JP2008508190A - Inhibition of capsaicin receptor activity in the treatment of obesity or obesity-related diseases and disorders - Google Patents

Abstract

The present invention provides a method of treating a disease or disorder that would benefit from inactivating or down-regulating capsaicin receptor activity in a mammal by inhibiting capsaicin receptor activity. The present invention also provides methods of treating obesity and obesity-related diseases and disorders in mammals by inhibiting the activity of capsaicin receptors.
[Selection figure] None

Description

Field of Invention

  The present invention is in the field of human medicine, particularly in the treatment of obesity related diseases and disorders such as impaired glucose tolerance, insulin resistance, and diabetes mellitus. More particularly, the present invention relates to methods of treating diseases and disorders associated with obesity by administering compounds that modulate capsaicin receptor activity.

Background of the Invention

Obesity and related disorders are very serious and have become global health problems. The prevalence of obesity and related disorders is increasing in epidemic, with a significant decline in quality of life for patients and enormous health care costs for society ¹ . Prevention strategies is not only to preserve the functional capacity of potential diabetic patients, it demonstrated that also a national investment has considerable potential benefit ^{2,3. 4} Therefore, the execution of the effective intervention strategies may be judiciously seem.

Obesity-induced pathologies are associated with the development of impaired glucose tolerance as a result of both impaired insulin secretion and increased insulin resistance. Obesity is type 2 diabetes, type 1 diabetes, cardiovascular disease, high blood pressure, but is not limited to colorectal cancer, rectal cancer, colorectal cancer, pancreatic cancer, esophageal cancer, breast cancer, prostate cancer, uterine cancer, kidney cancer , Endometrial cancer, gallbladder cancer, thyroid cancer, liver cancer, cervical cancer, ovarian cancer, gastric cancer, non-Hodgkin lymphoma, cancers including multiple myeloma, and, but are not limited to, polycystic ovarian syndrome ( With a cluster of disorders such as PCO), infertility, and reproductive system disorders including impotence or erectile dysfunction. Reducing dietary fat combined with daily exercise has been shown to reduce the risk of developing type 2 diabetes by 58% ⁵ . This improvement exceeded the benefits obtained after pharmacological treatments such as metformin. Weight loss programs, however, are often unsuccessful over a long period of time, and patients tend to return to weight and tend to return to their previous weight after intensive monitoring. Therefore, it seems increasingly difficult to continuously lose weight as a way to prevent obesity-induced disorders. Currently, only surgical transformation of the gastrointestinal tract has proven long-term success. Pharmaceutically, weight loss has proven difficult; therefore, current treatment of obese patients is directed at preventing or ameliorating the complications of obesity. Current conventional treatments are not sufficient; therefore, alternative methods for preventing obesity-related disorders are needed.

Summary of the Invention

  The present invention relates to diseases or disorders that benefit from inactivating or down-regulating capsaicin receptor activity in a mammal by administering a therapeutically effective amount of a direct or indirect capsaicin receptor antagonist. Provide a method of treating.

  The present invention also provides a method for treating obesity in a mammal by administering a therapeutically effective amount of a direct or indirect capsaicin receptor antagonist.

  The present invention further relates to obesity in a mammal that inactivates or downregulates the activity of a capsaicin receptor in a mammal by administering a therapeutically effective amount of a direct or indirect capsaicin receptor antagonist. Also provided are methods for treating diseases and disorders.

  The present invention further provides for obesity related diseases in mammals by administering a therapeutically effective amount of a direct or indirect capsaicin receptor antagonist in combination with one or more additional active agents in appropriate proportions. Also provided are methods for treating disorders. When used in combination with one or more additional active agents, the combination of compounds is preferably a synergistic combination. Synergy occurs when the effects of a compound when administered in combination are greater than the additive effects of the compound when administered as a single drug. In general, synergistic effects are most clearly demonstrated at suboptimal concentrations of compounds. Such additional active agents may be selected from anti-diabetic agents, anti-hyperlipidemic agents, anti-obesity agents, antihypertensive agents, and agents for treating complications of or associated with obesity or diabetes.

Detailed Description of the Invention

  The present invention is a method for treating obesity or obesity-related diseases or disorders by inactivating or down-regulating the activity of capsaicin receptors, comprising a therapeutically effective amount of direct or indirect There is provided a method comprising administering capsaicin receptor antagonists to a mammal in need thereof.

  Further embodiments of the present invention provide methods wherein a disease or disorder associated with obesity is selected from: type 1 diabetes, type 2 diabetes, impaired glucose tolerance, cardiovascular disease, hypertension, insulin resistance, cancer, And reproductive system disorders.

  A further embodiment of the present invention provides a method wherein said cancer is selected from: colorectal cancer, rectal cancer, colorectal cancer, pancreatic cancer, esophageal cancer, breast cancer, prostate cancer, uterine cancer, kidney cancer, uterine body. Cancer, gallbladder cancer, thyroid cancer, liver cancer, cervical cancer, ovarian cancer, gastric cancer, non-Hodgkin lymphoma, and multiple myeloma.

  Further embodiments of the present invention provide methods wherein the reproductive system disorder is selected from: polycystic ovary syndrome (PCO), infertility, and impotence or erectile dysfunction.

  Further embodiments of the present invention provide methods wherein said direct or indirect capsaicin receptor antagonist is selected from: natural products, synthetic organic compounds, peptides, proteins, antibodies, antibody fragments, single chain antibodies, And antibody-based constructs.

  Further embodiments of the invention provide therapeutically effective amounts of direct or indirect capsaicin receptor antagonists for antidiabetic drugs, antihyperlipidemic drugs, antiobesity drugs, and diseases associated with obesity or obesity. Alternatively, a method of administration in combination with an additional active agent, selected from agents for the treatment of complications resulting from or associated with a disorder, is provided.

  In another embodiment of the invention, a kit is provided that includes a substance useful in a product or currently claimed method. The product includes a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The container may be formed from a variety of materials such as glass or plastic. The container may contain a composition effective to specifically inhibit the action of the capsaicin receptor and may have a sterile contact port (for example, the container may have a stopper that can be punctured by a hypodermic needle. It may be an intravenous solution bag or vial). The active agent in the composition is a capsaicin receptor antagonist and / or a capsaicin or anandamide neutralizing agent. The label on or associated with the container indicates that the composition is useful for the treatment of obesity and / or diseases associated therewith. The product may further comprise a second container comprising a pharmaceutically acceptable buffer such as phosphate buffered saline, Ringer's solution, and dextrose solution. It may further include other materials desirable from a commercial end consumer standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.

  A further embodiment of the invention is a method for treating obesity and conditions associated with obesity-related diseases with a low degree of inflammation, comprising a therapeutically effective amount of a direct or indirect capsaicin receptor There is provided a method comprising administering antagonists to a patient in need thereof.

  Obesity occurs as a result of a positive energy balance when energy intake exceeds energy consumption. Under normal conditions, excess energy is stored as fat. Several peripheral factors such as leptin and insulin are believed to be affected by this process and some are known. These factors can affect the process of food intake (and possibly energy consumption) and return the energy balance to neutrality. A normal feedback system that regulates this energy balance is a protection system that prevents obesity and related disorders. However, mammals can easily disable this feedback system as a result of obesity-induced diseases and disorders. Obesity-induced disorders are associated with destabilization of other homeostasis systems, such as glucose or lipid homeostasis, and ultimately lead to impaired glucose tolerance associated with decreased insulin secretion and increased insulin resistance. It is burned. The exact mechanism underlying obesity-induced disorders is not fully understood.

Obesity-induced conditions appear to be associated with a low degree of inflammatory conditions ^6-8 . Therefore, the degree of control of insulin resistance and glycemia (or HbA _1C ) is associated with increased levels of C-reactive protein (a marker of phase 1 inflammation) ^9,10 . Several inflammatory markers have been shown to be associated with body fat percentage in Pima Indian ¹¹ , and therefore inflammation may have a role in the cause of obesity and related diseases and disorders It shows.

