JP4908182B2 - Nucleic acid amplification determination method, target nucleic acid detection method, and apparatus used therefor - Google Patents

Description

  The present invention relates to a method for determining the presence or absence of nucleic acid amplification, a method for detecting a target nucleic acid, and an apparatus used therefor.

  As a useful method for analyzing the base sequence of a test sample, a nucleic acid amplification method for amplifying a specific target nucleic acid is known, and this method is an indispensable technique for diagnosis of genetic diseases and the like. In order to effectively use the technology of this nucleic acid amplification method, a method for determining the presence or absence of nucleic acid amplification of a target nucleic acid with high sensitivity is required.

  As a general method for determining the presence or absence of nucleic acid amplification, there is a method of observing fluorescence after electrophoresis of a reaction solution obtained by performing a nucleic acid amplification reaction to which a fluorescent intercalator such as ethidium bromide is added. In addition, there is a method of determining the presence or absence of nucleic acid amplification using as an index the binding between pyrophosphate and metal ions generated when the nucleic acid amplification reaction proceeds (see, for example, Patent Document 1). Further, there is a method for determining the presence or absence of nucleic acid amplification by observing the labeling substance incorporated into the nucleic acid by using a primer or nucleotide labeled with a labeling substance such as a fluorescent dye in the nucleic acid amplification reaction (for example, Patent Document 2). reference).

  On the other hand, when performing a nucleic acid amplification reaction, it is necessary to remove an amplification inhibiting substance such as a protein from a sample as a pretreatment, and as a method therefor, a technique using chloroform and ethanol can be mentioned. Also, there is a method of purifying nucleic acid by electrophoresis focusing on the difference in charge between nucleic acid and protein (for example, see Patent Document 3).

Guanine can measure the oxidation current due to oxidation near +0.9 V (silver / silver chloride electrode). The amount of DNA contained in the test solution can be determined by quantifying the concentration of guanine based on the oxidation current. An estimation method has been reported (for example, see Non-Patent Document 1).
JP 2004-283161 A JP-A-9-187275 JP-T-2001-500966 Soichi Yabuki and three others, “Quantification of DNA based on oxidation current of nucleic acid guanine”, [online], November 26, 2004, 50th Polarography and Electroanalytical Chemistry Conference, [November 2006 Search on March 13], Internet <URL: http://www.aist.go.jp/RRPDB/system/Koukai.Detail>

  However, conventional methods for determining the presence or absence of nucleic acid amplification are not satisfactory in terms of economy and efficiency, such as requiring special equipment. In addition, further improvement has been demanded in terms of sensitivity.

  For example, in a method using a fluorescent intercalator, a UV lamp and a dark room for observing fluorescence are required. Further, in the method described in Patent Document 1, the determination tends to be difficult when the reaction solution is in a very small amount, and the determination result is erroneous because the test sample contains a colored substance, a fluorescent substance, an insoluble substance, or the like. It was easy to occur. Furthermore, in the method described in Patent Document 2, it is necessary to remove the labeled primer or nucleotide that was not incorporated into the nucleic acid, and the labeled primer or nucleotide used was expensive.

  The present invention has been made in view of the above circumstances, and an object thereof is to provide a method for determining the presence or absence of nucleic acid amplification capable of obtaining a highly sensitive determination result by a simple process.

  As a result of intensive studies to solve the above problems, the present inventor has found that the electrochemical characteristics of the reaction solution for performing the nucleic acid amplification reaction change greatly with the progress of the nucleic acid amplification reaction, and based on this finding. The present invention has been completed.

  That is, the present invention is a method for determining the presence or absence of nucleic acid amplification, in which the presence or absence of nucleic acid amplification is determined based on a change in electrochemical characteristics of a reaction solution for performing a nucleic acid amplification reaction.

