JP2009136235A - Transgenic oryzias latipes with visualized lymphatic vessel and screening method of lymphangiogenesis inhibitor using the oryzias latipes - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a screening method of a substance affecting lymphangiogenesis, and a transgenic oryzias latipes useful for applying to the screen method. <P>SOLUTION: Under control of a vascular endothelial growth factor receptor 3 (VEGFR-3) gene promoter derived from an oryzias latipes, the transgenic oryzias latipes is obtained by transformation using a gene structure connecting reporter genes or an expression vector. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a lymph vessel visualization transgenic medaka, a promoter, a vector, a transformed cell for producing the medaka, and a method for screening a lymphangiogenesis inhibitor using the transgenic medaka.

One of the causes that makes cancer treatment difficult is lymph node metastasis. Cancer cells have been found to induce new lymphatic vessels in and around the tumor, and the resulting rich lymphatic vessels increase the chance for cancer cells to invade and promote cancer lymph node metastasis. Therefore, development of the anti-cancer agent has been promoted with a focus on inhibition of lymphangiogenesis as a new target. However, regarding the mechanism of lymphangiogenesis, “VEGF-C is received by VEGFR-3 expressed in lymphatic progenitor cells mainly derived from venous endothelial cells, and VEGFR-3 emits a phosphorylation signal. The expression of the transcription factor Prox-1 by some route and the formation of lymphatic vessels is not clear. Therefore, a method for searching for lymphangiogenesis inhibitors has not been established other than the method of investigating the effect of inhibiting phosphorylation of VEGFR-3 exclusively using a cultured cell system.
Special table 2005-536186

  An object of the present invention is to provide a method for screening a substance that affects lymphangiogenesis, and a transgenic medaka useful for application to the screening method.

As a result of repeated studies in view of the above problems, the present inventor has obtained DNA containing the promoter region of Vascular endothelial growth factor receptor 3 (VEGFR-3) gene expressed in the medaka lymphatic system.
Fragments were identified. In fact, it was demonstrated that this fragment can selectively express a reporter gene in lymphatic cells in a medaka individual.

The present invention relates to a DNA fragment having promoter activity having an arbitrary gene expression in lymphatic cells, a plasmid vector containing the DNA fragment, a transgenic medaka, and a screening method for a substance that inhibits lymphatic relationship.
Item 1. A transgenic medaka transformed with a gene construct or expression vector in which a reporter gene is linked under the control of the promoter of medaka-derived Vascular endothelial growth factor receptor 3 (VEGFR-3) gene.
Item 2. A screening method for a lymphangiogenesis inhibitor, which comprises causing a test substance to act on the medaka according to Item 1, and evaluating the influence of the test substance on the growth of lymphatic vessels.

According to the present invention, the medaka VEGFR-3 promoter that can be expressed in medaka lymphatic cells can be obtained for the first time.

  By using the promoter of the present invention, any heterologous gene can be highly expressed in medaka lymphatic cells, and transgenic medaka can be easily obtained.

In the transgenic medaka of the present invention, juveniles express a reporter gene in the whole lymphatic vessels and in a part of blood vessels (veins), and therefore, lymphangiogenesis inhibitors can be screened using these juveniles. For example, a transparent medaka is used as a medaka and GFP is used as a promoter.
By linking a reporter gene containing fluorescent protein such as YFP and luciferase, cells in a living individual can be visually observed, and the lymphatic system formation inhibitory action of physiologically active substances including drug candidate compounds is real-time. Can be observed. The thus obtained lymphangiogenesis inhibitor may be used not only as an anticancer agent but also as a therapeutic agent for diseases caused by abnormal lymphangiogenesis such as lymphangioma.

  The transgenic medaka of the present invention in which a fluorescent protein is incorporated as a reporter gene can visualize lymphatic vessels while alive only by observation with a fluorescence microscope. A lymphatic angiogenesis inhibitor candidate substance is administered to such a lymphatic vessel visualization transgenic medaka, and lymphangiogenesis of the transgenic medaka can be measured and screened under a fluorescence microscope.

The present inventors predicted that VEGFR-3 is selectively expressed in medaka lymphatic progenitor cells,
The promoter was obtained. In transgenic medakas introduced with a reporter gene linked to the VEGFR-3 promoter, VEGFR-3 was expressed only in lymphatic vessels in mature medaka, and in both venous and lymphatic vessels in medaka fry. 3- (4-Dimethylamino-naphthalen-1-ylmethylene) -1,3-dihydro-indol-2-one (MAZ51; CALBIOCHEM), which is known to inhibit phosphorylation of VEGFR-3, acts on this fry It was confirmed that lymphangiogenesis was selectively inhibited.

