JP2010252789A - Protein complex for decomposing cellulose and use of the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a protein complex in which proteins contributing to cellulose decomposition are clustered and which is suitable for improving the functions of these proteins and synergistic effects between the proteins and other proteins. <P>SOLUTION: A complex is formed for cellulose decomposition, wherein the complex is provided with a carrier having a plurality of biotin binding sites and one or more of the multiple cellulose decomposition proteins which are biotinylated and retained on the carrier and contribute to the decomposition of cellulose. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a protein complex for cellulose degradation and use thereof.

  Enzymatic degradation of cellulose requires a large amount of cellulase and is degraded by the action of multiple types of cellulases such as endoglucanase and cellobiohydrolase, and cellulose-binding domains with high affinity for cellulose. It has been known.

  Microorganisms such as Clostridium thermocellum are known to form a cellulase clustered (integrated) complex called cellulosome on the cell surface. In the cellulosome, a Scaffoldin protein having a cohesin site capable of binding cellulase functions as an enzyme carrier. Scaffoldin protein has a cellulose binding domain (CBD).

  The cohesin site of scaffoldin specifically binds to the corresponding dockerin site fused to the enzyme to form a cellulase clustering complex, so-called “cellulosome”. Scaffoldin and cellulase contain a cellulose binding domain (CBD).

  There is an attempt to form an artificial cellulose complex using such a scaffoldin protein (Non-patent Document 1). In this Non-Patent Document 1, an artificial scaffolding protein comprising two cohesins and CBD each capable of binding two kinds of endoglucanases derived from different microorganisms is prepared. The production of a chimeric endoglucanase complex from two types of endoglucanases is disclosed. Furthermore, it is disclosed that Avicel was decomposed using this chimeric endoglucanase complex (Non-patent Document 1, Table 1). In addition, it is also disclosed that Avicel was decomposed with a mixture of two types of complexes bound to cohesin-endoglucanase in which each of the cohesins and the two types of endoglucanases were bound (Non-patent Document 1, in particular, FIG. 5).

Degradation of cellulose substrates by cellulosome chimeras. Journal of Biological Chemistry 2002, 277, 49621-49630

However, it has been found that there is a limit to the complexation of cellulase using cellulosomal scaffolding protein.
First, with the technique described in Non-Patent Document 1, the effect of accumulating a plurality of endoglucanases is not always sufficiently obtained. That is, according to the result of degradation of Avicel with the chimeric endoglucanase complex, it was found that the two kinds of endoglucanases each exhibited a degradation activity of 1.7 to 3 times that of the free state. On the other hand, when comparing the degradation results of Avicel with two types of cohesin-endoglucanase complexes, it was found that the increase in endoglucanase activity was due to the binding of dockerin and cohesin fused to EG. It is thought that the effect of CBD of scaholdin protein. From the above, it is considered that the effect of accumulation of endoglucanase is low.

Secondly, the binding between dockrin and cohesin is not necessarily stable under conditions suitable for cellulase activity. That is, the improvement in endoglucanase activity in the above complex greatly depends on the improvement in endoglucanase activity due to the binding of dockrin and cohesin. Certainly, the dockrin-cohesin binding is relatively strong ( ^{−10 −10} M), but the half-life of the complex is more than 24 hours at 37 ° C., and at 50 ° C. where general cellulase enzyme treatment is performed, It is easily inferred that the composite is easily broken. In addition, since the dockrin-cohesin interaction is Ca ²⁺ -dependent binding, it requires Ca ²⁺ at the time of complex formation. In addition, there is a disadvantage that it becomes fragile when the Ca ²⁺ concentration is insufficient.

  Third, as described above, there is also a disadvantage that the enzyme activity depends on the interaction between dockrin, which is a part of the enzyme activity, and cohesin on the scaffoldin protein. That is, the number of cellulases that can be used is enormous. For this reason, it is not practical to confirm the improvement of endoglucanase activity by expressing a fusion protein in which a dockerin site is fused to each of a number of cellulases in Escherichia coli, yeast, etc., and then binding this fusion protein to cohesin. It was.

  Accordingly, an object of the present invention is to provide a protein complex suitable for clustering proteins that contribute to cellulose degradation and improving the function of these proteins and the synergistic effect with other proteins. .

  In order to solve the above-mentioned problems, the present inventors searched for a carrier suitable for integrating enzymes that contribute to cellulose degradation. Knowledge that clustered complexes suitable for functional expression of protein such as cellulase can be obtained by binding biotinylated cellulase or CBD to biotin-binding protein such as streptavidin used as part of the probe To complete the present invention. That is, according to the present invention, the following means are provided.

  According to the present invention, a protein complex for degrading cellulose, a carrier having a plurality of biotin-binding sites, and one or two types that contribute to the degradation of cellulose held in the carrier via biotin A composite comprising the above plurality of cellulolytic proteins is provided. In the composite of the present invention, the carrier may include streptavidin or quantum dots.

  The cellulolytic protein may contain one or more cellulases, and the cellulolytic protein may contain one or more cellulose binding domains. The cellulolytic protein may contain two or more cellulases or two or more cellulose binding domains. Further, the cellulase may contain endoglucanase.

  According to this invention, the manufacturing method of the degradation product of a cellulose provided with the process of decomposing | disassembling a cellulose using the protein complex of this invention is provided.

  Further, according to the present invention, a step of decomposing cellulose using the protein complex of the present invention, a step of obtaining a useful substance by fermentation using a carbon source containing a degradation product of cellulose obtained in the above step, A method for producing a useful substance is provided.

It is a schematic diagram which shows an example of a protein complex. It is a figure which shows the structure of pelB origin signal peptide + SacII site destruction AnEglA + Bio-tag + His-tag fragment. It is a figure which shows the structure of an EcoRI-pelB origin signal peptide + CBDamo + Bio-tag + His-tag fragment. It is a figure which shows the various clusters produced combining CBEG and BCBDamo, and its evaluation result. It is a figure which shows the various clusters produced combining CBEGamo and BCBDamo, and its evaluation result. It is a figure which shows the correlation between chemically modified biotinylated endoglucanase (CBEG) concentration and reducing sugar concentration. It is a figure which shows the evaluation result of integration to the PSC of a QD cluster. It is a figure which shows the decomposition | disassembly result (reducing sugar concentration) of PSC by various QD clusters. It is a figure which shows the decomposition | disassembly result (specific activity: equivalent concentration / actual concentration) of PSC by various QD clusters. It is a figure which shows the expression vector of C terminal site specific biotinylated CelD derived from C. thermocellum. It is a figure which shows the decomposition | disassembly result of PSC by the SA cluster using C terminal site specific biotinylated CelD derived from C. thermocellum. It is a figure which shows the decomposition | disassembly result of PSC by the QD cluster using C terminal area specific biotinylated CelD derived from C. thermocellum. It is a figure which shows the expression vector of C terminal site specific biotinylated CBHA derived from C. thermocellum. It is a figure which shows the decomposition | disassembly result of PSC by the SA cluster using C terminal site specific biotinylated CBHA derived from C. thermocellum.

  The present invention relates to a protein complex for decomposing cellulose and use thereof, and more particularly to a protein complex, a method for producing a degradation product of cellulose, and a method for producing a useful substance. According to the protein complex of the present invention, one or two or more types of cellulose-degrading proteins that contribute to cellulose degradation are bound to a carrier through the binding of biotin and a biotin-binding protein (biotin-avidin bond). Is retained. For this reason, a plurality of cellulolytic proteins that contribute to cellulose degradation can be easily accumulated. A plurality of such cellulolytic proteins can be held in close proximity. As a result, the cellulolytic activity can be effectively increased. In addition, since the bond between the carrier and the cellulolytic protein in the protein complex of the present invention is a strong bond, it is a more stable enzyme complex. Furthermore, since the bond is thermally stable, the composite structure can be stably maintained even in a process at a high temperature, and the composite effect can be reliably obtained.