  According to the knowledge of the present inventors, when guanine is incorporated into the nucleic acid chain as the nucleic acid amplification reaction proceeds, the electrochemical characteristics of the reaction solution derived from the oxidation of guanine at the electrode are greatly changed. Therefore, it is determined that nucleic acid amplification has progressed when a change in electrochemical characteristics has occurred, and it has been determined that nucleic acid amplification has not progressed unless a change in electrochemical characteristics has occurred substantially. That is, according to this method, it is possible to easily determine the presence or absence of nucleic acid amplification simply by performing electrochemical measurement of the reaction solution. In addition, such a change in electrochemical characteristics is hardly affected by impurities, and a determination result with high sensitivity can be obtained.

  The presence or absence of nucleic acid amplification may be determined based on a change in current value when a predetermined voltage is applied to a reaction solution for performing a nucleic acid amplification reaction. By using such a determination method, it is possible to easily obtain a determination result with particularly high sensitivity. In this case, the predetermined voltage is preferably 0.8 to 1.2V. If the voltage is lower than 0.8 V, the change in current before and after the reaction of the nucleic acid amplification reaction tends to be small, and if it is higher than 1.2 V, the change in current before and after the reaction of the nucleic acid amplification reaction tends to be small. Further, the change in the current value is preferably a decrease in the current value derived from the oxidation current caused by the oxidation of guanine. When guanine is incorporated into the nucleic acid chain, the oxidation current generated by the oxidation of guanine decreases, so that the current value of the reaction solution decreases significantly as the reaction proceeds. By determining the presence or absence of nucleic acid amplification based on such a change in current value, it is possible to obtain a more highly sensitive determination result.

  In another aspect, the present invention relates to a method for detecting a target nucleic acid in a test sample. The detection method according to the present invention includes a step of purifying a nucleic acid from a test sample, a nucleic acid amplification reaction for amplifying a target nucleic acid in a reaction solution containing the purified nucleic acid, and using the above-described method for determining the presence or absence of nucleic acid amplification. Determining whether or not the target nucleic acid is amplified in the reaction solution. By using the detection method of the present invention, a highly sensitive detection result can be obtained with a simple process.

  In the step of purifying nucleic acid from the test sample, the nucleic acid may be purified from the test sample so that the nucleic acid is pooled in the collection tank. The detection method according to the present invention may further include a step of introducing the nucleic acid pooled in the recovery tank into the reaction tank connected to the recovery tank. In this case, in the step of determining the presence or absence of nucleic acid amplification, the nucleic acid amplification reaction can be performed in a reaction tank connected to the recovery tank. By using such a detection method, it is possible to suppress a detection error due to mixing of a substance from the outside and obtain a detection result with higher sensitivity.

  In the above detection method, it is preferable to purify the nucleic acid from the test sample by electrophoresis. By using the electrophoresis method, the nucleic acid can be easily and accurately purified.

  In still another aspect, the present invention relates to a reaction apparatus used for the determination method. The reaction apparatus according to the present invention includes a reaction vessel into which a reaction solution for performing a nucleic acid amplification reaction is introduced, and an electrode inserted into the reaction vessel. By using the reaction apparatus of the present invention, a highly sensitive determination result can be obtained with a simple process.

  In still another aspect, the present invention relates to a detection device used for the detection method. A detection apparatus according to the present invention includes the above-described reaction apparatus and a purification apparatus that purifies nucleic acid from a test sample connected to a reaction tank of the reaction apparatus. By connecting the refining device to the reaction vessel, it is possible to suppress a detection error due to mixing of substances from the outside and obtain a highly sensitive detection result.

  The purification device is preferably a purification device that purifies nucleic acid from a test sample by electrophoresis. By using such a purification apparatus, the nucleic acid can be easily purified with high accuracy.

  Further, when purifying nucleic acid by electrophoresis, the purification apparatus comprises an anode-side electrolytic cell, a recovery tank connected to the reaction tank and pooling nucleic acid, a holding tank for holding a test sample, It has a cathode side electrolytic cell, and it is preferable that these are connected in this order. By using such a purification apparatus, the nucleic acid can be easily purified with high accuracy, and the purified nucleic acid can be introduced into the reaction tank without being exposed to the external environment.