Thus, it is a feature of the present invention that an anti-cancer agent that inhibits lymphangiogenesis can be screened by linking the medaka VEGFR-3 promoter obtained in the present invention and a reporter gene to produce a transgenic medaka. .

  The sequence of the medaka-derived VEGFR-3 promoter is shown in SEQ ID NO: 1.

In the present specification, the “medaka promoter” refers to a DNA fragment having the ability to act as a promoter (promoter function) in medaka. "Promoter" is a DNA that has the activity to promote gene expression in fish, especially small teleosts such as medaka
Means a fragment. A promoter means a specific base sequence on DNA that initiates mRNA synthase (transcription) using DNA as a template. Specific examples include a promoter of a medaka-derived VEGFR-3 gene and a modified form thereof. The modified promoter is a small teleost such as medaka (
In particular, it means a modified promoter having promoter activity in medaka), and specifically includes the following:
(A) DNA comprising the nucleotide sequence of SEQ ID NO: 1 or its complementary strand (b) consisting of a nucleotide sequence in which one or more nucleotide sequences are deleted, substituted, inserted or added in the nucleotide sequence of (a), and medaka DNA with the ability to act as a promoter
(C) DNA having the ability to hybridize with a DNA comprising the nucleotide sequence of (a) or (b) under stringent conditions and to act as a medaka promoter.

As stringent conditions, specifically, 6 × SSC (0.9 M NaCl, 0.09 M trisodium citrate) or 6 × SSPE (3 M NaCl, 0, ₂ M NaH ₂ PO ₄ , 20 mM EDTA · 2Na, The conditions of hybridization at 42 ° C. in pH 7.4) and further washing with 0.5 × SSC at 42 ° C. are mentioned as an example of the stringent conditions of the present invention, but are not limited thereto. .

In one embodiment of the present invention, the promoter is a D consisting of the base sequence set forth in SEQ ID NO: 1.
In NA, it is a DNA having a base sequence in which one or more DNAs are deleted, substituted, inserted or added, and having the ability to act as a medaka promoter. The medaka promoter of the present invention has a promoter sequence added at the 3 ′ or 5 ′ end or inside of the base sequence shown in SEQ ID NO: 1 or a base sequence that increases translation efficiency, or has a promoter activity at the 3 ′ or 5 ′ end. As long as it is deleted.

  The “vector” of the present invention is obtained by introducing the above promoter into a cloning vector or a reporter vector lacking the promoter, for example, pGLscriptII as a general cloning vector derived from Escherichia coli, and pGL3 Basic (Promega) having luciferase as a reporter. And pEGFP vector (Clontech) having a fluorescent protein as a reporter.

  The vector is selected according to the host cell of each fish. The method for introducing the promoter of the present invention into a vector follows the method for introducing a normal gene into a vector.

  The “transgenic medaka” of the present invention can be obtained by incorporating a reporter gene into the vector and introducing it into a fertilized egg of medaka. Instead of a vector, a transgenic medaka can be obtained by linking a heterologous gene to a promoter of the present invention so that the gene can be expressed, and introducing the gene construct into a fertilized egg of medaka in the same manner.

  Since the transgenic medaka obtained in the present invention is not included in the deposit target organism of the depository institution, it is maintained in a state that can be distributed by the present applicant.

  The medaka is not particularly limited, but the medaka STII strain is a transparent medaka strain that lacks the original medaka pigment (black, white, iridescent), and is a reporter protein (especially a fluorescent protein) expressed in cells within the individual. This is preferable because the signal can be easily observed.

  Examples of transformation methods for introducing the vector of the present invention into host cells include electroporation method, microinjection method, calcium phosphate method, method using liposome, particle gun method and the like.

  Elements necessary for the promoter of the present invention can be determined, and a promoter in which parts other than essential elements are modified can be prepared.

As a method for determining the element site on the promoter of the present invention, for example, Joseph
Sambrook, David W. Russell Molecular Cloning Produced a promoter with a regulated length using the deletion method and PCR described in Chapter 13 of the third edition. After transformation into medaka cells, etc., the promoter under the desired conditions There is a method for investigating the activity using a reporter gene. When determining the element sequence in more detail, DNA mutation is introduced into the promoter as described in Chapter 13 of Joseph Sambrook, David W. Russell Molecular Cloning 3rd edition, or the mutation using PCR method is used. As described above, after introduction into medaka cells and the like by introduction, a method of investigating promoter activity and determining the most important element sequence can be mentioned.

  Modification of the promoter of the present invention can be performed by various methods such as connecting the elements of the promoter in tandem, and a promoter with altered activity can be obtained.

