JP2008142009A - Detection method and detection kit for objective dna or rna in specimen using pna probe, preparation method and preparation kit for objective dna or rna to be hybridized with pna probe, and pna chip for detection of objective dna or rna - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a detection method and a detection kit to use a PNA (peptide nucleic acid) probe, more easily, accurately and quickly detecting the objective DNA or RNA in a specimen. <P>SOLUTION: The objective DNA or RNA in a specimen is hybridized with a PNA probe hybridizable with the DNA/RNA, by incubating the DNA/RNA and the PNA probe, in a hybridization liquid containing DMSO, and the obtained hybridized product is washed with a washing liquid containing a lower alcohol having a carbon number of 1-4. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention detects a target DNA or RNA in a specimen using a PNA probe and a detection kit, a preparation method and a preparation kit for target DNA or RNA to be hybridized with a PNA probe, and a target DNA or RNA Therefore, the target DNA or RNA can be detected more easily, accurately and in a short time.

In recent years, a method using a direct hybridization method or a gene amplification method (PCR method) has been used as a method for detecting a target gene. In recent years, a DNA chip having a large number of probes attached thereto has been invented and has begun to be used in fields such as research and medical diagnosis. A general DNA chip has a size of 1 to 10 cm ² , and is immobilized so that thousands to hundreds of thousands of kinds of DNA are aligned in this region. In general, an expressed gene or polymorphism is detected by hybridization with a fluorescently labeled DNA probe. For detection, a high-performance fluorescent scanner having a resolution of 1 to 10 μm is used. DNA chip technology has been developed as a new technology to dramatically advance the results of the genome structure analysis project as a post-genomic research subject, and provides new means for research and development such as drug discovery research, disease diagnosis and development of prevention methods It is expected to do. This technique is spreading because of its simplicity, its ability to collect a large amount of gene expression information, etc., and appeal to the eye using fluorescent labels.

  However, since the DNA chip adopts the principle of hybridization by the binding force between nucleic acids, it has a disadvantage that it is necessary to take a long incubation time. Originally, many DNA chips have a DNA probe having a length of 60-80 bases attached on a chip substrate, and a method of analyzing this by competitive hybridization is common. However, since the DNA probe has a large number of bases, it is unsuitable for single nucleotide polymorphisms (hereinafter referred to as SNPs) analysis that needs to recognize a single base mismatch, and therefore a short oligo of about 20-30 bases. A chip using DNA has also been devised. However, when the number of bases of the DNA probe is reduced, the efficiency of hybridization decreases, so it is necessary to lengthen the hybridization time, and a result cannot be obtained in a short time. For this reason, the DNA chip is still in the technical development stage in terms of accuracy and sensitivity. In addition, in order to evaluate the accuracy of the DNA chip, it takes time and labor to create a distribution map after analyzing multiple samples.

  An ECA (Electronic Chemical Array) chip is a ceramic chip in which synthetic oligo DNA (80 bases) is covalently bonded onto a gold microelectrode. This chip array is homologous to the microelectrode, and the current flows only through the electrode that has captured the target gene, so that the target gene can be detected as an electrical signal. Whereas a conventional DNA chip uses a labeled DNA as a sample, an ECA chip subjected to measurement without labeling has high sensitivity and does not require PCR. In addition, SPR (Surface Plasmon Resonance) is not as well integrated as DNA chips and ECA chips, but is very interesting in that kinetic analysis can be performed in a state closest to the ecological environment.

  On the other hand, since around 1991, a peptide nucleic acid (PNA), which is a kind of pseudo-nucleic acid, has been developed and attracts attention (Non-patent Document 1). For example, the heat stability of PNA / DNA and PNA / RNA has been proved to be extremely higher than that of DNA / DNA and DNA / RNA. Therefore, when PNA is used, the hybridization temperature is increased as compared with the prior art. It is speculated that nonspecific binding other than PNA and the nucleic acid of interest can be further suppressed. In the case of DNA / DNA, it is necessary to set the salt concentration to a certain value or more in order to suppress the negative charge of the phosphate group as much as possible, but in the case of PNA / DNA, PNA itself has no negative charge. Since it is a neutral polymer, it is hardly affected by the salt concentration. Therefore, hybridization is possible under acidic, basic, and low ionic strength, and it is presumed that the rules for hybridization buffers used in DNA / RNA probes are not necessary. For PNA probes, it is only necessary to dilute with distilled water. It is expected that the labor on the work can be reduced. Furthermore, the sugar phosphate backbone of DNA and RNA is negatively charged and has electrostatic repulsion between complementary strands, but in the case of PNA, there is no electrostatic repulsion because it originally has no charge.

  Thus, compared to conventional nucleic acids, PNA has (1) high ability to form a double strand, (2) high ability to recognize base sequences, and (3) extremely stable degradation against in vivo nucleases and proteases. As a result, PNA has gained a great deal of attention as an antisense molecule as a tool with high utility value in molecular biology and genetic engineering as an alternative to DNA.

However, PNA has drawbacks that synthesis is difficult and that PNA oligomers are difficult to permeate cell membranes. Further, even if the PNA probe is fixed to the chip and used in the same manner as the DNA chip, it is difficult to specifically detect the target DNA or RNA, and a search for a more effective method of using PNA continues. .
Perry-O'Keefe, H. et al., J. Microbiol. Method., Vol. 47, pp. 281-292 (2000).

  With the background of the above-described conventional technology, the present inventors tried to construct a simple advanced technology for PNA. That is, an object of the present invention is to provide a detection method and a detection kit using a PNA probe capable of detecting a target DNA or RNA in a sample in a simpler, accurate and short time. Another object of the present invention is to provide a preparation method and a preparation kit for a target DNA or RNA to be hybridized with a PNA probe. It is another object of the present invention to provide a PNA chip that can more accurately and easily determine the presence or absence of target DNA or RNA without requiring competitive hybridization.