  According to the method of the present invention, a highly sensitive determination result can be obtained by a simple process in determining whether nucleic acid amplification is performed.

  Hereinafter, preferred embodiments of the present invention will be described. However, the present invention is not limited to the following embodiments.

  The target nucleic acid detection method according to the present embodiment includes a step of purifying nucleic acid from a test sample so that the nucleic acid is pooled in the recovery tank, and a reaction in which the nucleic acid pooled in the recovery tank is connected to the recovery tank. The step of introducing into the tank and the nucleic acid amplification reaction for amplifying the target nucleic acid in the reaction liquid containing the purified nucleic acid are carried out in the reaction tank, and the nucleic acid is changed based on the change in the electrochemical characteristics of the reaction liquid for performing the nucleic acid amplification reaction. Determining whether or not there is amplification.

  That is, synthesis or amplification of a nucleic acid by synthesizing or amplifying a target nucleic acid on a nucleic acid or a polynucleotide chain, and measuring a current value (especially an oxidation current value) in a reaction solution that changes with the synthesis reaction or amplification reaction. The progress of the reaction is detected. This method is not affected even if the reaction field is colored, unlike the conventional technique which captures the color change of the reaction solution. In addition, it is possible to electrically extract nucleic acid from the test sample and introduce the extracted nucleic acid into the reaction field as it is, so that the opportunity to contact the outside after adding the test sample is minimized. It is possible to prevent the detection result from being false positive due to external contamination.

  The detection method according to the present embodiment can be performed using, for example, the detection apparatus shown in FIG. A detection apparatus 100 shown in FIG. 1 includes a reaction tank 11 into which a reaction solution for performing a nucleic acid amplification reaction is charged, a reaction apparatus 10 having an electrode 12 inserted into the reaction tank 11, and a purification for purifying nucleic acid from a test sample. The apparatus 30 is comprised. The purification apparatus 30 has an anode side electrolytic cell 34, a recovery tank 31 in which nucleic acids are pooled, a holding tank 33 in which a test sample is held, and a cathode side electrolytic cell 35. Connected in order. And the collection tank 31 and the reaction tank 11 are connected via the connection part 50 so that the contents can go in and out. Hereinafter, an embodiment of the detection method will be described in detail by taking as an example the case of detecting a target nucleic acid using the detection apparatus 100 of FIG.

  In the purification device 30, the nucleic acid is purified from the test sample held in the holding tank 33, and the purified nucleic acid is temporarily pooled in the collection tank 31. At this time, the nucleic acid is selectively extracted from the test sample to some extent.

  The anode side electrolytic cell 34, the cathode side electrolytic cell 35 and the holding tank 33 are filled with an electrolytic solution in advance. The electrolytic solution includes a buffer, a supporting electrolyte, and the like. The holding tank 33 and the collection tank 31 are separated by a porous filtration membrane 37. An anode 41 is inserted into the anode side electrolytic cell 34, and a cathode 42 is inserted into the cathode side electrolytic cell 35.

  In general, since nucleic acids have many negative charges in their molecules, they exhibit high electrophoretic mobility toward the anode side. On the other hand, the charge of a protein is determined by the ratio of an amino group that induces a positive charge and a carboxyl group that induces a negative charge, and the total charge is less than that of a nucleic acid. Therefore, when a predetermined voltage (about 50 V) is applied between the anode 41 and the cathode 42, the nucleic acid having high mobility passes through the porous filtration membrane 37 and moves to the collection tank 31 side before the protein having low mobility. To do. By performing such electrophoresis for a certain time (about 2 to 5 minutes), the purified nucleic acid is pooled in the collection tank 31. By a method using electrophoresis, nucleic acids can be selectively extracted so that the amount of protein, which is a main impurity in the test sample, is small.

  The nucleic acid pooled in the collection tank 31 is introduced into the reaction tank 11 through the connection portion 50. For example, electrophoresis is performed in a state where the flow path in the connection part 50 is closed, the nucleic acid is pooled in the recovery tank 31, and then the flow path is opened to send the purified nucleic acid to the reaction tank 11. .