  For example, by providing a plurality of cellulose-binding domains as cellulose-degrading proteins, the probability of physical adsorption of the protein complex to cellulose can be increased, and as a result, the diffusion rate can be reduced. Moreover, a local catalyst density | concentration can be raised by providing two or more cellulases as a cellulose degradation protein.

  According to the protein complex of the present invention, the degree of freedom in the distance between the enzyme to be complexed or between the enzyme and the protein is increased by using the cellulolytic protein. That is, by complexing an enzyme with biotin via an appropriate linker, the distance between enzymes, the distance between enzymes and proteins, and the configuration can be easily adjusted. It is possible to provide a complex in which cellulases suitable for attack are clustered (integrated) on cellulose sites that can serve as substrates.

  Hereinafter, embodiments of the present invention will be described in detail. FIG. 1 is a schematic view of an example of the protein complex of the present invention.

(Protein complex)
The protein complex of the present invention is for cellulose degradation. That is, the present protein complex is used for the purpose of degrading cellulose to obtain cellulose degradation products such as low-molecular oligosaccharides, cellobiose and glucose.

  In the present specification, cellulose refers to a polymer in which glucose is polymerized by β-1,4-glucoside bonds and derivatives thereof. The degree of polymerization of glucose in cellulose is not particularly limited, but is preferably 200 or more. In addition, examples of the derivative include derivatives such as carboxymethylation, aldehyde formation, or esterification. Cellulose may contain cellooligosaccharide and cellobiose, which are partially decomposed products thereof. Further, the cellulose may be crystalline cellulose or non-crystalline cellulose, but preferably contains crystalline cellulose. Furthermore, the cellulose may be naturally derived or artificially synthesized. The origin of cellulose is not particularly limited. It may be derived from plants, fungi, or bacteria.

(Career)
The protein complex includes a carrier having a plurality of biotin binding sites. The carrier may have a plurality of biotin binding sites. Examples of such binding sites include avidin, streptavidin, neutravidin (NeutrAvidin) (http://www.technochemical.com/pierce/avidin/neutravidin .htm) and other multimers such as modified and homologous forms thereof. A multimer may be a protein in which a plurality of these proteins are linked by an amino acid sequence or a chemical linker. A protein having a plurality of avidin binding sites or such a multimeric protein can be handled as a single carrier. Such a protein having a plurality of biotin binding sites per se can be used as a carrier. According to such a carrier, mobility and diffusibility are ensured, a composite having excellent accessibility to the substrate can be obtained, and cellulose can be effectively decomposed.

  The carrier can take a form in which a plurality of biotin-binding sites are provided on a support having various three-dimensional forms such as particles such as a substrate and beads. By providing the support with a biotin binding site, the carrier can be separated. Such a support is not particularly limited, and examples thereof include glass, plastic, ceramics, and quantum dots. It is preferable to use quantum dots as the support. By using a quantum dot as a support, a large number of biotin binding sites can be provided, and the multivalent effect can be increased. For example, the reaction rate of cellulose degradation can be increased. Moreover, it becomes easy to grasp the dynamics by using fluorescent quantum dots.

  As the quantum dot, a quantum dot that can be synthesized or obtained without particular limitation can be used. Examples of fluorescent quantum dots include Cd, Zn, Hg, Cu, Ag, Ti, V, Cr, Mn, Fe, Co, Ni, Zr, Mo, Ta, W, Ir, Eu, Sm, and Mg. Quantum dots comprising at least one metal atom selected from the group consisting of and at least one atom selected from the group consisting of S, Se and Te. A typical example is CdSe. The average particle size of the quantum dots is not particularly limited, but can be about 1 nm to 500 nm, preferably about 3 nm to 50 nm.

  Quantum dots having a biotin binding site, that is, quantum dots having avidin or the like on the surface are commercially available as the Qdot streptavidin labeling series (Invitrogen) or the like, and proteins can be obtained by known methods (Biofunctinalization of Nanomaterials Edited by According to p1-40 in Challa Kumar WILLEY-VCH (2005), Biofuntionalization og fluorescent Nanoparticles MJ Murcia and CA Naumann), it can also be produced by binding to the surface of a quantum dot.

  The carrier preferably comprises 3 or more biotin binding sites per molecule. Accumulation of three or more cellulose-degrading proteins can effectively enhance the ability to decompose cellulose. More preferably, the number is 4 or more.

  These various modes of carriers can be used alone or in combination of a plurality of types. Moreover, the carrier of various aspects can also be held on a solid phase carrier such as a substrate or a bead. Holding the carrier on the solid phase carrier is advantageous for repeated use.

(Cellulolytic protein)
The present protein complex includes one or two or more cellulose-degrading proteins that contribute to cellulose degradation. Cellulose-degrading protein should just have an amino acid sequence which finally contributes to decomposition | disassembly of a cellulose. Examples of the cellulose-degrading protein include proteins composed of amino acid sequences that directly act on cellulose and contribute to cellulose degradation. The cellulolytic protein may be the whole naturally occurring protein, a part thereof having a desired activity, or an artificially modified product thereof. More specifically, examples of the cellulolytic protein include cellulose-relaxing proteins such as cellulase, cellulose binding domain (CBD), expansin, swollenin and the like.

  Cellulase means a series of enzymes that break down cellulose into glucose. Cellulases are selected from these enzyme groups, but preferably endoglucanase (EC 3.2.1.74), cellobiohydrolase (EC 3.2.1.91) and β-glucosidase (EC 23.2.4.1, EC 3.2.1.21). Is mentioned. Among them, it is preferable to use at least endoglucanase in order to decompose crystalline cellulose and efficiently reduce the molecular weight of cellulose. Also preferred is cellobiohydrolase. Note that cellulase 13 (5, 6, 7, 8, 9) of GHF (Glycoside Hydrolase family) (http://www.cazy.org/fam/acc.gh.html) is based on the similarity of amino acid sequences. , 10, 12, 44, 45, 48, 51, 61, 74). You may combine the same or different cellulases classified into a different family. A cellulase can be used 1 type or in combination of 2 or more types from various cellulases. As long as the cellulase has activity as a cellulase, it may be a part of the cellulase such as its catalytic domain.

  Although it does not specifically limit as a cellulase, It is preferable that it is a cellulase with high activity itself. Examples of such cellulases include Phanerochaete bacteria, Trichoderma bacteria such as Trichoderma reesei, Fusarium bacteria, Fusarium bacteria, Tremetes bacteria, Penicillium bacteria, and Humicola bacteria. In addition to filamentous fungi such as Humicola, Acremonium, and Aspergillus, Clostridium, Pseudomonas, Cellulomonas, and Luminococcus Bacteria such as genus (Ruminococcus) and Bacillus, primordial fungi such as Sulfolobus, and more, such as Streptomyces and Thermoactinomyces Derived cellulase. Such cellulase may be artificially modified.

  In one embodiment of the present invention, an amino acid sequence (SEQ ID NO: 1) described as a mature peptide of endoglucanase A (AnEglA); AJ224451 (GenBank accession number) derived from Aspergillus nigar can be used as a cellulase. , A variant or homologue thereof, that is, an amino acid sequence in which one to several amino acids are deleted, substituted, added and / or inserted in the amino acid sequence shown in SEQ ID NO: 1, and has a cellulose binding activity An amino acid sequence; or an amino acid sequence having 60% or more identity with the amino acid sequence set forth in SEQ ID NO: 1, and having an cellulose binding activity can also be used.