As a result of research in view of the above problems, the present inventors have found that a target DNA or RNA in a sample and a PNA probe capable of hybridizing with the target DNA or RNA are contained in a hybridization solution containing dimethyl sulfoxide (DMSO). By hybridizing by incubating and washing the obtained hybridized product with a washing solution containing a lower alcohol having 1 to 4 carbon atoms, the PNA probe and the target DNA or RNA can be hybridized in a short time. I found out. In addition, when the present inventors hybridize the amplification product obtained after amplifying the target DNA or RNA with the PNA probe, the present DNA is used with a sense primer and an antisense primer in a molar ratio of 1: 4 to 100. Or, when an RNA amplification product was obtained, it was found that the target DNA or RNA and PNA probe can be more efficiently hybridized. In addition, the present inventor uses a PNA chip having at least a PNA probe having a sequence completely complementary to the base sequence of the target DNA or RNA, a PNA probe having only one base mismatched with the base sequence of the target DNA or RNA, and It has been found that by providing a PNA probe that does not hybridize with the target DNA or RNA, the target DNA or RNA can be detected more accurately and easily. The present invention has been completed as a result of further studies based on the above findings, and is described below.
Item 1. A method for detecting a target DNA or RNA in a specimen using a PNA probe, comprising the following steps:
(1) Incubating a target DNA or RNA in a sample in a hybridization solution containing DMSO and a PNA probe capable of hybridizing with the target DNA or RNA under conditions that allow hybridization;
(2) a step of washing the product of the step (1) with a washing solution containing a lower alcohol having 1 to 4 carbon atoms, and (3) a hybridized product of the PNA probe and the target DNA or RNA after the step (2). Detecting the presence or absence of
The detection method characterized by including.
Item 2. Item 2. The detection method according to Item 1, wherein the concentration of DMSO in the hybridization solution is about 5 to 60% by weight.
Item 3. Item 2. The detection method according to Item 1, wherein the cleaning solution has a lower alcohol concentration of 1 to 4 carbon atoms of 50 to 100% by weight.
Item 4. Item 2. The detection method according to Item 1, wherein the target DNA or RNA is an amplification product obtained using a sense primer and an antisense primer in a ratio of 1: 4 to 100.
Item 5. Item 2. The detection method according to Item 1, wherein the target DNA or RNA is detected using a PNA chip in which the PNA probe is disposed on the chip.
Item 6. The PNA chip has at least a PNA probe having a sequence completely complementary to the base sequence of the target DNA or RNA, a PNA probe having one base mismatched with the base sequence of the target DNA or RNA, and a PNA probe serving as a negative control Item 6. The detection method according to Item 5, which comprises:
Item 7. A kit for detecting DNA or RNA of interest in a sample using a PNA probe, comprising:
(I) a hybridization solution containing DMSO, and (ii) a washing solution containing a lower alcohol having 1 to 4 carbon atoms,
A kit comprising:
Item 8. Item 8. The kit according to Item 7, further comprising a sense primer and an antisense primer used in a ratio of 1: 4 to 100.
Item 9. Item 8. The kit according to Item 7, wherein the PNA probe includes a PNA chip disposed on the chip.
Item 10. A method for preparing a target DNA or RNA to be hybridized with a PNA probe, wherein the target DNA or RNA is obtained by performing PCR using a sense primer and an antisense primer in a ratio of 1: 4 to 100. The preparation method.
Item 11. A kit for preparing a target DNA or RNA to be hybridized with a PNA probe, comprising a sense primer and an antisense primer used in a ratio of 1: 4 to 100.
Item 12. A PNA chip for detecting target DNA or RNA, having at least one PNA probe having a sequence completely complementary to the base sequence of the target DNA or RNA and one base mismatched with the base sequence of the target DNA or RNA A PNA chip comprising a PNA probe and a PNA probe serving as a negative control.
Item 13. The PNA probe having a sequence completely complementary to the base sequence of the target DNA or RNA, the PNA probe having one base mismatched with the base sequence of the target DNA or RNA, and the PNA probe serving as the negative control are adjacent to each other. Item 13. The PNA chip according to Item 12, wherein the PNA chip is arranged.

1. Detection method and detection kit of target DNA or RNA in specimen using PNA probe The detection method of the present invention comprises (1) a target DNA or RNA in a specimen in a hybridization solution containing DMSO, and the target DNA or RNA A step of incubating a PNA probe capable of hybridizing with RNA under a condition capable of hybridizing, (2) a step of washing the product of the step (1) with a washing solution containing a lower alcohol having 1 to 4 carbon atoms, and (3 And a step of detecting the presence or absence of a hybridized product of the PNA probe and the target DNA or RNA after the step (2). Moreover, the detection kit of the present invention is characterized by comprising (i) a hybridization solution containing DMSO and (ii) a washing solution containing a lower alcohol having 1 to 4 carbon atoms.

  In the present invention, the term “hybridized” means that when hybridized under hybridization conditions using a hybridization solution containing DMSO and a washing solution containing a lower alcohol having 1 to 4 carbon atoms, the target DNA or RNA and the target DNA or It means that a hybridized product with a PNA probe targeting RNA is obtained. Hereinafter, the detection method and detection kit of the present invention will be described in detail.

Detection Method of the Present Invention As described above, the detection method of the present invention hybridizes a target DNA or RNA in a sample with a PNA probe that can hybridize with the target DNA or RNA in a hybridization solution containing DMSO. Incubating under conditions that allow soybeans (1). Specifically, in this step, a sample containing the target DNA or RNA is mixed with a hybridization solution, and this mixture is incubated at an appropriate time and temperature in the presence of a PNA probe capable of hybridizing with the target DNA or RNA. Is. The PNA probe is preferably preheated.

  In this case, the incubation temperature can be appropriately adjusted according to the target DNA or RNA, the base sequence of the PNA probe, the length of the PNA probe, and the like, preferably in the range of 36-50 ° C, more preferably 50 ° C. In addition, the incubation time can be appropriately adjusted according to the target DNA or RNA, the base sequence of the PNA probe, the length of the PNA probe, and the like, preferably 5 to 60 minutes, and more preferably 60 minutes. The heating temperature of the PNA probe is not limited, but is preferably the same as the incubation temperature.

  The hybridization solution used in the present invention can be explained as follows. Any hybridization solution may be used as long as it is prepared by adding DMSO to a commonly used hybridization solution. The DMSO concentration of the hybridization solution is preferably about 5 to 60% by weight, more preferably 20 to 25% by weight. As an example, 5 × SSPE containing 1 wt% SDS with DMSO added can be used as a hybridization solution.

  Moreover, the detection method of this invention includes the process (2) which wash | cleans the product of a process (1) with the washing | cleaning liquid containing a C1-C4 lower alcohol as above-mentioned. Specifically, in this step, the PNA probe is obtained by bringing the hybridization product of the DNA or RNA in the sample obtained in step (1) and the probe into contact with a washing solution containing a lower alcohol having 1 to 4 carbon atoms. DNA or RNA that is not hybridized with the PNA probe, such as DNA or RNA that is only attached to the PNA probe.

  Here, the washing can be performed at a temperature appropriately adjusted according to the target DNA or RNA, the base sequence of the PNA probe, the length of the PNA probe, etc., preferably 60 ° C. or less, more preferably 50 ° C. or less. Further, room temperature is more preferable because it does not require labor for temperature control. In addition, the washing can be performed for an appropriately adjusted time according to the target DNA or RNA, the base sequence of the PNA probe, the length of the PNA probe, etc., preferably from 1 to 30 minutes from the point that it can be detected in a short time, More preferably, it is 1 to 15 minutes.

  The cleaning liquid used in the present invention can be explained as follows. The cleaning solution may be prepared by adding a lower alcohol having 1 to 4 carbon atoms to a commonly used cleaning solution, but is preferably prepared by adding a lower alcohol to water such as distilled water. is there. The lower alcohol concentration in the cleaning liquid can be 50 to 100% by weight, preferably 80 to 100% by weight, and more preferably 100% by weight. Examples of the lower alcohol having 1 to 4 carbon atoms include methanol, ethanol, propanol, isopropanol, butanol and the like, preferably ethanol.

  By using the hybridization solution and the washing solution, a hybridization product of the target DNA or RNA and a PNA probe capable of hybridizing to the target DNA or RNA can be obtained with high accuracy. Further, by using the hybridization solution and the washing solution, DNA or RNA that is simply attached to the PNA probe but not hybridized can be effectively removed.

  Therefore, by using the above hybridization solution and washing solution, the target DNA or RNA and PNA probe can be hybridized in a short time, and signals such as fluorescence emission of the hybridized product thus obtained will be described below. It can be clearly observed in the step (3).

  In addition, after the said process (2), it can wash | clean further as needed, for example, can wash | clean by 1xSSPE containing 0.1% SDS.