  In the reaction tank 11, a reagent for gene amplification is put in advance. This reagent may be put into the reaction tank 11 while being held on an insoluble carrier such as a porous support. In the case of the conventional method using optical detection such as fluorescence, turbidity, absorbance, etc., it is difficult to detect the progress of the nucleic acid amplification reaction using the porous support with high accuracy. Detection is significantly hindered by the contamination. On the other hand, according to this embodiment, it is possible to detect the progress of the nucleic acid amplification reaction with high accuracy even when a porous support is used.

  After introducing the nucleic acid into the reaction tank 11, if necessary, before performing the nucleic acid amplification reaction, electrochemical measurement is performed to confirm initial electrochemical characteristics. The electrochemical measurement is performed using the electrode 12 including the working electrode 12a, the reference electrode 12b, and the counter electrode 12c.

  The nucleic acid amplification reaction proceeds by energizing a rubber heater 15 provided in contact with the reaction vessel 11 as a heating means for heating the reaction solution to heat the reaction solution to a predetermined temperature. The method of the nucleic acid amplification reaction is not particularly limited. For example, in addition to the PCR (Polymerase Chain Reaction) method, which is currently the most common method for nucleic acid amplification in vitro, LAMP (Loop-Mediated Isolation Amplification) Amplification method (Patent No. 3313358, etc.), SDA (Strand Displacement Amplification) method (Japanese Patent Publication No. 7-114718, etc.), NASBA (Nucleic Acid Sequence Amplification) method (Patent No. 26509) Can be applied.

  Among these amplification reaction methods, the LAMP method forms a loop structure at the end of the base sequence to be amplified, and at the same time, an extension reaction by polymerase occurs, and at the same time, primers hybridized to the region in the loop The product of the previous extension reaction is dissociated into a single strand while the nucleic acid strand is extended by a strand displacement reaction. Since the generated single-stranded nucleic acid has a self-complementary region at its end, a new extension reaction starts by forming a loop at the end. Since the actual LAMP method proceeds isothermally, the above reactions occur simultaneously in parallel. As a feature of the LAMP method, in addition to the strand displacement reaction that proceeds isothermally, the amount of amplification product is very large. This is partly due to the fact that the thermal denaturation operation, which causes the polymerase to be inactivated, is not included. Since the amount of this amplification product is large, the change in the oxidation current value of guanine due to nucleic acid amplification is also large, and the LAMP method is particularly suitable as a method for nucleic acid amplification reaction to be applied in this embodiment.

  The enzyme used for nucleic acid synthesis in the nucleic acid amplification reaction is not particularly limited. Examples of enzymes preferably used include E. coli. E. coli DNA polymerase, Taq DNA polymerase, T4 DNA polymerase, reverse transcriptase, SP6 RNA polymerase, T7 RNA polymerase, terminal deoxynucleotidyl transferase, Poly (A) polymerase, Bst DNA polymerase, Vent DNA polymerase . The reaction of each enzyme can be performed under any known conditions (T. Maniatis et al., Molecular cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Press, 1989).

  The presence or absence of an amplification reaction is determined based on the change over time in the electrochemical characteristics of the reaction solution in which the nucleic acid amplification reaction is performed. When the target nucleic acid is contained in the test sample, the amplification reaction proceeds by the nucleic acid amplification reaction, and the electrochemical characteristics of the reaction solution change greatly. The electrochemical characteristics include a current value or resistance value when a predetermined voltage is applied, and a voltage value when a predetermined current is applied. For example, the current value when a predetermined voltage (preferably 0.8 to 1.2 V) is applied to the reaction solution decreases as the nucleic acid amplification reaction proceeds. When the target nucleic acid is not contained in the test sample, the amplification reaction does not proceed and the electrochemical characteristics such as the current value are not substantially changed. Therefore, it is possible to clearly determine the presence or absence of an amplification reaction based on the presence or absence of a change in electrochemical characteristics. Specifically, for example, if the change in the current value when a constant voltage is applied to the reaction solution in the range of 0.8 to 1.2 V is within ± 7% with respect to the initial current value, It can be determined that the amplification reaction did not proceed. In this case, the change in the current value is, for example, a decrease in the current value (oxidation current value) derived from the oxidation current generated by the oxidation of guanine.

