of the present invention is the use of a polypeptide construct, nucleic acid or composition as described above or a polypeptide construct, nucleic acid or composition as described above, wherein said disease is transient Cerebral ischemic attack, unstable or stable angina, angina, cerebral infarction, myocardial infarction, peripheral arterial occlusive disease, restenosis, coronary artery bypass grafting, coronary valve replacement; and coronary vascular procedures such as angioplasty, One that results from stenting, carotid endarterectomy or atherectomy.

  Another embodiment of the present invention is the use of a polypeptide construct, nucleic acid or composition as described above or a polypeptide construct, nucleic acid or composition as described above, wherein said disease is non-occlusive Thrombus formation, obstructive thrombus formation, arterial thrombus formation, acute coronary occlusion, restenosis, restenosis after PCTA or stenting, thrombus formation in stenotic artery; angioplasty, atherectomy, or Either hyperplasia after arterial stenting, obstructive syndrome in the vascular system, or poor patency of the diseased artery.

  Another embodiment of the present invention is the use of a polypeptide construct, nucleic acid or composition as described above, or a polypeptide construct, nucleic acid or composition as described above, wherein the disease is a harsh environment. Plaque formation or thrombus formation.

  Another embodiment of the present invention is the use of the polypeptide construct, nucleic acid or composition described above, or the use of the polypeptide construct, nucleic acid or composition described above, wherein the polypeptide construct is Administered intravenously, transdermally, orally, sublingually, topically, nasally, vaginally, rectally, or by inhalation.

  Another embodiment of the invention is a composition comprising a polypeptide construct as described above or a nucleic acid encoding said polypeptide construct, or a composition as described above, and a pharmaceutically acceptable vehicle.

Another embodiment of the present invention is:
(a) culturing a host cell comprising a nucleic acid capable of encoding the above polypeptide under conditions that allow expression of the polypeptide; and
(b) A method for producing a polypeptide as described above, which comprises recovering the polypeptide produced from the culture.

  Another embodiment of the present invention is the above method, wherein said host cell is a bacterium or yeast.

  Another embodiment of the present invention is a method of treating an invasive medical device for preventing platelet-mediated aggregation around an insult site, comprising coating the device with the polypeptide construct described above.

  Another embodiment of the invention is an invasive medical device for enclosing platelet-mediated aggregation around an invasive site, the device being coated with the polypeptide construct described above.

Another embodiment of the invention is a method of identifying an agent that modulates platelet-mediated aggregation, comprising:
(a) contacting the polypeptide construct described above with a polypeptide corresponding to its target, or a fragment thereof, in the presence and absence of a candidate modulator under conditions that allow binding between these polypeptides; and
(b) measuring the binding between the polypeptides of step (a), and if the binding in the presence of the candidate modulator is reduced compared to binding in the absence of the candidate modulator, the candidate modulator Identified as being an agent that modulates platelet-mediated aggregation.

  Another embodiment of the present invention is a screening kit for agents that modulate platelet-mediated aggregation according to the method described above.

  Another embodiment of the invention is an unknown agent that modulates platelet-mediated aggregation identified by the method described above.

Another embodiment of the present invention is a method for diagnosing a disease or disorder characterized by abnormal function of platelet-mediated aggregation, comprising:
(a) contacting the sample with the above polypeptide construct,
(b) detecting binding of the polypeptide construct to the sample; and
(c) compare the binding detected in step (b) with the reference binding;
Diagnosing a disease or disorder characterized by an abnormal function of platelet-mediated aggregation if there is a difference in binding compared to the sample.

  Another embodiment of the present invention is a screening kit for diagnosing a disease or disorder characterized by abnormal function of platelet-mediated aggregation by the above method.

 Another embodiment of the present invention is a kit as described above comprising the polypeptide construct as described above.

(Detailed explanation)
The present invention relates to polypeptide constructs, each comprising one or more single domain antibodies against the target, and the finding that this construct has a modulating effect on platelet-mediated aggregation.

Target According to the present invention, the target is any of vWF, vWF A1 domain, A1 domain of activated vWF, vWF A3 domain, gpIb, or collagen. The target is a mammal, derived from species such as rabbit, goat, mouse, rat, cow, calf, camel, llama, monkey, donkey, guinea pig, chicken, sheep, dog, cat, horse, Human is preferred. The human vWF sequence is shown in Table 30, SEQ ID NO: 48.

  Also targeted are vWF, vWF A1 domain, activated vWF A1 domain, vWF A3 domain, gpIb, or collagen fragments that can elicit an immune response. vWF, vWF A1 domain, activated vWF A1 domain, vWF A3 domain, gpIb, or a fragment of collagen that can bind to a single domain antibody raised against a “parent” full-length target Is the target.

As used herein, a fragment contains less than 100% sequence (eg, 99%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, etc.) As expected, it contains 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids. The fragment is long enough for the interaction to be maintained with an affinity of 1 × 10 ⁻⁶ M or greater.

  Fragments as used herein also refer to those in which one or more amino acids are arbitrarily inserted, deleted, and substituted, but do not substantially alter the ability of the target to bind to a single domain antibody against a wild-type target. The number of inserted, deleted, or substituted amino acids is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 , 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 Alternatively, it is preferably up to 70 amino acids.

A single domain antibody to a target means a single domain antibody that is capable of binding to the target with an affinity greater than 10 ⁻⁶ M.

Single domain antibody A single domain antibody is an antibody whose complementarity determining regions are part of a single domain polypeptide. Examples include heavy chain antibodies, antibodies that are essentially devoid of light chains, single domain antibodies derived from traditional four chain antibodies, engineered antibodies, single domain scaffolds other than those derived from antibodies. However, it is not limited to these. The single domain antibody may be any conventional technique or any future single domain antibody. Single domain antibodies can be derived from any species, including but not limited to mice, humans, camels, llamas, goats, rabbits, cows. According to one aspect of the invention, a single domain antibody as used herein is a naturally occurring single domain antibody known as a heavy chain antibody lacking a light chain. Such single domain antibodies are disclosed, for example, in WO 9404678. For clarity, this variable domain, derived from a heavy chain antibody essentially lacking a light chain, is described herein as a VHH or nanobody, to distinguish it from the conventional VH of a four chain immunoglobulin. Such VHH molecules can be obtained from antibodies from camelid species such as camels, llamas, dromedaries, alpaca, guanaco. In addition to camelids, other species can produce heavy chain antibodies that are essentially devoid of light chains, and such VHHs are also within the scope of the present invention.

  VHHs according to the present invention and known to those skilled in the art are heavy chain variable domains derived from immunoglobulins that are essentially devoid of light chains, such as those derived from camelids described in WO 9404678. Yes (hereinafter referred to as VHH domains or nanobodies). VHH molecules are about one-tenth the size of IgG molecules. They are also single polypeptides and are very stable to withstand extreme pH and temperature conditions. Furthermore, they are resistant to the action of proteases, which is not found in conventional antibodies. Moreover, in vitro expression of VHH produces functional VHH that is suitably folded in high yield. In addition, antibodies generated in camelids recognize epitopes other than those recognized by antibodies generated in vitro using antibody libraries or by immunization of non-camelid mammals (International Publication No. 9749805). As such, anti-albumin VHH can interact more efficiently with serum albumin known to be a carrier protein. Bound proteins, peptides, and small compounds may not be able to utilize some of the serum albumin epitopes as carrier proteins. However, since VHH is known to bind to epitopes such as “abnormal” or unconventional recesses (WO9749805), the affinity of VHH for circulating albumin can be increased.

VHH class The invention further relates to polypeptide constructs, in which case the single domain antibody is a VHH against the target described herein, in which case VHH belongs to the class comprising human-like sequences. VHH is an amino acid from the group consisting of glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, tryptophan, methionine, serine, threonine, asparagine, or glutamine at position 45, eg, Kabat number. It is a feature of this class that it has L45 by attaching. The VHH sequences represented by SEQ ID NO: 1 and SEQ ID NO: 3 that bind to vWF belong to this human-like class of VHH polypeptides. As such, peptides belonging to this class are highly homologous to the amino acid sequence of the human VH framework region, so there is no concern that an undesired immune response will occur when this peptide is administered directly to humans, Furthermore, there is no burden of humanization.

  Thus, according to one aspect of the invention, a polypeptide construct comprising one or more single domain antibodies corresponding to the sequence represented by any of SEQ ID NOs: 1 and 3 is directly directed to a patient in need thereof. Can be administered.

  Another human-like class of camelid single domain antibodies, represented by SEQ ID NOs: 16 and 18, is described in WO 03/035694, typically from human sources or other species It contains the hydrophobic FR2 residue found in these antibodies. However, even if the hydrophilicity is lost by this, a conserved tryptophan residue at position 103 in which a large number of residues such as charged arginine residues, uncharged residues such as serine and glycine are present in the VH of the double-chain antibody is present. This loss is compensated for by replacing the group. As such, peptides belonging to these two classes show high homology to the amino acid sequence of the human VH framework region, so there is a concern that even if this peptide is administered directly to humans, an undesirable immune response is produced. There is no further burden on humanization.

  Any VHH used according to the present invention may be a conventional class VHH or a human-like camelid antibody class VHH. The antibody may be directed against the entire target or a fragment thereof. These polypeptides include full-length camelid antibodies, ie chimeric variants of heavy chain camelid antibodies comprising Fc and VHH domains, human Fc domains.

  The one or more single domain antibodies of the polypeptide construct against the target may be of the same sequence. Alternatively, the antibodies may not all have the same sequence. Polypeptide constructs may not all share the same sequence, but it is within the scope of the invention to include anti-target single domain antibodies against the same target, fragments thereof, and one or more antigens thereof.

  It is another aspect of the invention that the polypeptide construct comprises two or more single domain antibodies, in which case each of the two single domain antibodies is a different target, i.e. vWF, vWF A1. Domain, activated vWF A1 domain, vWF A3 domain, gpIb, and collagen.

  Another aspect of the invention is a bispecific polypeptide construct comprising a vWF A1 domain, a single domain antibody against the A1 domain of activated vWF, and another single domain antibody against the vWF A3 domain. The bispecific polypeptide construct inhibits the interaction between vWF and collagen, and the interaction between vWF and platelets.

  According to an embodiment of the invention, the polypeptide construct can comprise two or more single domain antibodies that are linked. Single domain antibodies can be identical in sequence and can be directed against the same target or antigen. Depending on the number of VHHs attached, the multivalent VHH may be divalent (2VHH), trivalent (3VHH), tetravalent (4VHH), or may contain more valent molecules.

  Further, a polypeptide construct disclosed herein comprising one or more single domain antibodies against each serum protein of interest is an anti-target single that has a half-life in the subject's circulatory system that is not part of said construct. The present invention also relates to the surprising finding that the half-life of domain antibodies is significantly extended. Furthermore, the construct was found to exhibit the same advantageous VHH properties such as high intact stability in mice, extreme pH tolerance, high temperature stability and high target affinity.

  Examples of such constructs are represented by SEQ ID NOs: 13-15, and these constructs include anti-vWF VHH and anti-mouse serum albumin VHH.

  Accordingly, another embodiment of the invention is a polypeptide construct corresponding to the sequence represented by any of SEQ ID NOs: 13-15.

  Other examples of such constructs are represented by SEQ ID NOs: 42-45, which include humanized anti-vWF VHH and anti-mouse serum albumin VHH.

  Accordingly, another embodiment of the invention is a polypeptide construct corresponding to the sequence represented by any of SEQ ID NOs: 42-45.

  The serum protein may be any suitable protein or fragment thereof found in the subject's serum. In one aspect of the invention, the serum protein is serum albumin, serum immunoglobulin, thyroxine binding protein, transferrin, or fibrinogen. Depending on the desired use, such as the half-life required for effective therapy and / or compartmentalization of the target antigen, the VHH partner can be directed to one of the above serum proteins.

  Examples of single domain antibodies against serum albumin are sequences represented by sequences corresponding to any of SEQ ID NOs: 16-19 and 49-61. Accordingly, another aspect of the invention is a polypeptide construct further comprising one or more antiserum single domain antibodies, wherein the antiserum single domain antibody sequences are SEQ ID NOs: 16-19 and 49-61. Corresponds to any of the sequences represented by

  Such constructs can circulate in the serum of the subject for several days, reducing the frequency of treatment and the inconvenience of the subject, resulting in reduced treatment costs. Furthermore, it is an aspect of the invention that the half-life of the polypeptide constructs described herein can be controlled by the number of antiserum protein single domain antibodies present in the construct. Controllable half-life is desirable in some situations, for example, when applying timed doses of therapeutic polypeptide constructs.

  Another embodiment of the present invention is a polypeptide construct as described herein further comprising a thrombolytic agent.

  The thrombolytic agent can be non-covalently or covalently bound to a single domain antibody by covalent or non-covalent means. Such covalent coupling means are described below. Non-covalent means include those by protein interactions such as biotin / streptavidin, or by immune complexes.

  Alternatively, the thrombolytic agent can be administered simultaneously, fractionated, or sequentially in the context of the polypeptide construct of the present invention.

  Another aspect of the invention is a composition comprising at least one polypeptide construct disclosed herein and at least one thrombolytic agent for simultaneous, fractional, or sequential administration to a subject. is there.

  One aspect of the present invention is a treatment of an autoimmune disease comprising administering to an individual an effective amount of at least one polypeptide construct of the present invention and at least one thrombolytic agent simultaneously, fractionated, or sequentially. Is the method.

  Another embodiment of the present invention is a kit comprising at least one polypeptide construct of the present invention and at least one thrombolytic agent for simultaneous, fractional or sequential administration to a subject. It is an aspect of the present invention that kits can be used in accordance with the present invention. It is an aspect of the present invention that the kit can be used to treat the diseases cited herein.

  Simultaneous administration means that the polypeptide and the thrombolytic agent are administered to the subject simultaneously. For example, as a mixture or composition containing the components. Examples include intravenous solutions, tablets, liquids, topical creams and the like, and each preparation includes, but is not limited to, the ingredients.

  Separate administration means that the polypeptide and the thrombolytic agent are administered to the subject simultaneously or substantially simultaneously. Those components are present in the kit as separate unmixed preparations. For example, the polypeptide and thrombolytic agent may be present in the kit as individual tablets. Tablets may be administered to a subject by taking both tablets at the same time, or by taking another type of tablet immediately after one type of tablet.

  Sequential administration means that the polypeptide and the thrombolytic agent are sequentially administered to the subject. The polypeptide and thrombolytic agent are present in the kit as separate unmixed preparations. There is a time difference in administration. For example, one component can be 336, 312, 288, 264, 240, 216, 192, 168, 144, 120, 96, 72, 48, 24, 20, 16, 12, 8, from the administration of another component. It may be administered up to 4, 2, 1, or 0.5 hours later.

  For sequential administration, one component may be administered at various doses at one time or any number of times before / after administration of another component. Sequential administration can be combined with simultaneous or sequential administration.

  The medical uses of the polypeptide constructs described below include the polypeptide constructs disclosed herein and at least one polypeptide for simultaneous, fractional, or sequential administration to a subject as disclosed hereinabove. It also applies to compositions containing thrombolytic agents.

  Thrombolytic agents according to the present invention may include, for example, staphylokinase, tissue plasminogen activator, streptokinase, single chain streptokinase, urokinase, acyl plasminogen-streptokinase complex.

  Single domain antibodies are any of the polypeptide constructs comprising more than one single domain antibody disclosed herein, linked using methods known in the art or any future method. May be formed. As described in Blattler et al., Biochemistry 24, 1517-1524, European Patent Application Publication No. 294703, these antibodies can be fused, for example, by chemical crosslinking by reaction of amino acid residues with organic derivatizing agents. Alternatively, a single domain antibody can be genetically fused at the DNA level, ie, a complete polypeptide construct comprising one or more anti-target single domain antibodies and one or more antiserum protein single domain antibodies A polynucleotide construct encoding the body is formed. Methods for producing bivalent or multivalent VHH polypeptide constructs are disclosed in PCT patent application WO 96/34103. One way of joining multi-single domain antibodies is by genetic methods by joining single domain antibody coding sequences directly or via a peptide linker. For example, the C-terminus of the first single domain antibody can be linked to the N-terminus of the next single domain antibody. This binding scheme can be extended to bind additional single domain antibodies to construct and produce trivalent, tetravalent, etc. functional constructs.

  The polypeptide constructs disclosed herein can be made by one skilled in the art by methods known in the art or any future method. For example, by immunizing camels and obtaining hybridomas therefrom, or by cloning a library of single domain antibodies using molecular biology techniques known in the art, followed by the use of phage display methods Depending on the method chosen, VHH can be obtained using methods known in the art.

  One aspect of the present invention relates to the finding that polypeptides represented by Table 30 SEQ ID NOs: 1-7 derived from Camelid VHH bind to vWF and inhibit its interaction with collagen.

  Thus, one embodiment of the invention is a polypeptide construct in which at least one single domain antibody corresponds to the sequence represented by any of SEQ ID NOs: 1-7.

  Another embodiment of the invention is a polypeptide construct corresponding to the sequence represented by any of SEQ ID NOs: 8-12. The sequence corresponds to a monospecific polypeptide construct (such as SEQ ID NOs: 8 and 11) or a heterospecific polypeptide construct comprising different sequences of VHH (such as SEQ ID NOs: 9, 10, and 12). Both are against vWF.

  Another embodiment of the invention is a polypeptide construct comprising one or more single domain antibodies against vWF.

  Platelet aggregation is a very complex phenomenon and occurs in an in vivo situation. The interaction of vWF with collagen occurs only under the high shear stress observed in small arteries. In order to evaluate platelet aggregation under high shear stress, we performed perfusion experiments. Example 16 represents shear stress data obtained with SEQ ID NOs: 1-12, which are specific vWF-A3 binding substances. This experiment is typical of the interactions that occur immediately after injury (eg, during angioplasty) of a small arterial vessel wall.

  Surprisingly, monovalent VHH works very well in platelet aggregation experiments under high shear stress. 50% inhibition of platelet aggregation was obtained at concentrations of 0.08-0.3 μg / ml. In comparison, the IgG vWF specific antibody 82D6A3, which inhibits the interaction with collagen, inhibits 50% platelet aggregation at approximately 20-fold concentration (Vanhoorelbeke K. et al., Journal of Biological Chemistry, 2003, 278: 37815- 37821). These results were unexpected considering that the IC50 value of the monovalent VHH was up to one-seventh that of the IgG of 82D6A3 by ELISA.