Reporter genes that are preferably connected to the promoter of the present invention include fluorescent proteins (green fluorescent protein (GFP), yellow fluorescent protein (YFP), blue fluorescent protein (BFP), red fluorescent protein (RFP), etc.), Examples include aequorin, alkaline phosphatase, luciferase, β-glucuronidase, β-lactamase, β-galactosidase, acetohydroxyacid synthase, chloramphenicol acetyltransferase, horseradish peroxidase, nopaline synthase, octapin synthase, etc. Fluorescent proteins are preferred in that they are easily observed with the naked eye when measurement is performed, and luciferases are preferable when quantitative measurement is performed.

EXAMPLES Hereinafter, although this invention is demonstrated in detail according to an Example, this invention is not limited to these Examples.
Example 1
(1) Acquisition of upstream region of Ol VEGFR-3
The amino acid sequence data of human, mouse and zebrafish of the Vascular endothelial growth factor receptor 3 (VEGFR-3, also known as FMS-like tyrosine kinase 4, FLT-4) gene is NCBI gene database (http: //www.ncbi.nlm. obtained from nih.gov). Among them, zebrafish sequence data (NM_130945) was used as a query, and medaka homolog (Ol VEGFR-3)
Was predicted using the medaka genome BLAST search service (http://dolphin.lab.nig.ac.jp/medaka/srch_db/search_medaka_blastdb2.php?lang=eg&lmode=all, golw_scaffold Hd-rR (200506)). The range from the translation start point of Ol VEGFR-3 to 3787 bp upstream was predicted as the promoter region and amplified by PCR. The primers used for amplification were upstream gcagtccgtcaatactgagg (SEQ ID NO: 2) and downstream ttctggactggagatctggag (SEQ ID NO: 3) designed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) A sequence consisting of upstream ggtaccgcagtccgtcaatactgagg (SEQ ID NO: 4) and downstream ccatggctccagatctccagtccagaa (SEQ ID NO: 5), each of which was connected to the restriction enzyme sites of Kpn I and Nco I, was prepared by requesting the synthesis from Operan. Genomic DNA was prepared from the medaka Hd-rR strain (♂) (Dneasy tissue kit, QIAGEN). Using this as a template, genomic DNA-PCR was performed using the above primers, and the genomic fragment was cloned. PCR
Uses Ex Taq (Takara) as the polymerase and the reaction solution composition is a standard protocol. GeneAmp PCR System 9700 (Applied Biosystems) is used as the thermal cycler at 94 ° C for 4 minutes (94 ° C for 30 seconds, 65 ° C ( Amplified by a temperature change of 30 ° C, 72 ° C 4 minutes), 7 times (94 ° C 30 seconds, 58 ° C 30 seconds, 72 ° C 4 minutes) 28 times, 72 ° C 5 minutes . PCR
When the products were separated by agarose gel electrophoresis, a band of the desired size was confirmed. The reaction product was extracted and purified from the gel (Mini-elute kit, QIAGEN). The purified PCR product was cloned into pGEM-Teasy vector (Promega) by TA-cloning method. The plasmid vector thus prepared was prepared using a Mini-prep kit (QIAGEN). In order to verify that the obtained gene sequence is the predicted upstream region of Ol VEGFR-3, DNA sequencing was performed using the purified plasmid vector as a template and the DyeTerminator method (BigDyeTerminator, ABI3130, AppliedBiosystems). By the above, 3787 bp Ol VEGFR-3
A promoter was obtained. Hereinafter, this base sequence is referred to as pFLT4-4.0k.

(2) Production of transgene
A plasmid vector expressing a reporter gene downstream of the Ol VEGFR-3 promoter was prepared as follows. The sequence containing the region encoding the protein of green fluorescent protein EGFP (Clontech) was cleaved at the NcoI / XbaI site and replaced with the luciferase gene of pGL3 Basic vector (Promega). In addition, in order to delete the restriction enzyme sequence in the multicloning site (MCS), pFLT4-4.0k cloned above was subcloned into the 5 ′ KpnI site and the 3 ′ NcoI site. A plasmid vector expressing an EGFP reporter gene downstream of the constructed Ol VEGFR-3 promoter is called pFLT4: EGFP. This expression plasmid vector was transformed into E. coli DH5α and purified using a QIAprep Mini kit (QIAGEN).

