JP2015001394A - Cover body and use of the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a cover body which is to be installed on a substrate to store a liquid on the substrate and improves spreadability of the liquid and reduces the unevenness of contact between the liquid and the solid-phase substrate.SOLUTION: A cover body is to be installed on a substrate to store a liquid on the substrate. The substrate has an analyte capture part on an upper surface thereof, and the cover body has a concave portion and a locking part for matching between relative positions of the concave portion and the analyte capture part. The concave portion includes: a storage part for storing the liquid covering the analyte capture part; and two or more flow passage parts communicating with the storage part, and each flow passage part includes: a communication port communicating with the storage part; and an open port located in an end part on the side opposite to the communication port.

Description

  The present invention relates to a covering used for the purpose of holding a solution on a solid substrate when the sample solution is brought into contact with the substrate, and a method thereof.

The microarray is a device in which a physiologically active substance is immobilized on the surface of a solid phase substrate. For example, in the case of a nucleic acid microarray, the nucleic acid is fixed on a solid phase substrate such as plastic or glass. The nucleic acid microarray is used in such a manner that a solution containing nucleic acid detected and amplified from a specimen such as a cell is developed on the microarray and reacted for a predetermined time. The nucleic acid immobilized on the microarray and the nucleic acid in the sample solution undergo a hybridization reaction corresponding to the homology of the base sequence, and this reaction rate is quantified by using a label such as a fluorescent dye or radioisotope. Information on the sequence of the nucleic acid contained in the sample solution can be obtained.

  Since the reaction of physiologically active substances is generally a liquid phase reaction, it is necessary to bring the sample into contact with the microarray surface in a solution state and hold it for a certain period of time in order to cause the sample to react with the physiologically active substance immobilized on the microarray. There is. In this operation, it is important that the surface of the microarray contacts the sample solution uniformly over the front surface. Uniform contact means that the thickness of the liquid phase is constant and bubbles are not included. It is also important to prevent evaporation of the sample solution during the reaction. If the contact between the sample solution and the microarray is uneven or a part of the sample solution evaporates, the reaction efficiency varies depending on the position on the microarray, and the reliability of the obtained data is lowered.

In order to develop the sample solution and the microarray uniformly, a method of providing a certain space between the hybrid cover and the microarray has been studied (for example, Patent Document 1).
However, if the hybrid cover is simply placed on the microarray, there is a problem that the hybrid cover moves during hybridization and cannot cover the important physiologically active substance.

JP2003-21637

  The present invention is a covering that is placed on the substrate to store the liquid on the substrate, improves the developability of the liquid, and reduces non-uniform contact between the liquid and the solid phase substrate It aims at providing a covering.

Such an object is achieved by the present inventions (1) to (9) below.
(1) A covering disposed on the substrate for storing a liquid on the substrate, the substrate having a specimen capturing portion on an upper surface thereof, the covering including the recess, A recessed portion and a locking portion for aligning the relative position of the sample capturing portion, wherein the recessed portion is a storage portion for storing a liquid covering the sample capturing portion, and two or more communicating with the storing portion And a flow passage portion having a communication port communicating with the storage portion and an open port at an end opposite to the communication port.
(2) The covering according to (1), wherein the specimen capturing unit is a substance in which a substance that captures a biological substance is fixed by spotting.
(3) The locking portion includes two or more first locking portions disposed on the front end surface of the covering body, and two or more second engagement portions disposed on opposing positions on the side surface of the covering body. The covering according to the above (1) or (2), which has a stopper.
(4) The first locking portion is bent in the tip direction of the covering body so that at least a part of a portion where the covering body extends from the substrate is in contact with the tip surface of the substrate. The covering according to (3) above.