  This clearly demonstrates that the large antibodies are not suitable for interaction with the initiation of aggregation or macromolecules in the middle, such as those involved in platelet-mediated aggregation. vWF forms multimers up to 60 monomers (final multimers up to 20 million daltons in size). In fact, it is already known that 82D6A3 cannot use all A3 domains (Dongmei WU, Blood, 2002, 99, 3623-3628). In addition, large conventional antibodies limit tissue permeability at sites of damaged blood vessels, for example during platelet-mediated aggregation.

  Nanobodies have a unique structure consisting of a single variable domain. VHH molecules derived from camelid antibodies are the smallest (about 15 kDa, i.e. one-tenth the size of conventional IgG) intact antigen-binding domain known, and therefore for delivery to high density tissues And it is very suitable for the limited space travel between macromolecules that participate in or initiate the platelet-mediated aggregation process.

  To the best of our knowledge, experiments have shown for the first time that small nanobodies are more advantageous than large intact antibodies for inhibiting such interactions between large macromolecules. It is.

  Even though nanobodies are small and therefore favoring permeation, such small molecules inhibit interactions between large polymers such as vWF and collagen (up to 60 monomers) with such high efficiency It is still amazing what we can do. Only large multimeric forms of vWF have been described to have hemostatic activity (Furlan, M ,. 1996, Ann. Hematol. 72: 341-348). Binding of multimeric vWF to collagen occurs with an affinity 100 times that of monomeric vWF fragments.

  The results of high shear stress experiments suggest that lower doses may be administered to patients. Therefore, side effects (such as immunogenicity and bleeding problems) are expected to be small.

  The present invention also relates to the finding that a polypeptide corresponding to a sequence represented by any of SEQ ID NOs: 23-31 derived from a single domain llama antibody binds to the A1 domain of vWF.

  Accordingly, another embodiment of the invention provides a polypeptide construct comprising one or more single domain antibodies, wherein at least one single domain antibody corresponds to a sequence represented by any of SEQ ID NOs: 23-31 Is the body.

  Another embodiment of the invention is a polypeptide construct corresponding to the sequence represented by any of SEQ ID NOs: 32-34. The sequences correspond to bivalent polypeptide constructs that both contain the same sequence of VHH to the vWF A1 domain.

  In order to study the effect of the polypeptide construct comprising the sequences represented by SEQ ID NOs: 23-31 on platelet aggregation under high shear stress, the present inventors have conducted flow chamber perfusion experiments. Example 25 shows shear stress data obtained with SEQ ID NOs: 23-31, which are specific vWF-A1 binding substances.

  The present invention relates to a polypeptide corresponding to a sequence represented by any one of SEQ ID NOs: 62 to 65 derived from a single domain llama antibody, not to an inactive vWF that circulates freely (such as after binding to collagen). ) It also relates to the finding that it selectively binds to the A1 domain of the active conformation of vWF. This provides a safer and more effective antithrombotic agent. As used herein, “selective binding” with respect to the vWF A1 domain means that the llama antibody has at least 10-fold, preferably 100-fold, affinity for the active conformation of vWF compared to the inactive form. Means that.

  Accordingly, another embodiment of the present invention provides a polypeptide construct comprising one or more single domain antibodies, wherein at least one single domain antibody corresponds to a sequence represented by any of SEQ ID NOs: 62-65. Is the body.

  In another embodiment of the invention, a polypeptide construct comprising one or more single domain antibodies to the same target and further comprising one or more single domain antibodies to the same target in the same domain but different epitopes It is.

  For example, the sequences represented by SEQ ID NOs: 9, 10, and 12 are heterospecific polypeptide constructs that include VHH for different epitopes in the A3 domain of vWF. Accordingly, another embodiment of the invention is a polypeptide construct corresponding to the sequence represented by any of SEQ ID NOs: 9, 10, and 12.

  Another embodiment of the invention is a polypeptide construct with two or more single domain antibodies against the same target.

  The sequences represented by SEQ ID NOs: 8 and 11 are polypeptide constructs comprising VHHs for the same epitope in the A3 domain of vWF, in which case both VHHs have the same sequence. Accordingly, another embodiment of the invention is a polypeptide construct corresponding to the sequence represented by any of SEQ ID NOs: 8 and 11.

  In another embodiment of the invention, the polypeptide construct comprises one or more single domain antibodies against one domain of the same target and one or more single domain antibodies against the same target but another domain of the same target. Including. Examples of different domains may be the A1 and A3 domains of vWF.

  In another example, the sequences represented by SEQ ID NOs: 20, 21, and 22 are heterospecific polypeptide constructs comprising VHHs for epitopes on different domains of vWF, ie, A1 and A3 of vWF. Accordingly, another embodiment of the invention is a polypeptide construct corresponding to the sequence represented by any of SEQ ID NOs: 20, 21, and 22.

  It is an aspect of the invention that at least one VHH for the A1 domain in the heterospecific polypeptide construct recognizes the active conformation of vWF. Such a VHH corresponds to the sequence represented by any of SEQ ID NOs: 62-65.

  Such polypeptide constructs may have superior antithrombotic activity compared to that of monomeric VHH. To study the effects of these polypeptide constructs, perfusion experiments were performed in the flow chamber to study platelet aggregation under high shear stress. Example 30 represents shear stress data obtained with a heterospecific polypeptide construct comprising anti-vWF-A1 VHH and anti-vWF-A3 VHH.

  The present invention also relates to the finding that the polypeptide represented by SEQ ID NOs: 35-37 derived from single domain llama antibodies binds to collagen type I and / or type III.

  Accordingly, another embodiment of the invention is a polypeptide construct in which at least one single domain antibody corresponds to the sequence represented by any of SEQ ID NOs: 35-37.

  In another embodiment of the invention, the polypeptide construct is one or more single domain antibodies against collagen type I and / or type III and the same target in the same domain but one or more single domains against different epitopes. Includes single domain antibodies. The sequences represented by 3P1-31_3P2-31 and 3L-41_3P2-31 are heterospecific polypeptide constructs containing VHH for different epitopes in collagen type I. Accordingly, another embodiment of the invention is a polypeptide construct corresponding to the sequence represented by any of SEQ ID NOs: 46 and 47.

  Another aspect of the invention is a polypeptide construct comprising one or more single domain antibodies against platelet glycoprotein Ib.

  A mouse anti-human vWF monoclonal antibody, AJvW-2 (IgG), was developed. This inhibits the interaction between platelet glycoprotein Ib (gpIb) and von Willebrand factor (vWF) during induction of human platelet aggregation by ristocetin and botrocetin (PCT Application No. WO 00/10601) . AJvW-2 Fab inhibits recurrent coronary artery thrombosis without extending bleeding time in dogs (Kageyama S et al., Thromb Res., 2001 Mar 1; 101 (5): 395-404) after balloon injury in guinea pigs Prevent thrombus deposition and neointimal formation (Kageyama S et al., Arterioscler Thromb Vasc Biol. 2000 Oct; 20 (10): 2303-8).

  Antibody 6B4 is a monoclonal antibody (MoAb) raised against purified human gpIb (PCT application number WO 01/10911 A2). When injected into baboons, intact IgG and its F (ab ′) 2 fragment caused thrombocytopenia almost immediately. The cause is whether bivalent F (ab ') 2 mediated platelet cross-linking or Fc: Fc receptor interaction mediated activation of platelet aggregation (Cauwenberghs N. et al., Arteriosclerosis, Thrombosis and Vascular biology, 2000, 20: 1347 and, for example, Cadroy Y et al., Blood, 1994, 83: 3218-3224, Becker BH et al., Blood, 1989, 74: 690-694, Ravanat C. et al., Thromb. Haemost 1999, 82: 528a (see summary). Platelet deposition on high collagen bovine pericardium was inhibited when Fab fragments were injected into baboons before thrombus formation. However, no further inhibition of thrombosis was observed when the Fab fragment nm was injected after the thrombus was left to form.

  The affinity of the Fab fragment for the gpIb receptor on platelets was shown to be reduced by a factor of 10 compared to intact IgG or F (ab ') 2 (KD = 49.2nM, 4.7nM, respectively) , And 6.4 nM). Furthermore, the IC50 value of ristocetin-induced platelet aggregation for Fab was up to 1/10 compared to IgG or F (ab ′) 2 (IC50 were 40 nM, 4.5 nM and 7.7 nM, respectively).

  Activation of Fc: Fc receptor mediated platelet aggregation and / or F (ab ') 2 mediated platelet cross-linking, this treatment of intact IgG or F (ab') 2 therapeutically in vivo Although observed upon use, the undesirable thrombocytopenia caused by these may be presumed to be avoided by the use of VHH because VHH does not contain Fc and is not bivalent. Since nanobodies are already single domain molecules, affinity and activity are not lost as observed with the 6B4 Fab fragment.

Humanized antibodies The discovery of naturally occurring single domain antibodies in llamas, dromedaries, and camels has led to advantages of monoclonal antibodies, such as specificity and low toxicity, and small molecule benefits, such as tissue permeability and A new class of therapeutic molecules has been identified that combine stability. Unfortunately, the development of suitable therapeutic products based on these proteins has the disadvantage of being from camelids and therefore not from humans. Non-human proteins contain amino acid residues that can be immunogenic when injected into a human patient. Studies have shown that camelid VHHs are not immunogenic when injected into mice, but it is preferable to replace camelid residues with human residues. These humanized polypeptides should be substantially non-immunogenic in humans, but retain the affinity and activity of the wild-type polypeptide.

  Humanization means to mutate so that it is less immunogenic or disappears when administered to a human patient. Humanization of polypeptides according to the present invention includes the step of replacing one or more camelid amino acids by their human counterparts found in the human consensus sequence, but the polypeptide does not lose its normal properties. None, ie, the antigen binding ability of the polypeptide obtained by humanization is not significantly affected.

  We have determined that amino acid residues of antibody variable domains (VHH) can be modified to reduce their immunogenicity against different species but not to lose their original affinity for the antigen. The group was determined. VHH is used that is modified at the amino acid residues so identified and useful for administration to different species. More particularly, the present invention relates to the preparation of modified VHH modified for administration to humans, the resulting VHH itself, and the use of such “humanized” VHHs in the treatment of disease in humans.

  In order to humanize VHH polypeptides, it is necessary to introduce and mutate only a limited number of amino acids into a single polypeptide chain without abruptly losing binding and / or inhibitory activity. The inventors have found. This differs from the humanization of scFv, Fab, (Fab) 2, and IgG, which introduces amino acid changes in the two chains, light and heavy, and conserves the assembly of both chains .

  Humanization techniques can be performed by a method that includes replacing any of the following residues, alone or in combination: FR1, positions 1, 5, 28, and 30, FR2 positions 37, 44, Hallmark amino acids at 45 and 47, FR3 residues 74, 75, 76, 83, 84, 93, and 94, and FR4 positions 103, 104, 108, and 111. Numbering is according to Kabat numbering. Examples of such humanized sequences are shown in Table 30, SEQ ID NOs: 2, 38-41.

  The polypeptides shown in Examples 63 and 64 have a high degree of homology to human germline VH DP-47. Further humanization required the introduction of a certain amount of amino acids into a single polypeptide chain and mutagenesis. This differs from the humanization of scFv, Fab, (Fab) 2, and IgG, which introduces amino acid changes in the two chains, light and heavy, and conserves the assembly of both chains .

  This polypeptide contains a human-like residue in FR2. Humanization required mutagenesis of residues at positions 1 and 5 of FR1, which were introduced by primers used for repertoire cloning. These triggers do not occur naturally in llama sequences. Mutagenesis of these residues did not abolish binding and / or inhibitory activity. Humanization of FR1 required mutagenesis at positions 28 and 30. Mutagenesis of these residues also did not abolish binding and / or inhibitory activity.

  Humanization also required mutagenesis of residues at positions 74, 75, 76, 83, 84, 93, 94 of FR3. Mutagenesis of these residues did not abolish binding and / or inhibitory activity.

  Humanization also required mutagenesis of residues 104, 108, and 111 of FR4. Mutagenesis of Q108L resulted in low levels of production in E. coli. Position 108 is exposed to solvent in camelid VHH, but in human antibodies this position is embedded at the VH-VL interface (Spinelli, 1996; Nieba, 1997). In isolated VH, position 108 is exposed to the solvent. Introducing nonpolar hydrophobic Leu instead of polar uncharged Gln can have a dramatic impact on the intrinsic folding / stability of this molecule.

One embodiment of the invention is a method for humanizing VHH comprising:
(a) Substituting any of the following residues, alone or in combination:
FR1, position 1, 5, 28 and 30,
Hallmark amino acids at positions 37, 44, 45, and 47 of FR2,
FR3 residues 74, 75, 76, 83, 84, 93, and 94, and
FR4 positions 103, 104, 108, and 111
Numbering is according to Kabat numbering.

  Examples of such humanized sequences are shown in Table 30, SEQ ID NO: 2, 38-41.

  The use of antibodies and their humanized derivatives from sources such as mice, sheep, goats, rabbits, etc. as a treatment for conditions that need to regulate platelet-associated aggregation is problematic for several reasons. Traditional antibodies are not stable at room temperature, preparation and storage must be refrigerated, and essential refrigeration research facilities, refrigerators, and refrigerated transport are essential, which increases time and cost. It becomes a cause. In developing countries, refrigeration may not be possible. The expression yield of the Fab molecule is very low and the production method is very labor intensive. Furthermore, the production or small-scale production of the antibody is expensive. This is because mammalian cell lines required for the expression of intact and active antibodies require a high degree of support in terms of time and equipment but have very low yields. Furthermore, the binding activity of conventional antibodies depends on the pH, and is therefore not suitable for use in environments outside the normal physiological pH range, for example, gastric bleeding treatment or gastric surgery. Furthermore, conventional antibodies are unstable at low or high pH and are therefore not suitable for oral administration. However, camelid antibodies have been proven to withstand harsh conditions such as extreme pH, denaturing reagents, and high temperatures (Ewert S et al., Biochemistry 2002 Mar 19; 41 (11): 3628-36). This antibody would be suitable for delivery by oral administration. Furthermore, the binding activity of conventional antibodies is temperature dependent and is therefore not suitable for use in assays or kits performed at temperatures outside the bioactive temperature range (eg, 37 ± 20 ° C.).

  The polypeptide constructs represented by SEQ ID NOs: 1-47 and 49-65 and their derivatives not only have the advantageous characteristics of conventional antibodies such as low toxicity and high selectivity, but they also have additional properties. Show. The high solubility of these means that they can be stored and / or administered at higher concentrations compared to conventional antibodies. That they are stable at room temperature means that they can be prepared, stored and / or transported without the use of refrigeration equipment, leading to cost, time and space savings (as described in Example 61). ). Another advantageous feature compared to conventional antibodies is that the half-life in circulation is short, which in accordance with the present invention provides, for example, albumin binding, specificity for albumin and other specificities for the target. This half-life can be modulated by bispecific nanobodies having, Fc binding, VHH binding (divalent VHH) or by PEGylation (described in Examples 41-54). A short controllable half-life is desirable for surgical operations, such as operations that must inhibit platelet-mediated aggregation in a limited time. Moreover, if bleeding problems or other complications occur, the dose can be reduced immediately. The fact that the polypeptide of the present invention retains the binding activity even at a pH and temperature exceeding the normal physiological range means that the polypeptide can be used even under extreme pH and temperature conditions. Those requiring regulation of platelet-mediated aggregation, such as gastric surgery, control of gastric bleeding, and assays performed at room temperature. The polypeptides of the present invention show long-term stability even at extreme pH, meaning that they are suitable for delivery by oral administration. The polypeptides of the present invention can be produced cost-effectively by fermentation in a convenient recombinant host organism such as E. coli or yeast, which differs from conventional antibodies that require expensive mammalian cell culture facilities. The expression level that can be achieved is high. Examples of yields of the polypeptides of the present invention are 1-10 mg / ml (E. coli) and up to 1 g / l (yeast). The polypeptides of the present invention also exhibit high binding affinity to a wide range of different antigen types and the ability to bind to epitopes not recognized by conventional antibodies, for example, the polypeptide has the potential to penetrate recesses. A loop structure based on the long CDR provided is shown, showing inhibition of enzyme function. Furthermore, since binding often occurs only through the CDR3 loop, it is assumed that peptides derived from CDR3 should be able to be used therapeutically (Desmyter et al., J Biol Chem, 2001, 276: 26285-90). ). The preparation of such peptides is described in Example 65. The polypeptides of the present invention can also retain full binding ability to enzymes or toxins as fusion proteins. Furthermore, activation of platelet aggregation mediated by Fc: Fc receptors and / or cross-linking of platelets mediated by F (ab ′) (2), this cross-linking may include intact IgG or F (ab ′ ) (2) (see Cauwenberghs N. et al., Arteriosclerosis, Thrombosis and Vascular biology, 2000, 20: 1347), but in the undesirable thrombocytopenia caused by them, VHH reduces Fc Since it is not included and is not bivalent, it may be assumed that the use of VHH is avoided. Thus, the polypeptides represented by SEQ ID NOs: 1-15, 20-47, 62-65, homologues or functional parts thereof, represent a significant cost and time saving in the treatment and diagnosis of conditions associated with platelet-mediated aggregation. Patients who need the polypeptide should be less likely to encounter the problems associated with conventional agonists.

  Platelet-mediated aggregation is the process by which vWF-bound collagen adheres to platelets and / or platelet receptors (both examples are gpIa / IIa, gpIb, or collagen) and ultimately activates platelets. Activation of platelets results in fibrinogen binding and ultimately platelet aggregation. Providing polypeptides that modulate processes involving platelet-mediated aggregation, such as vWF-collagen binding, vWF-platelet receptor adhesion, collagen-platelet receptor adhesion, platelet activation, fibrinogen binding, and / or platelet aggregation It is within the scope of the present invention. The polypeptide is derived from a camelid antibody to vWF, vWF A1, A1 domain of activated vWF, A3 domains, gpIb, or collagen, and according to SEQ ID NOs: 1-15, 20-47, and 62-65 described above. Has the same advantages as the polypeptide represented.

  According to an aspect of the invention, the polypeptide construct may be a homologous sequence of the full-length polypeptide construct. According to another aspect of the invention, the polypeptide construct may be a functional part of a full-length polypeptide construct. According to another aspect of the invention, the polypeptide construct may be a homologous sequence of a full-length polypeptide construct. According to another aspect of the invention, the polypeptide construct may be a functional part of a homologous sequence of a full-length polypeptide construct. According to an aspect of the invention, the polypeptide construct may comprise the sequence of the polypeptide construct.

  According to aspects of the invention, the single domain antibody used to form the polypeptide construct may be a complete single domain antibody (eg, VHH) or a homologous sequence thereof. According to another aspect of the invention, the single domain antibody used to form the polypeptide construct may be a functional part of a complete single domain antibody. According to another aspect of the invention, the single domain antibody used to form the polypeptide construct may be a homologous sequence of a complete single domain antibody. According to another aspect of the invention, the single domain antibody used to form the polypeptide construct may be a functional part of a homologous sequence of a complete single domain antibody.