  As described above, the detection method of the present invention includes the step (3) of detecting the presence or absence of a hybridized product between the PNA probe and the target DNA or RNA. Specifically, in this step, the presence / absence of a hybridized product of the PNA probe and the target DNA or RNA is discriminated based on the presence / absence of a signal derived from the hybridized product or the signal intensity. The signal can be obtained based on, for example, a labeling agent or a fluorescent dye that is previously labeled on the probe, and the signal and signal intensity are observed and measured using a conventionally known apparatus such as a fluorescence microscope or a scanner. Can do. For example, if a signal derived from a hybridization product of the PNA probe and the target DNA or RNA is observed, it is determined that the target DNA or RNA is present in the sample, and if it is not observed, it is determined not to exist.

  The target DNA or RNA in the specimen used in the present invention can be explained as follows. The origin of the target DNA or RNA in the specimen is not limited, such as virus origin, bacteria origin, chicken origin, pig origin, human origin and the like. The sample may be prepared so that the presence or absence of the target DNA or RNA can be determined. For example, the sample may include cells that have undergone some kind of cell membrane permeabilization, and the extracted target DNA or RNA The target DNA or RNA amplification product may be included, such as PCR or RT-PCR.

  When an amplification product of the target DNA or RNA is used as a specimen, the amplification product can be obtained according to a usual method. When obtaining the amplification product of the target DNA or RNA, for example, PCR or RT-PCR method can be used as described above. However, the PCR conditions such as temperature, time, cycle number, and reverse transcription reaction conditions are determined by the target DNA. Alternatively, it is appropriately adjusted according to the base sequence, length, etc. of RNA or primer. Those skilled in the art can easily make such adjustments through preliminary experiments and the like. About the sense primer and antisense primer to be used, it is preferable to obtain an amplification product using the sense primer and the antisense primer in a molar ratio of 1: 4 to 100, and the sense primer and the antisense primer are 1: 4 to 50. More preferably, these are used in a molar ratio of 1:10.

  When the amplification product obtained using the sense primer and the antisense primer at a molar ratio of 1: 1 is used and the amplification product obtained using the molar ratio of 1:10 are compared, the former is compared. In the latter case, the target DNA or RNA can be more efficiently hybridized with the PNA probe, and the hybridized product can be detected more clearly.

  The PNA probe used in the present invention can be explained as follows. The PNA probe is not limited as long as it can detect the target DNA or RNA, may be completely complementary to the base sequence of the target DNA or RNA, may not be completely complementary, the base sequence and length of the probe, It can be determined appropriately according to hybridization conditions. Preferably, the PNA probe is completely complementary to the base sequence of at least a partial region of the target DNA or RNA (hereinafter also referred to as PNA probe 1), and has a one base mismatch with the region. (Hereinafter also referred to as PNA probe 2), more preferably PNA probe 1. Moreover, it is preferable that a probe serving as a negative control is further fixed to the PNA chip of the present invention. Here, the probe serving as a negative control means a probe that does not hybridize with the target DNA or RNA.

  In the present invention, the “PNA probe having a sequence that is completely complementary to the base sequence of the target DNA or RNA” refers to a probe that is completely complementary to at least a partial region of the target DNA or RNA. Alternatively, not only a probe that is completely complementary to a partial region of the entire base sequence of RNA but also a probe that is completely complementary to the entire base sequence of the target DNA or RNA. In the present invention, the “PNA probe having one base mismatched with the base sequence of the target DNA or RNA” is preferably the base of the “PNA probe having a sequence completely complementary to the base sequence of the target DNA or RNA”. This is a PNA probe having one base mismatched with the sequence.

  In addition, the PNA probe used in the present invention is not limited as long as it has a length sufficient to detect the target DNA or RNA, and preferably the PNA oligomer as the PNA probe is about 12 to 20 mer. Can do. The PNA probe can be labeled with various labeling agents such as biotin, and can be labeled with various fluorescent dyes such as Cy3 and Cy5. The PNA probe may be fixed on the chip, or may not be fixed on the chip.

  When a PNA probe fixed on a chip is used, that is, when a PNA chip is used, the PNA chip is synthesized on a substrate generally used as a chip material such as glass, plastic, or ceramic. It may be produced by attaching a probe, or may be produced by synthesizing a PNA probe on the substrate. A plurality of PNA probes can be fixed to the PNA chip as a matter of course, but it is preferable to fix a probe with a unified estimated Tm value. In this case, the PNA probe only needs to target any part of the target DNA or RNA or amplification product, and preferably targets the terminal part of the target DNA or RNA or amplification product. The plurality of PNA probes arranged on the PNA chip is not limited as long as it is a combination capable of detecting the target DNA or RNA in the specimen.

  For example, when it is desired to discriminate a difference of one base between the target DNA or RNA and another DNA or RNA, at least the PNA probe 1 and the PNA probe 2 are fixed to the chip. In this case, the PNA probe 1 and the target DNA or RNA can be efficiently hybridized, but the PNA probe 2 and the target DNA or RNA are appropriately adjusted to hybridization conditions that do not hybridize at all. By appropriately adjusting the conditions of (2), the target DNA or RNA can be specifically detected. For this reason, according to the method of the present invention, for example, SNPs can be determined, and various gene phenotypes of the same disease can be diagnosed.

  In another example, the PNA chip includes a PNA probe 1 that is completely complementary to the base sequence of at least a partial region of the target DNA or RNA, and a PNA probe 2 having a one base mismatch with the base sequence of the region. And a PNA probe having a mismatch of 2 bases with the region (hereinafter also referred to as PNA probe 3) can be immobilized together. In this case, the PNA probe 1 and the target DNA or RNA are efficiently hybridized by appropriately adjusting the hybridization conditions, that is, the conditions of the above steps (1) and (2), and the PNA probe 2 and the target It is possible to prevent hybridization with DNA or RNA as efficiently as the former, and to prevent hybridization with PNA probe 3 and target DNA or RNA at all. In this case, for example, in the washing process after hybridization, the problem of false positives can be cleared by controlling the washing so that a little fluorescence is left in the spot where the PNA probe 2 is fixed. That is, for example, in PNA probe 1, PNA probe 2, and PNA probe 3, if there is no difference in signal intensity such as fluorescence, a false positive reaction is determined. For example, when the signal intensity decreases in the order of PNA probe 1, PNA probe 2, and PNA probe 3, it is determined that the target DNA or RNA can be accurately detected.

  In any of the PNA chips described above, it is preferable to place a probe serving as a negative control. In addition, the conditions of the above steps (1) and (2) can be easily adjusted by a person skilled in the art through preliminary experiments according to the target DNA or RNA and the base sequence and length of the probe. .

  Furthermore, for example, the PNA probe 1 and the PNA probe 2 are arranged on the PNA chip, and the PNA probe serving as a negative control is arranged on the chip adjacent to or in close proximity in various arrangement forms such as columns, rows, and circles. Can do. A PNA probe having a different sequence can be arranged between these probes. The term “adjacent” means that a certain PNA probe may be adjacent to at least one other PNA probe. For example, it may be arranged in a row in the horizontal direction or in a row in the vertical direction. Is not to be done. Preferably, at least the PNA probe 1 and the PNA probe 2 are arranged next to each other, and more preferably, the PNA probe 1, the PNA probe 2, and the negative control probe are arranged in order in the vertical or horizontal direction. preferable.

  As described above, by arranging at least the PNA probe 1 and the PNA probe 2 adjacent to or close to each other on the chip, it becomes easier to compare the fluorescence intensities between the spots where the probes are arranged. That is, by arranging each probe in this way, the determination of the presence or absence of false positives becomes easier and more accurate. Accordingly, the present invention provides a false positive by arranging a PNA probe having at least a sequence completely complementary to the target DNA or RNA and a PNA probe having a mismatch of one base with the target DNA or RNA on the chip. It also provides a method for determining the presence or absence of a reaction.