  The measurement mode for performing electrochemical measurement for determining the presence or absence of an amplification reaction is not particularly limited as long as the change in electrochemical characteristics accompanying the amplification reaction can be confirmed. Specific examples of the measurement mode include a linear sweep voltammetry (LSV) method, a differential pulse voltammetry (DPV) method, and a chronoamperometry (CA) method. Alternatively, constant voltage measurement or constant current measurement is also applicable.

  The detection apparatus 100 may be a microchemical analysis system (μTAS) formed on a substrate. In this case, the substrate and the microchemical analysis system formed on the substrate can also be applied as a microdevice for detecting a target nucleic acid. According to such a micro device, it is possible to detect a target nucleic acid simply and with high accuracy even with a small amount of test sample. In the case of the conventional detection method, it is extremely difficult to carry out using a microchemical analysis system, but this embodiment also has an advantage that it is suitable for detection by a microchemical analysis system.

  Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not limited to these.

Example 1 Evaluation of Electrochemical Characteristics of dNTP Electrochemical measurements were performed on dNTP (deoxyribocleoside triphosphate), which is a nucleic acid amplification reaction substrate, to evaluate the electrochemical characteristics of dNTP.

(1) Preparation of sample A reagent solution having the following composition was prepared.
Tris-HCl (pH 8.8) 20 mM
KCl 10 mM
(NH ₄ ) ₂ SO ₄ 10 mM
MgSO ₄ 8 mM
Inner primer (FIP, BIP) 3.2 μM
Outer primer (F3, B3) 0.8 μM
Bst polymerase 8U / tube

The sequences of Inner primer and Outer primer are shown below.
FIP TGTTCCTGATGCAGTGGGCAGCTTTAGTCTGCGGCGGTGTTCTG (SEQ ID NO: 1)
BIP TGCTGGGTCGGCACAGCCTGAAGCTGACCTGAAATACCTGGCCTG (SEQ ID NO: 2)
F3 TGCTTGTGGCCTCTCGTG (SEQ ID NO: 3)
B3 GGGTGTGTGAAGCTGTG (SEQ ID NO: 4)

  A sample (dNTP sample) was prepared by adding dNTP, which is a nucleic acid amplification reaction substrate, to the reagent solution so as to be 5.6 mM. Here, dNTP samples were prepared so that dATP, dTTP, dCTP, and dGTP, which are constituents of dNTP, were 1.4 mM, respectively. Furthermore, four types of samples (dATP sample, dTTP sample, dCTP sample, and dGTP sample) were prepared by adding any one of dATP, dTTP, dCTP, and dGTP to the reagent solution so as to be 1.4 mM. .

(2) Measurement mode Using a potentiostat (Hokuto Denko, HZ-5000), the oxidation current value was measured by the linear sweep voltammetry (LSV) method under the following conditions.
Initial potential: Natural potential Scanning speed: 80 mV / sec
Final potential: 1.2V
Sampling: 100 mV

(3) Measuring method Electrochemical measurement was performed on 80 μL of the sample added to the micro-measurement cell (manufactured by BAS).

(4) Electrode A silver / silver chloride electrode (manufactured by BAS: diameter 4 mm) is used as a reference electrode, a platinum wire is used as a counter electrode, and a glassy carbon electrode (manufactured by BAS: disk 3 mm outside diameter, electrode diameter 1 mm) is used as a working electrode. Electrode). Prior to measurement, these electrode surfaces were polished using a cell polishing kit (manufactured by BAS).