  Another aspect of the invention is a single domain antibody corresponding to any of SEQ ID NOs: 1-7, 16-19, 23-31, 35-41, and 49-65, homologous sequences thereof, and / or functions thereof Part.

  According to another aspect of the invention, the polypeptide construct may be a homologous sequence of the parent sequence. According to another aspect of the invention, the polypeptide construct may be a functional part of the parent sequence. According to another aspect of the invention, the polypeptide construct may be a functional part of a homologous sequence of the parent sequence.

  As used herein, a homologous sequence may include one or more amino acid additions, deletions, or substitutions that do not substantially alter the functional properties of the polypeptide. The number of amino acid deletions or substitutions is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 amino acids It is preferable that

  Homologous sequences according to the present invention include polypeptides extended by amino acid additions to form human heavy chain antibodies or human single domain heavy chain antibodies, but the functional properties of the unmodified polypeptide are substantially reduced by this addition. Is not subject to change.

  Homologous sequences of the present invention may include polypeptides represented by any of SEQ ID NOs: 1-47 and 49-65, which are humanized (described in Examples 63 and 64).

  Homologous sequences of the present invention include, for example, sequences corresponding to sequences of any of SEQ ID NOs: 1-47 and 49-65 present in other camelid species such as camels, llamas, dromedaries, alpaca, guanacos, etc. It's okay.

  When sequence homology is indicated by the term homologous sequence, the term indicates high sequence identity (70%, 75%, 80%, 85%, 90%, 95%, or 98%) to the parent sequence. Means a sequence exhibiting characteristics similar to the parent sequence, i.e. affinity, said identity being calculated using known methods.

Alternatively, the homologous sequence may be any amino acid sequence resulting from a possible substitution at any number of positions in the parent sequence according to the following formula:
Replacing Ser with Ser, Thr, Gly, and Asn;
Arg is replaced by one of Arg, His, Gln, Lys, and Glu;
Replacing Leu with one of Leu, Ile, Phe, Tyr, Met, and Val;
Replace Pro with one of Pro, Gly, Ala, and Thr;
Replacing Thr with one of Thr, Pro, Ser, Ala, Gly, His, and Gln;
Replacing Ala with one of Ala, Gly, Thr, and Pro;
Replace Val with one of Val, Met, Tyr, Phe, Ile, and Leu;
Replacing Gly with one of Gly, Ala, Thr, Pro, and Ser;
Ile is replaced by one of Ile, Met, Tyr, Phe, Val, and Leu;
Replacing Phe with one of Phe, Trp, Met, Tyr, Ile, Val, and Leu;
Replacing Tyr with one of Tyr, Trp, Met, Phe, Ile, Val, and Leu;
Replace His with one of His, Glu, Lys, Gln, Thr, and Arg;
Replacing Gln with one of Gln, Glu, Lys, Asn, His, Thr, and Arg;
Replacing Asn with one of Asn, Glu, Asp, Gln, and Ser;
Replacing Lys with one of Lys, Glu, Gln, His, and Arg;
Replacing Asp with one of Asp, Glu, and Asn;
Replacing Glu with one of Glu, Asp, Lys, Asn, Gln, His, and Arg;
Replace Met with one of Met, Phe, Ile, Val, Leu, and Tyr.

  Homologues according to the present invention are capable of hybridizing under stringent hybridization conditions to the reverse complement of a nucleotide sequence capable of encoding a polypeptide 50, 100, 200, 300, 400, 500, 600, 800 Or a nucleotide sequence greater than 1000 nucleotides (such as the sequence described by SAMBROOK et al., Molecular Cloning, Laboratory Manuel, Cold Spring Harbor Laboratory press, New York).

As used herein, a functional moiety refers to a single domain antibody of sufficient length to maintain the interaction with an affinity of 1 × 10 ⁻⁶ M or greater.

  Alternatively, the functional portion of a single domain antibody of the present invention contains a partial deletion in the complete amino acid sequence, but still maintains the binding site and protein domain necessary for target binding and interaction.

  Alternatively, any functional portion of SEQ ID NOs: 1-7 includes a partial deletion in the complete amino acid sequence, but still maintains the binding site and protein domain necessary to inhibit binding of vWF to collagen. Polypeptide.

  Alternatively, any functional portion of SEQ ID NOs: 23-31 and 62-65 contains a partial deletion in the complete amino acid sequence, but still requires binding sites and protein domains for binding and interaction with the A1 domain of vWF It is a polypeptide that maintains

  Alternatively, the functional part of any of SEQ ID NOs: 35-37 contains a partial deletion in the complete amino acid sequence, but still maintains the binding site and protein domain necessary for binding and interaction with collagen It is.

  Alternatively, the functional portion contains a partial deletion in the complete amino acid sequence of the polypeptide, but still maintains the binding site and protein domain necessary for binding and interaction with the antigen that induced it. It includes, but is not limited to, VHH domains.

  As used herein, a functional portion refers to a polypeptide sequence that is less than 100% of the sequence (eg, 99%, 90%, 80%, 70%, 60%, 50%, etc.) and comprises amino acid 5 Say something that contains more than one.

  A portion refers to a nucleotide sequence that encodes a polypeptide sequence, but less than 100% of the sequence (eg, 99%, 90%, 80%, 70%, 60%, 50%, etc.) and 15 nucleotides The thing including the above is said.

  An aspect of the present invention is that the need for injection can be avoided by administration of a polypeptide construct according to the present invention. Conventional antibody-based therapeutics have significant potential as drugs. This is because they have very good specificity for their target and low intrinsic toxicity. However, these antibodies have one significant drawback: they are relatively unstable and sensitive to protease degradation. This means that conventional antibody drugs cannot be administered orally, sublingually, topically, nasally, vaginally, rectally or by inhalation. The reason is that these drugs are not resistant to the low pH at these sites, the action of proteases in these sites and blood, and / or because of their large size. Such drugs must be administered by injection (intravenous, subcutaneous, etc.) to overcome some of these problems. Administration by injection requires expert training to use the hypodermic syringe or needle accurately and safely. Further, there is a need for sterilizers, therapeutic polypeptide liquid formulations, vial packaging of the polypeptide in sterile and stable form, and sites suitable for needle penetration in the subject. In addition, subjects generally experience physical and psychological stress before and after receiving an injection.

  Embodiments of the present invention overcome these problems of the prior art by providing the polypeptide constructs of the present invention. The construct does not substantially lose activity and is sufficiently small, resistant and stable for oral, sublingual, topical, nasal, vaginal, rectal or inhalation delivery. ing. The polypeptide constructs of the present invention not only eliminate the need for injection and reduce cost / time, but are more convenient and more comfortable for the subject.

  One embodiment of the present invention is for use in the treatment, prevention, and / or alleviation of disease symptoms that can be modulated by substances that control platelet-mediated aggregation and can pass through the gastric environment without inactivating the substance. Polypeptide constructs disclosed herein.

  As known by those skilled in the art, once the polypeptide construct can be obtained, apply formulation technology to release the maximum amount of polypeptide at the right site (stomach, large intestine, etc.) Can do. This delivery method is important for the treatment, prevention and / or alleviation of disease symptoms whose targets are located in the digestive system.

  Aspects of the invention include orally administering to a subject a polypeptide construct disclosed herein to a disease symptom that can be modulated by a substance that controls platelet-mediated aggregation and can pass through the gastric environment without being inactivated. Is a method of treating, preventing and / or alleviating by.

  Another embodiment of the present invention is the use of an agent for treating, preventing and / or alleviating disease symptoms that can be modulated by substances that control platelet-mediated aggregation and can pass through the gastric environment without being inactivated. Use of the polypeptide construct disclosed herein for preparation.

  An aspect of the present invention is a method for delivering a substance that controls platelet-mediated aggregation to the digestive system without inactivating the substance by orally administering to the subject a polypeptide construct disclosed herein. is there.

  Aspects of the present invention provide a method of orally administering a polypeptide construct disclosed herein to a subject to deliver a substance that controls platelet-mediated aggregation to the bloodstream of the subject without inactivating the substance. It is.

  Another embodiment of the present invention is herein for use in the treatment, prevention, and / or alleviation of symptoms or diseases that can be modulated by substances that control platelet-mediated aggregation delivered to the vagina and / or rectum. The polypeptide construct disclosed in 1.

  By way of example, but not by way of limitation, a formulation according to the present invention is provided herein as a vaginal ring in the form of a gel, cream, suppository, film, or in the form of a sponge or that slowly releases the active ingredient over time. (Such formulations are described in European Patent Application Publication No. 707473, European Patent Application Publication No. 684814, US Pat. No. 5,609,001).

  Aspects of the invention can be modulated by agents that control platelet-mediated aggregation delivered to the vagina and / or rectum by vaginal and / or rectal administration of a polypeptide construct disclosed herein to the subject. A method of treating, preventing and / or alleviating possible disease symptoms.

  Another embodiment of the invention is the preparation of a medicament for treating, preventing and / or alleviating disease symptoms that can be modulated by substances that control platelet-mediated aggregation delivered to the vagina and / or rectum. For use of the polypeptide constructs disclosed herein.

  Aspects of the invention provide for inactivating a substance that controls platelet-mediated aggregation in the vagina and / or rectum by administering the polypeptide construct disclosed herein to the vagina and / or rectum of the subject. It is a method of delivering without letting.

  Embodiments of the invention inactivate a substance that controls platelet-mediated aggregation in the bloodstream of a subject by administering a polypeptide construct disclosed herein to the vagina and / or rectum of the subject It is a method of delivering without.

  Another embodiment of the present invention is for use in the treatment, prevention, and / or alleviation of disease symptoms that can be modulated by substances that control platelet-mediated aggregation delivered to the nose, upper respiratory tract, and / or lung. Polypeptide constructs disclosed herein.

  In one example, but not by way of limitation, a formulation according to the present invention comprises a polypeptide construct disclosed herein in the form of an intranasal spray (eg, aerosol) or inhaler. Because this polypeptide construct is small, it can reach its target much more efficiently than therapeutic IgG molecules.

  Aspects of the invention can be modulated by substances that control platelet-mediated aggregation delivered to the upper respiratory tract and lungs by administering to a subject the polypeptide construct disclosed herein by inhalation through the mouth or nose. Is a method of treating, preventing and / or alleviating various disease symptoms.

  Another embodiment of the present invention is for treating, preventing and / or alleviating disease symptoms that can be modulated by substances that control platelet-mediated aggregation delivered to the nose, upper respiratory tract, and / or lung. Use of a polypeptide construct disclosed herein for the preparation of a medicament, without inactivating said polypeptide.

  Aspects of the invention include platelet-mediated aggregation in the nose, upper respiratory tract, and lung without inactivation by administering the polypeptide constructs disclosed herein to the nose, upper respiratory tract, and / or lung of a subject. A method of delivering a substance that controls

  Aspects of the invention control platelet-mediated aggregation in a subject's bloodstream without inactivation by administering a polypeptide construct disclosed herein to the subject's nose, upper airway, and / or lung. A method of delivering a substance.

  One embodiment of the present invention provides a polypeptide disclosed herein for use in the treatment, prevention, and / or alleviation of disease symptoms that can be modulated by substances that control platelet-mediated aggregation delivered to the intestinal mucosa. In this case, intestinal mucosa permeability is increased due to the disease. Because the polypeptide construct disclosed herein is small in size, it more efficiently passes through the intestinal mucosa and reaches the bloodstream in subjects suffering from diseases that cause increased intestinal mucosal permeability. be able to.

  Aspects of the invention treat and prevent disease symptoms that can be modulated by substances that control platelet-mediated aggregation delivered to the intestinal mucosa by orally administering to a subject a polypeptide construct disclosed herein. In this case, the intestinal mucosa permeability is increased by the above-mentioned disease.

  This method can be further enhanced by the use of an additional aspect of the invention-active transport carrier. In this aspect of the invention, VHH is fused to a carrier that enhances transport through the intestinal wall and into the bloodstream. In one example, without limitation, this “carrier” is a second VHH fused to a therapeutic VHH. Such fusion constructs are made using methods known in the art. The “carrier” VHH specifically binds to a receptor on the intestinal wall that induces active transport through the intestinal wall.

  Another embodiment of the present invention is a book for the preparation of a medicament for treating, preventing and / or alleviating disease symptoms that can be modulated by substances that control platelet-mediated aggregation delivered to the intestinal mucosa. Use of the polypeptide construct disclosed in the specification, wherein intestinal mucosa permeability is increased by the disease.

  An aspect of the present invention is a method of delivering a substance that controls platelet-mediated aggregation to the intestinal mucosa without inactivation by orally administering the polypeptide construct of the present invention to a subject.

  An aspect of the invention is a method of delivering a substance that controls platelet-mediated aggregation to a subject's bloodstream without inactivation by orally administering the polypeptide construct of the invention to the subject.

  This method can be further enhanced by the use of an additional aspect of the invention-active transport carrier. In this aspect of the invention, the polypeptide construct described herein is fused to a carrier that enhances transport through the intestinal wall and into the bloodstream. In one example, without limitation, the “carrier” is VHH fused to the polypeptide. Such fusion constructs are made using methods known in the art. The “carrier” VHH specifically binds to a receptor on the intestinal wall that induces active transport through the intestinal wall.

  One embodiment of the present invention is for use in the treatment, prevention, and / or alleviation of disease symptoms that can be modulated by substances that control platelet-mediated aggregation that can efficiently pass through sublingual tissue. The polypeptide construct disclosed in the document. Formulations of the polypeptide construct disclosed herein, such as tablets, sprays, drops, are placed under the tongue, pass through the mucosa and are adsorbed onto the sublingual capillary network.

  Aspects of the invention can be modulated by substances that control platelet-mediated aggregation that can efficiently pass through the sublingual tissue by sublingual administration of the polypeptide constructs disclosed herein to the subject. A method of treating, preventing and / or alleviating disease symptoms.

  Another embodiment of the invention is the preparation of a medicament for treating, preventing and / or alleviating disease symptoms that can be modulated by substances that control platelet-mediated aggregation that can pass through sublingual tissue. For use of the polypeptide constructs disclosed herein.

  An aspect of the invention is a method of delivering a substance that controls platelet-mediated aggregation to a sublingual tissue without inactivation by sublingual administration of a polypeptide construct disclosed herein to a subject.

  An aspect of the present invention is a method of orally administering a polypeptide construct disclosed herein to a subject to deliver to the subject's bloodstream without inactivating a substance that controls platelet-mediated aggregation.

  One embodiment of the invention herein is for use in the treatment, prevention, and / or alleviation of disease symptoms that can be modulated by substances that control platelet-mediated aggregation that can effectively pass through the skin. A disclosed polypeptide construct.

  Formulations of the polypeptide construct, such as creams, films, sprays, drops, patches, are placed on the skin and penetrated.

  Aspects of the invention provide for the treatment of disease symptoms that can be modulated by substances that control platelet-mediated aggregation that can effectively pass through the skin by topical administration of a polypeptide construct disclosed herein to a subject. A method of treating, preventing and / or alleviating.

  Another embodiment of the invention is the preparation of a medicament for treating, preventing and / or alleviating disease symptoms that can be modulated by substances that control platelet-mediated aggregation that can effectively pass through the skin. For the use of the polypeptide constructs disclosed herein.

  An aspect of the invention is a method of delivering to a skin a substance that controls platelet-mediated aggregation without inactivation by topically administering the polypeptide construct disclosed herein to the subject.

  An aspect of the invention is a method of delivering a substance that controls platelet-mediated aggregation to a blood stream of a subject by locally administering to the subject a polypeptide construct disclosed herein.

  In another embodiment of the invention, a polypeptide construct disclosed herein is a carrier single domain that acts as an active transport carrier for transporting the polypeptide construct to the blood via the alveolar space. Further comprises an antibody (eg, VHH).

  The polypeptide construct further includes a carrier that specifically binds to a receptor present on the mucosal surface (bronchial epithelial cells) and allows active transport of the polypeptide from the alveolar space to the blood. A carrier single domain antibody can be fused to the polypeptide construct. Such fusion constructs have been made and described herein using methods known in the art. “Carrier” single domain antibodies specifically bind to receptors on the mucosal surface that induce active transport through the surface.

  Another aspect of the invention is a method of determining which single domain antibody (eg, VHH) is actively transported into the bloodstream immediately after nasal administration. Similarly, naive VHH or immune VHH phage libraries can be administered nasally, and blood or organs are isolated after various time points after administration to rescue phage that are actively transported into the bloodstream be able to. An example of a receptor for active transport from the alveolar space to the bloodstream is Fc receptor N (FcRn), but is not limited thereto. One aspect of the invention includes a VHH molecule identified by the method. Such VHH can then be used as a carrier VHH for delivering therapeutic VHH to the corresponding target in the bloodstream immediately after nasal administration.

  One embodiment of the present invention is a polypeptide construct disclosed herein for use in the treatment, prevention, and / or alleviation of disease symptoms associated with platelet-mediated aggregation or dysfunction thereof. Such diseases include thrombotic thrombocytopenic purpura (TTP), transient cerebral ischemic attacks, unstable or stable angina, cerebral infarction, myocardial infarction, peripheral arterial occlusive disease, restenosis. The diseases further include those resulting from coronary artery procedures such as coronary artery bypass grafting, coronary valve replacement; and angioplasty, stenting, atherectomy.

  Other diseases include non-occlusive thrombus formation, obstructive thrombus formation, arterial thrombus formation, acute coronary occlusion, restenosis, restenosis after PCTA or stenting, thrombus formation in stenotic arteries; angiogenesis Hyperplasia after surgery, atherectomy, or arterial stenting; obstructive syndrome in the vascular system, or poor patency of the diseased artery.

  One aspect of the present invention is a polypeptide construct disclosed herein for use in the treatment, prevention, and / or alleviation of a disease or condition associated with platelet-mediated aggregation or dysfunction thereof, wherein the polypeptide The construct is administered intravenously, transdermally, orally, sublingually, topically, nasally, vaginally, rectally, or by inhalation.

  Another aspect of the present invention is to construct a polypeptide as disclosed herein for the preparation of a medicament for treating, preventing and / or alleviating a disease or condition associated with platelet-mediated aggregation or dysfunction thereof. Use of the body, wherein the polypeptide construct is administered intravenously, transdermally, orally, sublingually, topically, nasally, vaginally, rectally, or by inhalation.