  Several factors released or produced after tissue injury or during inflammation can interact with a variety of afferent sensory neurons. These factors include lipids, hydrogen ions, heat, ATP, serotonin, bradykinin, nerve growth factor, and anandamide. They include various receptors on the cell membrane (including but not limited to TRPV1, CB1, PG, or P2X3) or ion channels (including but not limited to ASICS (acid-sensitive ion channels)). ) And / or induce changes in the state of intracellular messengers and enzymes (including but not limited to ATP and PKC) that stimulate cellular influx and / or associated activation of nerve fibers To do. These factors can all act synergistically and are most involved in the capsaicin receptor via direct or indirect activation, providing a rapid and sufficient response to the disorder. The exogenous vanilloid, capsaicin, has been shown to selectively bind to this subset of nerve fibers via capsaicin receptors.

Capsaicin-sensitive nerves are sensory nerve fibers that carry afferent signals from the periphery regarding noxious stimuli ¹³ , satiety ¹⁴ , and temperature ¹⁵ . Both Aδ and C fiber types of afferent sensory nerves are involved in pain sensation, are thermosensitive, and can respond to the exogenous vanilloid, capsaicin. Capsaicin has therefore been used as a pharmacological tool to study the role of these fibers.

  The use of capsaicin to study the role of capsaicin-sensitive nerves in experimental mammals, especially their role in pain has been studied for decades. About 40 years ago, capsaicin, the pungent component of red pepper, was shown to selectively activate the Aδ and C fiber types, a subset of the major afferent nerves. The mechanism by which this happens was not known at the time. Systemic administration of capsaicin to a mammal results in acute stimulation by influx of cations into neurons, depolarization, increased excitability, and generation of action potentials. This triggers an afferent effect and an efferent signal consisting of the release of vasoactive and pro-inflammatory peptides (eg CGRP, somatostatin, and substance P). The magnitude of these signals is related to the degree of stimulation / injury underlying the interaction with nerve fibers. The fact that receptor stimulation by capsaicin causes calcium influx makes capsaicin neurotoxic when administered at high doses. Capsaicin administered at neurotoxic doses can cause permanent (when administered to neonatal laboratory mammals) or transient and reversible desensitization (when given to adult mammals) of capsaicin-sensitive neurons. Trigger. The desensitized state allows the study of the role of capsaicin sensitive nerves in normal or diseased experimental mammals. The state of desensitization, however, does not exclude that the factor is responsible for possible changes in the state. Receptors, ion channels, intracellular substances, or extracellular factors are associated with potentials to interact with capsaicin-sensitive neurons and can, alone or in combination, theoretically contribute to the effect of desensitization.

Numerous direct capsaicin analogues have been identified (e.g., resiniferatoxin, RTX ^{16, 17} or Orubaniru (Olvanil) ^{18, 19,} and cannabinoids ^20). Indirect activation of the capsaicin receptor can also occur through, for example, intracellular PKC ²¹ , and thus, but not limited to, compounds containing PKC activators are indirect capsaicin. It is considered an agonist. Capsaicin antagonists have also been identified (eg capsazepine or ruthenium red) but have little functionality in in vitro experiments. Recently, the capsaicin receptor antagonist N- (4-t-butylphenyl) -4- (3-chloropyridin-2-yl) tetrahydropyrazine-1 (2H) -carboxamide (BCTC) has been successfully treated with capsaicin-mediated hyperalgesia. , ^Have been shown to be effective in inhibiting inflammatory hyperalgesia or allodynia, and hyperalgesia following nerve injury ^22,23 . The role of capsaicin-sensitive nerves in normal energy balance has been shown by experimental studies using capsaicin desensitization. Capsaicin-sensitive nerves have been found to affect glucose homeostasis via food intake ¹⁴ , temperature regulation ¹⁵ , and altered insulin secretion ²⁴ and insulin sensitivity ²⁵ . In an experimental animal model of obesity and related disorders, type 2 diabetes, we recently desensitized with capsaicin or RTX, blood glucose and glycemic control, including HbA _1C ^26,27 , dyslipidemia ²⁷ has been shown to improve plasma dipeptidyl peptidase IV (DPP IV) activity ²⁸ , insulin secretion ²⁹ , and insulin sensitivity ³⁰ . These findings indicate that the capsaicin-sensitive nerve system is overactive during obesity or obesity-related disorders. Down-regulation of capsaicin-sensitive nerves can be a novel pharmacological treatment for obesity and obesity-related disorders.

It has been shown that capsaicin binds to a specific receptor, the capsaicin receptor. This receptor, also called vanilloid receptor 1 (VR1) or transient receptor channel vanilloid 1 (TRPV1), was cloned and described several years ago ^31,32 . Capsaicin receptors are found in various brain regions such as peripheral afferent sensory nerve membranes and hypothalamus, hippocampus, and substantia nigra ³³ . The receptor is also found in non-neural cells such as mast cells, keratinocytes, leukocytes, and macrophages ³⁴ . Endogenous ligands for capsaicin receptors have not yet been identified, but ligands from eicosanoid pools such as fatty acids and anandamide have been shown to be satisfactory ³⁵ .

Two research groups created and characterized knockout mice lacking the capsaicin receptor. The mice are severely deficient in their response to chemical or temperature sensitivities ³⁶ , despite appearing normal in a wide range of behavioral tests, including responses to acute nociceptive fever stimuli. ³⁷ was completely deficient in the ability to generate carrageenan-induced thermal hyperalgesia. These data indicate that capsaicin receptors are required for inflammatory sensitization to nociceptive heat stimuli and that there is a sufficient alternative mechanism for the normal sensation of nociceptive heat. Show.

Glucose intolerance can be induced by feeding normal mice with a high-fat diet and, in the early stages, is simply explained by a decrease in glucose effectiveness, but after prolonged feeding inadequate initial of insulin secretion is important ^38.

  The present invention is a surprising discovery in capsaicin receptor knockout mice that the state of impaired glucose tolerance after a period of high fat diet was improved in mice lacking capsaicin receptor and Explain in detail what is associated with an enhanced insulin response. Therefore, capsaicin receptors are involved in mediating high fat-induced glucose intolerance, in part through reducing glucose-stimulated insulin secretion. Thus, abolishing, blocking or antagonizing capsaicin receptor action restores the outcome of obesity and can therefore be used as a novel treatment for obesity and related disorders.

Glucose tolerance can change from moment to moment ³⁹ but is generally constant in normal individuals. In obesity or obesity-related disorders, there is glucose intolerance due to decreased insulin secretion or insulin sensitivity. According to World Health Organization criteria, glucose intolerance (IGT) is characterized by a 2-hour plasma glucose level between 7.8 and 11.0 mM after a standard oral glucose tolerance test (OGTT).

  As used herein, “treating” or “treatment” refers to patient management and nursing for the purpose of combating a disease, condition, or disorder. Treatment includes administering a compound of the invention to prevent the onset of symptoms or complications, alleviating the symptoms or complications, or eliminating the disease, condition, or disorder. Treating glucose intolerance therefore includes, as much as possible, inhibiting the increase in blood glucose following a standard oral glucose tolerance test, concomitantly with improved insulin secretion and / or insulin sensitivity.

  As used herein, the term “obesity” means an excess of adipose tissue. In this context, obesity is best described as excessive body fat accumulation that poses a health risk. Although the distinction between normal and obese individuals is only an approximation, the health risk posed by obesity is probably a continuum with increased body fat accumulation. However, in the present invention, an individual with a body mass index (BMI = weight (kg) divided by height (m) squared) of 25 or more is considered obese.

  As used herein, the term “associated disorder” includes, but is not limited to, type 1 diabetes, type 2 diabetes, cardiovascular disease, cancer, and other diseases whose etiology is derived from or related to obesity State is included.

As used herein, the term “low degree of inflammation” means a condition characterized by a slight increase in the degree of inflammation markers to a much lower degree than that seen in acute inflammation. Inflammatory markers include, but are not limited to, C-reactive protein, serum amyloid A protein, white blood cell count, cytokines (eg IL-6, IL-8, and TNF-α), and neuropeptides (eg CGRP). included. For additional information on the relationship between obesity and inflammation, reference may be made to the article by Ramos et al., Surgery , 134 (2), pp. 329-335 (2003) and references cited therein.

  The terms “administering” or “administration” as used herein are methods for introducing a capsaicin receptor antagonist or an antibody against capsaicin or a capsaicin analog (both direct and indirect) into the body. , Refers to a method that allows the substance to interact with a capsaicin receptor or capsaicin or capsaicin analog. The preferred route of administration will introduce the substance into the systemic circulation. Non-limiting examples include oral administration and transdermal, subcutaneous, intravenous, and intramuscular administration.