(5) Evaluation LSV measurement was performed on the prepared dNTP sample, dATP sample, dTTP sample, dCTP sample, and dGTP sample. FIG. 2 shows the measurement result of the oxidation current value by the LSV method. As shown in FIG. 2, in the case of the dNTP sample, the oxidation current started to flow around 0.8V, and the oxidation current value increased to 1.2V. Further, in the dATP sample, dTTP sample, and dCTP sample, almost no increase in the oxidation current value was observed within the range of 0.8 to 1.2V. On the other hand, in the dGTP sample, the oxidation current started to flow around 0.8V, and the oxidation current value increased to 1.2V. The changes in the oxidation current values in the dNTP sample and the dGTP sample almost coincided.

  From the above measurement results, it became clear that only guanine of the nucleobases was oxidized at the electrode within the range of 0.8 to 1.2 V, and an oxidation current was generated. In addition, it is known that the oxidation potential of guanine is the lowest among nucleobases.

  Further, with respect to the components of the reagent solution (salts, Tris buffer, primer, Bst, etc.), almost no increase in oxidation current value was observed within the potential range. From these facts, it was clarified that, among the components of the reaction solution for performing the nucleic acid amplification reaction, only guanine produces an oxidation current within the above potential range.

Example 2: Determination of presence or absence of nucleic acid amplification using electrode oxidation reaction of guanine For a reaction solution for performing a nucleic acid amplification reaction, the presence or absence of nucleic acid amplification is determined by performing electrochemical measurement under the same conditions as in Example 1. We examined whether it was possible.

(1) Nucleic acid amplification reaction by LAMP method A sample similar to the dNTP sample prepared in Example 1 is used as an amplification reaction solution, and a nucleic acid amplification reaction is performed by adopting a LAMP (Loop-Mediated Isolation Amplification) method as a nucleic acid amplification method. It was. The reaction temperature was 65 ° C. Moreover, pBR322 into which PSA cDNA was cloned was used as a template nucleic acid for the amplification reaction positive standard.

(2) Electrochemical measurement Using the same measurement mode, measurement method and electrode as in Example 1, electrochemical measurement is performed on amplification reaction solutions having different reaction times, and changes in the electrochemical characteristics with the passage of reaction time are observed. evaluated.

(3) Measurement result In FIG. 3, the measurement result of the oxidation current value by the LSV method of an amplification reaction liquid is shown. As shown in FIG. 3, it was observed that the oxidation current value decreased as the nucleic acid amplification reaction (LAMP reaction) progressed, that is, as the turbidity increased. FIG. 4 is a graph showing the relationship between the oxidation current value and the turbidity at a potential of 1V. As is clear from FIG. 4, it is considered possible to determine the presence or absence of nucleic acid amplification by confirming a decrease in the oxidation current value around 1 V, for example.

Example 3 Influence of Electrode The influence of the type of electrode on the result of electrochemical measurement was examined. Electrochemical characteristics of the reaction solution in the same nucleic acid amplification reaction as in Example 2 using a gold electrode (manufactured by BAS: disk electrode having an outer diameter of 3 mm and an electrode diameter of 1.6 mm) as the working electrode instead of the glassy carbon electrode Was evaluated for changes. In addition, a disposable electrode with a sample reservoir (made by Hokuto Kagaku Sangyo Co., Ltd.) in which a working electrode (carbon paste), a reference electrode (silver / silver chloride) and a counter electrode (carbon paste) are formed on a 2 mm square substrate is used as an electrode. The same evaluation was performed.

(4) Measurement method When the working electrode was a gold electrode, the sample volume was set to 80 μL, and the current value was measured using a trace measurement cell (manufactured by BAS). In the case of a disposable electrode, the sample volume was set to 100 μL, and the current value was measured using a sample reservoir.

(5) Measurement Result FIG. 5 is a graph showing the measurement result of electrochemical measurement when a gold electrode is used as the working electrode, and FIG. 6 is a graph showing the measurement result of electrochemical measurement when a disposable electrode is used. As shown in FIGS. 5 and 6, even when a gold electrode or a disposable electrode is used in place of the glassy carbon electrode as the working electrode, the oxidation current value when nucleic acid amplification by the LAMP reaction occurs (positive) The value was lower than the oxidation current value when it did not occur (negative). From the above results, it was confirmed that the decrease in the oxidation current value accompanying the progress of the nucleic acid amplification reaction can be measured regardless of the type of electrode.