  Another aspect of the present invention is a method of treating, preventing and / or alleviating a disease or condition associated with platelet-mediated aggregation or dysfunction thereof comprising the polypeptide construct disclosed herein in a subject. Wherein the heterospecific polypeptide construct is administered intravenously, transdermally, orally, sublingually, topically, nasally, vaginally, rectally, or by inhalation. Is the method.

  Another aspect of the invention is a polypeptide construct disclosed herein for use in the treatment, prevention, and / or alleviation of a disease or condition associated with platelet-mediated aggregation or dysfunction thereof.

  Another aspect of the present invention is the use of a polypeptide disclosed herein for the preparation of a medicament for treating, preventing and / or alleviating a disease or condition associated with platelet-mediated aggregation or dysfunction thereof. Is use.

  The polypeptide constructs of the invention can be used to screen for agents that modulate the binding of the polypeptide to vWF (or gpIb or collagen). If an agent is identified in an assay that measures only binding or displacement of the polypeptide, it must be subjected to a functional test to determine whether it acts as a platelet-mediated aggregation modulator.

  In one example of a displacement experiment, a phage or cell expressing vWF or a fragment thereof is bound in a binding buffer, e.g., with a polypeptide represented by SEQ ID NO: 1, in the presence of increasing concentrations of a candidate modulator or Culture in the absence. To assess and correct the assay, a control competition reaction can be performed using increasing concentrations of the unlabeled polypeptide. After incubation, the cells are washed thoroughly and the bound labeled polypeptide is measured appropriately for a given label (eg, scintillation counting, fluorescence, etc.). A reduction of at least 10% in the amount of labeled polypeptide bound in the presence of the candidate modulator indicates transposition of binding by the candidate modulator. A candidate modulator is considered to specifically bind in this and other assays described herein if the candidate modulator replaces 50% of the labeled polypeptide (unsaturated polypeptide dose) at a concentration of 1 μM or less. . Of course, it is involved in the polypeptide represented by SEQ ID NO: 2-15, 20-47, 62-65 or the polypeptide construct disclosed herein and platelet-mediated aggregation such as vWF, gpIb, collagen etc. It would be easy to apply the above method to the screening of candidate modulators that alter the binding between macromolecules or fragments thereof.

  Alternatively, binding or binding displacement can be monitored by surface plasmon resonance (SPR). The surface plasmon resonance assay can be used as a quantification method to measure the binding between two molecules by a change in mass near the fixed sensor, which changes from the aqueous phase to the vWF immobilized on the membrane on the sensor. Or a fragment thereof, eg, by binding or loss of binding of the polypeptide represented by SEQ ID NO: 1. After injection or removal of the polypeptide or candidate modulator, this mass change is measured as a resonance unit over time and measured using a Biacore Biosensor (Biacore AB). vWF or fragments thereof can be immobilized on a sensor chip (eg, research grade CM5 chip, Biacore AB) in a lipid film, for example, by the method described by Salamon et al. (Salamon et al., 1996, Biophys J. 71 : 283-294, Salamon et al., 2001, Biophys. J. 80: 1557-1567, Salamon et al., 1999, Trends Biochem. Sci. 24: 213-219, each of which is incorporated herein by reference). Sarrio et al. Demonstrated that SPR can be used to detect binding of a ligand to a GPCR A (1) adenosine receptor immobilized on a lipid layer on a chip (Sarrio et al., 2000, Mol. Cell. Biol. 20 : 5164-5174, incorporated herein by reference). The binding conditions for the polypeptide constructs of the invention in the SPR assay can be fine tuned by those skilled in the art at the starting point using the conditions reported by Sarrio et al. Of course, the screening of candidate modulators that alter the binding between the polypeptide constructs disclosed herein and macromolecules or fragments thereof involved in platelet-mediated aggregation such as vWF, gpIb, collagen, etc. It will be easy to apply the method.

  SPR can perform binding modulator assays in at least two ways. One can pre-couple the polypeptide represented by SEQ ID NO: 1, for example, to immobilized vWF or fragments thereof, followed by injecting candidate modulators at concentrations ranging from 0.1 nM to 1 μM. Displacement of bound polypeptide can be quantified, allowing detection of modulator binding. Alternatively, membrane-bound vWF or a fragment thereof can be pre-cultured with a candidate modulator and challenged with, for example, the polypeptide represented by SEQ ID NO: 1. Difference in binding affinity between the polypeptide and vWF or fragment thereof pre-cultured with the modulator as compared to the binding affinity between the polypeptide and vWF or fragment thereof in the absence of a modulator. Demonstrates the binding or displacement of the polypeptide in the presence of a modulator. In either assay, a decrease of 10% or more in the amount of the polypeptide bound in the presence of the candidate modulator compared to the amount of the polypeptide bound in the absence of the candidate modulator results in the candidate modulator being vWF. Or it shows that the interaction with the fragment | piece and the said polypeptide was inhibited. Of course, it is involved in the polypeptide represented by SEQ ID NO: 2-15, 20-47, 62-65 or the polypeptide construct disclosed herein and platelet-mediated aggregation such as vWF, gpIb, collagen etc. It would be easy to apply the above method to the screening of candidate modulators that alter the binding between macromolecules or fragments thereof.

  For example, another method for detecting inhibition of binding of a polypeptide represented by SEQ ID NOs: 1-15, 20-34, 38-45, or 62-65 to vWF or a fragment thereof is fluorescence resonance energy transfer ( FRET). FRET is a quantum mechanical phenomenon that occurs when the emission spectrum of D overlaps with the excitation spectrum of A between a fluorescent donor (D) and a fluorescent acceptor (A) that are in close proximity (usually <100 mm). A molecule to be tested, for example, the polypeptide represented by SEQ ID NO: 1, and vWF or a fragment thereof are labeled with a complementary donor and acceptor fluorescent chromophore. The wavelength of fluorescence emitted simultaneously with excitation of the donor fluorochromophore while closely bound together by vWF: polypeptide interaction is the excitation wavelength when the polypeptide and vWF or a fragment thereof are not bound. Unlike the wavelength of the fluorescence emitted in response to the above, the bound molecule versus the unbound molecule is quantified by measuring the emission intensity at each wavelength. Donor fluorophores for labeling vWF or fragments thereof are well known in the art. Of particular importance are variants of A. Victoria GFP known as Cyan FP (CFP, Donor (D)) and Yellow FP (YFP, Acceptor (A)). As an example, a YFP variant can be made as a fusion protein with vWF or a fragment thereof. GFP mutant expression vectors (Clontech) and reagents labeled with fluorescent chromophores (Molecular Probes) are known in the art as fusions. By adding a candidate modulator to a mixture of fluorescently labeled polypeptide and YFP-vWF, energy transfer is inhibited, and this inhibition is demonstrated, for example, by a decrease in YFP fluorescence relative to a sample that does not contain the candidate modulator. . In assays that use FRET to detect vWF: polypeptide interactions, a decrease in fluorescence emission intensity by 10% or more at the acceptor wavelength in a sample with a candidate modulator compared to a sample without the candidate modulator FIG. 5 shows that the modulator inhibited the vWF: polypeptide interaction. Of course, the polypeptide represented by any of SEQ ID NOs: 2-15, 20-47, 62-65 or the polypeptide construct disclosed herein and involved in platelet-mediated aggregation such as vWF, gpIb, collagen, etc. It would be easy to apply the method to the screening of candidate modulators that alter the binding between the macromolecules or fragments thereof.

  A variation on FRET uses fluorescence quenching to monitor molecular interactions. One molecule of the interaction pair can be labeled with a fluorescent chromophore, and the other with a molecule that quenches the fluorescence of the fluorescent chromophore when placed in close proximity thereto. A change in fluorescence upon excitation indicates that the association of the tagged molecule of the fluorophore: quencher pair has changed. In general, an increase in fluorescence of labeled vWF or a fragment thereof indicates that a polypeptide molecule having a quencher (eg, a polypeptide construct of the invention) has been transposed. In the quenching assay, an increase in fluorescence emission intensity in the sample containing the candidate modulator by 10% or more compared to the sample without the candidate modulator indicates that the candidate modulator inhibited the vWF: polypeptide interaction. Of course, the screening of candidate modulators that alter the binding between the polypeptide constructs disclosed herein and macromolecules or fragments thereof involved in platelet-mediated aggregation such as vWF, gpIb, collagen, etc. It will be easy to apply the method.

  In addition to surface plasmon resonance and FRET methods, fluorescence polarization can also be used for binding quantification. The fluorescence polarization value of a fluorescently tagged molecule depends on the rotational correlation time or tumbling rate. By vWF or a fragment thereof associated with a fluorescently labeled polypeptide (eg, a polypeptide represented by any of fluorescently labeled SEQ ID NOS: 1-15, 20-34, 38-45, and 62-65) A complex such as a complex formed has a higher polarization value than a labeled polypeptide that is not a complex. If the candidate inhibitor disrupts or inhibits the interaction between vWF or a fragment thereof and the polypeptide by encapsulating a candidate inhibitor of vWF: polypeptide interaction, the mixture is free of candidate inhibitors. In comparison, the fluorescence polarization decreases. Fluorescence polarization is well suited for the identification of small molecules that disrupt the formation of vWF: polypeptide complexes. A decrease of 10% or more in fluorescence polarization in the sample containing the candidate modulator compared to fluorescence polarization in the sample without the candidate modulator indicates that the candidate modulator inhibited the vWF: polypeptide interaction. Of course, the screening of candidate modulators that alter the binding between the polypeptide constructs disclosed herein and macromolecules or fragments thereof involved in platelet-mediated aggregation such as vWF, gpIb, collagen, etc. It will be easy to apply the method.

  Another alternative to monitor vWF: polypeptide interactions uses biosensor assays. ICS biosensors have been described in the art (Australian Membrane Biotechnology Research Institute; Cornell B, Braach-Maksvytis V, KingL, Osman P, Raguse B, Wieczorek L, and Pace R. “Using ion channel switches. A biosensor that usesion-channel switches, Nature 1997, 387, 580). In this technique, the association of vWF or a fragment thereof with a polypeptide (eg, a polypeptide represented by any of SEQ ID NOs: 1-15, 20-34, 38-45, and 62-65) is suspended. It is associated with the closure of the gramicidin-promoted ion channel of the molecular membrane and thus with a measurable change in admittance (similar to impedance) of the biosensor. This method is a linear admittance change of more than six orders of magnitude and is ideally suited for large-scale high-throughput screening methods for small molecule combinatorial libraries. An admittance change (increased or decreased) of 10% or more in the sample containing the candidate modulator compared to the admittance of the sample not containing the candidate modulator indicates that the candidate modulator interacts with the polypeptide with vWF or a fragment thereof. Indicates inhibition. In an assay that tests the interaction of vWF or a fragment thereof with a polypeptide (eg, a polypeptide represented by any of SEQ ID NOs: 1-15, 20-34, 38-45, and 62-65) It is also important to note that the modulator of interaction need not necessarily interact directly with the domain of the protein that physically interacts with the polypeptide. Modulators may also interact at sites removed from the interaction site, causing, for example, vWF conformational changes. Modulators (inhibitors or agonists) that act in this manner are nevertheless important as agonists for modulating platelet-mediated aggregation. Of course, the screening of candidate modulators that alter the binding between the polypeptide constructs disclosed herein and macromolecules or fragments thereof involved in platelet-mediated aggregation such as vWF, gpIb, collagen, etc. It will be easy to apply the method.

  Any of the described binding assays can be used to determine whether an agent is present in a sample, eg, a tissue sample, which binds to vWF or a fragment thereof, or such as from SEQ ID NO: 1 to It affects the binding of vWF to a polypeptide represented by any of 15, 20-34, 38-45, or 62-65. To do so, vWF or a fragment thereof is reacted with the polypeptide in the presence or absence of a sample, and polypeptide binding is appropriately measured by the binding assay used. A decrease in binding of the polypeptide by 10% or more indicates that the sample contains an agent that modulates the binding between the polypeptide and vWF or a fragment thereof. Of course, the screening of candidate modulators that alter the binding between the polypeptide constructs disclosed herein and macromolecules or fragments thereof involved in platelet-mediated aggregation such as vWF, gpIb, collagen, etc. It would be easy to apply a generalized method.

Cells Useful cells according to the invention are preferably selected from the group consisting of bacterial cells such as E. coli, yeast cells such as S. cerevisiae and P. pastoris, insect cells, or mammalian cells.

  A cell useful according to the invention introduces a nucleic acid sequence encoding a polypeptide comprising any of SEQ ID NOs: 1-47 and 49-65 therein or encoding a polypeptide construct of the invention according to the invention. Any cell in which the polypeptide is expressed at or above the natural level as defined herein can be. The polypeptide of the invention expressed in a cell preferably exhibits normal or generally normal pharmacology as defined herein. The polypeptide of the present invention expressed in a cell comprises a nucleotide sequence capable of encoding the amino acid sequence shown in Table 30 or a nucleotide sequence capable of encoding an amino acid sequence at least 70% identical to the amino acid sequence shown in Table 30 Is most preferred.

  According to a preferred embodiment of the present invention, the cells consist of COS7 cells, CHO cells, LM (TK) cells, NIH-3T3 cells, HEK-293 cells, K-562 cells, or 1321N1 astrocytoma cells. Or selected from the group consisting of other transducible cell lines.

  In general, “therapeutically effective amount”, “therapeutically effective dose”, and “effective amount” are the amounts necessary to achieve the desired result or results (treating or preventing platelet aggregation). means. One of ordinary skill in the art can appreciate that the potency, and thus the “effective amount,” may vary with the various compounds used in the present invention that inhibit platelet-mediated aggregation. One skilled in the art can easily evaluate the strength of action of a compound.

  As used herein, the term “compound” refers to a polypeptide construct disclosed herein, or a nucleic acid capable of encoding the polypeptide, an agent identified by the screening methods described herein, or one or more derivatives. It refers to the above-mentioned polypeptide containing an amino acid.

  "Pharmaceutically acceptable" means a substance that is biologically or not undesirable, i.e., without causing or including any undesirable biological action. It means that the substance can be administered to an individual together with the compound without interacting in a deleterious manner with any of the other ingredients of the pharmaceutical composition.

  The invention disclosed herein is useful for treating or preventing a platelet-mediated aggregation condition in a subject and includes administering a pharmaceutically effective amount of a compound or composition that inhibits BTK and inhibits platelet-mediated aggregation. .

  The invention disclosed herein is useful for the treatment or prevention of the first process of thrombus formation in a subject and includes administering a pharmaceutically effective amount of a compound or composition according to the invention.

  The invention disclosed herein is useful for treating or preventing restenosis in a subject and includes administering a pharmaceutically effective amount of a compound or composition according to the invention.

  One aspect of the present invention is the use of a compound of the present invention for treating or preventing a platelet-mediated aggregation condition in a subject, wherein a pharmaceutically effective amount of the compound is administered in combination with another compound, such as aspirin. Including doing.

  One aspect of the present invention is the use of a compound of the present invention for treating or preventing a platelet-mediated aggregation condition in a subject, and in combination with another compound, such as a thrombolytic agent, a pharmaceutically effective amount of the compound Administration.

  Another aspect of the present invention is the use of a compound of the present invention for treating or preventing plaque or thrombus in an individual. The plaque formation or thrombus formation can be under highly severe conditions. In thrombosis and re-occlusion, platelets are reversibly adhered or locked at a high shear rate, followed by a strong adhesion by collagen receptors on the platelets, which activates the platelets, i.e. damages. It is particularly important under high shear conditions that platelets are anchored by vWF to exposed collagen in the received vessel wall. The inventors have found that the polypeptide constructs of the invention are unexpectedly successfully performed under high shear conditions (eg, Example 16).

  The present invention is not limited to administration of formulations containing a single compound of the present invention. It is within the scope of the present invention to provide a combination therapy in which a formulation comprising more than one compound of the present invention is administered to a patient in need thereof.

  Platelet-mediated aggregation conditions include but are not limited to unstable angina, stable angina, angina, embolization, deep vein thrombosis, hemolytic uremic syndrome, hemolytic anemia, acute renal failure , Thrombolytic complications, thrombotic thrombocytopenic purpura, disseminated intravascular comgelopathy, thrombosis, coronary heart disease, thromboembolic complications, myocardial infarction, restenosis, and atrium with atrial fibrillation Thrombus formation, Chronic unstable angina, Transient ischemic stroke and stroke, Peripheral vascular disease, Arterial thrombosis, Preeclampsia, Embolism; Angioplasty, Carotid endarterectomy, Vascular graft anastomosis Later restenosis and / or thrombosis; and chronic exposure to cardiovascular devices. Such conditions can also arise from thromboembolism and re-occlusion during and after thrombolytic treatment, after angioplasty, and after coronary artery bypass surgery.

  Methods for quantifying the inhibition of platelet-mediated aggregation using standard tests described herein or using other similar tests are well known in the art. Depending on the method, at least 10%, for example, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount in between Including platelet-mediated aggregation is preferably reduced, more preferably close to 90%.

  Similarly, the method has at least intracellular calcium mobilization, including, for example, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%. Should be reduced by 10%. Similarly, depending on the method, the concentration of phosphorylated PLCg 2 including, for example, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% Should be reduced by at least 10%.

  The decrease can be measured, for example, by comparing the optical impedance with an apparatus for measuring platelet aggregation over time. Any other known measurement method can be used. For example, (1) simultaneously with collagen stimulation, the concentration of intracellular calcium mobilization induced by collagen increases with time, so the measurement can include measuring the concentration of collagen-induced intracellular calcium, or (2) Simultaneously with collagen stimulation, the concentration of phosphorylated PLCg 2 increases with time, so the measurement may include measuring the concentration of phosphorylated PLCg 2.

  Cells can be produced, for example, by adding a compound of the invention to the medium in vitro (by continuous infusion, bolus delivery, or replacing the medium with compound-containing medium) or (local delivery, systemic delivery, inhalation, Contact can be achieved by adding the compound to the extracellular fluid in vivo (by intravenous injection, bolus delivery, or continuous infusion). The “contact” duration with a cell or cell population is determined by the time that the compound is present at a physiologically effective concentration or an estimated physiologically effective concentration in the medium or extracellular fluid in which the cells or cells are immersed. The contact duration is preferably 1 to 96 hours, more preferably 24 hours, but such times should vary based on the half-life of the compound and should be optimized by one skilled in the art using routine experimentation. Should be able to.

  The compounds that can be used in the present invention are formulated as pharmaceutical compositions and are adapted to a mammalian host such as a human patient or domestic animal in various forms adapted to the chosen route of administration, ie, oral or parenteral, Administration by intranasal, intravenous, intramuscular, topical, or subcutaneous routes by inhalation.