  In the present invention, the PNA probe 3 having a mismatch of 2 bases with the target DNA or RNA is also preferably arranged adjacent to or close to the PNA probe 1, the PNA probe 2, the PNA probe serving as a negative control, and the like. A person skilled in the art may appropriately select which PNA probe is arranged in combination according to the purpose of research, the purpose of diagnosis, and the like.

Detection Kit of the Present Invention The detection kit of the present invention includes a hybridization solution containing DMSO and a washing solution containing a lower alcohol having 1 to 4 carbon atoms as described above. The hybridization solution and lower alcohol contained in the kit are as described above. In addition, hybridization conditions when using the kit, determination of the presence or absence of target DNA or RNA, and detection means can be performed in the same manner as described above.

  The target DNA or RNA in the sample in the present invention is also as described above, and an amplification product can be obtained in the same manner as described above. The PNA probe to be used is also as described above.

  In addition, the kit may further include a sense primer and an antisense primer used in a ratio of 1: 4 to 100. In this case, in order to make the kit of the present invention more convenient to use. The kit preferably contains a sense primer and an antisense primer in a ratio of 1: 4 to 100. Further, the present invention can further include a PNA chip, but the PNA chip can include those described above. In addition, the kit of the present invention can also include instructions describing a protocol for using the kit.

  From the above, according to the detection method and detection kit of the present invention, it is possible to determine the presence or absence of the target DNA or RNA efficiently in a short time. In addition, when a sample containing an amplification product obtained by using a sense primer and an antisense primer in a molar ratio of 1: 4 to 100 is used as a specimen, the target DNA or RNA can be detected more efficiently. Is possible. Furthermore, by using the PNA chip as described above, it becomes possible to detect the target DNA or RNA more easily without the need for competitive hybridization.

  For example, infections showing serious symptoms such as AIDS and SARS are difficult to treat. Therefore, establishment of an early detection system is required worldwide. Introduction of early diagnosis methods to medical institutions and bedsides is effective as a preventive method, but conventional diagnosis methods have problems such as "it takes time, is expensive, and is difficult to handle".

  Further, for example, in diagnosis of various viral diseases, diagnosis is often performed by detecting an antibody against a viral antigen (protein) suspected from clinical signs. However, the generation of virus-derived antigens requires several days after virus infection, and therefore there is a need to solve the time-related problem that cannot be connected to treatment unless the disease is onset.

  In recent years, a method of detecting viral RNA or DNA or RNA using a PCR method or a method of detecting using a hybridization method has been used as in other infectious diseases. However, for example, in the method using a DNA or RNA chip, it takes time and labor to obtain results as described above.

  In the present invention, an infectious disease that can be accurately diagnosed only by such an antigen-antibody reaction can be detected at an early stage and used for prevention or treatment, and a DNA or RNA chip is used. Diagnosis can be made more quickly, conveniently and accurately.

  Further, the present invention makes it possible to further develop the results of the genome structure analysis project, and to further effectively conduct research and development such as drug discovery research, disease diagnosis and prevention method development. It makes it possible.

2. Preparation method of target DNA or RNA to be hybridized with PNA probe and preparation kit In the preparation method of the present invention, an amplification product of target DNA or RNA is used in a ratio of 1: 4 to 100 using a sense primer and an antisense primer. It is obtained by performing PCR. In addition, the detection kit of the present invention includes a sense primer and an antisense primer used in a ratio of 1: 4 to 100.

  Here, the target DNA or RNA is as described above, and according to the preparation method and the adjustment kit of the present invention, the amplification product also has a molar ratio of the sense primer to the antisense primer of 1: 4 to 100. It can be obtained in the same manner as described above. Preferably, the molar ratio of the sense primer to the antisense primer is 1: 4 to 50, more preferably 1:10. In addition, the amplification product obtained by the preparation method and / or preparation kit can be hybridized with the PNA probe in the same manner as described above, and the presence or absence of the target DNA or RNA can be determined in the same manner as described above. Can do.

  In addition, the kit may further include a sense primer and an antisense primer used in a ratio of 1: 4 to 100. In this case, in order to make the kit of the present invention more convenient to use. The kit preferably contains a sense primer and an antisense primer in a ratio of 1: 4 to 100. Further, the present invention can further include a PNA chip, but the PNA chip can include those described above. The adjustment kit of the present invention can also contain instructions describing a protocol for using the kit.

  As described above, when an amplification product is obtained with the molar ratio of the sense primer to the antisense primer as described above, the target DNA or RNA that is the amplification product can be more efficiently hybridized with the PNA probe. It becomes possible.

3. PNA chip for detecting target DNA or RNA The PNA chip of the present invention has a PNA probe having a sequence completely complementary to the base sequence of the target DNA or RNA, one base mismatched with the base sequence of the target DNA or RNA. It is characterized in that it has at least a PNA probe having a PNA probe and a PNA probe serving as a negative control, and can be obtained in the same manner as described above except that the PNA probe is prepared so as to have this characteristic.

  The target DNA or RNA can be the same as described above, and the amplification product can be obtained in the same manner. Also when the PNA chip of the present invention is used, it can be hybridized with the PNA probe in the same manner as described above, and the presence or absence of the target DNA or RNA can be determined in the same manner as described above. Further, the PNA chip of the present invention can further include a PNA probe having two bases mismatched with the base sequence of the target DNA or RNA, as described above.

  Therefore, according to the PNA chip of the present invention, for example, SNPs can be determined as described above, and various gene phenotypes of the same disease can be diagnosed. Further, in the washing process after hybridization, for example, by controlling the washing so that a little fluorescence is emitted in a spot where a PNA probe having a one-base mismatch is arranged, the problem of false positive can be cleared.

  The above description is also applied to the arrangement of the probes in the PNA chip of the present invention. Therefore, when arranged in this way, it becomes easier to compare the fluorescence intensities between the spots as described above, and the determination of the presence or absence of false positives becomes easier and more accurate.

  Hereinafter, the contents of the present invention will be specifically described with reference to the following examples and comparative examples. However, the present invention is not limited to these.

(I) Design of PNA oligomer to be attached on the chip
Example 1: PNA chip 1
Nucleotide sequence data of the human hepatitis C virus (HCV) genome was obtained from the National Institutes of Health genome database, and the sequences of PCR primers and PNA probes were examined. Commercially available gene analysis software was used for primer sequence selection. The base sequence of the PCR primer is as follows.
5 ′ sense primer: GCAGAAAGCGTCTAGCCATGGGCGT (primer 1) (SEQ ID NO: 1)
3 'sense primer: ACTGCCTGATAGGGTGCTTGCGAG (primer 2) (SEQ ID NO: 2)
A PNA oligomer having a complementary sequence in the region amplified by this primer was selected as a PNA probe for detection, and a PNA oligomer was synthesized by a conventional method. The selected base sequence is as follows.
Spot 1 (PNA probe for detection having a sequence completely complementary to the base sequence of HCV): AAGCGTCTAGCCATG (probe 1) (SEQ ID NO: 3)
Spot 2 (HCV nucleotide sequence and detecting PNA probe having a mismatched two bases, underlined mismatch site): AAGC C TCTAG G CATG ( probe 2) ( SEQ ID NO: 4)
Spot 3 (detection PNA probe having a sequence completely complementary to the base sequence of HCV located upstream of 5 ′): CAGAAAGCGTCTAGCCA (probe 3) (SEQ ID NO: 5)
Spot 4 (PNA probe having a sequence completely complementary to the base sequence of HCV located on the 3 ′ downstream side): TGGCGGTTAGTATGAGTGTCGTGC (probe 4) (SEQ ID NO: 6)
Spot 5 (probe for detection of SARS coronavirus, used as negative control): AAATACAACTACTGC (probe 5) (SEQ ID NO: 7)
That is, as a PNA probe for detection, a PNA oligomer that can specifically detect HCV as a target, a PNA oligomer having a mismatch of 2 bases with the PNA oligomer, and a PNA oligomer that can specifically detect the HCV, 5 ′ end upstream A PNA chip (hereinafter referred to as PNA chip 1) in which a PNA oligomer located on the 3 ′ side of the PNA oligomer capable of specifically detecting the HCV and a PNA probe serving as a negative control are arranged in order. Created. The specifications of the PNA chip 1 are shown in FIG. The spots 1 to 5 correspond to circles 1 to 5 in FIG.