Example 4 Application to Nucleic Acid Amplification Reaction on Insoluble Carrier In the case of nucleic acid amplification reaction in a porous support, the possibility of electrochemical detection of the presence or absence of nucleic acid amplification reaction was examined.

(1) Preparation of sample, etc. The experiment was performed under the same conditions as in Example 2 with respect to sample preparation, template nucleic acid detected by the LAMP method, reaction temperature, and measurement mode.

(2) Electrochemical measurement The electrode used was a disposable electrode similar to that used in Example 3. Electrochemical measurement was performed by immersing the amplification reaction solution in a water-absorbing filter paper cut out to a size of 5 mm × 10 mm (Toyo Filter Paper Co., Ltd .: No. 26-WA) and pressing the filter paper against the electrode.

(3) Measurement results Fig. 7 shows the measurement results of electrochemical measurement. Similarly to Example 3, for example, in the vicinity of 1 V, the oxidation current value when the nucleic acid amplification reaction occurred (Positive) showed a value lower than the oxidation current value when the nucleic acid amplification did not occur (Negative). From this result, it was confirmed that the presence or absence of nucleic acid amplification on the insoluble carrier could be detected by electrochemical measurement. Thus, even in the case of an amplification reaction solution immersed on an insoluble carrier, the presence or absence of nucleic acid amplification could be detected, which means that insoluble unnecessary substances contained in the sample (denatured proteins, inorganic precipitates, etc.) This suggests that nucleic acid amplification can be detected even if is introduced into the reaction solution.

Example 5: Examination of measurement mode In order to elucidate the cause of the decrease in the oxidation current value accompanying the progress of the nucleic acid amplification reaction, electrochemical measurement was performed in a measurement mode other than the LSV method. Conditions other than the measurement mode were the same as in Example 2.

(1) Differential pulse voltammetry (DPV)
Electrochemical measurement by the DPV method was performed under the following conditions. According to the DPV method, reactions such as current from the background and charging of the electric double layer accompanying the electrode reaction can be reduced, and the net reaction occurring at the electrode can be accurately captured.
Initial potential: natural potential Final potential: 1.2V
Pulse width: 50msec
Pulse period: 1 sec
Pulse height: 10mV
Sampling interval: 5 mV

(2) Chronoamperometry (CA)
Electrochemical measurement by the CA method was performed under the following conditions. The CA method is a method in which current measurement is performed while applying a constant potential to an electrode, and a current value at a specific potential can be measured more accurately than in the LSV method.
Initial potential: natural potential Applied potential: 1V
Sampling: 20 sec

(3) Measurement Results FIG. 8 is a graph showing the results of electrochemical measurement by the DPV method. In the case of the DPV method, unlike the case of the LSV method (FIG. 3), a clear peak was observed in the vicinity of 0.8V. This peak of the oxidation current value was observed around the same 0.8 V regardless of the presence or absence of nucleic acid amplification by the LAMP reaction. This indicates that guanine is subjected to electrode oxidation by the same reaction mechanism even in a dNTP state, even when nucleic acid amplification occurs and is incorporated into a nucleic acid chain. On the other hand, as in the case of the LSV method, the oxidation current value when the amplification reaction proceeds (Positive) is lower than that of Negative. This suggests that the frequency of contact with the electrode is reduced when dNTPs are polymerized to form nucleic acid chains.

  Moreover, as shown in FIG. 9, the change of the oxidation current value accompanying the progress of the amplification reaction was also observed in the limit current measurement by the CA method. FIG. 10 is a graph showing the results of performing a Cottrell plot analysis on the current-time curve obtained by the CA method. The slope of the straight line when the nucleic acid amplification reaction progressed (Positive) was smaller than the slope of the straight line when the nucleic acid amplification reaction did not occur (Negative). Since the slope of the straight line obtained by the Cottrell plot correlates with the diffusion coefficient of the substance to be detected, it is considered that the oxidation current value decreased as a result of the decrease in the diffusion coefficient of guanine due to nucleic acid amplification.