  In another embodiment of the present invention, the cellulase is an amino acid sequence (SEQ ID NO: 24) described as a mature peptide of Clostridium thermocellum endoglucanase (cellulase D) (CP000568.1 (GenBank accession number)). In addition to the endoglucanase A derived from Aspergillus niger, mutants and homologues thereof can be used.

  Furthermore, in another embodiment of the present invention, the amino acid sequence (SEQ ID NO: 25) described as the mature peptide of Clostridium thermocellum cellobiohydrolase (cellobiohydrolase A) can be used as the cellulase. As with endoglucanase A derived from Aspergillus niger, mutants and homologues thereof can be used.

  In the present specification, “one to several amino acids are deleted, substituted, added and / or inserted” means, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10, More preferably, it means that 1 to 5 arbitrary numbers of amino acids are deleted, substituted, added and / or inserted.

  In the present specification, for example, the “amino acid sequence having 60% or more identity with the amino acid sequence described in SEQ ID NO: 1” means 60% or more, preferably 70% or more, more than the amino acid sequence described in SEQ ID NO: 1. Preferably, it means an amino acid sequence having an identity of 80% or more, more preferably 90% or more, particularly preferably 95% or more, and most preferably 98% or more. As used herein, “identity” is a relationship between two or more proteins or two or more polynucleotides that is known to those skilled in the art and is determined by comparing sequences. “Identity” in the art refers to a protein or polynucleotide sequence as determined by alignment between protein or polynucleotide sequences, or in some cases by alignment between a series of such sequences. Means the degree of sequence invariance between. Identity can be determined, for example, by the BLAST (Basic Local Alignment Search Tool) program by Altschul et al. (Eg, Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ., J. Mol. Biol., 215: p403-410 ( 1990), Altschyl SF, Madden TL, Schaffer AA, Zhang J, Miller W, Lipman DJ., Nucleic Acids Res. 25: p3389-3402 (1997)). The conditions for using software such as BLAST are not particularly limited, but it is preferable to use default values. Identity is typically referred to as Identity in sequence homology search results such as BLAST.

  When using a mutant or homologue of the cellulose binding domain having the amino acid sequence described in SEQ ID NO: 1 as described above in the present invention, instead of using DNA encoding the amino acid sequence described in SEQ ID NO: 1, A DNA encoding the above mutant or homolog may be used. DNA encoding such a mutant or homologue can also be prepared by any method known to those skilled in the art, such as chemical synthesis, genetic engineering techniques, and mutagenesis. Specifically, desired DNA can be obtained by using DNA encoding the amino acid sequence described in SEQ ID NO: 1 and introducing mutations into these DNAs. For example, it can be carried out using a method of bringing DNA into contact with a drug that becomes a mutagen, a method of irradiating ultraviolet rays, a genetic engineering method, or the like. Site-directed mutagenesis, which is one of the genetic engineering methods, is useful because it can introduce a specific mutation at a specific position. Molecular cloning 2nd edition, Current Protocols in Molecular. Biology, Nucleic Acids Research, 10, 6487, 1982, Nucleic Acids Research, 12, 9441, 1984, Nucleic Acids Research, 13, 4431, 1985, Nucleic Acids Research, 13, 8749,1985, Proc. Natl. Acad. Sci USA, 79, 6409, 1982, Proc. Natl. Acad. Sci. USA, 82, 488, 1985, Gene, 34, 315, 1985, Gene, 102, 67, 1991, etc. Can do.

  The cellulose binding domain means an amino acid sequence having binding ability to cellulose. Many cellulases have a domain having cellulolytic activity and a domain that binds to cellulose. These cellulose-binding domains are classified into nine families (Family I to IX) based on their amino acid sequence homology (Tomme, P. et al., Adv. Microbiol. Physiol., 37, 1-81). (1995)). In the present invention, from these cellulose-binding domains, an appropriate one can be selected and used according to the purpose of use in consideration of affinity and selectivity for binding to cellulose. For example, the cellulose binding domain may have a binding property to crystalline cellulose or may have a binding property to cellulose, but the type of cellulose to be decomposed and the type of cellulase used simultaneously. Can be determined as appropriate.

  Specific examples of the cellulose binding domain that can be used in the present invention include the cellulose binding domain of cellulase derived from Cellulomonas fimi. More specifically, the cellulose binding domain of endoglucanase C derived from Cellulomonas fimi can be mentioned. The amino acid sequence of such a cellulose binding domain is set forth in SEQ ID NO: 18. In addition, cellulose binding domains of various cellulases of the cellulase-producing microorganisms already described, such as Tricoderma reesei, can be used. Cellulose binding domains can improve the accessibility of cellulases to cellulose. As the cellulose binding domain, in addition to the known cellulose binding domain, these mutants and homologues as described above can be used alone or in combination.

  Examples of the cellulose relaxation protein include swollenin and expansin, which are cellulose relaxation proteins. Cellulose relaxed proteins can improve the accessibility of cellulases to cellulose. Expansin is a kind of plant cell wall protein, and is widely found in monocotyledonous plants such as rice and dicotyledonous plants such as sweet potato. Sworenin is a protein derived from Trichoderma reesei having homology with expansin. As a cellulose relaxation protein, in addition to known expansins and swollenins, these mutants and homologues as described above can be used alone or in combination of two or more.

  The cellulose-degrading protein may indirectly contribute to cellulose degradation. These proteins can also improve the accessibility of cellulases to cellulose. Examples of such cellulose-degrading proteins include proteins that contribute to cellulose degradation by acting on lignin that may coexist with cellulose. More specifically, lignin degrading enzymes such as lignin peroxidase, manganese peroxidase, and laccase can be mentioned. As the lignin degrading enzyme, in addition to known lignin degrading enzymes, these mutants and homologues as described above can be used alone or in combination of two or more.

  Moreover, hemicellulase which decomposes | disassembles hemicellulose is mentioned. Hemicellulose refers to a polysaccharide other than cellulose and pectin among the polysaccharides constituting the cell wall of land plant cells. Examples of hemicellulose include xylan, mannan, glucomannan and the like. Hemicellulase is a general term for enzymes that degrade hemicellulose, and examples thereof include xylanase. Such an enzyme may be derived from a cellulolytic microorganism such as Trichoderma or Aspergillus. As the hemicellulase, in addition to known hemicellulases, these mutants and homologues as described above can be used alone or in combination of two or more.

  The protein complex comprises a cellulolytic protein held against a carrier. Cellulolytic proteins are thought to be formed by biotin trapping in a biotin-binding groove that is also a hydrophobic site of a carrier. In order to retain the cellulose-degrading protein on the carrier by such specific binding, the biotinylated cellulose-degrading protein may be brought into contact with the carrier.