The hybridization solution is 1 × SSPE (1 × SSPE = 150 mM NaCl, 10 mM NaH ₂ PO ₄ .H ₂ O, 1 mM EDTA, pH 7.4 containing 1% SDS (Sodium Dodecyl Sulfate, SDS) and 20% DMSO (dimethyl sulfoxide). ) Was used. The PNA chip is fixed in a hybridization chamber and preheated to 50 ° C. Next, 4 μl of the RT-PCR amplification product prepared by targeting a part of the sequence of HCV is mixed with 16 μl of the hybridization solution, and carefully placed on this PNA chip and placed in a thermostat dedicated to hybridization at 50 ° C. I put it and warmed it. The heating time was 60 minutes. The PNA chip 1 after hybridization was washed for 5 minutes after removing the hybridization cover in EtOH, and then left in 1 × SSPE containing 0.1% SDS for 1 minute. Microarray analysis was performed using a GeneTAC LSIV apparatus (manufactured by Genomic Solution).

  As a result, fluorescent emission was observed not only at spot 1 but also at spots 3 and 4, but no fluorescent emission was observed at spots 2 and 5. The results are shown in FIG. From this, it was found that the target gene can be recognized not only by a probe having a sequence completely complementary to the base sequence of the target gene, but also by a probe having a sequence on the upstream side and a probe having a sequence on the downstream side. . It was also found that a probe having a mismatch of 2 nucleotides with the nucleotide sequence of the target gene does not recognize the target gene under the experimental conditions.

Example 2: PNA chip 2
As a result of functional evaluation using the PNA chip 1 prepared in Example 1, “unification of estimated Tm value at the time of hybridization formation of the designed PNA oligomer with a complementary DNA oligomer”, “PCR amplification product Targeting the terminal portion ”,“ Naturally, it is expected that the PNA probe having a single-base mismatch can be prevented from hybridizing by appropriately adjusting the hybridization conditions. The points to be improved, such as the adoption of not only oligomers but also single-base mismatched PNA oligomers, are highlighted.

Therefore, a PNA oligomer having a complementary sequence in the primer region selected in Example 1 was selected as a detection PNA probe, and a PNA oligomer was synthesized by a conventional method. The selected base sequence is as follows.
Spot 1 (detection PNA probe having a sequence completely complementary to the base sequence of HCV, designed so that the Tm value is around 55 ° C.): CAGAAAGCGTCTAGCCA (probe 6) (SEQ ID NO: 8)
Spot 2 (detection PNA probe having a mismatched base sequences and one base HCV, underlined mismatch site): CAGAAAG G GTCTAGCCA (probe 7 ) ( SEQ ID NO: 9)
Spot 3 (PNA probe for detection having a mismatch of 2 nucleotides with the base sequence of HCV, the underlined portion is a mismatch site): CA C AAAGCGTCTA C CCA (probe 8) (SEQ ID NO: 10)
Spot 4 (PNA probe for detection having a sequence completely complementary to the base sequence of HCV located on the 5 ′ upstream side for 16 bases): ATGGCGTTTAGTATGAGGT (probe 9) (SEQ ID NO: 11)
Spot 5 (used as a negative control): ACTGACTGACTGACTACTACT (probe 10) (SEQ ID NO: 12)
That is, as a PNA probe for detection, a PNA oligomer capable of specifically detecting the target HCV, a PNA oligomer having a one base mismatch with the PNA oligomer, and a PNA oligomer capable of specifically detecting the HCV with a two base mismatch PNA oligomer having a PNA oligomer positioned in the 5 'end upstream of 16 bases of the sequence of the PNA oligomer capable of specifically detecting the HCV, and a PNA probe serving as a negative control in this order (hereinafter referred to as PNA chip) Chip 2) was created. The specifications of the PNA chip 2 are shown in FIG. The spots 1 to 5 correspond to circles 1 to 5 in FIG.

  Similarly to Example 1, the fluorescence brightness of each spot was measured. The PNA chip 2 after hybridization was washed for 5 minutes after removing the hybridization cover in EtOH, and then left for 1 minute in 1 × SSPE containing 0.1% SDS for 1 minute. The case of stirring and the case of stirring for 3 minutes were compared.

  As a result, when left standing in 1 × SSPE containing 0.1% SDS for 1 minute, fluorescence was observed not only at spot 1 but also at spot 2 and spot 4 (FIG. 4). In addition, it was observed that the fluorescent emission intensity gradually decreased in spot 2 and spot 3 as compared with spot 1.

  In addition, when stirring for 1 minute in 1 × SSPE containing 0.1% SDS and stirring for 3 minutes, fluorescence emission is not observed in spots 2 and 3 to which a PNA probe having a mismatch of HCV base sequence and 1 base is fixed. Little was observed.

(Ii) Examination of PCR conditions
Example 3: Examination of PCR conditions 1
HCV-infected blood was used as a sample. PCR was performed according to the kit manufacturer's manual. First, RNA fraction was purified from 140 μl of serum using Rneasy Mini Kit (manufactured by QIAGEN). Next, 20 μl of RT-PCR amplification product was obtained from 10 μl of the RNA solution using Sensiscript RT Kit (manufactured by QIAGEN). As incubation conditions, reverse transcription reaction was performed at 37 ° C. for 60 minutes, and the reaction was stopped at 93 ° C. for 5 minutes. A primer pair (DNA oligonucleotide equivalent to the primer in the AmpliCore Kit of Roche Co., Ltd.) was prepared to amplify the core region of HCV. A 5 'terminal sense primer (HCV001) (SEQ ID NO: 13) and a 3' terminal antisense primer labeled with the fluorescent dye Cy5 (HCV002) (SEQ ID NO: 14) (SEQ ID NO: 14) were used (Table 1). ). The molar ratio of HCV001 and HCV002 was adjusted to 1:10. 5 μl of the RT-PCR amplification product was made 100 μl with a PCR mix and amplified 40 times using Gene Amp PCR System 9600-R (Perkin Elmer). As PCR amplification conditions, 94 ° C for 3 minutes, 66 ° C for 1 minute, 72 ° C for 1 minute for 1 cycle, 94 ° C for 30 seconds, 66 ° C for 30 seconds, 72 ° C for 1 minute for 38 cycles, 94 A cycle of 30 ° C. for 30 seconds, 66 ° C. for 30 seconds and 72 ° C. for 5 minutes was employed. This condition followed the protocol of Roche Corporation.