  The active agents used in the present invention are administered to mammals, preferably humans, and administered intravenously as a bolus or by continuous infusion over a period of time, or intramuscularly, intraperitoneally, intracerebral, intracerebral spinal cord, subcutaneously. , Intraarticular, intrasynovial, intrathecal, intraocular, intralesional, oral, topical, or pulmonary (ie, by inhalation), or administration by sustained release.

  A “therapeutically effective” amount is at least the minimum amount of active agent necessary to provide a therapeutic benefit to the mammal, but less than a toxic amount. Stated another way, a therapeutically effective amount is an amount that induces, ameliorates or causes improvement in a mammal with glucose intolerance.

  “Carrier” as used herein is a pharmaceutically acceptable carrier, excipient, or stabilizer that is nontoxic to cells or mammals when exposed to them in the amounts and concentrations employed. Is included. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; Proteins such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides including glucose, mannose, or dextrin And other carbohydrates; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salts that form counterions such as sodium; and / or Tween®, polyethylene glycol (PEG), and pluronics (PLURONICS; registered trademark) It includes emissions surfactant.

  The terms “combination therapy”, “in combination”, “in combination” and the like, as used herein, are single pharmaceutical preparations that are an antibody to a capsaicin receptor antagonist or capsaicin or capsaicin-like compound of the invention. And administering other active agents, as well as administering each active agent as a separate pharmaceutical formulation. When separate dosage formulations are used, the compound of the invention and the other active agent can be administered essentially simultaneously, ie simultaneously, or separately staggered times, ie sequentially. For different formulations, the route of administration may be the same or different for each drug. Any known or conceivable route of administration for an individual drug is acceptable for the practice of the present invention.

  The term “mammal” as used herein means an animal classified as a mammal and includes humans, domestic farm and zoo animals, sports or companion animals, and the like. In a preferred embodiment of the invention, the mammal is a human.

  The term “antibody” is used in the broadest sense and specifically includes monoclonal antibodies, chimeric antibodies, humanized antibodies, and all human antibodies.

  The term “monoclonal antibody” as used herein refers to an antibody obtained from a collection of substantially homologous antibodies, ie, a naturally occurring mutation in which a small number of the individual antibodies comprising the collection may be present. Means the same except.

  The term “antibody fragment” means a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab ′, F (ab ′) 1, and Fv fragments; diabodies; linear antibodies; single chain antibody molecules; and multi-selective formed from antibody fragments Antibodies are included.

  The term “Fv” is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy chain and one light chain variable region in close, non-covalent association. It is in this structure that the three complementarity determining regions (CDRs) of each variable region interact to determine the antigen binding site on the surface of the VH-VL dimer. Collectively, 6 CDRs confer antigen binding specificity to the antibody. However, even a single variable region (or half of an Fv containing only three CDRs specific for the antigen) has the ability to recognize and bind to the antigen, but has a lower binding power than a complete antibody .

The Fab fragment also contains the constant region of the light chain and the first constant region (CHI) of the heavy chain. Fab fragments differ from Fv fragments by the addition of several residues at the carboxy terminus of the heavy chain CHI region containing one or more cysteines derived from the hinge site. Fab'-SH here means Fab 'in which the cysteine residues in the constant region have a free thiol group. F (ab ′) ₂ antibody fragments are naturally produced as pairs of Fab ′ fragments that have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

The papain degradation of the antibody produces two identical antigen-binding fragments, so-called Fab fragments, each producing a single antigen-binding site and the remaining Fc fragment (nomenclature indicating the ability to easily crystallize). Pepsin treatment produces an F (ab ′) ₂ fragment with _two antigen binding sites, which can also crosslink antigen.

  The “light chains” of vertebrate antibodies (immunoglobulins) can be classified into two distinct and distinct types, so-called kappa and lambda, based on the amino acid sequences of their constant regions. Depending on the amino acid sequence of the constant region of their heavy chains, immunoglobulins can be classified into different classes. There are five major classes of immunoglobulins, IgA, IgD, IgE, IgG, and IgM, some of which are further classified into subclasses (isotypes) such as IgG1, IgG2, IgG3, IgA, and IgA2, for example May be.

  “Single-chain Fv” antibody fragments comprise the VH and VL regions of an antibody, wherein these regions are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL regions, thereby allowing the sFv to form the desired structure for antigen binding. The term “immunoadhesin” refers to an antibody-like molecule that binds the binding specificity of a heterologous protein to the effector function of an immunoglobulin constant region (“adhesion”). Structurally, the immunoadhesin comprises a fusion of amino acid sequences with desirable binding specificities other than the antigen recognition and binding site of the antibody (ie, heterogeneity), and the immunoglobulin constant region sequence in the immunoadhesin is , IgG-1, IgG-2, IgG-3, or UgG4 subtype, IgA (including IgA-1 and IgA-2), IgE, IgD, or IgM.

  The term `` diabody '' refers to a small antibody fragment having two antigen binding sites, which fragment comprises a heavy chain variable region (VH) linked to a light chain variable region (VL) in the same polypeptide chain. Comprising (VH-VL). By using a linker that is too short to pair two regions on the same chain, the region pairs with the complementary region of the other chain, resulting in two antigen binding sites.

A “capsaicin receptor antagonist” refers to a capsaicin receptor that binds (direct antagonist) or blocks activation stimuli without causing excitement, ie, the influx of calcium into the cell (indirect antagonist / Allosteric antagonist), a compound that antagonizes, blocks or inhibits the biological activity of an endogenous capsaicin receptor ligand, capsaicin or capsaicin analog. Examples of compounds that are receptor antagonists without agonist activity (stimulation of calcium influx into cells) include halogenated analogs ^43,44 of RTX, diarylpiperazines and related compounds ⁴⁵ , N- (3-acryloxy- 2-Benzylpropyl) -N '-[4- (methylsulfonylamino) benzyl] -thiourea analog ⁴⁶ KJM429 [N- (4-tert-butylbenzyl) -N'-[4- (methylsulfonylamino) benzyl ] Thiourea] and JYL1421 [N- (4-tertbutylbenzyl) -N '-[3-fluoro-4- (methylsulfonylamino) benzyl] thiourea] ⁴⁷ N- (4-chlorobenzyl) -N'- (4-hydroxy-3-iodo-5-methoxybenzyl) thiourea (IBTU) ⁴⁸ , acyclic phenethylthiocarbamate derivative ⁴⁹ , urea derivative and others ^50-52 , amine derivative ⁵³ , pyridine derivative ⁵⁴ , urea and amide derivatives ^55,56 , BCTC ^{22 23} , N-alkylglycine ⁵⁷ , SB-366791 (N- (3-methoxyphenyl) -4-chlorocinnamide) ^{58 and the} like. Without limitation, the compounds included in the above examples are consistent with various embodiments of the invention.

  Direct capsaicin receptor antagonists or indirect capsaicin receptor antagonists are compounds useful in the presently claimed methods, including but not limited to natural products, synthetic organic compounds, peptides, proteins, antibodies Antibody fragments, single chain antibodies, and antibody-based constructs.

  The current level of those skilled in the art of receptor binding and capsaicin receptor analysis is well evaluated for capsaicin receptor antagonists within the ordinary skill of the art. There are several established approaches for identifying capsaicin receptor antagonists. One basic scheme involves the measurement of calcium influx into cells with receptors following receptor binding analysis. This is done by using a fixed radioactive coupling method. Characterization is a functional test in cells expressing a VR1 receptor (clonal cell line or dorsal root ganglion cell) to assess whether it inhibits agonist-stimulated cellular entry of calcium Can be performed using tests for (eg, capsaicin, low pH, or elevated temperature (above 45 ° C.)). Measurement of calcium influx can be done using fluorescent calcium dyes (eg FURA-2), radioactive calcium, or by patch clamp techniques. Compounds that bind or do not themselves stimulate cellular influx of calcium are considered antagonists. The in vitro effects of such compounds are evaluated by various pain-related tests, such as the ability to counteract pain / hyperalgesia induced by intraplantar administration of capsaicin in rodent feet. It's okay.

  Cell-based tests can be used to identify indirect capsaicin receptor agonists, and thus can also be used to identify antagonists.