(3) Introduction of gene A transgenic medaka line was created and established using the expression vector prepared above. The medaka into which the gene was introduced was an STII strain that was a transparent medaka. The Medaka STII line is a transparent medaka line that originally lacks the medaka pigment (black, white, rainbow), and is an experimental medaka that allows easy observation of fluorescent protein signals expressed in cells within an individual. (Shared by Professor Wakamatsu, Nagoya University). The parent medaka was reared in a circulating water tank (IWAKI pomp) under a light cycle at 27 ° C. with a light period of 14 hours and a dark period of 10 hours. Paired with sexually mature medaka STII, spawned medaka fertilized eggs were collected and placed in ice-cold Hanks solution to temporarily stop the development. The attached yarns forming the egg mass were carefully removed with tweezers under a stereomicroscope and separated one by one. Unfertilized and immature eggs were removed at this point. The expression vector solution to be injected was adjusted with Vector DNA, 30 ng / μl, K ₂ PO ₄ (pH 8.0), 0.1 M, phenol red (Sigma, cell culture grade), 0.02%). After filling the glass electrode (outer diameter 1.0 mmφ, inner diameter 0.85 mmφ Harvard) with the injected DNA solution and removing the bubbles,
It connected to the microinjector (Femtojet, Eppendorf), and 0.2 pl-0.5 pl was inject | poured into the cell in the 1-2 cell stage medaka fertilized egg under a stereomicroscope (Olympus). The fertilized egg after DNA injection was transferred to an embryonic solution (0.03% Red Sea Salt solution) and incubated at 28 ° C. The signal of the fluorescent protein derived from the expression plasmid vector injected in the advanced embryo (G0) was observed under a stereomicroscope (MZ-FLIII, Leica),
Recording was made with a digital CCD camera (DP70, Olympus). As primary screening,
Only those in which the expression of fluorescent protein was recognized in the population were extracted and reared for the next generation.

The grown G0 individuals were individually crossed with wild-type partners, and the resulting fertilized eggs (F1) were individually collected. If the injected expression vector is inserted into the genome of the mating G0 individual germline cell, as a secondary screening, F1 individuals are observed under a fluorescence microscope at a certain rate (to the genome at one cell stage). Individuals that express the fluorescent protein (50% when inserted) should be obtained. As a result, transgenic individuals via the germ line could be obtained. Similarly, an F1 transgenic individual was bred and crossed with a wild type to obtain an F2 line. The resulting transgenic medaka larvae are shown in FIG. 1, and adult fish are shown in FIG. Fig. 3 shows a photograph of a medaka mated with a blood cell visualization transgenic medaka (distributed from the National Institute of Radiological Sciences). As shown in FIG. 3, the blood vessels and the lymphatic vessels are clearly different, and it was revealed that the transgenic medaka of the present invention can specifically label the lymphatic vessels.

(4) Administration of candidate substances for lymphangiogenesis inhibitors
3- (4-Dimethylamino-naphthalen-1-ylmethylene) known to inhibit phosphorylation of VEGFR-3
-1,3-dihydro-indol-2-one; MAZ51 (CALBIOCHEM) was used. Dissolve this in medaka breeding water (0.03% seawater brine) to a final concentration of 50 μM. Since MAZ51 is a hydrophobic substance, MAZ51 was first dissolved in DMSO to a concentration of 10 mM, and then diluted 200-fold with 0.03% seawater brine to prepare an aqueous solution. The embryos 2 to 3 days after fertilization after removal of the egg membrane in this aqueous solution were cultured for 3 days. In the obtained transgenic medaka, the formation of lymphatic vessels was inhibited as compared with the medaka not treated with MAZ51 (FIG. 4).

(5) Evaluation of candidate substances for lymphangiogenesis inhibitors The results of the formation of lymph vessels in this embryo are observed using a fluorescent stereomicroscope, confocal laser microscope, etc., and the image data is compared with the usual one. The effect of inhibiting lymphangiogenesis can be evaluated. In addition, since this transgenic medaka also expresses GFP in blood vessels in the developmental stage, it is also possible to evaluate the effects of anticancer agents aimed at inhibiting angiogenesis.

The juvenile medaka of lymphatic vessel visualization is shown. 1 shows adult medaka fish with lymphatic visualization. Figure 2 shows a transgenic medaka of the present invention crossed with a blood cell visualization transgenic medaka. In the medaka of the present invention, it was confirmed that only lymphatic vessels were visualized. The transgenic medaka of the present invention in which MAZ51 is allowed to act indicates that lymphatic vessel formation is inhibited. In C, lymphangiogenesis is suppressed. A: Day 2 embryo (control) B: Day 5 embryo (control) C: Day 5 embryo (Day 2 embryo immersed in MAZ51 aqueous solution and cultured for 3 days)

Claims (2)

A transgenic medaka transformed with a gene construct or expression vector in which a reporter gene is linked under the control of the promoter of medaka-derived Vascular endothelial growth factor receptor 3 (VEGFR-3) gene. A screening method for a lymphangiogenesis inhibitor, which comprises causing a test substance to act on the medaka according to claim 1 and evaluating the influence of the test substance on the growth of lymphatic vessels.

Images