(5) Said 2nd latching | locking part is bent so that at least one part of the part which the said covering body extended from the said board | substrate may contact the side surface of the said board | substrate in the side surface direction of the said covering body. The covering according to (3) or (4).
(6) The covering according to any one of (1) to (5), wherein the depth of the recess is 0.2 mm or more and 1 mm or less.
(7) The covering according to any one of (1) to (6), wherein a width of the communication port of the flow path is narrower than a maximum width in a direction parallel to the width direction of the communication port in the storage unit.
(8) The covering according to any one of (1) to (7), wherein a material of the covering is plastic.
(9) The covering according to (8), wherein the plastic is transparent or translucent.
(10) The covering according to any one of (1) to (9) is installed on the substrate, a liquid containing a biological substance is injected into the opening, and a liquid containing the biological substance is injected onto the substrate. How to store.

  According to the present invention, in order to store the liquid on the substrate, the covering is installed on the substrate, improves the developability of the liquid, and reduces uneven contact between the liquid and the solid substrate. A coated body can be provided.

It is a bottom view which shows an example of 1st embodiment of the coating body of this invention. It is a top view which shows an example of 1st embodiment of the coating body of this invention. It is a bottom view which shows an example of the use condition of the coating body of this invention. It is a side view which shows an example of 1st embodiment of the coating body of this invention. It is a side view which shows an example of the use condition of the coating body of this invention. It is a front view which shows an example of 1st embodiment of the coating body of this invention. It is a front view which shows an example of the use condition of the coating body of this invention.

An example of the covering of the present invention will be described in detail with reference to the drawings.

FIG. 1 is a bottom view of a covering 100 according to an embodiment of the present invention as viewed from below, and FIG. 2 is a top view of the covering 100 as viewed from above. In the present invention, the lower surface of the covering body is a surface that has a recess and is bonded to the substrate surface in order to store liquid on the substrate, and the upper surface is a surface opposite to the lower surface. .
As shown in FIG. 1, a covering 100 according to an embodiment of the present invention includes a first region 10 and a second region 20 adjacent to the first region 10, and has a recess 11 in the first region 10. In addition, the second region 20 includes the locking portions 21 to 24, and the recess 11 further includes the flow path portions 111 and 112 and the storage portion 113.

(Concave)
FIG. 3 is a bottom view of an example in which a covering 100 according to an embodiment of the present invention is installed on a substrate.
As shown in FIG. 3, the recess 11 is provided on the surface side in contact with the substrate 200 when the covering 100 is installed on the substrate 200, and a liquid is provided between the substrate 200 and the covering 100. It provides a space where it can be stored.

(Reservoir)
As shown in FIGS. 1 and 3, the concave portion 11 includes a storage portion 113 for storing a liquid covering the specimen capturing portion 210 of the substrate 200, and flow path portions 111 and 112 communicating with the storage portion 113. Have
The storage unit 113 covers the entire surface of the sample capturing unit 210 of the substrate 200 with a minimum area, and can fill the entire surface of the sample capturing unit 210 with a minimum amount of liquid.
The planar shape of the reservoir 113 is not particularly limited, and may be a polygon such as a triangle or a quadrangle. However, the liquid expandability is good, and the generated bubbles are from an opening described later. From the viewpoint of easy removal, it is preferably substantially circular or elliptical.

(Flow path part)
The channel portion 111 has a communication port communicating with the storage portion 113 and an opening 114 at the end opposite to the communication port. Further, in the storage unit 113, the flow channel unit 112 is disposed at a position facing the flow channel unit 111, and the flow channel unit 112 has a communication port communicating with the storage unit 113 and an end portion on the opposite side to the communication port. An opening 115 is provided.
Here, the liquid covering the specimen capturing part 210 of the substrate 200 is injected from, for example, the opening 114, passes through the flow path part 111, and is developed in the storage part 113. Alternatively, it may be injected from the opening 115, passed through the flow path part 112, and developed in the storage part 113.

In addition, when liquid is injected from one of the open ports 114 and 115, air pushed out from the other open port is released, so that liquid clogging when liquid is injected into the storage unit 113 is less likely to occur. In addition, non-uniform contact between the liquid and the sample capturing unit 210 due to the mixing of bubbles into the recess 11 caused by clogging can be prevented.
Furthermore, even when air bubbles enter the recess 11, it is easy to remove the air bubbles by tilting the substrate 200 and moving the air bubbles to the opening.
In the covering according to the present invention, the number of the flow path portions communicating with the storage section may be two or more, and the present invention is not limited to the embodiment shown in FIG. Even if it is doing, the said effect can be exhibited.