It is a top view which shows one Embodiment of a detection apparatus. It is a graph which shows the measurement result of the oxidation current value of each base in dNTP by LSV method. It is a graph which shows the measurement result of the oxidation current value by LSV method of an amplification reaction liquid. It is a graph which shows the relationship between the acid value electric current value in electric potential 1V, and turbidity. It is a graph which shows the measurement result of the oxidation current value by LSV method of an amplification reaction liquid. It is a graph which shows the measurement result of the oxidation current value by LSV method of an amplification reaction liquid. It is a graph which shows the measurement result of the oxidation current value by LSV method of an amplification reaction liquid. It is a graph which shows the measurement result of the oxidation electric current value by DPV method of an amplification reaction liquid. It is a graph which shows the measurement result of the oxidation current value by CA method of an amplification reaction liquid. It is a graph which shows the analysis result by the Cottrell plot of the measurement result of the oxidation current value by CA method.

Explanation of symbols

  DESCRIPTION OF SYMBOLS 10 ... Reaction apparatus, 11 ... Reaction tank, 12 ... Electrode, 12a ... Working electrode, 12b ... Reference electrode, 12c ... Counter electrode, 15 ... Rubber heater, 30 ... Purification apparatus, 31 ... Collection tank, 33 ... Holding tank, 34 ... Anode-side electrolytic cell, 35 ... cathode-side electrolytic cell, 37 ... porous filtration membrane, 41 ... anode, 42 ... cathode, 50 ... connection part, 100 ... detection device.

Claims (9)

Purifying nucleic acid from a test sample such that the nucleic acid is pooled in a collection vessel;
Introducing the nucleic acid pooled in the recovery tank into a reaction tank connected to the recovery tank;
In the reaction tank, a nucleic acid amplification reaction is performed to amplify the target nucleic acid in a reaction solution containing purified nucleic acid, and the presence or absence of nucleic acid amplification is determined based on a change in electrochemical characteristics of the reaction solution in which the nucleic acid amplification reaction is performed. A method for determining the presence or absence of nucleic acid amplification of the target nucleic acid in the reaction solution using the method, and a method for detecting the target nucleic acid in the test sample.   The detection method according to claim 1, wherein the presence or absence of nucleic acid amplification is determined based on a change in current value when a predetermined voltage is applied to the reaction solution.   The detection method according to claim 2, wherein the predetermined voltage is 0.8 to 1.2V.   The detection method according to claim 2 or 3, wherein the change in the current value is a decrease in a current value derived from an oxidation current caused by oxidation of guanine.   The detection method according to any one of claims 1 to 4, wherein the nucleic acid is purified from the test sample by electrophoresis. A reaction vessel into which a reaction solution for performing a nucleic acid amplification reaction is charged;
An electrode inserted into the reaction vessel,
The reaction vessel is connected to a collection vessel in which nucleic acids purified from the test sample are pooled;
The reaction apparatus used for the detection method as described in any one of Claims 1-5. A reactor according to claim 6;
A purification device for purifying nucleic acid from a test sample connected to the reaction vessel of the reaction device,
The purification apparatus has a recovery tank in which nucleic acids purified from the test sample are pooled, and the recovery tank is connected to the reaction tank;
The detection apparatus used for the detection method as described in any one of Claims 1-5.   The detection apparatus according to claim 7, wherein the purification apparatus is a purification apparatus that purifies nucleic acid from a test sample by electrophoresis. The purification device is
An anode side electrolytic cell;
A recovery tank connected to the reaction tank and in which nucleic acids are pooled;
A holding tank in which the test sample is held;
A cathode side electrolytic cell,
The detection device according to claim 8, wherein these are connected in this order.

Images