  The compounds of the invention can also be administered using gene therapy delivery methods. See, for example, US Pat. No. 5,399,346. The entirety of which is incorporated herein by reference. A first cell transfected using a gene therapy delivery method and a gene for a compound of the invention is further characterized by a tissue-specific promoter that targets a specific organ, tissue, graft, tumor, or cell. Can be introduced.

  Thus, the compounds of the present invention can be administered systemically, for example, orally, in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They can be enclosed in hard or soft gelatin capsules, tableted, or incorporated directly into patient food. For oral therapeutic administration, the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. it can. Such compositions and preparations should contain at least 0.1% of active compound. Of course, the proportions of the compositions and preparations can vary and can conveniently be from about 2 to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically usable compositions is such that an effective dosage level will be obtained.

  For tablets, troches, pills, capsules, etc .: binders such as gum tragacanth, acacia, corn starch, gelatin; excipients such as dicalcium phosphate; disintegrants such as corn starch, potato starch, alginic acid; magnesium stearate And other sweeteners such as sucrose, fructose, lactose, or aspartame; and flavoring agents such as peppermint, winter green oil, and cherry flavoring. When the unit dosage form is a capsule, in addition to the above types of substances, it may contain a liquid carrier such as vegetable oil or polyethylene glycol. Various other materials may be present as coatings to otherwise modify the physical form of the solid unit dosage form. For example, tablets, pills, capsules can be coated with gelatin, wax, shellac, sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl or propylparabens as preservatives, a coloring agent and flavoring such as cherry or orange flavor. Of course, any substance used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts used. In addition, the active compound can be incorporated into sustained-release preparations and devices.

  The active compound can also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with harmless surfactants. Dispersants can also be prepared with glycerol, liquid polyethylene glycols, triacetin, mixtures thereof, and oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

  Pharmaceutical dosage forms suitable for injection or infusion include sterile aqueous solutions, dispersions, or sterile injection or infusion solutions or dispersions as appropriate, formulated with active ingredients, optionally encapsulated in liposomes. Sterile powders may be included. In all cases, the best dosage form must be sterile liquid and stable under the conditions of manufacture and storage. Liquid carriers or vehicles include, for example, water, ethanol, polyol (eg, glycerol, propylene glycol, liquid polyethylene glycols, etc.), vegetable oils, non-toxic glyceryl esters Or a solvent or liquid dispersion medium containing a suitable mixture thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The action of microorganisms is prevented by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers, sodium chloride. By using an absorption delaying agent such as aluminum monostearate or gelatin in the composition, the injectable composition can be absorbed for a long time.

  Sterile injectable solutions are prepared by incorporating the required amount of active compound in a suitable solvent, including some of the other previously listed ingredients required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are the vacuum drying technique and the lyophilization technique, by which any additional desired ingredients present in the solution that have been previously sterile filtered into the active ingredient are added. The added powder is brought about.

  For topical administration, ie when the compound is liquid, the compounds of the invention can be applied in pure form. In general, however, it is desirable that the compound be administered to the skin as a composition or formulation in combination with a skin-acceptable carrier, which may be solid or liquid.

  Solid carriers that can be used include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Liquid carriers that can be used include water, hydroxyalkyl, glycols, or water-alcohol / glycol blends, in which case the compounds of the invention are dissolved in effective concentrations, optionally using non-toxic surfactants. Or can be dispersed. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resulting liquid composition can be applied from an absorbent pad and used to impregnate bandages and other dressings, or can be sprayed onto the affected area using a pump type or aerosol spray.

  Application pastes, gels, ointments for direct application to the user's skin using thickeners with liquid carriers such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified cellulose, modified mineral substances Soap can also be formed.

  Examples of usable topical compositions that can be used to deliver compounds to the skin are known in the art, such as Jacquet et al. (US Pat. No. 4,608,392), Geria (US Pat. No. 4,992,478), Smith. (US Pat. No. 4,559,157) and Wortzman (US Pat. No. 4,820,508).

  The dose of a compound that can be used can be quantified by comparing its in vitro activity and in vivo activity in animal models. Methods for estimating effective doses for mice and other animals up to humans are known in the art, see, eg, US Pat. No. 4,938,949.

  Generally, the concentration of the compound in a liquid composition such as a lotion is about 0.1 to 25 wt%, preferably about 0.5 to 10 wt%. The concentration in a semi-solid or solid composition such as a gel or powder is about 0.1-5 wt%, preferably about 0.5-2.5 wt%.

  The amount of the compound, active salt, or derivative thereof required for therapeutic use will vary not only depending on the particular salt selected, but also on the route of administration, the nature of the condition being treated, age, and the condition of the patient, Ultimately left to the discretion of the attending physician or clinician. The dose of the compound will also vary depending on the target cell, tumor, tissue, graft, or organ.

  The desired dose may conveniently be provided as a single dose or as divided doses administered at appropriate intervals, eg, 2, 3, 4 or more sub-doses per day. The sub-dose itself can be divided into several more roughly divided doses, such as multiple inhalations from a nebulizer or multiple instillation applications.

  The treatment plan may include long-term daily treatment. “Long term” means a duration of at least 2 weeks, preferably weeks, months or years. The required changes in this dose range can be determined by one of ordinary skill in the art using only routine experimentation taught herein. See Remington's Pharmaceutical Sciences (4th edition, Martin, E. W.), Mack Publishing Co., Easton, PA. In the case of any complication, the individual physician can adjust the dose.

  The present invention provides agents that are platelet-mediated aggregation modulators.

  Candidate agents can be synthetic agents, mixtures of agents, or natural products (eg, plant extracts or culture supernatants). Candidate agents according to the present invention include small molecules that can be synthesized, natural extracts, peptides, proteins, carbohydrates, lipids and the like.

  Candidate modulator agonists can be screened from large libraries of synthetic or natural agonists. A number of means are currently used for random and targeted synthesis of saccharide, peptide, and nucleic acid based agents. Synthetic agonist libraries include several, including Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, NJ, USA), Brandon Associates (Merrimack, NH, USA), Microsource (New Milford, CT, USA) Commercially available from companies. A rare chemical library is available from Aldrich (Milwaukee, Wis., USA). Combinatorial libraries can also be obtained and prepared. Alternatively, natural drug libraries in the form of bacterial, fungal, plant, and animal extracts can be obtained from, for example, Pan Laboratories (Bothell, Washington, USA), Myco Search (North Carolina, USA), or It can be easily generated by methods well known in the art. In addition, natural libraries, synthetically generated libraries, and agonists are readily modified by conventional chemical, physical, and biochemical means.

  Useful agonists can be found within numerous chemical classes. Useful agonists will be organic agonists or small organic agonists. The molecular weight of the small organic agonist is greater than 50 daltons but less than about 2,500 daltons, preferably less than about 750 daltons, and more preferably less than about 350 daltons. Exemplary classes include heterocycles, peptides, saccharides, steroids, and the like. This agent can be modified to enhance efficacy, stability, pharmaceutical compatibility, and the like. Another agent can be identified, generated, or screened using the structural identification of the agent. For example, when peptide agonists are identified, they can be functionalized at various amino or carboxyl termini such as: acylation or alkylation for amino groups, esterification or amidation for carboxyl groups ( amidification) and the like, non-natural amino acids such as D amino acids, particularly D alanine can be used and modified to enhance their stability.

  In the first screen, useful concentrations of candidate agents according to the present invention are from about 10 mM to about 100 μM or higher (ie, 1 mM, 10 mM, 100 mM, 1M, etc.). Used with 9 additional concentrations up to the first screening concentration, where the additional concentration is semilogarithmically used for the second screening or to generate a concentration curve. Determine by decreasing at intervals (eg, 9 more concentrations).

High-throughput screening kit The high-throughput screening kit according to the present invention contains all the means and media necessary to carry out the detection of agents that modulate platelet-mediated aggregation, and is targeted to the targets of the present invention, such as vWF and fragments thereof. In the presence of a polypeptide (eg, a polypeptide represented by SEQ ID NOs: 1-15, 20-34, 38-45, 62-65, or a polypeptide construct), preferably in a concentration range of 1 μM to 1 mM. Detect by interacting. The kit includes: A recombinant cell of the invention that contains and expresses a nucleotide sequence encoding vWF or a fragment thereof on a solid support, such as a microtiter plate, more preferably on a 96-well microtiter plate according to the kit. Cells which grow according to methods well known in the art, in particular those described in WO 00/02045. Alternatively, vWF or a fragment thereof is provided in a purified form, for example, for fixation by a person skilled in the art on a 96-well microtiter plate. Alternatively, vWF or a fragment thereof is provided in the kit, for example, pre-fixed on a 96-well microtiter plate. Alternatively, where the macromolecule to be screened is gpIb, gpIa / IIa, or collagen, the above embodiments comprise a gpIb, gpIa / IIa, or collagen polypeptide or polynucleic acid, respectively, instead of vWF become. The kit may include more than one type of macromolecule (eg, vWF, gpIb, collagen macromolecule, and / or polynucleic acid). The modulator agonist according to the present invention is added to a given well at a concentration of about 1 μM to 1 mM or more in the presence of an appropriate concentration of the polypeptide construct. The concentration of the polypeptide is preferably in the range of 1 μM to 1 mM. The kit may include more than one polypeptide.

  The binding assay is performed according to the methods already disclosed herein, for example in the absence of a modulator agonist to which the results have been added, but for example a polypeptide of vWF or a fragment thereof, eg SEQ ID NO: 2-15 , 20-34, 38-45, or 62-65, etc. Show (for example) at least 2-fold, preferably 5-fold, more preferably 10-fold, most preferably 100-fold or more increase or decrease in vWF-polypeptide binding compared to the level of activity in the absence of modulator Wells are selected for further analysis.

Other Kits Useful According to the Invention The present invention provides kits useful for screening for platelet-mediated aggregation modulators and kits useful for diagnosing diseases or disorders characterized by dysregulated platelet-mediated aggregation. Kits useful in accordance with the present invention may include isolated vWF or fragments thereof. Alternatively or additionally, the kit may include cells transformed to express vWF or a fragment thereof. In another embodiment, the kit according to the invention may comprise a polynucleotide encoding vWF or a fragment thereof. In yet another embodiment, a kit according to the present invention may include specific primers useful for amplification of vWF or fragments thereof. Alternatively, if the macromolecule to be screened is gpIb or collagen, the above embodiments comprise gpIb, gpIa / IIa, collagen polypeptide, or polynucleic acid, or fragments thereof, respectively, instead of vWF Become. The kit may include more than one macromolecule (eg, vWF, gplb, collagen macromolecule, or polynucleic acid, or fragments thereof). A kit that can be used according to the present invention includes an isolated polypeptide represented by any of SEQ ID NOs: 1-15, 20-47, or 62-65, a homologue thereof, or a functional part thereof, or a book. Polypeptide constructs according to the invention may be included. The kit according to the present invention may include cells transformed to express the polypeptide. The kit may include more than one polypeptide. In another embodiment, a kit according to the invention may include a polynucleotide encoding a macromolecule, eg, vWF, gpIb, collagen, or a fragment thereof. In yet another embodiment, a kit according to the invention may include specific primers useful for amplification of macromolecules such as, for example, vWF, gpIb, collagen, or fragments thereof. Accordingly, all kits according to the present invention include the item or combination of items described and the packaging material. The kit also includes instructions for use.

Medical Device The present invention also provides an invasive medical device coated with an agent obtained from the polypeptide construct of the present invention or the screening method of the present invention for use in a device in need thereof. Examples of instruments include, but are not limited to, surgical tubes, occlusion instruments, and prosthetic instruments. Applications of the instrument include surgical procedures that require regulation of platelet-mediated aggregation around the invasive site.

  One embodiment of the invention is a method of treating an invasive medical device for preventing platelet-mediated aggregation around an invasive site, comprising coating the device with a polypeptide construct or agent according to the invention.

  Another embodiment of the present invention is an invasive medical device that surrounds platelet-mediated aggregation around the site of invasion, in which case the device is coated with a polypeptide construct or agent according to the present invention.

It is a figure which shows the interaction involved in the platelet aggregation 1st stage. It is a figure which shows the interaction involved in the platelet aggregation 1st stage. It shows that VHH inhibits the interaction between vWF and collagen. FIG. 5 shows the binding to vWF by purified VHH as quantified by ELISA as described in Example 7. FIG. 10 shows an ELISA for testing inhibition of binding of vWF and collagen by VHH described in Example 9. FIG. 12 shows a Western blot showing the expression of the A3 domain of vWF as a fusion with OprI on the surface of E. coli described in Example 11. FIG. 3 shows a restriction map of the multicloning site of PAX011 for constructing a bivalent or bispecific nanobody. FIG. 14 shows ELISA binding of monovalent VHH versus bivalent and bispecific VHH to purified vWF as described in Example 13. FIG. 16 shows the bispecific VHH stability described in Example 15 in human plasma immediately after culture at 37 ° C. for up to 24 hours. It is a figure which shows the interaction involved in the platelet aggregation 1st stage. It is a figure which shows that VHH has inhibited the interaction between vWF and platelets. FIG. 18 shows a Western blot showing the expression of the AWF domain of vWF as a fusion with OprI on the surface of E. coli described in Example 18. FIG. 14 shows the binding of purified VHH to vWF as described in Example 20 quantified by ELISA. FIG. 22 shows inhibition of binding of gpIb and VWF by A50 and A38 (negative control) described in Example 21. It is a figure which shows the interaction involved in the platelet aggregation 1st stage. Specific to vWF, with one VHH that inhibits the interaction between vWF and collagen, and a second VHH that is specific to vWF but inhibits the interaction between vWF and platelets Bispecific constructs are shown. FIG. 29 shows binding to vWF by ELISA as described in Example 28. It is a figure which shows the interaction involved in the platelet aggregation 1st stage. VHH is specific for collagen and inhibits the interaction between vWF and collagen. It is a figure which shows the refinement | purification VHH described in Example 34, and the coupling | bonding of collagen type I and type III. FIG. 14 shows a phage ELISA described in Example 44 showing the presence of HSA-specific nanobodies in the library. FIG. 49 shows the binding of plasma expressing an albumin binding substance and plasma blotted onto nitrocellulose as described in Example 48. FIG. 14 shows Coomassie staining of plasma samples on SDS-PAGE described in Example 48. FIG. 14 shows the binding between purified nanobody and mouse albumin quantified by ELISA described in Example 50. FIG. 22 shows a bispecific construct described in Example 51 with one VHH that binds albumin and a second VHH that binds vWF to improve half-life. FIG. 14 shows a sandwich ELISA showing the functionality of both VHHs of the bispecific construct described in Example 53. It is a figure which shows the interaction involved in the platelet aggregation 1st stage. It shows that VHH is specific for gpIb and inhibits the interaction between vWF and platelets. FIG. 5 shows the residual activity of C37 stored at −20 ° C. compared to C37 cultured at 37 ° C. for up to 194 hours. As described in Example 61, the stability of C37 is compared to the stability of a scFv specific for the B3 antigen and a stable dsFv (stabilized by two disulfide bonds). FIG. 14 shows the inhibitory activity of C37 stored at −20 ° C. compared to C37 cultured at 37 ° C. for 1 year as described in Example 61. It is a figure which shows the coupling | bonding of C37 fixed to human plasma origin vWF described in Example 62, and acrylamide. FIG. 6 shows a comparison of the amino acid sequences of human germline sequences DP-47 and C37 described in Example 63. FIG. 6 shows inhibition of binding of C37 and C37hum vWF to collagen as quantified by ELISA as described in Example 64. It is a figure which shows the coupling | bonding of rA1 with the A11, A12, A13, A14, A15, and A16 clones measured by ELISA. It is a figure which shows the coupling | bonding of vWF and the A11, A12, A13, A14, A15, and A16 clones measured by ELISA.

  The invention is illustrated by the following non-limiting examples.

Description of Examples Example 1 Immunization of Rama 002 Example 2 Repertoire cloning Example 3. Library rescue, phage preparation

Selection of vWF binding substances that inhibit the interaction with collagen:
Example 4 Selection of vWF binding substance that inhibits interaction with collagen by first and second round panning Example 5 Functional characterization of vWF binding substances. Example 5. Inhibition of binding of vWF and collagen by VHH. Expression and purification of VHH. ELISA binding to vWF Example 8 Specificity of VHH Example 9 Inhibition ELISA with purified VHH
Example 10 Clone Sequencing Example 11. Epitope mapping Example 12. Expression and purification of bivalent and bispecific VHH Example 13 Binding to vWF in ELISA Example 14. Inhibition ELISA with purified VHH
Example 15. Stability of bivalent or bispecific constructs in human plasma Example 16. Evaluation of inhibition by VHH under high shear stress

Selection of vWF-binding substances that inhibit the interaction with platelets:
Example 17. Selection of vWF binding substances that inhibit interaction with platelets by panning Example 18. Screening for binding of vWF to A1 domain Example 19 Selection of vWF binding substance that inhibits interaction with platelets using MATCHM Example 20 ELISA binding of purified VHH to vWF Example 21. Inhibition ELISA with purified VHH
Example 22. Clone Sequencing Example 23. Evaluation of inhibition by VHH under high shear stress Example 24. Expression and purification of divalent VHH Example 25. Evaluation of inhibition by VHH under high shear stress

Create a bispecific construct for vWF-specific VHH:
Example 26. Construction and sequencing of bispecific constructs Example 27. Expression and purification of bispecific constructs Example 28. Example 29. Binding to vWF Inhibition of vWF-collagen binding by bispecific constructs compared to monovalent VHH. Evaluation of inhibition by VHH under high shear stress

Screening for collagen type I and type III binding substances:
Example 31. Selection of Binding Substance to Collagen Type I Example 32. Example 33. VHH binding to collagen type I and type III by ELISA Clone Sequencing Example 34. Binding of purified VHH to collagen types I and III Example 35. Selection of Collagen Type I Binding Substance that Inhibits Interaction with vWF Example 36. Example 37. Binding of VHH to collagen type I and type III by ELISA Clone Sequencing Example 38. Binding of purified VHH to collagen types I and III Example 39. Inhibition of binding of vWF and collagen by collagen-specific VHH tested by ELISA Example 40 Tested for platelet aggregation inhibition by collagen-specific VHH under low and high shear stress

Improved VHH half-life:
Example 41. Rama immunization Example 42. Repertoire cloning Example 43. Library rescue, phage preparation Example 44. Phage ELISA
Example 45. Selected First and Second Round Biopanning Example 46. Screening of individual clones after biopanning Example 47. HinfI pattern and sequencing Example 48. Example 49. Testing cross-reactivity with different species of albumin Expression and Purification Example 50. ELISA for MSA of purified nanobody
Example 51. Construction and sequencing of bispecific constructs Example 52. Expression and purification of bispecific constructs Example 53. Functionality of both VHHs of the bispecific construct Example 54. Inhibition of vWF-collagen binding by bispecific constructs compared to monovalent VHH.