A method for biotinylating a desired protein and a method for complexing a biotinylated protein with a carrier such as avidin are well known to those skilled in the art. For example, the cellulolytic protein can be biotinylated by using an appropriate biotinylating agent. The biotinating agent is not particularly limited as long as it binds biotin directly or via an appropriate spacer. A preferred biotinylating agent is bound via a spacer having an aliphatic amide structure such as —NH— (CH ₂ ) _n —CO— (n = 1 to 6) or a polyalkylene glycol structure. Polyalkylene glycols include polyethylene glycol (PEG), polypropylene glycol (PPG), polybutylene glycol (PBG), (PEG)-(PPG)-(PEG) block copolymers, (PPG)-(PEG)-( (PPG) block copolymer, (PEG)-(PBG)-(PEG) block copolymer, (PBG)-(PEG)-(PBG) block copolymer, and the like, preferably PEG, PPG, (PEG)-(PPG)-(PEG) block copolymer, (PPG)-(PEG)-(PPG) block copolymer, more preferably PEG. A preferred PEG structure is —CH ₂ CH ₂ O) _n — (wherein n represents an integer of 2 to 500, preferably 2 to 100, more preferably 2 to 50, and further preferably 4 to 10). is there.

  The biotinating agent of the present invention may have a polyalkylene glycol structure as a spacer. The polyalkylene glycol structure is preferably bonded to biotin and cellulolytic protein via an amide bond via an ester, amide or thioether bond.

Examples of biotinating agents include X- (CH ₂ ) _m1 -NH- {CO (CH ₂ ) _n NH} _m2- (biotinyl) (X is a sulfosuccinimide oxycarbonyl group, succinimide oxycarbonyl group, Active ester residues capable of reacting with amino groups such as tetrafluorophenoxycarbonyl, cyanomethyloxycarbonyl, p-nitrophenyloxycarbonyl, I, Br, Cl, etc. to form amide (NHCO) or aminoalkyl groups, halogen atoms M1 represents an integer of 2 to 6, and m2 represents an integer of 0 to 50, preferably 1 to 10, more preferably 0 to 5, and still more preferably 0 to 3.

Specific biotinating agents typically include, for example, Pierce's EZ-Link Sulfo-NHS-Biotin, EZ-Link Sulfo-NHS-LC-Biotin, EZ-Link Sulfo-NHS-LC-LC-Biotin And various biotinating agents such as EZ-Link-NHS-PEO ₄ -Solid Phase Biotinylation Kit.

  In order to biotinylate the cellulose-degrading protein with the biotinating agent, the biotinating agent and the cellulose-degrading protein may be reacted at about 1 ° C to 37 ° C.

Cellulolytic proteins can be biotinylated without using a biotinylating agent. For example, a method using a tag (peptide) having a specific biotinylation site by biotin ligase can be mentioned. A tag having a specific sequence is added to the C-terminus or N-terminus of the cellulolytic protein, and the lysine contained in the tag is biotinylated in a site-specific manner with biotin ligase. Such commercially available tags include genecopoeia Avi-tag ^TM (LERAPGGLNDIFEAQKIEWHE or GLNDIFEAQKIEWHE) and Invitrogen BioEase Tag ^TM (one of the C-terminal sequences of the α subunit of Klebsiella pneumoniae oxaloacetate decarboxylase α-subunit). 72 parts (peptides of amino acid residues 524 to 595), which are part, are known, but are not limited thereto.

  By bringing the biotinylated cellulolytic protein into contact with the carrier, the carrier and the cellulolytic protein are firmly bonded to each other, and the protein complex of the present invention can be constituted. For example, it is sufficient for the number of avidin bonds in the carrier (for example, in the case of streptavidin, it is usually a tetramer. When such a tetramer is used as one molecule, the number of bonds is tetravalent). An amount of cellulolytic protein is supplied. Usually, the pH and salt concentration may be contacted in the presence of a suitable buffer (for example, 50 mM acetate buffer (pH 5.0)) at about 1 ° C. to 37 ° C., preferably near room temperature.

  Cellulolytic protein is a carrier in a combination (type and number) that is intended to be retained against a carrier of one molecule (for example, avidin usually takes a multimer such as a tetramer, which is a single molecule). To be supplied.

  The protein complex of the present invention preferably comprises a plurality of cellulolytic proteins. The “plurality of cellulolytic proteins” may include a plurality of the same type of cellulolytic protein, or two or more types of cellulolytic proteins, respectively. According to this protein complex, it is suitable for obtaining a synergistic effect of providing a plurality of cellulolytic proteins. Although not necessarily theoretically obvious, according to the present inventors, it is considered that the protein complex can effectively increase the expression of its activity when the protein is accumulated.

  The plurality of cellulolytic proteins preferably contain at least one cellulase. A plurality of one type of cellulase may be provided, or other cellulolytic proteins that contribute to the expression of the activity of the cellulase may be provided. The type of cellulase is not particularly limited, but endoglucanase is preferably used.

  Two or more types of cellulases may be included. This is because two or more types of cellulases are preferable for efficiently decomposing cellulose. The two or more types of cellulases are preferably selected from endoglucanase, cellobiohydrolase and β-glucosidase. Preferably, endoglucanase is included.

  The plurality of cellulolytic proteins preferably include a cellulose binding domain. More preferably, the cellulose binding domain is provided with cellulase. Cellulose-binding domains can dramatically enhance cellulose degradation by cellulases. The cellulose binding domain does not necessarily have to be derived from an organism (microorganism) from which cellulase is derived.

  The cellulose-binding domains may be of the same type or a plurality of types, and may be one or two. It is determined appropriately depending on the combination of the cellulase.

  For example, a preferred combination of cellulolytic proteins retained on a carrier includes a combination of a cellulase such as endoglucanase and a cellulose binding domain. For example, it is preferable to satisfy the binding site for a tetramer carrier, and the effect on the degradation of cellulose can be greatly improved by adding three or more cellulases or three or more cellulose-binding domains. Can be enhanced. That is, the effect of cellulolytic protein accumulation can be further exhibited.

(Method for producing cellulose degradation product)
The method for producing a cellulose degradation product of the present invention includes a step of degrading cellulose in a cellulose-containing material using the protein complex of the present invention. Any cellulose degradation product may be used as long as cellulose is reduced in molecular weight. More specifically, in addition to glucose which is the final degradation product, cellooligosaccharide, cellobiose and the like can be mentioned. As will be described later, when the cellulose degradation product is used as a carbon source during fermentation, the cellulose degradation product is preferably mainly composed of glucose.

  In the present specification, the cellulose-containing material may be any material that contains cellulose as described above. Therefore, the cellulose may be a complex with β-glucoside, which is a glycoside, lignocellulose, which is a complex with lignin and / or hemicellulose, and pectin. Cellulose-containing materials include natural fiber products such as cotton and linen, recycled fiber products such as rayon, cupra, acetate and lyocell, various straws such as rice straw, agricultural waste such as rice husks, bagasse and wood chips, waste paper, construction Biomass (woody and herbaceous) containing various wastes such as waste materials.

  Depending on the type of cellulose-containing material to be degraded, pretreatment or additional enzymes may be required. For example, when using lignocellulosic materials, physical, chemical or enzymatic pretreatment may be required for efficient degradation.

(Cellulose decomposition process)
The cellulose degradation step may be performed by bringing the cellulose in the cellulose-containing material into contact with the protein complex of the present invention in an environment suitable for the functional expression of the cellulolytic protein. When this protein complex holds cellulase, considering the stability of the cellulolytic reaction and the ease of operation, it is usually necessary to use a buffer solution having a buffer capacity in the pH range including the optimum pH of cellulase. preferable. Since typical preferred pH of general cellulase is about 4 to 6, for example, citrate buffer (citric acid and sodium citrate), acetate buffer (acetic acid-sodium acetate), citrate-phosphate buffer Liquid (citric acid-sodium dihydrogen phosphate) and the like. It is preferable to appropriately adjust the concentration and pH of such a buffer solution and set the pH of the hydrophilic solvent phase to 4 or more and 6 or less, more surely 4.0 or more and 6.0 or less.