  Antibody-based capsaicin receptor antagonists are also consistent with the claimed method. Anti-capsaicin receptor antibodies may be produced by a variety of well-known methods, including traditional antisera production and monoclonal antibody technology. The modified antibody forms described above may be made using established techniques. Once produced, the antibody is tested as described above for capsaicin receptor antagonist activity.

  Capsaicin or a direct or indirect analog neutralizing agent represents another aspect of the present invention. In this embodiment, capsaicin or a direct or indirect analog thereof is neutralized or biologically inactivated so that it cannot affect the receptor. Agents suitable for this application specifically bind to capsaicin or a direct or indirect analog thereof and preferably have a higher binding constant than the capsaicin receptor.

  Antibodies or antibody-based agents are preferred because they can be intentionally produced using well-established techniques.

  Immunoadhesin (an Fc fusion construct, similar to ENBREL®, in which the soluble ligand binding region of the capsaicin receptor is fused with human Fc) is also consistent with this aspect of the invention.

Dosage and Formulation Appropriate direct or indirect capsaicin receptor antagonists can be used in patients alone or mixed with an acceptable carrier in the form of a pharmaceutical formulation to treat obesity and other related diseases and disorders. Can be administered. Those skilled in the art of treating obesity and other related diseases and disorders can readily determine the dosage and route of administration of the compound to mammals, including humans in need of such treatment. The dosage and desired drug concentration for the pharmaceutical composition of the invention may vary depending on the particular use envisaged. Animal experiments provide reliable guidance for determining effective doses for human therapy.

The route of administration includes, but is not limited to, oral, buccal, rectal, transdermal, buccal, nasal, pulmonary, subcutaneous, intramuscular, intradermal, sublingual, colon, small chamber, intravenous, or Intestinal administration may be included. The compounds are formulated according to routes of administration based on acceptable pharmaceutical practice (Fingl et al., In The Pharmacological Basis of Therapeutics, Ch. 1, p. 1, 1975; Remington's Pharmaceutical Sciences, 18 ^th ed. Mack Publishing Co, Easton, PA, 1990).

  The pharmaceutically acceptable direct or indirect capsaicin receptor antagonist composition of the present invention includes tablets, capsules (including sustained-release or time-release formulations, respectively), pills, powders, granules, elixirs, in situ. It can be administered in multiple dosage forms such as gels, microspheres, crystalline complexes, liposomes, microemulsions, tinctures, suspensions, syrups, aerosol sprays, and emulsions. The compositions of the invention can also be administered in oral, intravenous (bolus or infusion), intraperitoneal, subcutaneous, transdermal, or intramuscular form, and all dosage forms used are known to those skilled in the pharmaceutical arts. Well known to The composition may be administered alone, but generally will be administered with a pharmaceutical carrier selected on the basis of the chosen route of administration and standard pharmaceutical practice.

  The dose of the composition of the invention may of course vary depending on known factors, such as the pharmacodynamic characteristics of a particular drug and its method and route of administration; patient species, age, sex, health, Medical condition and weight; nature and extent of symptoms; type of treatment to be combined; frequency of treatment; route of administration, function of patient's kidney and liver; and desired effect. A physician or veterinarian can determine and prescribe the effective amount of drug required to prevent, counteract, or inhibit the progression of the disease state.

  According to general guidance, a daily oral dose of active ingredient ranges from about 0.001 to 1000 mg / kg body weight, preferably 0.01 to 1 day per body weight when used for the indicated effects. Between 100 mg / kg, most preferably about 0.6-20 mg / kg / day. For intravenous administration, when used for the indicated effect, the daily dose of active ingredient may be between 0.001 ng and 100.0 ng / min per kg body weight during a constant rate infusion. Such constant intravenous infusion may preferably be administered at a rate of 0.01 ng to 50 ng / mm per kg body weight, most preferably 0.1 ng to 10.0 mg / mm per kg body weight. The compositions of the present invention may be administered in a single daily dose, or the total daily dose may be divided into 2, 3, or 4 doses per day and administered in packaged amounts. The compositions of the present invention may be administered by a depot formulation, which will allow sustained release of the drug over the desired day / week / month period.

  The compositions of the present invention can be administered in an intranasal form via topical use of a suitable intranasal vehicle or via a transdermal route using a transdermal patch. When administered in the form of a transdermal delivery system, drug administration will, of course, be more sustained during drug treatment than intermittent administration.

  The composition is typically a suitable pharmaceutical diluent, excipient or carrier (herein collectively referred to as a pharmaceutical carrier), the intended dosage form, ie an oral tablet, It is administered as a mixture with capsules, elixirs, aerosol sprays produced with or without propellants, and syrups, and those appropriately selected for normal pharmaceutical practice.

  For example, for oral administration in the form of a tablet or capsule, the active pharmaceutical ingredient can be, but is not limited to, lactose, starch, sucrose, glucose, methylcellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, mannitol , And can be combined with an oral, non-toxic, pharmaceutically acceptable, inert carrier such as sorbitol; for oral administration in liquid form, the oral drug content is limited Although not intended, it can be used in combination with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, and water. In addition, if desired or necessary, suitable binders, lubricants, disintegrating agents, and coloring agents can be incorporated into the mixture. Suitable binders include, but are not limited to, starch, gelatin, but not limited to natural sugars such as glucose or β-lactose, corn sweeteners, gum arabic, gum tragacanth, or sodium alginate. Natural and synthetic rubbers, carboxymethylcellulose, polyethylene glycols, and waxes. Lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, and sodium chloride. Disintegrants include, without limitation, starch, methylcellulose, agar, bentonite, and xanthan gum.

  The compositions of the present invention may be administered in the form of liposome or mixed micelle delivery systems such as small unilamellar vesicles, large unilamellar vesicles, and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine, or phosphatidylcholines.

  While prodrugs are known to enhance a number of desirable properties of the drug (ie, solubility, bioavailability, manufacturing, etc.), the compounds of the invention may be transported in prodrug form. Accordingly, the present invention is intended to encompass prodrugs of the presently claimed compounds, methods of their transport, and compositions comprising them.

  The composition of the present invention may be conjugated with a soluble polymer as a target drug carrier. Such polymers may include polyethylene oxide polylysine, polyvinyl pyrrolidone, pyran copolymers, polyhydroxypropyl methacrylamide phenol, or polyhydroxyethyl aspartamide phenol substituted with palmitoyl residues. Furthermore, the composition of the present invention is a class of biodegradable polymers that are useful for achieving sustained release of drugs, for example polyacetic acid, polyglycolic acid, polyacetic acid and polyglycolic acid copolymers , Polyepsilon caprolactone, polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacylates, and hydrogel cross-linked or amphiphilic block copolymers.

  Dosage forms (pharmaceutical compositions) suitable for administration may contain from about 0.1 mg to about 500 mg of active ingredient per dosage unit. In these pharmaceutical compositions, the active ingredient is usually present in an amount of about 0.5 to 95% by weight, based on the total weight of the composition.

  Gelatin capsules may contain the active ingredient and powdered carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, and stearic acid. Similar diluents can be used to make compressed tablets. Both tablets and capsules may be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets may be sugar-coated or film-coated to mask unpleasant taste and protect the tablets from the air, and may be enteric-coated for selective disintegration in the gastrointestinal tract.

  Liquid formulations for oral administration may contain coloring and flavoring to increase patient acceptance.

  In general, water, suitable oils, saline, aqueous dextrose (glucose), related sugar solutions, and glycols such as propylene glycol or polyethylene glycol are suitable carriers for parenteral solutions. Solutions for parenteral administration preferably contain a water soluble salt of the active ingredient, suitable stabilizers, and if necessary, buffer substances. It is suitable as a stabilizer to use antioxidants such as sodium bisulfite, sodium sulfate or ascorbic acid alone or in combination. Citric acid and its salts and sodium EDTA are also used. In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl or propylparaben, and chlorobutanol.

  Suitable pharmaceutical carriers are described in Remington: The Science and Practice of Pharmacy, Nineteenth Edition, Mack Publishing Company, 1995, and are standard references in the art.

Representative useful pharmaceutical dosage forms for administration of the compounds of the present invention can be described as follows:
Capsules A large number of unit capsules can be prepared by filling two standard hard gelatin capsules with 100 mg powdered active ingredient, 150 mg lactose, 50 mg cellulose, and 6 mg magnesium stearate.