  The state of the PT-PCR amplification product was confirmed by a standard electrophoresis method. That is, the gel after electrophoresis was immersed in 1 μg / ml ethidium bromide solution for 15 minutes, and then washed in distilled water for 20 minutes for staining. A band colored by ultraviolet irradiation was observed by photographing with a digital camera. As a result, it was found that there were no bands having different lengths and only bands having the target molecular weight.

  A hybridization experiment using the PNA chip 2 was performed using the obtained PCR amplification product. As a result, fluorescent emission was observed at spot 1, spot 2 and spot 4, and fluorescent emission was observed at spot 2 with lower brightness than spots 1 and 4. Further, fluorescence emission was not observed at the spots 3 and 5. From this, it was found that when an amplification product prepared with a molar ratio of the sense primer to the antisense primer of 1:10 was used as a sample, the target gene could be detected satisfactorily using the PNA probe.

Comparative Example 1: Examination of PCR conditions 2
The ratio of the 5 ′ terminal sense primer (HCV001) described in Example 3 to the 3 ′ terminal antisense primer labeled with the fluorescent dye Cy5 (HCV002) is 1: 1. After adjustment, PT-PCR was performed according to the conditions of Example 3. As a result, it was found that there were no bands having different lengths and only bands having the target molecular weight.

  A hybridization experiment using the PNA chip 2 was carried out using this PT-PCR amplification product, but a clear spot could not be observed as efficiently as in Example 3. This suggests that most of the PT-PCR amplification products with the primer ratio of 1: 1 are forming a double strand, and thus hybridization with PNA hardly occurs in both sections.

(Iii) Examination of hybridization conditions
Example 4: Examination of hybridization solution 1
As the hybridization solution, 5 × SSPE containing 1% SDS and 20% DMSO was used. The PNA chip 2 was fixed in a hybridization chamber and preheated to 50 ° C. Next, 4 μl of the RT-PCR amplification product prepared in accordance with Example 3 was mixed with 36 μl hybridization solution, carefully placed on the PNA chip 2 and placed in a thermostat dedicated to hybridization at 50 ° C. Warm up. The heating time was 60 minutes. After washing, the PNA chip 2 was washed by removing the hybridization cover in EtOH for 5 minutes and then in 1 × SSPE containing 0.1% SDS for 1 minute or 5 minutes. As a result, a clear spot could be confirmed under any condition (FIG. 5). In addition, a clear spot could be confirmed when stirring and washing were performed in 1 × SSPE containing 0.1% SDS for 1 minute or 5 minutes (FIG. 5).

Comparative Example 2: Examination of hybridization solution 2
As the hybridization solution, 5 × SSPE containing 1% SDS and 20% DMF (dimethylformamide) was used. However, when DMF was added, the hybridization solution became cloudy. The amount of DMF was varied from 10% to 50% but remained cloudy. Although hybridization was continued as it was and microarray analysis was performed, no spots were confirmed.

Comparative Example 3: Examination of hybridization solution 3
As the hybridization solution, 5 × SSPE containing 1% SDS and 20% NMP (N-methylpyroridon) was used. However, when NMP was added, the hybridization solution became cloudy. The amount of NMP was varied from 10% to 50% but remained cloudy. Although hybridization was continued as it was and microarray analysis was performed, no spots were confirmed.

Comparative Example 4: Examination of hybridization solution 4
As the hybridization solution, 5 × SSPE containing 1% SDS and 50% formaldehyde was used. The PNA chip 1 was fixed in a hybridization chamber and preheated to 50 ° C. Next, 4 μl of the prepared RT-PCR amplification product was mixed with 36 μl of the hybridization solution, carefully placed on the PNA chip 1 and placed in a 50 ° C. constant temperature incubator for warming. The heating time was 60 minutes. Washing of PNA chip 1 after hybridization is performed by simply removing the hybridization cover in 1xSSPE containing 0.1% SDS, and stirring and washing in 1xSSPE containing 0.1% SDS for 5 or 10 minutes. The cleaning method and the time were examined using those subjected to the above.

  As a result, in any case, the fluorescence emission could not be confirmed in the spot 1, and the fluorescence emission was confirmed only in the upstream spot 3 (FIG. 6). In addition, it was observed that the fluorescent emission of the spot became thinner and the PT-PCR amplification product was peeled off by washing (FIG. 6). From this, it was found that this hybridization solution is inappropriate.

Example 5: Examination 1 of cleaning liquid
As the hybridization solution, 5 × SSPE containing 1% SDS and 20% DMSO was used. The PNA chip 2 was fixed in a hybridization chamber and preheated to 36 ° C. or 50 ° C. Next, 4 μl of the RT-PCR amplification product prepared in accordance with Example 3 is mixed with 36 μl hybridization solution, carefully placed on this PNA chip, and placed in a constant temperature thermostat dedicated to hybridization at 36 ° C. or 50 ° C. And warmed up. The heating time was 5, 15, 30, and 60 minutes. After the hybridization, the PNA chip was washed by leaving the hybridization cover in EtOH for 5 minutes and then in 1 × SSPE containing 0.1% SDS for 1 minute. In addition, some samples were further washed by stirring in 1 × SSPE containing 0.1% SDS for 3 or 5 minutes.

  As a result, when washed by stirring for 5 minutes, the fluorescence emission intensity was stronger when the hybridization temperature was 50 ° C. than when it was 36 ° C. (FIGS. 7 and 8). The hybridization was expected to have a greater amount of PT-PCR amplification product than expected. That is, this indicates that the spot fluorescence emission intensity at 36 ° C. is remarkably reduced when washing is carried out for 5 minutes with a hybridization time of 30 minutes, whereas the tendency is less at 50 ° C. It was possible to guess from the fact that the target was well recognized. Therefore, it was proved that the hybrid temperature is more effective at 50 ° C than at 36 ° C. In addition, the fluorescence intensity increased as the hybridization time was increased from 5 minutes to 60 minutes. However, even when the hybridization time was 5 minutes, a good result could be obtained when the hybridization temperature was 50 ° C. and washing was performed by standing or stirring for 1 minute.

Example 6
As the hybridization solution, 5 × SSPE containing 1% SDS and 20% DMSO was used. The PNA chip 2 was fixed in a hybridization chamber and preheated to 50 ° C. Next, 4 μl of the RT-PCR amplification product prepared according to Example 3 was mixed with 36 μl hybridization solution, placed carefully on this PNA chip, and placed in a 50 ° C. dedicated thermostat for warming. did. The heating time was 60 minutes. After the hybridization, the PNA chip was washed by leaving the hybridization cover in EtOH for 5 minutes and then in 1 × SSPE containing 0.1% SDS for 1 minute. In addition, some samples were further stirred and washed in 1 × SSPE containing 0.1% SDS for 3 or 6 minutes, and the washing method and time were examined.

  As a result, in both cases of stirring and washing for 3 or 6 minutes, the fluorescence emission of the spots 1 and 4 could be clearly confirmed. The results are shown in FIG. However, in the case of stirring and washing for 3 minutes, it was found that the fluorescence emission at spot 2 was observed, whereas in the case of 6 minutes, the fluorescence emission at spot 2 was almost extinguished. This does not indicate that the 6 minute stirring cleaning is inappropriate, but even if the stirring cleaning is stopped immediately before the spot 2 disappears, it does not affect the fluorescence emission of the spots 1 and 4. This shows that the cleaning method can be controlled by the presence or absence of fluorescence emission at the spot 2.