In the covering according to the present invention, it is preferable that the width of the communication port of the flow path portion is narrower than the maximum width of the storage portion in the direction parallel to the width direction of the communication port. This makes it easier for the liquid to stay in the storage section, and makes it difficult for the liquid stored in the storage section to evaporate.
For example, in FIG. 1, the width A of the communication port of the flow path portion 111 is designed to be narrower than the maximum width B of the storage portion 113 in the direction parallel to the width direction.

 Here, in the covering according to the present invention, the depth of the recess is preferably 0.2 mm or more and 1 mm or less, more preferably 0.3 mm or more and 0.8 mm or less, 0.4 or more, More preferably, it is 0.6 mm or less. When the depth of the recess is less than the lower limit, the amount of liquid that can be stored in the storage part is small, so that the substance in the stored liquid is fixed to the specimen capturing part, In some cases, the amount of the biological material is reduced, and the reaction between the substance that captures the biological material and the biological material varies between the spotted portions. Moreover, when the depth of a recessed part is deeper than the said upper limit, since there are too many liquid quantities which can be stored in a storage part, it is unpreferable in terms of cost.

(Locking part)
As shown in FIGS. 1 and 3, in the covering 100, the locking portions 21 to 24 have a role of matching the relative positions of the concave portion 11 and the specimen capturing portion 210 of the substrate 200.
In particular, when the area of the specimen capturing part is small, there is a case where the entire surface of the specimen capturing part may not be covered with the reservoir part of the concave part due to a minute shift of the covering. The covering body can be fixed at a predetermined position, and the relative position between the concave portion and the specimen capturing section can be matched.

Further, as shown in FIG. 1, the locking portions 21 to 24 are opposed to the first locking portions (locking portions 21 and 22) arranged on the front end surface of the covering body 100 and the side surfaces of the covering body 100. The second locking portions (locking portions 23 and 24) arranged at the positions are classified.
Thus, the latching portion includes the first latching portion disposed on the front end surface of the covering body and the second latching portion disposed at the position facing the side surface of the covering body, thereby Thus, the covering body can be fixed at a predetermined position in both the vertical and horizontal directions, and the relative position of the concave portion and the specimen capturing portion can be more reliably aligned.
In addition, the number of the 1st latching | locking part and the 2nd latching | locking part is not limited to embodiment of FIG. 1, Even if it is three or more respectively, the said effect can be exhibited.

4 is a side view of the cover 100 according to an embodiment of the present invention as viewed from the side, and FIG. 5 is an example of the cover 100 according to the embodiment of the present invention installed on a substrate. It is a side view.
As shown in FIGS. 4 and 5, the first locking portion (locking portions 21, 22) has a portion where the covering body 100 extends from the substrate 200 in the leading end direction of the covering body 100. It is bent vertically so as to contact the surface. When the first locking portion has such a structure, the above-described effect can be exhibited more remarkably.

FIG. 6 is a front view of the covering 100 according to the embodiment of the present invention as viewed from the front, and FIG. 7 is an example in which the covering 100 according to the embodiment of the present invention is installed on a substrate. It is a front view.
As shown in FIGS. 6 and 7, the second locking portion (locking portions 23, 24) is such that the portion where the covering body 100 extends from the substrate 200 in the side surface direction of the covering body 100 is the side surface of the substrate 200. It is bent vertically so that it touches. When the second locking portion has such a structure, the above-described effect can be exhibited more remarkably.