Selection of gpIb binding substances that inhibit the interaction with vWF:
Example 55. Selection of rgpIb binding substance Example 56. Screening for binding substances by ELISA Example 57. Binding of purified VHH to rgpIb Example 58. Clone Sequencing Example 59. Example 60: Inhibitory properties of VHH specific for gpIb Evaluation of inhibition by VHH under high shear stress

Coating of stents, tubes, balloons, catheters and implants with VHH:
Example 61. VHH Stability Example 62. VHH fixed in polymer

Humanization of C37:
Example 63. Sequence comparison of C37 and DP-47 Example 64. Mutagenesis of C37

Anti-VWF VHH fragment Example 65. Expression of VHH-CDR3 fragment of vWF-C37 Example 66. Selection by biopanning of the first and second rounds against recombinant A1 (rA1) Example 67. Screening of individual clones after biopanning Example 68. HinfI pattern and sequencing Example 69. Inhibition ELISA

(Example)
Example 1: Immunization of Llama 002
One llama was immunized with vWF and collagen type I and type III cocktails. All of these antigens are involved in the first interaction that results in platelet aggregation (FIG. 1). The immunization scheme is summarized in Table 1.

Example 2: Repertoire cloning Peripheral blood lymphocytes (PBL) were isolated by density gradient centrifugation (Ficoll-Paque Plus Amersham Biosciences). Total RNA was extracted using PBL (Chomczynski and Sacchi 1987). cDNA was prepared using oligo d (T) oligonucleotide with MMLV reverse transcriptase (GibcoBRL) based on 100 μg of total RNA. The cDNA was purified by phenol / chloroform extraction, ethanol precipitated, and then used as a template to amplify the VHH repertoire.

In the first PCR, a repertoire of conventional antibody (1.6 kb) and heavy chain (1.3 kb) antibody gene segments was recombined with a leader-specific primer (5'-GGCTGAGCTCGGTGGTCCTGGCT-3 ') and an oligo d (T) primer (5'- AACTGGAAGAATTCGCGGCCGCAGGAATTTTTTTTTTTTTTTTTT-3 ') was used for amplification. The obtained DNA fragments were separated by agarose gel electrophoresis, and the 1.3 kb fragment encoding the heavy chain antibody segment was purified from the agarose gel. The second PCR was performed using a mixture of FR1 reverse primer and the same oligo d (T) forward primer. The PCR product was digested with SfiI (introduced in the FR1 primer) and BstEII (naturally occurring in FR4). After gel electrophoresis, a DNA fragment of about 400 base pairs was purified from the gel and ligated into the corresponding restriction sites of phagemid pAX004, resulting in a cloned VHH library after electroporation of E. coli TG1. The library size was 1.4 × 10 ⁷ cfu and all clones contained the correct size insert.

Example 3: Library Rescue, Phage Preparation The library was grown at 37 ° C. in 10 ml of a 2-fold dilution of TY medium containing 2% glucose and 100 μg / ml ampicillin until OD600nm reached 0.5. M13KO7 phage (10 ¹² ) was added and the mixture was incubated twice at 37 ° C. for 30 minutes each time without shaking the first time and then at 100 rpm. The cells were centrifuged at 4500 rpm for 10 minutes at room temperature. The bacterial pellet was resuspended in 50 ml of a 2-fold dilution of TY medium containing 100 μg / ml ampicillin and 25 μg / ml kanamycin and cultured overnight at 37 ° C. and 250 rpm with vigorous stirring. The overnight culture was centrifuged at 4 ° C. and 10,000 rpm for 15 minutes. Phages were PEG precipitated (20% polyethylene-glycol and 1.5M NaCl) and centrifuged at 10000 rpm for 30 minutes. The pellet was resuspended in 20 ml PBS. The phage was PEG precipitated again and centrifuged at 4 ° C. and 20000 rpm for 30 minutes. The pellet was dissolved in 5 ml of PBS-casein 1% solution. Phage were titrated by infecting TG1 cells at OD600nm = 0.5 and seeded on LB agar plates containing 100 μg / ml ampicillin and 2% glucose. The number of transformants indicates the number of phages (= pfu). Phages were stored at -80 ° C. with 15% glycerol.

Selection of vWF binding substances that inhibit the interaction with collagen (Figure 2)
Example 4: Selection of vWF binding agent that inhibits interaction with collagen: first and second round panning The wells of a microtiter plate were coated with 2 μg / ml vWF or PBS containing 1% casein. After incubation at 4 ° C. overnight, the wells were blocked with PBS containing 1% casein for 3 hours at room temperature. 200 μl of phage was added to the wells. After 2 hours of incubation at room temperature, the wells were washed 10 times with PBS-Tween and 10 times with PBS. Phages were specifically eluted with 100 μl of collagen type III at 100 μg / ml. Elution was performed overnight at room temperature. The eluted phage was left to infect exponentially growing TG1 cells and then seeded on LB agar plates containing 100 μg / ml ampicillin and 2% glucose. This experiment was repeated for the second round of panning under the same conditions as above. Table 2 shows the results of panning.

Example 5: Functional characterization of vWF binding material: Inhibition of vWF and collagen binding by VHH Microtiter plates were coated overnight at 4 ° C with PBS containing collagen type III at 25 μg / ml. The plate was washed 5 times with PBS-Tween and blocked with PBS containing 1% casein for 2 hours at room temperature. The plate was washed 5 times with PBS-Tween. In a microtiter plate well, 100 μl of 2 μg / ml vWF (vWF pre-cultured at 37 ° C. for 15 minutes) is mixed with 20 μl of periplasmic extract containing VHH antibody (described in Example 6) and incubated at room temperature for 90 minutes did. The plate was washed 5 times with PBS-Tween. Anti-vWF-HRP monoclonal antibody (DAKO) was diluted 3,000 times with PBS and cultured for 1 hour. The plate was washed 5 times with PBS-Tween and vWF-binding was detected with ABTS / H ₂ O ₂ . The signal was measured at 405 nm after 30 minutes. Table 3 shows the results indicating that the inhibitor was obtained after the first and second rounds of panning.

Example 6: VHH expression and purification Plasmids were prepared for vWF binding agents that inhibit interaction with collagen type III and transformed into WK6 electro-adaptive cells. A single colony was used to start overnight culture in LB containing 2% glucose and 100 μg / ml ampicillin. This overnight culture was diluted 100-fold with 300 ml of TB medium containing 100 μg / ml ampicillin and cultured at 37 ° C. until OD600 nm = 0.5. 1 mM IPTG was added and the culture was incubated at 37 ° C. for an additional 3 hours or overnight at 28 ° C.

  The culture was centrifuged at 4 ° C. and 10,000 rpm for 20 minutes. The pellet was frozen overnight or at -20 ° C for 1 hour. The pellet was then thawed at room temperature for 40 minutes, resuspended in 20 ml PBS and shaken on ice for 1 hour. The periplasmic fraction was isolated by centrifugation at 4 ° C., 20000 rpm for 20 minutes. The supernatant containing VHH was put into Ni-NTA and purified to homogeneity. The yield of VHH was calculated by the extinction coefficient. The results are summarized in Table 4.

Example 7: Binding to ELISA: vWF Microtiter plates were coated overnight at 4 ° C. with 2 μg / ml vWF. The plate was blocked for 2 hours at room temperature with 300 μl of PBS solution containing 1% casein. The plate was washed 3 times with PBS-Tween. Dilution series of all purified samples were incubated at room temperature for 2 hours. The plate was washed 6 times with PBS-Tween, then 1 hour at room temperature with PBS containing mouse anti-myc mAB at 1/2000, followed by 1 at room temperature with PBS containing 1/1000 anti-mouse-HRP conjugate. VHH binding was detected by incubation for a period of time. Staining was performed with the substrate ABTS / H ₂ O ₂ and after 30 minutes the signal was measured at 405 nm. The binding as a function of purified VHH concentration is shown in FIG.

Example 8: Specificity of VHH Microtiter plates were coated with 2 μg / ml vWF and three other antigens that were not involved in platelet aggregation but were also immunized with Rama 002. ELISA was performed with 670, 67, and 6.7 nM VHH as described in Example 7. The results are summarized in Table 5. The results show that the inhibitory VHH is specific for vWF.

Example 9: Inhibition ELISA using purified VHH
Inhibition ELISA was performed as described in Example 5, but instead of using purified vWF or human undiluted plasma, it was performed with 1/60 dilution of human plasma with decreasing concentrations of VHH. The results are shown in FIG. The concentration of VHH resulting in 50% inhibition (IC50) is shown in Table 6.

Example 10: Sequencing of clones Clones were sequenced with the universal reverse primer M13. The amino acid sequence is shown in Table 30 (SEQ ID NOs: 1, 3, 4, 5, 6, and 7).

Example 11: Epitope mapping
Cloning vWF A3 domain with pBAD-OprI-ss
The pBAD-OprI-strep-spec vector was used to display the VWF A3 domain as a fusion with OprI on the cell surface of UT5600 E. coli (F-ara-14 leuB6 azi-6 lacY1 proC14 tsx-67 entA403 trpE38 rfbD1 rpsL109 xyl-5 mtl-1 thi1 DompT fepC266) (Cote-Sierra et al., 1998, Gene, 221: 25-34). The gene encoding the A3 domain of vWF (201aa) was amplified by PCR using pre-A3 and A3 reverse PCR primers.
Before A3: CTG GTG CTG CAG AGG TGA AGC TTC GGA GAG GGG CTG CAG ATC
A3 reverse: ATC CAT GCA AAT CCT CTA GAA TCC AGA GCA CAG TTT GTG GAG

  Fragments and vectors were digested with HindIII and XbaI, ligated into UT5600 and transformed (= pBAD-vWF A1 / pBAD-vWF A3). Transformed cells were seeded on LB agar plates containing 20 μg / ml streptomycin, 50 μg / ml spectinomycin.

  The pBAD-vWF A3 plasmid was transformed into UT5600F cells and seeded on LB agar plates containing 20 μg / ml streptomycin, 50 μg / ml spectinomycin. A single colony was used to inoculate LB medium containing 20 μg / ml streptomycin, 50 μg / ml spectinomycin. The cells were grown overnight at 37 ° C. and 200 rpm. The next day, cells were induced with 0.2% arabinose and cultured for an additional hour at 37 ° C. and 150 rpm. To perform Western blotting, whole cell lysates were boiled in reducing sample buffer, loaded on 12% SDS-PAGE and transferred to nitrocellulose. The transferred protein was detected using a monoclonal anti-OprI antibody (SH2.2) (Cote-Sierra et al., 1998, Gene, 221: 25-34). Anti-mouse IgG conjugated with alkaline phosphatase was added (Sigma) and the blot developed with BCIP / NBT (FIG. 5).

The pBAD-vWF-A3 plasmid was transformed into UT5600F cells and seeded on LB agar plates containing 20 μg / ml streptomycin, 50 μg / ml spectinomycin. A single colony was used to inoculate LB medium containing 20 μg / ml streptomycin, 50 μg / ml spectinomycin. The cells were grown overnight at 37 ° C. and 200 rpm. The next day, cells were induced with 0.2% arabinose and cultured for an additional hour at 37 ° C. and 150 rpm. Microtiter plates were coated overnight at 4 ° C. with monoclonal anti-OprI antibody (SH2.2) diluted 1/1000 in PBS and blocked for 2 hours at room temperature with PBS containing 1% casein. After induction, all cells were allowed to bind to the plate for 1 hour at room temperature. The plate was washed 5 times with PBS-Tween. Single colony phage preparations were allowed to bind for 2 hours at room temperature. The plate was washed 5 times with PBS-Tween. Anti-M13HRP conjugate was used to detect phage bound to E. coli cells expressing the A3 domain or to inappropriate antigens on its surface. The plate was washed 5 times with PBS-Tween. Staining was performed with ABTS / H ₂ O ₂ and after 30 minutes the signal was measured at 405 nm. The results are summarized in Table 7.

Example 12: Bivalent and bispecific VHH: expression and purification An E. coli production vector pAX11 was designed (Figure 6). This allows for two-step cloning of bivalent or bispecific VHH.

  First, the carboxy-terminal VHH is cloned with PstI and BstEII, and in the second step, the other VHH is inserted with SfiI and NotI that do not cut within the first gene fragment. This procedure avoids the implementation of new sites by amplification, thereby avoiding the risk of introducing PCR errors. The sequences are shown in Table 30 (SEQ ID NOs: 8, 9, 10, 11, and 12).

  The protein was expressed and purified as described in Example 6. It was necessary to perform an additional purification step with superdex 75 to remove some monovalent degradation products (5-10%). The yields obtained for 1 liter expression and purification of the bivalent protein in E. coli are summarized in Table 8.

Example 13: Binding to vWF by ELISA As described in Example 7, binding to vWF was tested by ELISA and compared to the binding of monovalent VHH. The results are shown in FIG. It is clear from the results that bivalent and bispecific VHH shows strong binding to vWF when compared to monovalent VHH.

Example 14: Inhibition ELISA with purified VHH
As described in Example 5, inhibition of binding of vWF to collagen was tested for monovalency compared to divalent VHH. Instead of using purified vWF, 1/60 dilution of human, baboon and pig plasma was used in parallel. IC50 values are summarized in Table 9.

Example 15: Stability of bivalent or bispecific constructs in human plasma The stability of bivalent constructs was tested by culturing in human plasma at 37 ° C. AM-4-15-3 / AM2-75 was cultured at 37 ° C. in human plasma at a concentration of 38 μg / ml. Samples were removed after 1, 2, 3, 6, and 24 hours of culture. Samples were diluted 10-fold and analyzed by Western blot. The results are summarized in FIG. The bivalent construct has been shown to be stable in human plasma at 37 ° C. for at least 24 hours.

Example 16: Evaluation of inhibition by VHH under high shear stress Cover glass (18 x 18 mm, Menzel Glaeser) was washed overnight with a solution of chromosulfuric acid (2% chromium trioxide) and distilled. After rinsing with water, it was sprayed. Monomeric collagen type III was dissolved in 50 mmol / L acetic acid and sprayed onto a cover glass at a density of 30 μg / cm ² with a retouching airbrush (Badger model 100, Badger Brush Co). After spraying, the collagen surface is blocked with 1% human albumin in PBS (10 mmol / L phosphate buffer, pH 7.4, and 0.15 mol / L NaCl) for 1 hour, followed by non-specific perfusion Protein binding was prevented. Perfusion studies for collagen type III were performed in a specially devised miniature parallel plate perfusion chamber that contained a coverslip and had well-defined hydrodynamic properties. Whole blood was obtained from volunteers by venipuncture. Blood was drawn through the perfusion chamber by a Harvard infusion pump (pump 22, model 2400-004, Harvard, Natick, Mass., USA). The perfusion time was 5 minutes. Triplicate cover slips were inserted into the chamber. 5 ml whole blood was pre-warmed for 5 minutes at 37 ° C. with or without VHH and then recirculated through the chamber for 5 minutes at a wall shear rate of 300 s ⁻¹ or 1600 s ⁻¹ . Cover slips were removed, rinsed, fixed with 0.05% glutaraldehyde, dehydrated with methanol, and stained with May-Grueunwald / Giemsa. Platelet adhesion was quantified with an optical microscope (1,000 × magnification) connected to a computerized image analyzer (AMS40-10, Saffron Walden, UK). Platelet adhesion was expressed as a percentage of the surface covered with platelets. The results are summarized in Tables 10 and 11.

Selection of vWF binding substances that inhibit the interaction with platelets (Figure 9)
Example 17: Selection of vWF binding substances that inhibit the interaction with platelets: Panning Immunotubes were coated with 2 μg / ml vWF or PBS containing 1% casein. After overnight culture at 4 ° C., the tube was blocked with PBS containing 1% casein for 3 hours at room temperature. 200 μl of phage was added to the immunotube to make a final volume of 2 ml with PBS. After culturing at room temperature for 2 hours, the immunotube was washed 10 times with PBS-Tween and 10 times with PBS. Bound phage was eluted with 2 ml 0.2 M glycine buffer, pH = 2.4. Elution was performed at room temperature for 20 minutes. The eluted phage was left to infect exponentially growing TG1 cells and then seeded on LB agar plates containing 100 μg / ml ampicillin and 2% glucose. Table 12 shows the results of panning.

Example 18: Screening for binding of vWF to A1 domain
The pBAD-OprI-strep-spec vector was used to display the VWF A1 domain as a fusion with OprI on the cell surface of UT5600 E. coli (F-ara-14 leuB6 azi-6 lacY1 proC14 tsx-67 entA403 trpE38 rfbD1 rpsL109 xyl-5 mtl-1 thi1 DompT fepC266) (Cote-Sierra et al., 1998, Gene, 221: 25-34). The gene encoding the A1 domain of vWF (219aa) was amplified by PCR using A1 pre and A1 reverse PCR primers.
Before A1: CCG GTG AGC CCC ACC ACT CTA AGC TTG GAG GAC ATC TCG GAA CCG
A1 reverse: CCC CAG GGT CGA AAC CCT CTA GAG CCC CGG GCC CAC AGT GAC

  Fragments and vectors were digested with HindIII and XbaI, ligated into UT5600 and transformed (= pBAD-vWF A1 / pBAD-vWF A3). Transformed cells were seeded on LB agar plates containing 20 μg / ml streptomycin, 50 μg / ml spectinomycin.

  The pBAD-vWF A1 plasmid was transformed into UT5600F cells and plated on LB agar plates containing 20 μg / ml streptomycin and 50 μg / ml spectinomycin. A single colony was used to inoculate LB medium containing 20 μg / ml streptomycin, 50 μg / ml spectinomycin. The cells were grown overnight at 37 ° C. and 200 rpm. The next day, cells were induced with 0.2% arabinose and cultured for an additional hour at 37 ° C. and 150 rpm. To perform Western blotting, whole cell lysates were boiled in reducing sample buffer, loaded on 12% SDS-PAGE and transferred to nitrocellulose. The transferred protein was detected using a monoclonal anti-OprI antibody (SH2.2) (Cote-Sierra et al., 1998, Gene, 221: 25-34). Anti-mouse IgG conjugated with alkaline phosphatase was added (Sigma), and the blot was developed with BCIP / NBT as shown in FIG.

  An ELISA was performed as described in Example 11. The results are summarized in Table 13. The results show that vWF-A1 domain specific VHH is obtained.