  The temperature and time for cellulose degradation by cellulase are not particularly limited. Although it depends on the type of cellulase, it is usually about 30 ° C. to 70 ° C., preferably about 35 ° C. to 45 ° C., pH 2 or more and about 6 or less, and is performed for several hours to several tens of hours.

  The cellulose degradation step may be performed using one type of the present protein complex, or may be performed using two or more types of the present protein complex. When two or more kinds of the present protein complexes are used, a plurality of protein complexes may be used at the same time, or different protein complexes may be used in a plurality of stages. For example, a protein complex comprising endoglucanase as a cellulolytic protein, a protein complex similarly comprising cellobiohydrolase, and a protein complex similarly comprising glucosidase are appropriately set per type and content, Decomposition may be performed in one step, or cellulose may be decomposed in multiple steps.

  By carrying out the cellulose decomposition step using the present protein complex, a higher cellulose decomposition effect can be obtained with a smaller amount of cellulase. In addition, the present protein complex can repeatedly use the recovered enzyme to bind and hold cellulolytic proteins such as cellulase in a thermally stable state. For example, repeated use can be easily realized by holding the carrier of this protein complex in the carrier.

(Method for producing useful substances)
According to the present invention, a step of decomposing cellulose in a cellulose-containing material using the present protein complex, and a step of obtaining a useful substance by fermentation using a carbon source containing a decomposition product of cellulose obtained in the above step (Hereinafter also simply referred to as a fermentation step). The embodiment of the method for producing a cellulose degradation product of the present invention can be applied to the cellulose degradation step.

  The carbon source used in the fermentation process includes a cellulose degradation product obtained in the cellulose degradation process. The carbon source is effective as long as the cellulose degradation product is a part of the total carbon source (mass), but the cellulose degradation product is preferably mainly used.

  In the fermentation process, the cellulose decomposition process can be performed simultaneously. That is, the fermentation process may be performed by putting the cellulose-containing material and the present protein complex in the medium and using the produced cellulose degradation product as a carbon source.

  The microorganism used in the fermentation process is not particularly limited, and is appropriately selected according to the type of useful substance that can assimilate the degradation product of cellulose and is to be produced. The cellulose degradation product is mainly glucose, but may contain xylan derived from hemicellulose. For example, fungi such as yeast and mold, and microorganisms such as E. coli. The microorganism may be a wild type, artificially modified so as to efficiently assimilate cellulose degradation products by genetic engineering techniques, etc., or modified so that useful substances can be produced. Also good. A typical example is a microorganism such as yeast that produces ethanol. Moreover, the yeast and lactic acid bacteria which produce an organic acid may be sufficient.

  What is necessary is just to implement a fermentation process according to the kind of microorganisms to be used and the useful substance which it is going to produce. For the culture for fermentation, stationary culture, shaking culture, aeration-agitation culture, or the like can be used. The aeration conditions can be appropriately selected from anaerobic conditions, microaerobic conditions, aerobic conditions, and the like. The culture temperature is not particularly limited, but may be in the range of 25 ° C to 55 ° C. Moreover, although culture | cultivation time is also set as needed, it can be set as several hours-about 150 hours. The pH can be adjusted using an inorganic or organic acid, an alkaline solution, or the like. During the culture, antibiotics such as ampicillin and tetracycline can be added to the medium as necessary. In addition, after completion | finish of a conversion process, you may implement the process of removing microorganisms from a culture solution, collect | recovering fractions containing useful substances, such as ethanol, and also concentrating this.

  Although it does not specifically limit as a useful substance, The thing which can produce | generate microorganisms using glucose is preferable. For example, there are materials targeted by biorefinery technology, such as ethanol and other lower alcohols, fine chemicals (coenzyme Q10, vitamins and their raw materials, etc.) by adding an isoprenod synthesis pathway, glycerin by modification of glycolysis, and raw materials for plastics and chemical products. Can be mentioned.

  According to this production method, the manufacturing cost as a whole can be reduced by using the cellulose degradation product efficiently decomposed and recovered from cellulose.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated more concretely, this invention is not limited to a following example.

(Preparation of a construct containing a DNA fragment encoding endoglucanase (EG) derived from Aspergillus nigar)
In this Example, a DNA fragment encoding endoglucanase A (AnEglA); AJ224451 (GenBank accession number) derived from Aspergillus niger was prepared, and this was incorporated into an E. coli expression vector to produce a construct.
First, based on the nucleotide sequence information in the Genbank database, DNA (AnEglA; SEQ ID NO: 2) excluding the signal peptide portion was totally synthesized.

Subsequently, PCR was performed using the following primer set so that the DNA became NdeI-AnEglA-XhoI.
5 'side (30mer): CATATGCAGACGATGTGCTCTCAATATGAC (SEQ ID NO: 3)
3 'side (30mer): CTCGAGCTAGTTGACACTGGCGGTCCAGTT (SEQ ID NO: 4)

  The obtained PCR amplification product (SEQ ID NO: 5) was introduced into the NdeI-XhoI site of pET23b (Merck), which is an expression vector for E. coli, using In-fusion PCR cloning kit (Clontech) to obtain construct 1. .

(Preparation of biotinylated endoglucanase using biotinating agent)
First, the construct 1 prepared in Example 1 was transformed into competent cells of E. coli BL21 (DE3) (Merck). Colonies that had grown on the LB / Amp (50 μg / ml) selective medium were inoculated into LB / Amp (100 μg / ml) liquid medium and pre-cultured at 30 ° C. overnight. The composition of the LB medium was 10 g bacto-tryptone, 5 g yeast extract, and 10 g NaCl per liter. Next, 1/80 volume of the preculture was added to 2 × YT / Amp (100 μg / ml) liquid medium, and after culturing to OD600 = 0.6 at 30 ° C., IPTG was added to a final concentration of 1 mM. Cultured for 6 hours. The composition of 2 × YT medium was bacto-tryptone 16 g, yeast extract 10 g, and NaCl 5 g per liter.

  The cultured cells were collected by centrifugation, dissolved in 50 mM acetate buffer (pH 5.0) / 500 mM NaCl, and subjected to ultrasonic disruption. Thereafter, centrifugation was performed, the supernatant was filtered through a 0.45 μm filter, and the filtrate was purified by gel filtration chromatography (column is Superdex 75 (GE Healthcare)). The purified product was stored at 4 ° C. and used for chemical biotin modification.

  5 ml of the purified AnEglA solution (acetate buffer (pH 5.0) / 200 mM NaCl) was dialyzed in 500 ml of PBS (pH 7.4) at room temperature for 3.5 hours. A 6000-8000 pore size manufactured by Spectrum was used for the dialysis membrane. Thereafter, biotinylation of AnEglA was carried out at 4 ° C. for 20 hours using the Sulfo-NHS-LC-Biotinylation Kit, EZ-Link (PIERCE) according to the manual. Excess biotin was removed with a spin column attached to the kit to obtain “Chemically-biotinylated-AnEglA (CBEG)”.

(Preparation of a construct containing a DNA fragment encoding an endoglucanase that is biotinylated in a site-specific manner by biotin ligase)
In this example, a construct for holding DNA encoding endoglucanase fused with a tag biotinylated by biotin ligase in E. coli was prepared.

1. AnEglA fragment in which the SacII site inside the AnEglA fragment was destroyed To destroy the SacII site inside the DNA fragment (SEQ ID NO: 2) fully synthesized in Example 1 using the following primer set A (underlined part on the 3 ′ side) Using the DNA fragment as a template, PCR was performed using KOD + DNA polymerase (Toyobo). Similarly, PCR was performed using primer set B so as to include an overlapping portion.