As shown in FIG. 1, the locking portions 21 and 23 are integrally connected to the first region 10 via the first spacer portion 25, and the locking portions 22 and 24 are connected to the first region 10 via the second spacer portion 26. Yes. The first spacer portion 25 and the second spacer portion 26 define the relative positions of the locking portions 21 to 24 and the concave portion 11, that is, the concave portions 11 and the sample capturing portion 210 are locked by the locking portions 21 to 24. This contributes to the effect that the relative positions can be reliably matched.
Further, the first spacer portion 25 and the second spacer portion 26 are joined to the first region 10 in a region between both ends of the opening 115 and the side surface of the covering 100, respectively, and are provided as a pair with the opening 115 interposed therebetween. Has been. Thereby, it becomes easy to inject the liquid from the opening 115, and when the liquid is stored in the storage portion 113 of the recess 11, the liquid is prevented from leaking from the storage portion 113 to the second region due to capillary action. can do.

Here, the material of the covering 100 is not particularly limited, but is preferably plastic in that it is easy to integrally mold the entire covering 100 and high safety during handling.
Furthermore, the plastic is preferably transparent and translucent. As a result, it is possible to visually recognize the state of development of the liquid injected into the recess 11 and the presence or absence of the generation of bubbles, so that uneven contact between the liquid and the substrate can be reduced.

The method for storing the liquid on the substrate 200 using the covering 100 is not particularly limited. For example, the surface of the substrate 200 having the specimen capturing part 210 and the recess 11 of the covering 100 are formed. The bonding is performed so that the surfaces are in contact with each other, and liquid is injected from the opening 114. The injected liquid passes through the flow path part 111 and is developed in the storage part 113.
Here, the liquid is not particularly limited, and examples thereof include a liquid that is fixed to the specimen capturing unit 210 and that captures a biological material, and a liquid that includes a biological material having specific reactivity. .
In addition, as said biological origin, DNA, RNA, protein, sugar chain etc. are mentioned, for example.

The covering 100 is preferably provided with a step at the boundary between the first region 10 and the second region 20. Specifically, as shown in FIG. 4, the height of the first region 10 is preferably higher than the height of the second region 20 on the surface side where the covering 100 is in contact with the substrate 200.
Thereby, when a liquid is stored in the storage part 113 of the recessed part 11, it can prevent that a liquid leaks from the storage part 113 to a 2nd area | region by capillary action.
The step is not particularly limited, but is preferably 0.3 μm or more and 0.8 μm or less, and more preferably 0.4 μm or more and 0.6 μm or less. The said effect can be exhibited more notably by the said level | step difference being in the said range.

  Preferred embodiments of the present invention are as described above, but the present invention is not limited thereto. Further, in the present embodiment, the operations and effects of the configuration of the present invention are described. However, these operations and effects are merely examples and do not limit the present invention.

Examples of the present invention are described below, but are not limited thereto.

Example 1
(1) Preparation of microarray 5 spots of oligo DNA of sequence 1 were immobilized on a plastic substrate (length 75 mm x width 25 mm) to obtain a DNA microarray.
Array 1: aattcatggaaaaggtctgcgtcaaatccccagtcgtcatgcattgcc
(2) Preparation of hybridization solution 0.5 μL of λDNA (λDNA manufactured by Takara Co., Ltd.) adjusted to a concentration of 1.5 pg / μL as a template was amplified by PCR reaction using oligo DNAs of sequences 2-3. A PCR product fluorescently labeled with Cy3 was added to a hybridization buffer to obtain a hybridization solution.
Sequence 2: acggacttcgttgctttccagtt
Sequence 3: gaattacagcgcaacacagcaata

(3) Production of Covering Body A covering body having a bottom view shown in FIG. 1, a top view shown in FIG. 2, a side view shown in FIG. 4, and a front view shown in FIG.
Specifically, a saturated cyclic polyolefin resin (a hydrogenated product of 5-methyl-2-norbornene ring-opening polymer was used as a material to prepare a coated body by an injection molding method. A first region (25 mm × 25 mm × 1 mm) was provided, and a recess having a depth of 0.5 mm was provided on one surface of the first region.
In the recess, a substantially elliptical storage part having a major axis (17 mm) parallel to the long side of the first region, and two flow paths that are arranged at opposing positions in the minor axis direction of the storage part and communicate with the storage part Was provided.
The width of each flow path was 5 mm, and the width of the communication port communicating with the storage portion and the width of the end opposite to the communication port were the same.
In the second region adjacent to one long side of the first region, a pair of the first spacer portion and the second spacer portion is provided with the opening interposed therebetween. Each of the first spacer portion and the second spacer portion was provided with a first locking portion and a second locking portion on the tip and the side surface of the cover.