Example 19: Selection of vWF binding substances that inhibit the interaction with platelets: MATCHM
E. coli cells expressing the A1 domain of vWF (Example 18) were used for MATCHM experiments: UT5600 cells transformed with pBAD-OprI-A1 were grown and induced with 0.2% arabinose. Cells were washed and incubated with phage for 1 hour at room temperature. This mixture was washed 7 times with PBS-Tween and the phage was eluted with exponentially growing TG1 cells. The inventors performed selection of the first round and the second round. The results are summarized in Table 14.

Example 20: ELISA: Binding of purified VHH to vWF VHH specific for the A1 domain of vWF was expressed and purified as described in Example 6. Binding to vWF was measured by ELISA as described in Example 7. The results are shown in FIG.

Example 21: Inhibition ELISA with purified VHH
Microtiter plates were coated overnight at 4 ° C. with a solution containing 5 μg / ml of an antibody specific for the platelet receptor gpIb in PBS. The plate was washed 5 times with PBS-Tween and blocked with 300 μl of PBS solution containing 1% casein for 2 hours at room temperature. The plate was washed 3 times with PBS-Tween. Platelet receptor gpIb (gpIb) was added to the well of a microtiter plate at a concentration of 1 μg / ml and allowed to bind for 2 hours at room temperature. The plate was washed 5 times with PBS-Tween. VHH (A38 (negative control) and A50 (vWF A1 binding agent)) was added at decreasing concentrations. Plasma containing vWF was diluted 1/128 and pre-cultured at 37 ° C. for 5 minutes. Risto was added at a final concentration of 760 μg / ml and added to VHH. This mixture was incubated at room temperature for 30 minutes. 100 μl of this mixture was then added to the wells of the microtiter plate and incubated at room temperature for 90 minutes. The plate was washed 5 times with PBS-Tween. Anti-vWF-HRP monoclonal antibody was diluted 3.000 times with PBS and cultured for 1 hour. The plate was washed 5 times with PBS-Tween and vWF binding was detected with ABTS / H ₂ O ₂ . The signal was measured at 405 nm after 30 minutes. The results are summarized in FIG.

Example 22: Sequencing of clones Clones were sequenced with M13 universal reverse primer. The amino acid sequence is shown in Table 30 (SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, and 31).

Example 23: Evaluation of inhibition by VHH under high shear stress A shear experiment was performed as described in Example 16. Platelet adhesion was expressed as a percentage of the surface covered with platelets. The results are summarized in Tables 15 and 16.

Example 24: Bivalent VHH: Expression and Purification Bivalent molecules were constructed as described in Example 12. The sequences are shown in Table 30 (SEQ ID NOs: 32, 33, and 34).

  The protein was expressed and purified as described in Example 6. It was necessary to perform an additional purification step with superdex 75 to remove some monovalent degradation products (5-10%).

Example 25: Evaluation of inhibition by VHH under high shear stress Shear stress experiments were performed as described in Example 16. Platelet adhesion was expressed as a percentage of the surface covered with platelets. The results are summarized in Tables 17 and 18.

Create bispecific construct for vWF-specific VHH (Figure 13)
Example 26: Construction and sequence of bispecific constructs As described in Example 12, one VHH that is specific for vWF and inhibits interaction with collagen, and is also specific for vWF Produced a construct with a second VHH that inhibits interaction with the platelet receptor gpIb. The sequences are shown in Table 30 (SEQ ID NOs: 20, 21, and 22).

Example 27: Expression and purification of bispecific constructs Proteins were expressed and purified as described in Example 6. It was necessary to perform an additional purification step with superdex 75 to remove some monovalent degradation products (5-10%). The yields obtained for 1 liter expression and purification of the bispecific protein in E. coli are summarized in Table 19.

Example 28: Binding to vWF Binding to vWF was tested by ELISA as described in Example 7. The results are shown in FIG.

Example 29: Inhibition of vWF and collagen binding by bispecific construct compared to monovalent VHH As described in Example 5, inhibition of vWF and collagen binding was compared to bispecific construct. Were tested for monovalence. IC50 values are summarized in Table 20.

Example 30: Evaluation of inhibition by VHH under high shear stress Shear stress experiments were performed as described in Example 16. Platelet adhesion was expressed as a percentage of the surface covered with platelets. The results are summarized in Tables 21 and 22.

Screening for collagen type I and type III binding substances (Figure 15)
Example 31 Selection of Collagen Type I Binding Substance A microtiter plate was coated with 25 μg / ml collagen type I. Phages were prepared as described in Example 3 and allowed to bind to wells of microtiter plates that were blocked for 2 hours. After washing, the phage was eluted with 0.1 M glycine buffer, pH = 4.5. The results are summarized in Table 23.

Example 32: ELISA tested for binding of VHH to collagen types I and III As described in Example 7, the binding of the clones was tested by ELISA, but then the wells were coated at 25 μg / ml in PBS. Tested for type I or type III. The results are summarized in Table 24.

Example 33: Sequencing of clones Clones were sequenced with M13 universal reverse primer. The amino acid sequence is shown in Table 30 (SEQ ID NOs: 35, 36, and 37).

Example 34: Binding of purified VHH to collagen types I and III VHH was expressed and purified as described in Example 6. Microtiter plates were coated and blocked with 25 μg / ml collagen type I or type III. The binding material was added to a duplo diluent and binding was detected as described in Example 7. The results are summarized in FIG.

Example 35: Selection of a binding agent to collagen type I that inhibits interaction with vWF Microtiter plates were coated with 25 μg / ml collagen type I. As described in Example 3, phage were prepared and allowed to bind to wells of microtiter plates that were blocked for 2 hours. After washing, the phage was eluted with 300 μg / ml vWF. The selection of the second and third rounds was performed in the same manner.

Example 36: VHH binding to collagen types I and III tested by ELISA As described in Example 34, binding of clones to collagen types I and III was tested by ELISA.

Example 37: Sequencing of clones Clones were sequenced with M13 universal reverse primer.

Example 38: Binding of purified VHH to collagen types I and III VHH was expressed and purified as described in Example 6. Microtiter plates were coated and blocked with 25 μg / ml collagen type I or type III. As described in Example 34, binding material was added to the in duplo dilution to detect binding.

Example 39: Inhibition of vWF and collagen binding by collagen-specific VHH tested by ELISA Inhibition was tested as described in Example 5.

Example 40: Testing platelet aggregation inhibition by collagen-specific VHH under low and high shear stress Shear stress experiments were performed as described in Example 16. Platelet adhesion was expressed as a percentage of the surface covered with platelets.

Improved half-life of VHH Example 41: Immunization of llamas
One llama was immunized with human serum albumin (HSA). The immunization scheme is summarized in Table 25.

Example 42: Repertoire Cloning A library was prepared as described in Example 2. The library size was 2 × 10 ⁷ cfu and all clones contained the correct size insert.

Example 43: Rescue of Library, Phage Preparation Phages were prepared as described in Example 3.

Example 44: Phage ELISA
Microtiter plates (Maxisorp) were coated overnight at 4 ° C. with PBS solution containing 1% casein or 5 μg / ml HSA (human serum albumin). The plate was washed 3 times with PBS-Tween (0.05% Tween 20) and blocked with 200 μl of PBS solution containing 1% casein for 2 hours at room temperature. The plate was washed 5 times with PBS-Tween. Phages were prepared as described above and added to the wells at 2-fold serial dilutions. The plate was washed 5 times with PBS-Tween. Bound phage was detected with a mouse monoclonal antibody, anti-M13, conjugated with horseradish peroxidase (HRP) diluted 1/2000 in PBS. The plate was washed 5 times with PBS-Tween. Staining was performed with ABTS / H ₂ O ₂ and after 30 minutes the signal was measured at 405 nm. The results are shown in FIG. 17, which shows that HSA-specific nanobodies are present in the library.

Example 45: Selection: First and second round biopanning Wells of microtiter plates were coated with 10 μg / ml mouse serum albumin (MSA) or PBS containing 1% casein. After incubation at 4 ° C. overnight, the wells were blocked with PBS containing 1% casein for 3 hours at room temperature. 200 μl of phage was added to the wells. After 2 hours of incubation at room temperature, the wells were washed 10 times with PBS-Tween and 10 times with PBS. Bound phage was eluted with 100 μl of 0.2 M glycine buffer, pH = 2.4. Elution was performed at room temperature for 20 minutes. The eluted phages were left to infect exponentially growing E. coli TG1 cells and then seeded on LB agar plates containing 100 μg / ml ampicillin and 2% glucose. The second round was carried out under the same conditions as above. The results are summarized in Table 26.

Example 46: Screening of individual clones after biopanning
ELISA: Binding to human serum albumin (HSA) and mouse serum albumin (MSA) Periplasmic extracts were prepared as described in Example 6.

Microtiter plates were coated overnight at 4 ° C. with 5 μg / ml HSA, 5 μg / ml mouse serum albumin (MSA), or PBS solution containing 1% casein. Plates were blocked with 300 μl of 1% casein in PBS for 2 hours at room temperature. The plate was washed 3 times with PBS-Tween. After selection of the first and second rounds, periplasmic fractions were prepared for 23 individual clones and allowed to bind to the wells of the microtiter plate. The plate was washed 6 times with PBS-Tween and then incubated with a mouse anti-histidine monoclonal antibody Serotec MCA 1396 (1/1000 dilution) in PBS for 1 hour at room temperature, followed by 1 / of anti-mouse-alkaline phosphatase conjugate. Nanobody binding was detected by similarly culturing in 2000 PBS solution at room temperature for 1 hour. Stain with substrate PNPP (1M diethanolamine p-nitrophenyl-phosphate 2mg / ml, 1mM Mg ₂ SO ₄ , pH 9.8) and signal 30 minutes later Measured at 405 nm. The results are summarized in Table 27.

Example 47: HinfI pattern and sequencing After the second round of panning, PCR was performed on positive clones with a set of primers attached to sequences in the vector. The PCR product was digested with the restriction enzyme HinfI and loaded on an agarose gel. Four clones with different HinfI patterns were selected for further evaluation. Those clones were sequenced and the results are summarized in Table 30 (SEQ ID NOs: 16, 17, 18, and 19).

Example 48: Testing cross-reactivity with different species of albumin SDS-PAGE was performed on plasma (1/10 dilution) of different species (baboon, pig, hamster, human, rat, mouse, and rabbit) Blotted on nitrocellulose membrane. Phages were prepared as described in Example 3 for clones MSA21, MSA24, MSA210, MSA212, and inappropriate Nanobodies. Phage were allowed to bind to serum albumin blotted on nitrocellulose and unbound phage were washed away. Binding was detected by anti-M13 polyclonal antibody conjugated to HRP. DAP was used as a detection substrate. The results are shown in FIG.

  From these results, it may be inferred that all four binding agents cross-react between pig, human, mouse (low in MSA212), and hamster serum albumin. MSA21 also cross-reacts with rabbit serum albumin. For inappropriate nanobodies, no binding was observed (not shown).

  As a control experiment, SDS-PAGE was performed with different plasma samples diluted 1/100 in PBS. The gel was stained with Coomassie. From FIG. 19, it may be inferred that the albumin concentration of all plasma samples is high except for rabbit plasma, where albumin is low.

Example 49: Expression and purification Proteins were expressed and purified as described in Example 6.

Example 50: ELISA for MSA of purified nanobodies
Microtiter plates were coated overnight at 4C with 5 μg / ml MSA. After washing, the plate was blocked with PBS solution containing 1% casein for 2 hours at room temperature. Samples were applied in duplicate, starting with a 1/3 dilution of 2500 nM concentration and allowed to bind for 2 hours at room temperature. 1/1000 (K208) polyclonal rabbit anti-Nanobody serum was added for 1 hour at room temperature. Detection was performed with anti-rabbit alkaline phosphatase conjugate at 1/1000 and stained with PNPP. The results are shown in FIG.

Example 51: Construction and sequence of a bispecific construct A bispecific construct was prepared comprising a first VHH specific for albumin (MSA21) and a second VHH specific for vWF ( FIG. 21). Constructs were made as described in Example 12. The sequences are shown in Table 30 (SEQ ID NOs: 13, 14, and 15).

Example 52: Expression and purification of bispecific constructs Proteins were expressed and purified as described in Example 6. It was necessary to perform an additional purification step with superdex 75 to remove some monovalent degradation products (5-10%).

Example 53 Functionality of Both VHHs of Bispecific Construct Microtiter plates were coated overnight at 4 ° C. with 5 μg / ml mouse serum albumin. After washing the plate, the wells were blocked with PBS solution containing 1% casein for 2 hours. The bispecific protein was allowed to bind to the wells for 2 hours at room temperature. After washing, human, dog, and pig plasma were added at different dilutions and allowed to bind for 2 hours at room temperature. The binding of vWF was detected with DAKO anti-vWF-HRP at 1/3000 dilution. Staining was performed using ABTS / H ₂ O ₂ . The results are shown in FIG. It shows that the functionality of both VHHs is retained in the bispecific construct.

Example 54: Inhibition of vWF and collagen binding by bispecific constructs compared to monovalent VHH As described in Example 5, inhibition of vWF and collagen binding was compared to bispecific constructs. Were tested for monovalence. IC50 values are summarized in Table 28. The results show that the inhibitory properties of VHH are retained in the bispecific construct.

Selection of gpIb binding substances that inhibit the interaction with vWF (FIG. 23)
Immunization, repertoire cloning, and phage preparation were performed as described in Examples 1, 2, and 3.

Example 55: Selection of rgpIb binding agents Microtiter plates were coated with mouse mAb against rgpIb. The plate was blocked and rgpIb was allowed to bind at 5 μg / ml at room temperature for 2 hours. The plate was washed. Phages were prepared as described above and allowed to bind to microtiter plate wells. After washing, the phage was eluted with 0.1 M glycine buffer, pH = 4.5. The second round of panning was carried out in the same manner.

Example 56: Screening for binding substances by ELISA Periplasmic extracts were prepared as described in Example 6.

Supernatant was added to wells coated with mAb followed by gpIb as described in Example 55. Dilution series of all purified samples were incubated at room temperature for 2 hours. The plate was washed 6 times with PBS-Tween, and then VHH binding was detected by culturing with mouse anti-His-HRP mAB 1/2000 in PBS for 1 hour at room temperature followed by substrate ABTS / H ₂ O ₂ Stained with The signal was measured at 405 nm after 30 minutes.

Example 57: Binding of purified VHH and rgpIb Periplasmic fractions were prepared as described in Example 6. The supernatant containing VHH was put into Ni-NTA and purified to homogeneity. The yield of VHH was calculated by the extinction coefficient. An ELISA was performed as described in Example 55.

Example 58: Sequencing of clones Clones were sequenced with M13 universal reverse primer.

Example 59: Testing inhibitory properties of gpIb-specific VHH As described in Example 21, inhibition of VHH was tested by ELISA.

Example 60: Evaluation of inhibition by VHH under high shear stress Shear stress experiments were performed as described in Example 16. Platelet adhesion was expressed as a percentage of the surface covered with platelets.

Coating of stents, tubes, balloons, catheters, and implants with VHH Example 61: Stability of VHH As described in Example 7, VHH C37 was cultured at 37 ° C to bind vWF to collagen. Inhibition was measured at different time points by ELISA. The results were compared with VHH stored at -20 ° C. The result is shown in FIG. What can be seen from the comparison is the activity of scFv against the B3 antigen (Reiter et al., Protein Engineering, 1994, 7: 697-704), which is a framework residue to enhance its stability (dsFv). It is modified by introducing a disulfide bond between 44 and residue 105. After culturing at 37 ° C. for 60 hours, dsFv lost 40% of its activity. After culturing C37 at 37 ° C for 1 year, its inhibitory properties were analyzed in comparison with C37 stored in a freezer. ELISA was performed with human plasma at a final dilution of 1/200 as described in Example 5. The results are shown in FIG. Functionality has been shown to be fully retained (IC50 values of 0.085 μg / m and l0.1 μg / ml, respectively, when C37 is stored at 37 ° C. and −20 ° C.). Therefore, the shelf life of VHH is estimated to be long.

Example 62: VHH immobilized in polymer
A mixture of 30% acrylamide 0.5 ml; 1 M Tris pH = 7.5 1 ml; H ₂ O 3.5 ml; 10% APS 35 μl; TEMED 3.5 μl was prepared. To some wells, a final concentration of 10 μg / ml VHH C37 was added. The mixture was allowed to polymerize in the wells of a 96-well plate for 3 hours at room temperature. Starting with undiluted plasma, human plasma was added at different dilutions. After incubation at room temperature for 1 hour, the plate was washed, and anti-vWF-HRP (DAKO) was added at 1/2000 at room temperature for 1 hour. After washing the plate, substrate (ABTS / H ₂ O ₂ ) was added and OD405 nm was measured. The results are shown in FIG. The results show that VHH retains functionality after immobilization in the polymer.

Humanization of C37 Example 63: Sequence comparison of C37 and DP-47 As shown in Figure 27, by sequence comparison of C37 nanobody (SEQ ID NO: 1) and human VH3 germline (DP-47) A high degree of homology was found.
4 AA changes at positions 1, 5, 28, and 30 in FR1
4 AA variations at FR3 positions 74, 75, 84, and 94
3 AA changes at positions 104, 108, and 111 in FR4

Example 64: Mutagenesis of C37
C37 was mutated by use of a non-PCR based site-directed mutagenesis method. This method is described by Chen and Ruffner (Chenand Ruffner, Amplification of closed circular DNA in vitro, Nucleic Acids Research, 1998, 1126-1127) and commercialized by Stratagene (Quickchange site-directed mutagenesis).

  Plasmid DNA was used as a template in combination with two mutagenic primers (Table 29) to introduce the desired mutation. The two primers are each complementary to opposite strands of the template plasmid DNA. In polymerase reactions using pfu's DNA polymerase, each strand extends from the primer sequence during a cycling program that uses a fixed number of cycles. This results in a mixture of wild type and mutant strands. Digested with DpnI selects mutated in vitro synthetic DNA. DNA was precipitated, transformed into E. coli, and analyzed for required mutations by sequence analysis. A clone with the correct sequence was named C37-hum. The amino acid sequence is in SEQ ID NO: 2 in Table 30.

  C37-hum expression and purification was performed as described in Example 6. As described in Example 5, inhibition of C37 vWF binding to collagen was compared to C37-hum. The results are shown in FIG. It is clearly shown that the humanized variant of C37 retains full functionality.

  The positions that still need to be humanized are Q1, Q5, D104, Q108, and I111. Positions 1 and 5 can be humanized but do not lose their inhibitory properties. This is because these amino acids are introduced by the FR1 primer and are not naturally occurring in the llama sequence. Since we isolated VHH (AM-2-75 SEQ ID NO: 3), which is identical to C37 except for I111V, having the same functional properties (Example 9 and Table 6), position 111 is also human Can be

  Position 108 is exposed to solvent in camelid VHH while in human antibodies this position is embedded at the VH-VL interface (Spinelli, 1996; Nieba, 1997). In isolated VH, position 108 is exposed to solvent. Introducing nonpolar hydrophobic Leu instead of polar uncharged Gln can have a dramatic impact on the intrinsic folding / stability of this molecule.