Primer set A
5 'side (23mer): ATGCAGACGATGTGCTCTCAATA (SEQ ID NO: 6)
3 'side (31mer): CACATTCGCGGCGGTGAAAAGATCATACGCG (SEQ ID NO: 7)
Primer set B
5 'side (32mer): CTTTTCACCGCCGCGAATGTGGACCATGCCAC (SEQ ID NO: 8)
3 'side (22mer): CTAGTTGACACTGGCGGTCCAG (SEQ ID NO: 9)

  These PCR products were agarose gel electrophoresed and recovered using GFX PCR DNA and Gel Band Purification Kit (GE Healthcare), and PCR was performed using primer set C using 1 μl of each as a template. As a result, an AnEglA fragment (SEQ ID NO: 12) in which the SacII site was destroyed was obtained.

Primer set C
5 'side (23mer): ATGCAGACGATGTGCTCTCAATA (SEQ ID NO: 10)
3 'side (22mer): CTAGTTGACACTGGCGGTCCAG (SEQ ID NO: 11)

2. Preparation of pelB-derived signal peptide + SacII site disrupted AnEglA + Bio-tag + His-tag fragment (FIG. 2) First, a pelB-derived signal peptide + SacII site disrupted AnEglA + SacII fragment was prepared. 1. PCR was carried out using the DNA fragment (SEQ ID NO: 12) prepared in step 1 as a template and the following primer set to obtain the fragment (SEQ ID NO: 15). In the 5 ′ primer, the start codon ATG is underlined and the last amino acid A part of the signal peptide is also underlined. The obtained fragment was cloned into the SacI-SacII site of pBluescriptII (Stratagene) to obtain a construct 2. The sequence of the signal peptide was 22 residues at the N-terminus of E. carotovora pectate lyase B (AJ224451), and the Bio_tag part was referred to Molecular Immunology, 37, 2000, 1067-1077.

5 'side (100mer): GAGCTCCATGGCGATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCGATGGCGCAGACGATGTGCTCTCAATAT (SEQ ID NO: 13)
3 'side (26mer): CCGCGGCGTTGACACTGGCGGTCCAG (SEQ ID NO: 14)

  Next, a DNA fragment (SEQ ID NO: 16) of SacII-Bio-tag + His + tag-HindIII containing the Bio-tag site and His-tag site was fully synthesized and subcloned into SacII-HindIII of construct 2 to produce construct 3. . In the construct 3, a pelB-derived signal peptide + SacII site disrupted AnEglA + Bio-tag + His-tag fragment (SEQ ID NO: 17) is obtained.

  Furthermore, construct 3 was treated with SacI-HindIII and subcloned into the SacI-HindIII site of pUC18 to obtain construct 4.

(Preparation of C-terminal site-specific biotinylated endoglucanase)
In this example, AnEglA + Bio-tag + His-tag was site-specifically modified with biotin in E. coli. Escherichia coli AVB101 strain competent cell (Avidity) carrying plasmid pBirAcm capable of IPTG induction of biotin ligase for construct 4 was transformed, and LB / Amp (100 μg / ml), Chloramphenicol (34 mg / ml) agar medium Selected above. The expression of biotinylated AnEglA was partially changed according to the manual.

First, single colonies were inoculated into 3 ml of LB / Amp (100 μg / ml) and Chl (34 μg / ml) liquid medium, and pre-cultured overnight at 28 ° C. 3 ml of the preculture was added to 250 ml of 2 × T / Amp (100 μg / ml) liquid medium and cultured at 28 ° C. to an OD ₆₀₀ of 0.8. Furthermore, biotin and IPTG were added to final concentrations of 50 μM and 1 mM, respectively, and cultured overnight at 28 ° C. to produce biotinylated endoglucanase in the soluble fraction in E. coli.

  The culture broth was centrifuged to collect the supernatant, and ammonium sulfate precipitation was performed. Subsequently, the precipitate was dissolved in 5 ml of 50 mM Tris buffer (pH 8.0) / 200 mM NaCl, and dialysis was repeated twice in 500 ml of the same Tris buffer at room temperature for 6 hours to remove ammonium sulfate. Further, 1 ml of a 50% slurry of Ni Sepharose 6 Fast Flow (GE Healthcare) in Tris buffer and 4 ml of BCBDamo solution were mixed and reacted at 4 ° C. for 1 hour. The slurry was loaded onto the column and washed with 20 ml of 50 mM Tris buffer (pH 8.0) / 200 mM NaCl, 10 mM imidazole. Elution was performed with 50 mM Tris buffer (pH 8.0) / 200 mM NaCl, 100 mM imidazole to obtain a site-specific biotinylated AnEglA (BEGamo) purified in the eluate.

(Preparation of a construct containing a DNA fragment encoding the cellulose-binding domain (Family IV CBDN2; CAA40993) of endoglucanase C from Cellulomonas fimi)
In this example, a construct containing EcoRI-pelB-derived signal peptide + CBDamo + Bio-tag + His-tag fragment (FIG. 3) was prepared. First, a DNA fragment (SEQ ID NO: 19) having a base sequence obtained by converting the amino acid sequence of Family IV CBD _N2 of endoglucanase C derived from Cellulomonas fimi (179-328) (SEQ ID NO: 18) into a codon for Escherichia coli was synthesized. Called CBDamo.

(Construction of EcoRI-pelB-derived signal peptide + CBDamo-SacII-HindIII fragment-containing construct)
PCR was performed using the following primer set with the CBDamo fragment as a template so that EcoRI-pelB-derived signal peptide + CBDamo-SacII-HindIII was obtained (SEQ ID NO: 22). The start codon ATG in the 5 ′ primer is underlined, and the amino acid A part at the end of the signal peptide is shown in capital letters and underline.

5 'side (100mer): GAATTCATGGCGATGAAATACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTCGCGGCCCAGCCGGCGATGGCGGACTCCGAGGTCGAGCTCCTGC (SEQ ID NO: 20)
3 'side (40mer): AAGCTTGGCCGCGGCCGTCGCCGAGGTGGTGAGCGACACC (SEQ ID NO: 21)

  The obtained amplified DNA fragment was cleaved with EcoRI-HindIII and subcloned into the EcoRI-HindIII site of pUC18 to obtain a construct 5. Further, by subcloning the SacII-Bio-tag + His-tag-HindIII fragment (SEQ ID NO: 16) into the SacII-HindIII site of the construct 5, an EcoRI-pelB-derived signal peptide + CBDamo + Bio-tag + His-tag fragment (SEQ ID NO: 16) A construct 6 having 23) was obtained.

(Preparation of C-terminal site-specific biotinylated cellulose binding domain)
The E. coli AVB101 strain competent cell (Avidity) carrying the plasmid pBirAcm capable of IPTG induction of biotin ligase with the construct 6 obtained in the example was transformed, and biotinylated cellulose binding domain (BCBDamo) was obtained in the same manner as in Example 2. Got.

(Preparation of cluster with endoglucanase and cellulose binding domain)
Streptavidin forms a tetramer and binds to one molecule of biotin per molecule. When streptavidin tetramer is used as a single molecule carrier, a protein complex (cluster) having a maximum of 4 valences can be prepared. In this example, clusters having various ratios of endoglucanase biotinylated with a biotinating agent and endoglucanase site-specifically biotinylated on the C-terminal side were prepared.