(4) The covering prepared in (3) was placed on the DNA microarray prepared in the hybridization reaction (1), and the hybridization solution thermally denatured at 95 ° C. for 5 minutes was dispensed into the recesses. The DNA microarray was placed in a container that could be sealed, and reacted at 55 ° C. for 4 hours under humidified conditions. After completion of the hybridization reaction, the surface of the microarray was washed to complete the hybridization reaction.

(5) After completion of the hybridization reaction performed in measurement (4), the fluorescence intensity of the spin-dried DNA microarray is measured at each position where the probe is spotted using a DNA microarray scanner (GenePix: 4000x manufactured by Axon). It was measured. In the calculation of the fluorescence intensity, five measurement values are obtained for each probe, but the average of the three intermediate measurement values excluding the highest value and the lowest value is calculated to calculate the average value for each probe. It was set as the fluorescence intensity. The obtained results are shown in Table 1.

(Comparative Example 1)
The measurement was carried out in the same manner as in Example 1 using a rectangular smooth plate-like glass cover having no recesses and locking portions instead of the covering of the present invention. The obtained results are shown in Table 1.

  As can be seen from Table 1, in Example 1, the five oligo DNAs spotted on the substrate reacted uniformly with the hybridization solution, whereas in Comparative Example 1, it was in sufficient contact with the hybridization solution. The average value of the signal was lower than that of Example 1 because there was a spotted portion that was not.

10 1st area | region 11 Recessed part 20 2nd area | region 21 Locking part (1st locking part)
22 Locking part (first locking part)
23 Locking part (second locking part)
24 Locking part (second locking part)
25 First spacer portion 26 Second spacer portion 100 Covering body 111 Channel portion 112 Channel portion 113 Reservoir portion 114 Opening portion 115 Opening portion 200 Substrate 210 Sample capturing portion

Claims (10)

In order to store the liquid on the substrate, a covering body installed on the substrate,
The substrate has a specimen capturing part on its upper surface,
The covering has a recess, and a locking portion for aligning the relative position of the recess and the specimen capturing unit,
The concave portion has a storage portion for storing a liquid covering the specimen capturing portion, and two or more flow path portions communicating with the storage portion,
The said flow path part has a communicating port connected with the said storage part, and an open | release port in the edge part on the opposite side to the said communicating port, The covering body characterized by the above-mentioned. The covering according to claim 1, wherein the specimen capturing unit is a substance in which a substance that captures a biological substance is fixed by spotting. The locking portion includes two or more first locking portions disposed on the front end surface of the covering body, and two or more second locking portions disposed at positions facing side surfaces of the covering body. The covering according to claim 1 or 2, wherein: 4. The first locking portion is bent in such a manner that at least a part of a portion where the covering body extends from the substrate is in contact with the front end surface of the substrate in the leading end direction of the covering body. The covering according to 1. The said 2nd latching | locking part is a thing bent so that at least one part of the part which the said covering body extended from the said board | substrate might contact | connect the side surface of the said board | substrate in the side surface direction of the said covering body. 4. The coated body according to 4. The depth of the said recessed part is 0.2 mm or more and 1 mm or less, The coating body of any one of Claim 1 thru | or 5. The covering according to any one of claims 1 to 6, wherein a width of the communication port of the flow path is narrower than a maximum width in a direction parallel to a width direction of the communication port in the storage portion. The covering according to any one of claims 1 to 7, wherein a material of the covering is plastic. The covering according to claim 8, wherein the plastic is transparent or translucent. A method for storing the liquid containing a biological substance on the substrate by installing the covering according to any one of claims 1 to 9 on the substrate, injecting a liquid containing a biological substance into the opening.