Comparative Example 5
As the hybridization solution, 5 × SSPE containing 1% SDS and 25% DMSO was used. The PNA chip 1 was fixed in a hybridization chamber and preheated to 50 ° C. Next, 4 μl of the RT-PCR amplification product prepared according to Example 3 was mixed with 36 μl hybridization solution, placed carefully on the PNA chip 1 and placed in a thermostat dedicated to hybridization at 50 ° C. Warm up. The heating time was 60 minutes. The PNA chip 1 was washed after hybridization in a 70% aqueous isopropanol solution after removing the hybridization cover and allowed to stand for 5 minutes. In some cases, stirring and washing were performed in a 1 × SSPE solution containing 0.1% SDS for 5 to 10 minutes, and the washing method and time were examined.

  As a result, it was found that the surface of the chip was not removed regardless of the contents of cleaning, and the use of isopropanol was inappropriate (FIG. 10).

Comparative Example 6
As the hybridization solution, 5 × SSPE containing 1% SDS and 10% DMSO was used. The PNA chip 1 was fixed in a hybridization chamber and preheated to 50 ° C. Next, 4 μl of the RT-PCR amplification product prepared according to Example 3 was mixed with 36 μl hybridization solution, placed carefully on the PNA chip 1 and placed in a thermostat dedicated to hybridization at 50 ° C. Warm up. The heating time was 120 minutes. The PNA chip 1 after hybridization was washed for 5 minutes after removing the hybridization cover in a 5 × SSPE solution containing 10% DMSO. In some cases, the washing method and time were investigated by stirring and washing in a 5 × SSPE solution containing 10% DMSO for 5 minutes.

  As a result, although it was possible to detect the fluorescence emission of the spot, it was found that the fluorescence intensity of the spot 2 and the spot 3 is stronger than that of the spot 1 and is inappropriate for determination. In addition, regardless of the difference in the cleaning conditions, the spot fluorescence intensity varied even under the same cleaning conditions. In addition, it is difficult to clearly confirm the spot after the 10-minute cleaning, and the influence of the subtle difference with the 5-minute cleaning on the spot intensity becomes so clear that the operability is strict. Was found to be required.

(Iv) Detection of target gene using DNA chip (Comparative Example 7)
When the experiment was started under the conditions of hybridization using a conventional DNA microarray, it was found that hybridization was observed in 2 hours. However, from further examination of washing conditions, it was considered that the binding force was stronger when the reaction was performed with a hybridization solution at a lower salt concentration. Furthermore, when the SDS concentration in the hybridization solution was changed from 0.01% to 1.0%, it was confirmed that the influence was small. However, when SDS was not added, it was confirmed that the background was contaminated, so 1% SDS was used as a hybridization solution as before.

(V) Comparison of PNA chip and DNA chip of the present invention (Example 7)
A detection DNA probe corresponding to the detection PNA probe shown below was synthesized to produce a PNA chip 3 attached on the same chip substrate (FIG. 11). The selected base sequence is as follows.
Spot 1 (PNA probe for detection having a sequence completely complementary to the base sequence of HCV): TCGCAAGCACCCTATCA (probe 11) (SEQ ID NO: 15)
Spot 2 (detection PNA probe having a mismatch of 1 base near the base sequence of HCV, the underlined portion is a mismatch site): TCGCAAG G ACCCTATCA (probe 12) (SEQ ID NO: 16)
Spot 3 (detecting PNA probe having a one base mismatch in the nucleotide sequence and the terminal of the HCV, underlined mismatch site): TCGCAAGCACCCTAT G A (probe 13 ) ( SEQ ID NO: 17)
Spot 4 (detection PNA probe located on the 5 ′ upstream side for 16 bases and having a sequence completely complementary to the base sequence of HCV): CCTATCAGGCAGTACCA (probe 14) (SEQ ID NO: 18)
Spot 5 (used as a negative control): ACTGACTGACACTACTACTACT (probe 15) (SEQ ID NO: 19)
Spot 6: TCGCAAGCACCCTCATA (probe 16) (SEQ ID NO: 20)
Spot 7 (DNA probe having a mismatch of one base near the base sequence of the probe arranged as spot 6 and the underlined portion is a mismatch site): TCGCAAG G ACCCTATCA (probe 17) (SEQ ID NO: 21)
Spot 8 (DNA probe having a one base mismatch in base sequence end of the probe arranged as a spot 6, underlined mismatch site): TCGCAAGCACCCTAT G A (probe 18 ) ( SEQ ID NO: 22)
Spot 9 (DNA probe having a sequence that is completely complementary to the base sequence of the probe arranged as spot 6 and located 5 ′ upstream of 16 bases): CCTATCAGGCAGTACCA (probe 19) (SEQ ID NO: 23)
Spot 10 (used as a negative control): ACTGACTGACACTACTACTACT (probe 20) (SEQ ID NO: 24)
The specifications of the PNA chip 3 are shown in FIG. The spots 1 to 10 correspond to circles 1 to 10 in FIG. Each PNA probe was arranged in duplicate.

  As the hybridization solution, 5 × SSPE containing 1% SDS and 20% DMSO was used. The PNA chip 3 was fixed in a hybridization chamber and preheated to 50 ° C. Next, 4 μl of the RT-PCR amplification product prepared according to Example 3 was mixed with 36 μl hybridization solution, placed carefully on this PNA chip, and placed in a 50 ° C. dedicated thermostat for warming. did. The heating time was 5 to 60 minutes. After washing, the PNA chip was washed by removing the hybridization cover in EtOH for 1 minute, then in 1 × SSPE containing 0.1% SDS for 1 minute, and further for 3 minutes in 0.1 × 0.1%. Agitation washing was performed in 1 × SSPE containing% SDS.

  The result is shown in FIG. A better fluorescence emission result was obtained with the spot where the PNA probe was placed than with the spot where the DNA probe was placed. From this, it was found that the PNA probe has a higher hybrid ability than the DNA probe. The tendency was similar when the hybridization time was changed.

(Vi) Examination of PNA probe length (Example 8)
In order to investigate the influence of the length of the detection PNA probe shown below upon hybridization, a 17-mer PNA probe (corresponding to spots 1 to 5) with a Tm value of around 55 degrees and a Tm value of around 35 degrees A 12-mer PNA probe (corresponding to spots 6 to 10) was synthesized to produce a PNA chip 4 attached on the same chip substrate (FIG. 13). The selected base sequence is as follows.
Spot 1: CAGAAAGCGTCTAGCCA (probe 21) (SEQ ID NO: 25)
Spot 2 (detection PNA probe having a mismatch of 1 base near the base sequence of the probe arranged as spot 1, the underlined portion is a mismatch site): CAGAAAG G GTCTAGCCA (probe 22) (SEQ ID NO: 26)
Spot 3 (detection PNA probe having a mismatch of 2 nucleotides at the end with the base sequence of the probe arranged as spot 1, the underlined portion is a mismatch site): CA C AAAGCGTCTA C CCA (probe 23) (SEQ ID NO: 27)
Spot 4 (PNA probe for detection having a sequence completely complementary to the base sequence of the probe arranged as spot 1 located on the 5 ′ upstream side for 16 bases): ATGGCGGTTAGTATGAGGTGT (probe 24) (SEQ ID NO: 28)
Spot 5 (used as a negative control): ACTGACTGACACTACTACTACT (probe 25) (SEQ ID NO: 29)
Spot 6: CAGAAAGCGTCT (probe 26) (SEQ ID NO: 30)
Spot 7 (base sequence of probe arranged as spot 6 and PNA probe having a mismatch of 1 base near the center, underlined portion is mismatch site): CAGAA T GCGTCT (probe 27) (SEQ ID NO: 31)
Spot 8 (PNA probe having a mismatch of 2 nucleotides at the end with the base sequence of the probe arranged as spot 6, the underlined portion is a mismatch site): CAG T AAGC C TCT (probe 28) (SEQ ID NO: 32)
Spot 9 (PNA probe having a sequence that is completely complementary to the base sequence of the probe arranged as spot 6 and located at the 5 ′ upstream side for 16 bases): GTTAGTATGAGTG (probe 29) (SEQ ID NO: 33)
Spot 10 (used as a negative control): ACTGACTGACACTACTACTACT (probe 30) (SEQ ID NO: 34)
The specifications of the PNA chip 4 are shown in FIG. The spots 1 to 10 correspond to circles 1 to 10 in FIG. Each PNA probe was arranged in duplicate.