Soft gelatin capsules A mixture of active ingredients in digestible oils such as soybean oil, cottonseed oil and olive oil is prepared and injected into gelatin using a positive displacement pump to form a soft gelatin capsule containing 100 mg of the active ingredient To do. The capsule should be washed and dried.

Tablet tablets are prepared according to the usual procedure, e.g. with a dosage unit of 100 mg active ingredient, 0.2 mg colloidal silicon dioxide, 5 mg magnesium stearate, 275 mg microcrystalline cellulose, 11 mg starch, and 98.8 mg lactose. May be prepared. A suitable coating may be applied to increase palatability or absorption delay.

A parenteral composition suitable for administration by injection may be prepared, for example, by stirring 1.5% by weight of active ingredient in 10% by volume propylene glycol and water. The solution should be made isotonic with sodium chloride and sterilized.

Suspension aqueous suspensions are for oral and / or parenteral administration eg 100 mg fine active ingredient, 20 mg sodium carboxymethylcellulose, 5 mg sodium benzoate, 1.0 g sorbitol solution, USP, And 0.025 mL vanillin or other savory flavoring agent can be prepared to be 5 mL each.

Sustained release parenteral compositions suitable for administration by biodegradable microparticle injection include, for example, adding a suitable biodegradable polymer in a solvent and incorporating the active ingredient into the polymer solution, It may be prepared by removing the solvent from the matrix and consequently forming a matrix of polymer and active ingredient distributed in the matrix.

  All references cited herein, including publications, patent applications, and patents, are hereby indicated as if each reference was individually and specifically incorporated as part of this specification. To the same extent as published in full (to the maximum extent permitted by law), which is incorporated herein by reference. Any combination of the above-described elements in possible variations is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

  The use of the terms “a” and “its” in describing the present invention, as well as similar terms (particularly with respect to the claims), unless otherwise indicated herein or otherwise clearly contradicted by context, Should be construed as encompassing both.

  The terms “comprising”, “having”, “including”, and “including” are, unless otherwise stated, as unrestricted terms (ie, including but not limited to) Should be construed and read as encompassing the phrases “consisting of”, “consisting essentially of”, “consisting essentially of” (ie, “comprising of a particular component” When a composition is disclosed, the present invention relates, in relevant part, to other identical compositions characterized by consisting essentially of said components and (independently) compositions consisting of said components alone. Should also be understood to provide).

  The recitation of numerical ranges herein is intended to be treated as a shorthand notation referring individually to each distinct value within the range, unless otherwise indicated. Are hereby incorporated by reference as if individually listed. Unless otherwise indicated, all exact numerical values provided herein are representative of the corresponding approximation (ie, all accurate representative values provided for a particular factor or measure are where appropriate) It is also believed to provide a corresponding approximate measurement that is modified by “about”.

  All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context.

  The use of some and all examples or representative words (i.e. "like") described herein is merely intended to make the present invention more clear and claims Unless otherwise specified, the scope of the present invention is not limited. In the specification, when an unclaimed element is shown, there is no word to interpret as essential to the practice of the invention.

  The citation and incorporation of patent documents herein is done for convenience only and does not indicate an opinion on the validity, patentability, and / or feasibility of such patent documents.

  Preferred embodiments of the present invention are described herein. Variations of such preferred embodiments will become apparent to those skilled in the art upon reading the foregoing. The inventor expects those skilled in the art to use such variations where appropriate, and the inventor intends to implement the invention in addition to those explicitly described herein. . Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims dependent thereon as permitted by applicable law.

The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way.
The capsaicin receptor (VR1) antagonist BCTC (see above) used as described above may be synthesized as described in WO 02/08221.

Example 1
Experimental animals: Male capsaicin receptor (VR1) knockout mice (n = 11) (strain name: B6.129S4-Trpv1 ^tm1Jul , strain number: 003770) and male control mice (n = 8) were mixed with Jackson Laboratories. ), Bar Harbor, ME, US. The mice were transported to Denmark at the age of 5 weeks and then up to 29 weeks of age with a normal daylight cycle (lights on at 6 am, 6 pm at the Novo Nordisk A / S company, Malov Animal Unit, Denmark). Kept under controlled conditions of the outside world. Mice are divided into groups (1 group per cage), placed in standard cages (Euro Standard Type IV, Techniplast, Scanbur, Denmark) and acidified (0.4% citric acid) ) Tap water and standard chow (Altromin, Brogaarden Aps, Denmark) were made freely available. The cage is supplied with wooden wool (Brogaarden, Denmark) as a material for nesting, the material for making beds is poplar chips (Brogaarden, Denmark), and a bottle of acidified water is also used in a week. Exchanged twice. At 11 weeks of age, chow was changed to a high fat diet (Research Diet Prod. No. D12309, Research Diet Inc, New Brunswick, US).

Oral glucose tolerance test (OGTT)
OGTT was performed after a high fat diet for 15 weeks. Mice were fasted 18 hours before OGTT. After measuring fasting blood glucose as described below, glucose (Sygehus apotekerne, Denmark) at a concentration of 500 mg / ml was given orally by gavage (2 g / kg po). Blood samples for measuring blood glucose were obtained from capillaries at the tips of conscious mouse tails. Blood was collected in heparinized 5 μl capillary tubes and immediately suspended in 250 μl EBIO buffer (EBIO, Eppendorf, Germany). Following the experiment, glucose was measured using the glucose oxidase method (EBIO, Eppendorf, Germany). The area under the blood glucose curve (AUC) was measured by the trapezoidal method. Mean values of the two groups were compared using Student's t-test. If P was less than 0.05, it was considered statistically significant.

  Figure 1 shows 0-120 minutes of blood glucose after a 2 g / kg oral glucose tolerance test (OGTT) in male capsaicin receptor (VR1) knockout mice or control mice fed a high fat diet for 15 weeks The curve is shown. Male control mice (triangles) show a significant increase in glucose levels after oral glucose load, and blood glucose levels 120 minutes after glucose load are also elevated above baseline (fasting blood glucose level at 0 minutes) It shows a delay in glucose disappearance from blood (ie, impaired glucose tolerance). Male VR1 knockout mice (squares) show a diminished rise in blood glucose when compared, and blood sugar levels after 120 minutes have returned to baseline (fasting blood glucose at 0 minutes), hence It resembles blood glucose levels in normal mice after OGTT (no high fat diet), ie normal glucose tolerance.

  The group mean of calculated area under the blood glucose curve (b) shows that during the 120 minute test, the overall blood glucose level was compared to control mice (parallel bar chart) VR1 knockout mice (filled bar chart) ) Shows a very statistically significant decrease, demonstrating that glucose intolerance is not significantly evident in VR1 knockout mice compared to the control group after 15 weeks of high fat diet. Down-regulation of capsaicin receptors can therefore be a pharmacological approach in the prevention and treatment of impaired glucose tolerance and related diseases.

Glucose (ip) -induced early insulin secretion Mice were tested for insulin secretion by injecting glucose intraperitoneally after a high fat diet for 18 weeks. Mice were fasted for 18 hours prior to testing. Glucose (Sygehus apotekerne, Denmark) at a concentration of 500 mg / ml was administered intraperitoneally by injection (2 g / kg ip). Evaluation of the initial insulin response to intraperitoneally administered glucose was tested by taking approximately 70 μl of blood from capillaries at the tip of the conscious mouse's tail in a 100 μl heparinized capillary tube 2 minutes after exposure. The These tubes were centrifuged (4000 rpm / min / 4 ° C.) and 15 μl of plasma was stored and stored at −20 ° C. until testing using a homemade ELISA. The mean plasma insulin levels at 2 minutes of the two groups were compared by a nonparametric Mann-Whitney U-test with statistically significant differences between the variances of the groups. If P is less than 0.05, it is considered statistically significant.

  FIG. 2 shows group mean plasma insulin levels 2 minutes after intraperitoneal administration of glucose (2 g / kg). VR1 knockout mice (filled bar graph) show significantly higher plasma insulin levels 2 minutes after glucose load compared to control mice (bar graph with parallel lines). This indicates that VR1 knockout mice do not develop as easily as high fat diet-induced glucose intolerance as control mice do. Maintaining the ability to secrete insulin in response to glucose may partially explain normal glucose tolerance in high fat diet VR1 knockout mice. This suggests that inactivation or down-regulation of capsaicin receptor activity may be useful as a novel pharmacological approach in the prevention or treatment of impaired early insulin secretion.