  First, each of the biotinylated proteins (CBEG and BCBDamo was added to 2 μM streptavidin (Promega) 50 mM acetate buffer solution (pH 5.0) so that the various clusters shown in FIGS. 4 and 5 were obtained. Combination and AnEGamo and BCBDamo) were added and allowed to react at room temperature for 3 hours. Then, it preserve | saved at 4 degreeC and used for the measurement of enzyme activity.

(Evaluation of endoglucanase concentration and activity correlation)
In order to evaluate the endoglucanase activity of various clusters prepared in Example 7, first, the correlation between the endoglucanase concentration and its activity was examined. The enzymatic reaction was performed under the following conditions using Avicel PH-101 (Fluka) phosphate-swelled cellulose (PSC) as a substrate.
Reaction solution: 50 mM acetate buffer (pH 5.0)
PSC initial concentration: 0.1%
Reaction volume: 200μl
Enzyme concentration: 0-4μM
Reaction temperature: 40 ℃ (stirring with a rotator)
Reaction time: 2 hours

  For the evaluation of the activity, the concentration of reducing sugar is measured by performing TZ assay (Reference: Jue CK and Lipke PN (1985) Journal of Biochemical and Biophysical Methods, 11, 109-115) on the obtained reaction product. Was done. That is, 5 μl of enzyme reaction solution (or glucose solution for calibration curve) and 200 μl of TZ assay reaction solution were added to a 96-well plate, the plate was heated at 100 ° C. for 3 minutes, and then the plate was ice-cooled for 1 minute. Absorbance was measured at 660 nm for the reaction solution in the well. The TZ assay reaction solution was prepared as follows. That is, to 0.1M NaOH 300ml, add Tetrazolium blue 0.6g (Nacalai Tesque), dissolve by slowly stirring in a warm bath, add 1M sodium potassium tartrate 300ml to this solution, stir, filter and store at room temperature .

  The correlation between the enzyme concentration of CBEG biotinylated by chemical modification and PSC degradation activity was investigated. The TZ assay was performed by reacting the endoglucanase concentration at 0, 0.05, 0.1, 0.2, 0.4, 0.8, 2 μM. The results are shown in FIG.

  As shown in FIG. 6, it was found that there was a clear correlation between the logarithm of the enzyme concentration (0.05-2 μM) and the reducing sugar concentration.

(Evaluation of cellulose degradation activity improvement by clustering)
In this example, the endoglucanase activity was measured for the cluster prepared in Example 7, and the effect of clustering was evaluated. For the evaluation, the enzyme reaction and the TZ assay were performed for the various combinations shown in FIGS. 4 and 5 (free (non-clustered) mixture (4 types) and cluster (4 types)). The CBEG and BCBDamo shown in FIG. 4 were evaluated using the conditions shown in Example 8 as they were except that the endoglucanase concentration was set to the concentration shown in FIG. Further, BEGamo and BCBDamo shown in FIG. 5 were evaluated by directly adopting the conditions shown in Example 8 except that the endoglucanase concentration was fixed at 0.4 μM.

  Based on the measurement results of reducing sugars obtained for CBEG and BCBDamo, the correlation obtained in Example 8 was used to evaluate “actual enzyme concentration” and “apparent enzyme concentration due to clustering”. The results are also shown in FIG.

  As shown in FIG. 4, in Free 1-4, the apparent amount of enzyme (R value) relative to the amount of enzyme input is not much higher than the amount of enzyme actually input, and apparent amount relative to the actual amount of enzyme is not shown. The enzyme amount ratio (R value) was 1.35 to 1.67. From these results, the influence of free BCBDamo was considered about free CBEG.

  On the other hand, in the clusters 1 to 4, the ratio R of the cluster 1 in which EG and CBDamo are bonded one by one through the carrier is as high as 2.7. Consistent with previous findings that cellulolytic activity is higher than that. Further, cluster 4 having 3 EGs and 1 CBDamo showed the highest R value of 12.28 and was found to have an activity equivalent to 12 times or more of free EG. In addition, compared with cluster 1 in terms of the apparent enzyme amount, cluster 4 has 13.65 times the activity, and considering that the amount of EG is 3 times (even if divided by 3), The effect was 4.5 times as much. This is considered to be due to the effect of concentration or more due to the proximity of the catalytic sites, and the increase due to clustering of the catalytic sites was found to be effective in enhancing the activity of the EG enzyme.

  In addition, the R value of cluster 2 having 3 CBDamo and 1 EG was 10.7, which was equivalent to 10 times the amount of free EG. Compared with cluster 1, cluster 2 showed 4 times the activity, and it was found that an increase in the number of cellulose binding domains due to clustering is effective in enhancing the activity of the EG enzyme.

  Furthermore, the R value of cluster 3 with 2 EGs and 2 CBDs was 7.9, which is slightly lower than that of cluster 4 and cluster 2, but showed a reasonable effect. It was found that the cluster effect of the catalytic site and the cellulose binding domain was 3 higher than 2 respectively.

  FIG. 5 shows the measurement results of reducing sugars obtained for BEGamo and BCBDamo together with R values. The numerical values given in the vicinity of the cluster graph in FIG. 5 indicate the ratio of the measurement result of the reducing sugar of the cluster to the measurement result of the reducing sugar of the corresponding free BEGamo + BCBDamo. As shown in FIG. 5, it was observed that cellulolytic activity was improved by allowing a free cellulose-binding domain to coexist with free endoglucanase. In addition, clusters with a high CBDamo ratio show degradation activity over a longer period of time, suggesting that the reaction is multistage due to the cluster effect. Furthermore, referring to the R value shown in FIG. 5, it was found that the cellulolytic activity of endoglucanase was significantly increased in clusters having a large ratio of cellulose binding domains.

  In this example, a complex (QD cluster) in which endoglucanase and cellulose-binding domain were accumulated in quantum dots was produced, and the degradability of cellulose using this QD cluster was evaluated.

(Production of QD cluster)
In this example, Qdot streptavidin-labeled series quantum dots (Invitrogen) having a diameter of 15 to 20 nm were used as quantum dots (QD). Endoglucanase (chemically biotinylated endoglucanase: CBEG) and cellulose binding domain (biotinylated cellulose binding domain: BCBD) are 0: 4 (QDE ₄ ), 3: 1 (QDC ₃ E ₁ ), 2 for QD : 2 (QDC ₂ E ₂ ) and 1: 3 (QDC ₁ E ₃ ). Specifically, CBEG and BCBD were supplied so that the total number of molecules was 30 times the number of QDs and mixed well to prepare four types of QD clusters. Each QD cluster has about 30 sites. Therefore, each QD cluster was designed to accumulate a total of about 30 moles of endoglucanase and cellulose binding domain per mole QD.

(Integration of QD clusters into phosphate-swelled cellulose (PSC))
1000 μg of PSC was added to the prepared buffer solution containing 53.3 μM of QD clusters, mixed well, and then centrifuged at 6000 rpm for 30 seconds. A solution containing only QD instead of the QD cluster solution was similarly tested as a control. That is, for each sample, the fluorescence derived from the QD of the QD cluster before and after centrifugation was observed to evaluate the integration of the QD cluster into the PSC. The results are shown in FIG.

As shown in FIG. 7, for the QD cluster (QDC ₃ E _1, QDC ₂ E ₂ , QDC ₁ E ₃ ) complexed with CBD, fluorescence is strongly observed at the bottom of the container after centrifugation. It was found to be present with PSC. On the other hand, for the QD cluster (QDE ₄ ) and the control that were not complexed with CBD, fluorescence was observed throughout the solution even after centrifugation, and it was found that there was no coexistence with PSC. From the above, it was found that cellulose binding domains were accumulated in the produced QD clusters, and that QD clusters accumulated with cellulose binding domains were accumulated in PSC.