  As the hybridization solution, 5 × SSPE containing 1% SDS and 20% DMSO was used. The PNA chip was fixed in a hybridization chamber and preheated to 50 ° C. Next, 4 μl of the RT-PCR amplification product prepared according to Example 3 was mixed with 36 μl hybridization solution, placed carefully on this PNA chip, and placed in a 50 ° C. dedicated thermostat for warming. did. The heating time was 60 minutes. After the hybridization, the PNA chip was washed by leaving the hybridization cover in EtOH for 5 minutes and then in 1 × SSPE containing 0.1% SDS for 1 minute. Some samples were further stirred and washed in 1 × SSPE containing 0.1% SDS for 3 minutes.

  The result is shown in FIG. When the length of the PNA probe was 17 mer and 12 mer, the brightness of each spot was different depending on the length of the probe, but the target gene could be detected in either case.

FIG. 1 shows the specifications of the PNA chip 1. FIG. 2 shows the result of hybridization using the PNA chip 1. FIG. 3 shows the specifications of the PNA chip 2. FIG. 4 shows the result of hybridization using the PNA chip 2. FIG. 5 shows the results of hybridization using a hybridization solution containing 20 wt% DMSO. FIG. 6 shows the results of hybridization using a hybridization solution containing 50% by weight formaldehyde. FIG. 7 shows the results of hybridization performed at 50 ° C. FIG. 8 shows the result of hybridization performed at 36 ° C. FIG. 9 shows the examination results of the washing conditions using 1 × SSPE containing 0.1% SDS. FIG. 10 shows the hybridization results using 70% by weight of isopropanol as the washing solution. FIG. 11 shows the specifications of the PNA chip 3. FIG. 12 shows a comparison result between the PNA chip and the DNA chip. FIG. 13 shows the specifications of the PNA chip 4. FIG. 14 shows the examination result of the length of the PNA probe in the PNA chip.

SEQ ID NO: 1 shows the base sequence of primer 1.
SEQ ID NO: 2 shows the nucleotide sequence of primer 2.
SEQ ID NO: 3 shows the base sequence of probe 1.
SEQ ID NO: 4 shows the base sequence of probe 2.
SEQ ID NO: 5 shows the base sequence of probe 3.
SEQ ID NO: 6 shows the base sequence of probe 4.
SEQ ID NO: 7 shows the base sequence of probe 5.
SEQ ID NO: 8 shows the base sequence of probe 6.
SEQ ID NO: 9 shows the base sequence of probe 7.
SEQ ID NO: 10 shows the base sequence of probe 8.
SEQ ID NO: 11 shows the base sequence of probe 9.
SEQ ID NO: 12 shows the base sequence of probe 10.
SEQ ID NO: 13 shows the nucleotide sequence of HCV001 primer.
SEQ ID NO: 14 shows the nucleotide sequence of HCV001 primer.
SEQ ID NO: 15 shows the base sequence of probe 11.
SEQ ID NO: 16 shows the nucleotide sequence of probe 12.
SEQ ID NO: 17 shows the nucleotide sequence of probe 13.
SEQ ID NO: 18 shows the base sequence of probe 14.
SEQ ID NO: 19 shows the nucleotide sequence of probe 15.
SEQ ID NO: 20 shows the base sequence of probe 16.
SEQ ID NO: 21 is the base sequence of probe 17.
SEQ ID NO: 22 shows the base sequence of probe 18.
SEQ ID NO: 23 is the base sequence of probe 19.
SEQ ID NO: 24 is the base sequence of probe 20.
SEQ ID NO: 25 is the base sequence of probe 21.
SEQ ID NO: 26 is the base sequence of probe 22.
SEQ ID NO: 27 is the base sequence of probe 23.
SEQ ID NO: 28 is the base sequence of probe 24.
SEQ ID NO: 29 shows the nucleotide sequence of probe 25.
SEQ ID NO: 30 shows the nucleotide sequence of probe 26.
SEQ ID NO: 31 is the base sequence of probe 27.
SEQ ID NO: 32 shows the nucleotide sequence of probe 28.
SEQ ID NO: 33 is the base sequence of probe 29.
SEQ ID NO: 34 is the base sequence of probe 30.

Claims (13)

A method for detecting a target DNA or RNA in a specimen using a PNA probe, comprising the following steps:
(1) Incubating a target DNA or RNA in a sample in a hybridization solution containing DMSO and a PNA probe capable of hybridizing with the target DNA or RNA under conditions that allow hybridization;
(2) a step of washing the product of the step (1) with a washing solution containing a lower alcohol having 1 to 4 carbon atoms, and (3) a hybridized product of the PNA probe and the target DNA or RNA after the step (2). Detecting the presence or absence of
The detection method characterized by including. The detection method according to claim 1, wherein the concentration of DMSO in the hybridization solution is about 5 to 60% by weight. The detection method according to claim 1, wherein the concentration of the lower alcohol having 1 to 4 carbon atoms in the cleaning solution is 50 to 100% by weight. The detection method according to claim 1, wherein the target DNA or RNA is an amplification product obtained using a sense primer and an antisense primer in a ratio of 1: 4 to 100. The detection method according to claim 1, wherein the target DNA or RNA is detected using a PNA chip in which the PNA probe is arranged on the chip. The PNA chip has at least a PNA probe having a sequence completely complementary to the base sequence of the target DNA or RNA, a PNA probe having one base mismatched with the base sequence of the target DNA or RNA, and a PNA probe serving as a negative control The detection method according to claim 5, comprising: A kit for detecting DNA or RNA of interest in a sample using a PNA probe, comprising:
(I) a hybridization solution containing DMSO, and (ii) a washing solution containing a lower alcohol having 1 to 4 carbon atoms,
A kit comprising: The kit according to claim 7, further comprising a sense primer and an antisense primer used in a ratio of 1: 4 to 100. The kit according to claim 7, further comprising a PNA chip disposed on the chip. A method for preparing a target DNA or RNA to be hybridized with a PNA probe, wherein the target DNA or RNA is obtained by performing PCR using a sense primer and an antisense primer in a ratio of 1: 4 to 100. The preparation method. A kit for preparing a target DNA or RNA to be hybridized with a PNA probe, comprising a sense primer and an antisense primer used in a ratio of 1: 4 to 100. A PNA chip for detecting target DNA or RNA, having at least one PNA probe having a sequence completely complementary to the base sequence of the target DNA or RNA and one base mismatched with the base sequence of the target DNA or RNA A PNA chip comprising a PNA probe and a PNA probe serving as a negative control. The PNA probe having a sequence completely complementary to the base sequence of the target DNA or RNA, the PNA probe having one base mismatched with the base sequence of the target DNA or RNA, and the PNA probe serving as the negative control are adjacent to each other. The PNA chip according to claim 12, wherein the PNA chip is arranged.

Images