Example 2
Experimental animals: Male Zucker obese rats (n = 19) were purchased from Charles River Laboratories, US. At 6 weeks of age, rats are transported to Denmark, and then until 9 months of age, in a normal daylight cycle (lights on at 6 am, extinguishes at 6 pm) with the Malov animal unit of Novo Nordisk A / S, Denmark Maintained under controlled conditions of the outside world. Rats are placed in standard cages in groups of 3 rats per cage until the end of the experiment (Euro Standard Type IV, Techniplast, Scanbar, Denmark), acidified (0.4% citric acid) water supply Water and standard chow (Altromin, Brogaarden Aps, Denmark) were made freely available. The cage is supplied with wooden wool (Brogaarden, Denmark) as a material for nesting, the material for making beds is poplar chips (Brogaarden, Denmark), and a bottle of acidified water is also used in a week. Exchanged twice.

Oral glucose tolerance test (OGTT) and glucose-induced insulin secretion
At the age of 6 months, OGTT was performed shortly after oral administration of capsaicin receptor antagonist (BCTC). Rats were fasted for 18 hours before OGTT. Fasting blood glucose and plasma insulin were measured as described below. At -30 minutes, 15 mg / kg BCTC (n = 10) or vehicle (n = 9) was given orally by gavage. Rats were left in the cage until 0 hours and blood glucose was assessed according to OGTT. Briefly, glucose (Sygehus apotekerne, Denmark) at a concentration of 500 mg / ml was given orally by gavage (2 g / kg po). Blood glucose and plasma insulin were measured 30, 60, and 120 minutes after glucose administration. Blood samples for blood glucose and plasma insulin measurements were obtained from capillaries at the tip of conscious rat tails. Blood for blood glucose measurement was collected in heparinized 5 μl capillary tubes and immediately suspended in 250 μl EBIO buffer (EBIO, Eppendorf, Germany). After the experiment, glucose was measured using the glucose oxidase method (EBIO, Eppendorf, Germany).

  Blood for analysis of plasma insulin was obtained by collecting approximately 70 μl of blood from capillaries at the tips of conscious rat tails into heparinized 100 μl capillary tubes. These tubes were centrifuged (4000 rpm / min / 4 ° C.) and 15 μl of plasma was stored and stored at −20 ° C. until testing using a homemade ELISA.

  FIG. 3 shows blood glucose curve (a) and plasma insulin curve (b) after oral administration of BCTC, a capsaicin receptor antagonist, at −30 minutes and subsequent time 0 for 6 month old male Zucker obese rats. The curve after the oral glucose tolerance test (OGTT) of intraperitoneal administration of 2 g / kg is shown. Rats treated with solvent (squares) show a marked increase in glucose levels after oral glucose load, suggesting delayed glucose loss from the blood, ie impaired glucose tolerance. Rats treated with BCTC (triangles) show a diminished increase in blood glucose (a) and therefore improved oral glucose tolerance. Rats treated with solvent (squares) also show a decrease in glucose-induced insulin response (b), whereas rats treated with BCTC show significantly higher levels of plasma insulin after oral glucose loading (b ). This suggests that the improvement in oral glucose tolerance in Tucker rats after treatment with the capsaicin receptor antagonist BCTC is mediated in part by improved insulin secretion. These data therefore confirm that the capsaicin receptor is associated with impaired glucose tolerance and impaired glucose-induced insulin secretion.

  Down-regulation of capsaicin receptors can therefore be a pharmacological approach in the prevention and treatment of impaired glucose tolerance and related disorders, and the prevention or treatment of impaired early insulin secretion.

Measurement of inflammatory markers in mesenteric adipose tissue
At 9 months of age, the same rats were again tested for mesenteric inflammatory mediators. Rats were fasted for 18 hours and 15 mg / kg BCTC (n = 10) or vehicle (n = 9) were given orally by gavage. One hour after treatment, rats were anesthetized with isoflurane and decapitated. Mesenteric adipose tissue was quickly removed and transferred to 10 volumes of pre-cooled RNAlater (Sigma-Aldrich, USA) and stored at -20 ° C. To prevent interregional effects on gene expression patterns, 0.5-1 g tissue was homogenized in TRIzol reagent (1 ml / 100 mg tissue) (TRIzol; Invitrogen). Total RNA was extracted from 200 ml of homogenate according to the Qiagen protocol (Qiagen RNeasy Mini handbook, 2001). The first strand cDNA was synthesized using Superscript III reverse transcriptase and random hexamer primers according to the manufacturer's protocol (Invitrogen). The cDNA of the unknown sample was diluted 1:12 in water without nuclease (Qiagen). To create a calibration curve for PCR efficiency calculations, mix samples from each cDNA pool, 1: 6, 1:12, 1:24, 1:48, 1:96, 1: 192, And 1: 384, where only 100% (± 1%) PCR efficiency and R ² between 0.99 and 1 are allowed. The PCR amplification mixture (25 μl) includes 12.5 μl 2 × Platinum Quantitative PCR SuperMix-UDG (Invitrogen), 0.625 μl reverse primer (20 μM), 0.625 μl forward primer (20 μM), 0.625 Contained μl of probe (10 μM) (probe library Exiqon A / S, Denmark), and 5 μl of diluted cDNA template. Real-time quantitative PCR was performed using the MX3000P PCR machine (Stratagene, USA) with the following cycling parameters: 95 ° C. for 10 minutes polymerase activation, 95 ° C. for 30 seconds and 60 ° C. 40 cycles of amplification for 60 seconds. After amplification, the amplicon was confirmed by gel electrophoresis (E-gel, manufactured by Invitrogen).

  Relative gene expression of iNOS and F4 / 80 was measured by quantitative RT-PCR comparative Ct method (Applied Biosystems. User Bulletin # 2. ABI PRISM 7700 Sequencing System, 1997) using solvent as a standard. did. In order to normalize the expression data, 36B4 was used as an internal standard. Primers were designed for intron bridges of each gene using public domain primer design software from Probe Library Exicon A / S (http://www.probelibrary.com/). Primer and probe numbers are as follows: 36B4 accession number X15096.1 sense (5'gtgtttgacaatggcagcat 3 '), antisense (5'acagacgctggccacatt 3'), and probe Rat # 16. iNOS accession number NM012611.2 sense (5 'accatggagcatcccaagta 3'), antisense (5 'cagcgcataccacttcagc 3'), and probe Rat # 71. F4 / 80 accession number XM236797.2 sense (5'ggacttctccaagcctatcgt 3 '), antisense (5'cctctcagacttctgctttgg 3') and probe Rat # 26.

FIG. 4 shows the effect of BCTC on iNOS and F4 / 80 gene expression in mesenteric adipose tissue of 9 month old Zucker obese rats. Rats treated with BCTC (filled bar graph)
It showed significantly lower levels in both iNOS (a) and F4 / 80 1 hour after oral administration of BCTC (15 mg / kg). This suggests that BCTC mediates improved oral glucose tolerance and improved induced insulin release by reducing a low degree of inflammation in tissues, which is mediated by antagonizing capsaicin receptors. To do.

  It is useful as a novel pharmacological approach to the treatment of conditions where inactivating or down-regulating capsaicin receptor activity is associated with low levels of inflammation associated with obesity and obesity-related disorders. Indicates that it is possible.

  Figures 1 and 2 show that mice deficient in capsaicin receptor (VR1) do not develop impaired glucose tolerance a few weeks after ingestion of a high fat diet, indicating that early insulin for retained glucose It shows that it can be partially explained by the reaction.

  FIG. 3 shows that oral glucose tolerance can be improved by oral administration of a capsaicin receptor antagonist (BCTC) in another glucose intolerant male obese Zucker rat, indicating improved insulin secretion in response to oral glucose. Indicates something related. FIG. 4 shows that local inflammation is reduced in obese Zucker rats after administration of BCTC, and that improved glucose tolerance is associated with a reduced degree of inflammation.