(Cellulolytic activity)
In the same manner as in Example 9, the degradation activity of PSC was evaluated in the same manner as in Example 9, except that the four kinds of QD clusters thus prepared each had an endoglucanase concentration of 0.4 μM, with an initial substrate (PSC) concentration of 1 mg / ml. For each of the four QD clusters, a mixture of free biotinylated endoglucanase and biotinylated cellulose binding domain in the same molar ratio was similarly evaluated as a control. The measurement result by the reducing sugar concentration is shown in FIG. In addition, a comparison in specific activity is shown in FIG.

As shown in FIG. 8, compared with endoglucanase (native), a synergistic effect due to simultaneous accumulation with endoglucanase could be confirmed for the QD cluster retaining the cellulose binding domain. In addition, a synergistic effect could not be confirmed in the free mixture of each molar ratio as a control. In addition, as shown in FIG. 9, the QD cluster accumulation effect was clear when compared by specific activity. In addition, compared with QDC ₁ E ₃ and the streptavidin cluster C ₁ E ₃ prepared in Example 9, QDC ₁ E ₃ has a high reaction rate, whereas the reaction tends to be saturated within 2 hours. In the streptavidin cluster C ₁ E ₃ , the activity was prolonged over a long period. That is, these clusters were considered to have some difference in the reaction mode.

  In this example, the degradation activity of phosphate-swollen cellulose in a clustered complex using endoglucanase derived from Clostridium thermocellum was evaluated.

(1) Construction of the construct
Prepare a DNA fragment encoding endo 1,4 beta glucanase (cellulase D, CelD); CP000568.1 (GeneBank accession number) from Clostridium thermocellum strain ATCC 27405 and incorporate it into an E. coli expression vector A construct was made. First, based on the nucleotide sequence information in the GeneBank database, create a nucleotide sequence converted to a codon dominant for E. coli expression, and add NcoI at the N-terminus of the nucleotide sequence excluding the signal peptide portion and SacII restriction enzyme site at the C-terminus. The designed DNA (CelD; SEQ ID NO: 26) was fully synthesized, and the DNA fragment was cloned into the pUC57 vector. Next, as shown in FIG. 10, a DNA fragment excised from the pUC57 vector with restriction enzymes NcoI and SacII was ligated to the pRA2b vector excised at the same restriction enzyme site, and C-terminal site-specific biotinylated CelD (SEQ ID NO: 27) An expression vector was prepared.

(2) Experimental results (clustering using streptavidin)
C-terminal site-specific biotinylated CelD, biotinylated cellulose-binding domain (BCBDamo) prepared in Example 6 and streptavidin were mixed at the ratio shown in FIG. 11, and the degradation activity of phosphate-swelled cellulose (PSC) was evaluated. The results are also shown in FIG. As shown in FIG. 11, SA-D1C3 in which CelD: CBDamo is clustered at a ratio of 1: 3 with streptavidin as the nucleus shows the largest activity as in AnEglA, and is cellulose binding domain against enzyme domain 1 It was also confirmed for CelD that the ratio of 3 improved the activity most.

(Streptavidin modification) Clustering with QD as nucleus)
C-terminal site-specific biotinylated CelD, biotinylated cellulose binding domain (BCBDamo) prepared in Example 6 and streptavidin-modified QD were mixed in the ratio shown in FIG. 12, and the degradation activity of phosphate-swelled cellulose (PSC) was evaluated. did. The results are also shown in FIG. As shown in FIG. 12, QD-D1C3 in which CelD: CBDamo was clustered at a ratio of 1: 3 showed the most activity as in the case of using streptavidin as the nucleus. This result is the same as that of AnEglA, and even when QD is used as the nucleus, the ratio of cellulose binding domain 3 to enzyme domain 1 is the most applicable to not only AnEglA but also endoglucanase.

  On the other hand, when comparing the clustered SA-D1C3 and QD-D1C3 using CelD: CBDamo at the ratio of 1: 3 as streptavidin and QD, respectively, the enzyme domain concentration used in QD-D1C3 is SA- Although the amount was 0.8 times that of D1C3, the concentration of produced reducing sugar 24 hours after the start of the reaction was 1.36 times that of SA-D1C3. From this, in the case of CelD, it was found that the degradation activity is improved by clustering with QD.

  In this example, the degradation activity of phosphate-swollen cellulose in a clustered complex using cellobiohydrolase derived from Clostridium thermocellum was evaluated.

(1) Construction of the construct
Prepare a DNA fragment encoding cellulose 1,4 beta cellobiohydrolase A (CBHA; X80993.1 (GeneBank accession number) from Clostridium thermocellum, and incorporate it into an E. coli expression vector to create a construct First, based on the nucleotide sequence information in the Genebank database, a base sequence converted into a codon dominant for E. coli expression was created, and NcoI and C-terminal were added to the N-terminus of the nucleotide sequence excluding CBD Family IV and CBD Family III. Then, a DNA (CBHA; SEQ ID NO: 28) designed with a SacII restriction enzyme site was fully synthesized, and the DNA fragment was cloned into the pUC57 vector, and then the pUC57 vector was digested with restriction enzymes NcoI and SacII as shown in FIG. The excised DNA fragment was ligated to the pRA2b vector excised at the same restriction enzyme site, and C-terminal site-specific biotinylated CBHA (SEQ ID NO: 29) The expression vectors were produced.

(2) Experimental results (clustering using streptavidin)
C-terminal site-specific biotinylated CBHA, biotinylated cellulose-binding domain (BCBDamo) prepared in Example 6 and streptavidin were mixed at the ratio shown in FIG. 14, and the degradation activity of phosphate-swelled cellulose (PSC) was evaluated. The results are also shown in FIG. As shown in FIG. 14, SA-A1C3 obtained by clustering CBHA: CBDamo at a ratio of 1: 3 with streptavidin as the nucleus exhibits the largest activity as in the case of AnEglA and CelD, which are endoglucanases, and enzyme domain 1 It was found that the ratio of cellulose binding domain 3 with respect to cellobiohydrolase was most applicable to cellobiohydrolase.

SEQ ID NO: 3, 4, 6, 7, 8, 9, 10, 11, 13, 14, 20, 21: Primer SEQ ID NO: 5, 12, 15, 16, 17, 19, 22, 23, 26, 27, 28 29: Modified DNA

Claims (9)

A protein complex for cellulose degradation,
A carrier having a plurality of biotin binding sites;
A plurality of cellulose-degrading proteins that are held in the carrier via biotin and contribute to cellulose degradation;
A composite comprising.   The complex according to claim 1, wherein the cellulolytic protein comprises one or more cellulases.   The complex according to claim 1 or 2, wherein the cellulolytic protein comprises one or more cellulose-binding domains.   The complex according to any one of claims 1 to 3, wherein the cellulolytic protein comprises two or more cellulases or two or more cellulose-binding domains.   The complex according to any one of claims 2 to 4, wherein the cellulase contains an endoglucanase.   The composite according to claim 1, wherein the carrier includes streptavidin or quantum dots. A method for producing a degradation product of cellulose,
A method comprising decomposing cellulose using the protein complex according to any one of claims 1 to 6. A method for producing a useful substance,
A step of decomposing cellulose using the protein complex according to claim 1;
A step of obtaining a useful substance by fermentation using a carbon source containing a decomposition product of cellulose obtained in the step;
A method comprising:   The production method according to claim 8, wherein the useful substance is ethanol.