Anti-vWF VHH fragment Example 65: Expression of VHH-CDR3 fragment of vWF-C37
The CDR3 region of C37 was amplified by using a sense primer located in the framework 4 region (forward: CCCCTGGTCCCAGTTCCCTC) and an antisense primer located in the framework 3 region (reverse: TGTGCTCGCGGGGCCGGTAC).

In order to clone the CDR-3 fragment in pAX10, a second round of PCR amplification was performed by introducing the necessary restriction sites following the primers:
Reverse primer Sfi1:
GTCCTCGCAACTGCGGCCCAGCCGGCCTGTGCTCGCGGGGCCGGTAC
Forward primer Not1:
GTCCTCGCAACTGCGCGGCCGCCCCCTGGTCCCAGTTCCCTC

  PCR reaction was performed using 50 pmol of each primer and a reaction volume of 50 ml. The reaction conditions for the first PCR were 94 ° C. for 11 minutes, followed by 94/55/72 ° C. for 30/60/120 seconds for 30 cycles, and 72 ° C. for 5 minutes. All reactions were performed using 2.5 mM MgCl2, 200 mM dNTPs, and 1.25 U AmpliTaq God DNA polymerase (Roche Diagnostics, Brussels, Belgium).

  After cutting with Sfi1 and Not1, the PCR product was cloned into pAX10.

Isolation of conformation specific anti-vWF VHH's Example 66: Selection by 1st and 2nd round biopanning against recombinant A1 (rA1) 5 μg / ml vWF in microtiter plate wells Of recombinant A1 domain (rA1) or PBS containing 1% casein. After incubation at 4 ° C. overnight, the wells were blocked with PBS containing 1% casein for 3 hours at room temperature. 200 μl of phage was added to the wells. After 2 hours of incubation at room temperature, the wells were washed 10 times with PBS-Tween and 10 times with PBS. Bound phage was eluted with 100 μl of 0.2 M glycine buffer, pH 2.4. Elution was performed at room temperature for 20 minutes. The eluted phages were left to infect exponentially growing E. coli TG1 cells and then seeded on LB agar plates containing 100 μg / ml ampicillin and 2% glucose. A second round was performed under the same conditions as above, but the phages were resuspended in 10 μg / ml vWF. The wells of the microtiter plate were washed 7 times with 10 μg / ml vWF for 30 minutes. The results are summarized in Table 31.

Example 67: Screening of individual clones after biopanning
ELISA: A single colony binding to rA1 and vWF was used to start overnight culture in LB containing 2% glucose and 100 μg / ml ampicillin. This overnight culture was diluted 100-fold with TB medium containing 100 μg / ml ampicillin and cultured at 37 ° C. until OD600 nm = 0.5. 1 mM IPTG was added and the culture was incubated for an additional 3 hours at 37 ° C. or overnight at 28 ° C. The culture was centrifuged for 20 minutes at 4 ° C. and 10,000 rpm. The pellet was frozen overnight or at -20 ° C for 1 hour. The pellet was then thawed at room temperature for 40 minutes, resuspended in PBS and shaken on ice for 1 hour. The periplasmic fraction was isolated by centrifugation at 20.000 rpm for 20 minutes at 4 ° C. The supernatant containing VHH was used for further analysis.

  Microtiter plates were coated overnight at 4 ° C. with 2 μg / ml rA1 or 1 μg / ml vWF. The plate was blocked for 2 hours at room temperature with 300 μl of PBS solution containing 1% casein. The plate was washed 3 times with PBS-Tween. After the second round of selection, periplasmic fractions of 192 individual clones were prepared and allowed to bind to the wells of the microtiter plate. The plate was washed 6 times with PBS-Tween, then with PBS containing rabbit polyclonal anti-nanobodies (1/2000 dilution) for 1 hour at room temperature, followed by PBS containing goat anti-rabbit-HRP conjugate 1/2000 Nanobody binding was detected by incubation at room temperature for 1 hour. Staining was performed with the substrate ABTS / H2O2, and the signal was measured at 405 nm after 30 minutes. The results are summarized in Table 32. It can be concluded that 50 clones bind to rA1 and not vWF.

Example 68: HinfI pattern and sequencing After the second round of panning, PCR of rA1 positive and vWF negative clones was performed with a set of primers bound to the sequences in the vector. The PCR product was digested with the restriction enzyme HinfI and loaded on an agarose gel. For further evaluation, 30 clones were selected with different HinfI patterns. These clones were examined in more detail by ELISA as described in Example 67. Of the 30 clones, 4 were clearly shown to have a much higher affinity for rA1 than vWF. Data are shown in FIG. 29 (bound to rA1) and FIG. 30 (bound to vWF). These clones were sequenced and the results are summarized in Table 30 (SEQ ID NOs: 62-65).

Example 69: Inhibition ELISA
Inhibition of binding of vWF and gpIb by nanobodies was quantified by ELISA. Microtiter plates were coated overnight at 4 ° C. with a solution containing 5 μg / ml of an antibody specific for the platelet receptor gpIb in PBS. The plate was washed 5 times with PBS-Tween and blocked with 300 μl of PBS solution containing 1% casein for 2 hours at room temperature. The plate was washed 3 times with PBS-Tween. Plasma was added to microtiter plate wells at 1/2 dilution and allowed to bind for 1.5 hours at 37 ° C. The plate was washed 5 times with PBS-Tween. VHH was added at decreasing concentrations. Plasma containing vWF was preincubated at 1/50 dilution for 5 minutes at 37 ° C. The final concentration of 1 mg / ml ristocetin was added and added to VHH. This mixture was incubated at 37 ° C. for 1 hour. 50 μl of this mixture was then added to the wells of the microtiter plate and incubated at 37 ° C. for 90 minutes. The plate was washed 5 times with PBS-Tween. Anti-vWF-HRP monoclonal antibody was diluted 3,000 times with PBS and cultured for 1 hour. The plate was washed 5 times with PBS-Tween and vWF-binding was detected with ABTS / H2O2. The signal was measured at 405 nm after 30 minutes.

Figure 1 Interactions involved in the first stages of platelet aggregation.
Figure 2. Interactions involved in the first stages of platelet aggregation. It shows that VHH inhibits the interaction between vWF and collagen.
FIG. 3 Binding to vWF by purified VHH as quantified by ELISA as described in Example 7.
FIG. 4 ELISA for testing the binding inhibition of vWF and collagen by VHH as described in Example 9.
FIG. 5 Western blot showing expression of the A3 domain of vWF as a fusion with OprI on the surface of E. coli as described in Example 11.
FIG. 6 Restriction map of the multicloning site of PAX011 to construct bivalent or bispecific nanobodies.
FIG. 7 ELISA binding of monovalent VHH versus bivalent and bispecific VHH to purified vWF as described in Example 13.
FIG. 8 Stability of bispecific VHH in human plasma as described in Example 15 immediately after incubation at 37 ° C. for up to 24 hours.
FIG. 9 Interactions involved in the first stages of platelet aggregation. It shows that VHH inhibits the interaction between vWF and platelets.
FIG. 10 Western blot showing the expression of the A1 domain of vWF as a fusion with OprI on the surface of E. coli as described in Example 18.
FIG. 11. Binding to vWF by purified VHH as quantified by ELISA as described in Example 20.
FIG. 12 Inhibition of gpIb and VWF binding by A50 and A38 (negative control) as described in Example 21.
FIG. 13 Interactions involved in the first stages of platelet aggregation. Specific to vWF, with one VHH that inhibits the interaction between vWF and collagen, and a second VHH that is specific to vWF but inhibits the interaction between vWF and platelets Bispecific constructs are shown.
FIG. 14 Binding to vWF in ELISA as described in Example 28.
FIG. 15 Interactions involved in the first stages of platelet aggregation. VHH is specific for collagen and inhibits the interaction between vWF and collagen.
FIG. 16 Binding of purified VHH by ELISA described in Example 34 to collagen types I and III.
FIG. 17 Phage ELISA showing the presence of HSA specific nanobodies in the library described in Example 44.
FIG. 18. Binding of plasma expressing albumin binding material and plasma blotted onto nitrocellulose as described in Example 48.
FIG. 19 Coomassie staining of plasma samples on SDS-PAGE as described in Example 48.
FIG. 20 Binding of purified nanobody described in Example 50 by ELISA and mouse albumin.
FIG. 21. Bispecific construct described in Example 51 with one VHH that binds albumin and a second VHH that binds vWF to improve half-life.
FIG. 22. Sandwich ELISA showing functionality of both VHHs of the bispecific construct described in Example 53.
FIG. 23. Interactions involved in the first stages of platelet aggregation. It shows that VHH is specific for gpIb and inhibits the interaction between vWF and platelets.
FIG. 24 Residual activity of C37 stored at −20 ° C. compared to C37 cultured at 37 ° C. for up to 194 hours. As described in Example 61, the stability of C37 is compared to the stability of a scFv specific for the B3 antigen and a stable dsFv (stabilized by two disulfide bonds).
FIG. 25 Inhibitory activity of C37 stored at −20 ° C. compared to C37 cultured at 37 ° C. for 1 year as described in Example 61.
FIG. 26. Binding of human plasma-derived vWF described in Example 62 and C37 immobilized on acrylamide.
FIG. 27 Amino acid sequence comparison of human germline sequences DP-47 and C37 as described in Example 63.
FIG. 28. Inhibition of C37 and C37hum vWF-collagen binding as determined by ELISA as described in Example 64.
FIG. 29. Binding of rA1 to A11, A12, A13, A14, A15, and A16 clones measured by ELISA.
FIG. 30 Binding of vWF to A11, A12, A13, A14, A15, and A16 clones measured by ELISA.

Table Table 1: Immunization scheme used for Lama 002 according to Example 1.
Table 2: Plaque-forming units (pfu) after one or two rounds of panning with vWF compared to PBS-casein as described in Example 4. (Specific binding) pfu vWF divided by pfu casein (antigen) = enrichment.
Table 3: Number of inhibitors / number of tested clones after first and second rounds of panning as described in Example 5.
Table 4: Expression of VHH grown in WK6 E. coli cells as described in Example 6 and yield after purification (mg / l culture).
Table 5: OD405nm of binding in ELISA of VHH to 3 antigens immunized with vWF and also Lama 002 according to Example 8.
Table 6: VHH concentration (nM) required to inhibit vWF and collagen binding by 50% (IC50) as described in Example 9.
Table 7: Epitope mapping of VHH as described in Example 11 that binds to vWF and inhibits interaction with collagen.
Table 8: Yield of purified protein (mg) per liter culture for bivalent and bispecific VHH as described in Example 12.
Table 9: Monovalent IC50 values compared to bivalent and bispecific VHH. Inhibition was tested in human, porcine, and baboon plasma as described in Example 14.
Table 10: Inhibition of platelet aggregation under high shear stress (1600 s ⁻¹ ) as described in Example 16.
Table 11: Inhibition of platelet aggregation under low shear stress (300 s ^-1 ) as described in Example 16.
Table 12: Plaque-forming units (pfu) after one round of panning with vWF as described in Example 17. pfu vWF (antigen) divided by pfu casein (a-specific binding) = enrichment.
Table 13: ELISA screening results of individual colonies bound to vWF and the AWF domain of vWF as described in Example 18.
Table 14: Results after one round of MATCHM on pBAD-OprI-A1 cells as described in Example 19.
Table 15: Inhibition of platelet aggregation as described in Example 23 under high shear stress (1600 s ^-1 ).
Table 16: Inhibition of platelet aggregation under low shear stress (300 s ^-1 ) as described in Example 23.
Table 17: Inhibition of platelet aggregation under high shear stress (1600 s ⁻¹ ) as described in Example 25.
Table 18: Inhibition of platelet aggregation under low shear stress (300 s ^-1 ) as described in Example 25.
Table 19: Yield after expression and purification of bispecific constructs as described in Example 27.
Table 20: IC50 values of bispecific nanobodies for A1 and A3 domains of vWF as described in Example 29.
Table 21: Inhibition of platelet aggregation under high shear stress (1600 s ⁻¹ ) as described in Example 30.
Table 22: Inhibition of platelet aggregation under low shear stress (300 s ^-1 ) as described in Example 30.
Table 23: Plaque-forming units (pfu) after one round of panning with collagen type I as described in Example 31. pfu vWF (antigen) divided by pfu casein (a-specific binding) = enrichment.
Table 24: Number of clones bound to collagen type I and type III after one round of selection as described in Example 32.
Table 25: Immunization scheme for human serum albumin according to Example 41.
Table 26: Results after first and second rounds of panning with mouse serum albumin as described in Example 45.
Table 27: Clones were selected after selection of the first and second rounds and periplasmic extracts were prepared. These clones were analyzed by ELISA for binding to human and mouse albumin as described in Example 46.
Table 28: IC50 values of bispecific nanobodies for albumin and vWF as described in Example 54.
Table 29: Primer sequences used for humanization of C37 as described in Example 64.
Table 30: Table of amino acid sequences of peptides of the present invention and human von Willebrand factor (vWF). Human vWF sequences show bold A1 and A3 domains, respectively.
Table 31: Results after two rounds of panning in the rWF domain of vWF as described in Example 66.
Table 32: ELISA analysis of clones selected for binding to rA1 and vWF as described in Example 67.

Claims (25)

A polypeptide comprising two single domain antibody against von Willebrand factor (vWF),
The single domain antibody comprising a sequence represented by any one of SEQ ID NO: 3, 5 or 7, or a homologous sequence showing 90% or more identity with any of SEQ ID NO: 3, 5 or 7 A single domain antibody consisting of said homologous sequence is capable of inhibiting platelet aggregation by at least 50% at a concentration of 0.5 μg / ml or lower under high shear stress (1600 s ⁻¹ ) ,
Polypeptide.   2. The polypeptide of claim 1, wherein the two single domain antibodies are linked to each other by a peptide linker. The polypeptide according to claim 1 or 2 , wherein the at least one single domain antibody consists of a sequence represented by SEQ ID NO: 3 or a homologous sequence showing 90% or more identity to SEQ ID NO: 3. The polypeptide according to claim 1 or 2 , wherein the at least one single domain antibody consists of a sequence represented by SEQ ID NO: 5 or a homologous sequence showing 90% or more identity to SEQ ID NO: 5. The polypeptide according to claim 1 or 2 , wherein the at least one single domain antibody consists of a sequence represented by SEQ ID NO: 7 or a homologous sequence showing 90% or more identity to SEQ ID NO: 7. The polypeptide consists of two single domain antibodies against von Willebrand factor;
(1) at least one single domain antibody consists of a sequence represented by SEQ ID NO: 3 or a homologous sequence showing 90% or more identity to SEQ ID NO: 3, or (2) at least one single domain The antibody consists of SEQ ID NO: 5 or a sequence represented by a homologous sequence showing 90% or more identity to SEQ ID NO: 5, or (3) at least one single domain antibody is SEQ ID NO: 7 or SEQ ID NO: 7 And a sequence represented by a homologous sequence showing 90% or more identity,
The polypeptide according to claim 1 or 2 . Further comprising at least one single domain antibody against serum albumin, wherein the at least one single domain antibody against serum albumin is a sequence shown in either SEQ ID NO: 16-19 or SEQ ID NO: 16-19 The polypeptide of Claims 1-6 which consists of a sequence represented by either of the homologous sequences which show 90% or more identity. The polypeptide according to claim 7, which consists of the sequence shown in any one of SEQ ID NOs: 13 to 15. 9. A polypeptide according to claims 1-8 , wherein the at least one single domain antibody is a VHH domain. Kabat number wherein at least one single domain antibody is selected from the group consisting of glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, tyrosine, tryptophan, methionine, serine, threonine, asparagine, or glutamine is a VHH domain comprising the amino acid position 45 by attaching polypeptide of claim 1-9. It is a VHH domain comprising at least one single domain antibody arginine, serine, and the amino acid at position 103 according to the numbering of Kabat selected from uncharged amino acid residues or Ranaru group (Kabat), claim 1 10. The polypeptide according to 10 .   The polypeptide according to claim 11, wherein the uncharged amino acid residue is glycine. VHH obtained by at least one single domain antibody immunizing a camel and obtaining a hybridoma from the immunized camel, or by cloning a library of single domain antibodies and selecting by phage display a domain polypeptide of claim 1 to 12. At least one single domain antibody, one or more of the Camelidae amino acids replaced by the corresponding sequence in human found in the human consensus sequence, the polypeptide of claim 1 to 13. At least one single domain antibody is a hallmark amino acid at positions 1, 5, 28 and 30 of FR1, positions 37, 44, 45 and 47 of FR2, positions 74, 75, 76, 83, 84 of FR3, 93 and 94, as well as FR4 positions 103, 104, 108 and 111 (numbered according to Kabat numbering), either alone or in combination of these residues in human consensus sequences replaced by sequences the polypeptide of claim 1-14. Peptide linker is composed of three alanine residues, polypeptide according to claim 2-15. 16. The polypeptide of claim 1-15 , wherein the C-terminus of the first single domain antibody is linked to the N-terminus of the next single domain antibody. 18. A polypeptide according to claims 1 to 17 , wherein said single domain antibody consisting of a homologous sequence cannot inhibit platelet aggregation by 50% at a concentration of 10 [ mu] g / ml or lower under low shear stress (300 s < ^-1 > ) . Composition comprising the polypeptide and a pharmaceutically acceptable vehicle according to claim 1 to 18. Oral or parenteral, intranasal inhalation, intravenous, intramuscular, polypeptides and a pharmaceutically acceptable vehicle according to claim 1 to 18 in the form suitable route of administration selected from topical or subcutaneous routes A composition comprising. Simultaneous to the subject, fractionation, or sequential to administration, the polypeptides and compositions comprising at least one thrombolytic agent according to any one of claims 1 to 18. 22. The composition of claim 21 , wherein the thrombolytic agent is any of staphylokinase, tissue plasminogen activator, streptokinase, single chain streptokinase, urokinase and acyl plasminogen-streptokinase complex. A nucleic acid encoding the polypeptide according to any one of claims 1 to 18 . (a) culturing a host cell comprising a nucleic acid capable of encoding the polypeptide according to any one of claims 1 to 18 under conditions allowing expression of the polypeptide, and (b) the culture. and recovering the produced polypeptide from the method for producing a polypeptide according to any one of claims 1 to 18. 25. The method of claim 24 , wherein the host cell is a bacterium or yeast.