  Inhibiting capsaicin receptor activity in obesity or obesity-related diseases and disorders is therefore considered a promising new pharmacological approach.

Literature
1. International Diabetes Federation (IDF). Diabetes Atlas 2000. (2000).
2. Gray, A. et al. Cost effectiveness of an intensive blood glucose control policy in patients with type 2 diabetes: economic analysis alongside randomised controlled trial (UKPDS 41). United Kingdom Prospective Diabetes Study Group.BMJ 320, 1373-1378 ( 2000).
3. UK Prospective Diabetes Study Group.UKPDS 40.Cost effectiveness analysis of improved blood pressure control in hypertensive patients with type 2 diabetes.BMJ 317, 720-726 (1998).
4. Mann, J. Stemming the tide of diabetes mellitus. Lancet 356, 1454-1455 (2000).
5. Knowler, WC et al. Reduction in the incidence of type 2 diabetes with lifestyle intervention or metformin.NEW ENGL. J. MED. 346, 393-403 (2002).
6. Fagerberg, B., Bokemark, L. & Hulthe, J. The metabolic syndrome, smoking, and antibodies to oxidized LDL in 58-year-old clinically healthy men. Nutr. Metab. Carbiovasc. Dis. 11, 227-235 (2001).
7. Liu, S. Et al. Relation between a diet with a high glycemic load and plasma concentrations of high-sensitivity C-reactive protein in middle-aged women <sup> 1-3 </ sup>. Am J Clin N 75 , 492-498 (2002).
8. Temelkova-Kurktschiev, T. Subclinical inflammation in newly detected type II diabetes and impaired glucose tolerance [3]. Diabetolog 45, 151-2002.
9. Festa, A. et al. Chronic subclinical inflammation as part of the insulin resistance syndrome-The Insulin Resistance Atherosclerosis Study (IRAS). Circulation 102, 42-47 (2000).
10. Bhally, HS & Litvin, Y. Association between HbA1C and serum C-reactive protein levels in diabetes mellitus. Diabetes 50, A90 (2001).
11. Weyer, C. et al. Humoral markers of inflammation and endothelial dysfunction in relation to adiposity and in vivo insulin action in Pima Indians. Atherosclerosis 161, 233-242 (2002).
12. Julius, D. & Basbaum, AI Molecular mechanisms of nociception.Nature 413, 203-210 (2001).
13. Szolcsanyi, J., Jancso-Gabor, A. & Joo, F. Functional and fine structural characteristics of the sensory neuron blocking effect of capsaicin. Naunyn Schmiedebergs Arch Pharmacol 287, 157-169 (1975).
14. Barrachina, MD, Martinez, V., Wei, JY & Tache, Y.Leptin and CCK interact to reduce food intake in lean mice: Role of capsaicin-sensitive afferent neurons.Methods and Findings in Experimental and Clinical Pharmacology 19, 85 (1997).
15. Jancso-Gabor, A., Szolcsanyi, J. & Jancso, N. Irreversible Impairment of Thermo Regulation Induced by Capsaicin and Similar Pungent Substances in Rats and Guinea- Pigs.J PHYSIOL (LONDON) 206, 495-507 (1970) .
16. Blumberg, PM, Szallasi, A. & Acs, G. Resiniferatoxin: An ultrapotent capsaicin analogue. Br J Pharmacol 110, 45-62 (1993).
17. Szallasi, A. & Blumberg, PM Resiniferatoxin, a phorbol-related diterpene, acts as an ultrapotent analog of capsaicin, the irritant constituent in red pepper. Neuroscienc 30, 515-520 (1989).
18. Davey, PT, Banner, SE, Hamilton, TC & Sanger, GJ Inhibition by capsazepine and ruthenium red of the pro- and anti-nociceptive effects of olvanil.Br J Pharmacol 115, 100P-1995.
19. Wittka, R., Wieland, H., Meyes, H. & Denzer, D. Comparison of two vanilloid receptor agonists: capsaicin and olvanil.Life Sci 26, Abstract-391 (2000).
20. Ralevic, V., Kendall, DA, Jerman, JC, Middlemiss, DN & Smart, D. Cannabinoid activation of recombinant and endogenous vanilloid receptors. Eur J Pharmacol 424, 211-219 (2001).
21. Ahern, GP & Premkumar, LS PKC induces vanilloid receptor channel activity. Biophysical Journal 80, 208a (2001).
22. Pomonis, JD et al. N- (4-Tertiarybutylphenyl) -4- (3-cholorphyridin-2-yl) tetrahydropyrazine -1 (2H) -carbox-amide (BCTC), a novel, orally effective vanilloid receptor 1 antagonist with analgesic properties: II.in vivo characterization in rat models of inflammatory and neuropathic pain.J Pharmacol Exp Ther 306, 387-393 (2003).
23. Valenzano, KJ et al. N- (4-tertiarybutylphenyl) -4- (3-chloropyridin-2-yl) tetrahydropyrazine -1 (2H) -carbox-amide (BCTC), a novel, orally effective vanilloid receptor 1 antagonist with analgesic properties: I. in vitro characterization and pharmacokinetic properties. J Pharmacol Exp Ther 306, 377-386 (2003).
24. Karlsson, S., Scheurink, A., Steffens, A. & Ahren, B. Increased insulin secretion and glucose tolerance after neonatal capsaicin in mice.Diabetolog 37, A43 (1994).
25. Koopmans, SJ, Leighton, B. & DeFronzo, RA Neonatal de-afferentation of capsaicin-sensitive sensory nerves increases in vivo insulin sensitivity in conscious adult rats.Diabetolog 41, 813-820 (1998).
26. Gram, DX et al. Basal glycaemia and Glucose Tolerance is Improved after Resiniferatoxin in male Zucker Diabetic Fatty rats. Diabetologia 44 (Supplement 1), A 178. 2001.
Ref Type: Abstract
27. Gram, DX et al. Capsaicin Desensitisation Delays the Progression of Type 2 Diabetes in the Zucker Fatty Rat.Diabetes 49 (Supplement 1), A428. 2000.
Ref Type: Abstract
28. Gram, DX, Brand, CL, Wilken, M., Riebel, U. & Carr, RD DPPIV activity Is Decreased and Glucose Tolerance Improved by Sensory Nerve Denervatiion in the ZDF rat.Diabetes 50 (Suppl.2), A515, 2167-PO. 2001.
Ref Type: Abstract
29. Gram, DX et al. Sensory nerve desensitisation in Zucker Diabetic Fatty rats preserves in vitro insulin secretion. Diabetologia 43 (Supplement 1), A130. 2000.
Ref Type: Abstract
30. Moesgaard, S. et al. Sensory nerve inactivation by resiniferatoxin improves insulin sensitivity in male obese Zucker rats. Diabetes 52, A68-2003.
31. Caterina, MJ et al. The capsaicin receptor: A heat-activated ion channel in the pain pathway. NATURE (LOND) 389, 816-824 (1997).
32. Caterina, MJ & Julius, D. The vanilloid receptor: A molecular gateway to the pain pathway. Annu. Rev. Neurosci. 24, 487-517 (2001).
33. Mezey, E. et al. Distribution of mRNA for vanilloid receptor subtype 1 (VR1), and VR1-like immunoreactivity, in the central nervous system of the rat and human.Proc Natl Acad Sci USA 97, 3655-3660 (2000 ).
34. Cortright, DN & Szallasi, A. Biochemical pharmacology of the vanilloid receptor TRPV1-An update. Eur J Biochem 271, 1814-1819 (2004).
35. Smart, D. et al. The inherent lipid anandamide is a full agonist at the human vanilloid receptor (hVR1). Br J Pharmacol 129, 227-230 (2000).
36. Caterina, MJ et al. Impaired nociception and pain sensation in mice lacking the capsaicin receptor. Science (Washington DC) 288, 306-313 (2000).
37. Davis, JB et al. Vanilloid receptor-1 is essential for inflammatory thermal hyperalgesia. Nature 405, 183-187 (2000).
38. Ahren, B. & Pacini, G.Insufficient islet compensation to insulin resistance vs. reduced glucose effectiveness in glucose-intolerant mice.American journal of physiology.Endocrinology and metabolism 283, E738-E744 (2002).
39. La Fleur, SE, Kalsbeek, A., Wortel, J., Fekkes, ML & Buijs, RM A daily rhythm in glucose tolerance: A role for the suprachiasmatic nucleus. Diabetes 50, 1237-1243 (2001).
40. Wahl, P., Foged, C., Tullin, S. & Thomsen, C. Iodo-resiniferatoxin, a new potent vanilloid receptor antagonist. Mol. Pharmacol. 59, 9-15 (2001).
41. Seabrook, GR et al. Functional properties of the high-affinity TRPV1 (VR1) vanilloid receptor antagonist (4-hydroxy-5-iodo-3-methoxyphenylacetate ester) iodo-resiniferatoxin.J Pharmacol Exp Ther 303, 1052-1060 ( 2002).
42. (WO 02/08211). 2002.
Ref Type: Patent
43. Lee, J. et al. N- (3-acyloxy-2-benzylpropyl) -N '-[4- (methylsulfonylamino) benzyl] thioure a analogues: novel potent and high affinity antagonists and partial antagonists of the vanilloid receptor. J Med Chem 46, 3116-3126 (2003).
44. Wang, Y. et al. High affinity antagonists of the vanilloid receptor. Mol. Pharmacol. 62, 947-956 (2002).
45. Ioth, A., Blumberg, PM, Chen, Z. & Kozikowski, AP Design of a high-affinity competitive antagonist of the vanilloid receptor selective for the calcium entry-linked receptor population. Mol. Pharmacol. 65, 282-291 (2004).
46. Yoon, J. et al. Chain-branched acyclic phenethylthiocarbamates as vanilloid receptor antagonists. Bioorganic & Medicinal Chemistry Letters 13, 1549-1552 (2003).
47. (WO 03/022809). 2003.
Ref Type: Patent
48. (WO 02/090326). 2004.
Ref Type: Patent
49. (WO 02/072536). 2002.
Ref Type: Patent
50. (WO 03/014064). 2003.
Ref Type: Patent
51. (WO 02/76946). 2002.
Ref Type: Patent
52. McDonnell, ME, Zhang, S., Nasser, N., Dubin, AE & Dax, SL 7-Hydroxynaphthalen-1-yl-urea and -amide antagonists of human vanilloid receptor 1. Bioorganic & Medicinal Chemistry Letters 14, 531 -534 (2004).
53.Sun, Q. Et al. 4- (2-pyridyl) piperazine-1-carboxamides: potent vanilloid receptor 1 antagonists. Bioorg Med Chem Lett 13, 3611-3616 (2003).
54. Garcia-Martinez, C. et al. Attenuation of thermal nociception and hyperalgesia by VR1 blockers.Proc Natl Acad Sci USA 99, 2374-2379 (2002).
55. Gunthorpe, MJ et al. Identification and characterization of SB-366791, a potent and selective vanilloid receptor (VR1 / TRPV1) antagonist. Neuropharmacology 46, 133-149 (/ 1).
56. Sathianathan, V. et al. Insulin induces cobalt uptake in a subpopulation of rat cultured primary sensory neurons. Neurosci. Lett. 18, 2477-2486 (2003).

FIG. 1a shows a 0-g after oral glucose tolerance test (OGTT) of 2 g / kg oral administration in male capsaicin receptor (VR1) knockout mice and control mice, respectively, fed a 15-week old high fat diet. Shows 120 minute blood glucose curve. FIG. 1b shows the area under the blood glucose curve in FIG. 1a. FIG. 2 shows group mean plasma insulin levels 2 minutes after intraperitoneal administration of glucose (2 g / kg) to male VR1 knockout mice and control mice, respectively. FIG. 3a shows -30 min to 120 min blood glucose curve and plasma insulin curve, respectively, following an oral glucose tolerance test (OGTT) of 2 g / kg oral administration in 21 week old Zucker obese rats. BCTC, a capsaicin receptor antagonist, was administered orally (-15 mg / kg) at -30 minutes and glucose loading was performed at 0 minutes. FIG. 3b shows the -30 min to 120 min blood glucose curve and plasma insulin curve, respectively, after an oral glucose tolerance test of 2 g / kg oral administration in 21 week old Zucker obese rats. BCTC, a capsaicin receptor antagonist, was administered orally (-15 mg / kg) at -30 minutes and glucose loading was performed at 0 minutes. FIG. 4a shows inflammation markers iNOS and F4 in mesenteric adipose tissue of 9 month old Zucker obese rats one hour after oral administration of BCTC (15 mg / kg), a capsaicin receptor antagonist, by gavage. Indicates a relative level of / 80. Figure 4b shows inflammation markers iNOS and F4 in mesenteric adipose tissue of 9 month old Zucker obese rats one hour after oral administration of BCTC (15 mg / kg), a capsaicin receptor antagonist, by gavage Indicates a relative level of / 80.

Claims (23)

  A method for treating obesity in a mammal by inactivating or down-regulating the activity of a capsaicin receptor, comprising a therapeutically effective amount of a direct or indirect capsaicin receptor antagonist A method comprising administering to said mammal.   2. The method of claim 1, wherein the capsaicin receptor antagonist is a direct capsaicin receptor antagonist.   2. The method of claim 1, wherein the capsaicin receptor antagonist is an indirect capsaicin receptor antagonist.   A method for treating a disease or disorder associated with obesity in a mammal by inactivating or down-regulating the activity of a capsaicin receptor, comprising a therapeutically effective amount of a direct or indirect capsaicin receptor Administering an antagonist to a mammal in need thereof.   5. The method of claim 4, wherein the capsaicin receptor antagonist is a direct capsaicin receptor antagonist.   5. The method of claim 4, wherein the capsaicin receptor antagonist is an indirect capsaicin receptor antagonist.   5. The method according to claim 4, wherein the obesity-related disease or disorder is selected from the following: type 1 diabetes, type 2 diabetes, impaired glucose tolerance, cardiovascular disease, hypertension, insulin resistance, cancer , And reproductive system disorders.   8. The method of claim 7, wherein the obesity related disease or disorder is type 2 diabetes.   8. The method of claim 7, wherein the obesity related disease or disorder is type 1 diabetes.   8. The method of claim 7, wherein the obesity related disease or disorder is impaired glucose tolerance.   8. The method of claim 7, wherein the obesity related disease or disorder is cardiovascular disease.   8. The method of claim 7, wherein the obesity related disease or disorder is hypertension.   8. The method of claim 7, wherein the obesity related disease or disorder is cancer.   14. The method of claim 13, wherein the cancer is selected from: colorectal cancer, rectal cancer, colorectal cancer, pancreatic cancer, esophageal cancer, breast cancer, prostate cancer, uterine cancer, kidney cancer, endometrium Cancer, gallbladder cancer, thyroid cancer, liver cancer, cervical cancer, ovarian cancer, gastric cancer, non-Hodgkin lymphoma, and multiple myeloma.   8. The method of claim 7, wherein the obesity related disease or disorder is a reproductive system disorder.   16. The method of claim 15, wherein the reproductive system disorder is selected from: polycystic ovary syndrome (PCO), infertility, and impotence or erectile dysfunction.   17. The method according to any one of claims 1-16, wherein the direct or indirect capsaicin receptor antagonist is selected from: natural products, synthetic organic compounds, peptides, proteins, antibodies, Antibody fragments, single chain antibodies, and antibody-based constructs.   The method according to any one of claims 1 to 17, wherein the mammal is a human.   A kit for treating obesity or an obesity-related disease or disorder in a mammal in need thereof by inactivating or down-regulating the activity of a capsaicin receptor, comprising direct or indirect capsaicin receptor A kit comprising a body antagonist.   20. The kit according to claim 19, wherein the mammal is a human.   8. The method of claim 7, wherein the obesity related disease or disorder is insulin resistance.   A method for treating obesity or obesity-related diseases and disorders by inactivating or down-regulating the activity of a capsaicin receptor, comprising a therapeutically effective amount of a direct or indirect capsaicin receptor antagonist A further activity selected from antidiabetics, antihyperlipidemics, antiobesity agents, and agents for the treatment of complications resulting from or associated with obesity or obesity-related diseases or disorders A method comprising administering to a mammal in need thereof in combination with a drug.   A method for treating conditions associated with a low degree of inflammation associated with obesity and obesity-related disorders, wherein patients need a therapeutically effective amount of a direct or indirect capsaicin receptor Comprising administering to.

Images