JP2003189859A - Gene chip - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To solve a problem that a means with which the typing of HLA gene polymorphism is readily and simply carried out based on its base sequence is provided. <P>SOLUTION: A chip for separating HLA gene polymorphism comprises making the polymorphism of base sequence of domain of the following HLA DRB1 (β1) gene into a gene chip. (1) Base sequence 111-134 or a sequence approximately homologous the sequence, (2) base sequence 162-185 or a sequence approximately homologous to the sequence, (3) base sequence 186-209 or a sequence approximately homologous to the sequence, (4) base sequence 219-242 or a sequence approximately homologous to the sequence, (5) base sequence 249-272 or a sequence approximately homologous to the sequence, (6) base sequence 282-305 or a sequence approximately homologous to the sequence, (7) base sequence 303-326 or a sequence approximately homologous to the sequence, (8) base sequence 333-356 or a sequence approximately homologous to the sequence and (9) a specific sequence derived from HLA gene or a base sequence of a derived material thereof. <P>COPYRIGHT: (C)2003,JPO

Description

Detailed Description of the Invention

[0001]

The present invention relates to a gene chip, especially HLA.
The present invention relates to a gene chip used for means for selecting / determining gene polymorphism.

[0002]

2. Description of the Related Art It is said that when a phenotype controlled by one locus has a plurality of phenotypes and these phenotypes are in a genetic equilibrium within a population, the trait is polymorphic. Each type is called an allele. The polymorphism is caused not only by phenotypic traits, that is, by the difference in the amino acid sequences constituting proteins, but also by the absence of changes in the amino acid sequence.
It also exists at the level of the NA base sequence, and in many cases, it is detected as a difference in the DNA cleavage site by the restriction enzyme.

The HLA molecule, which is a human MHC (major histocompatibility complex) molecule, was found in 1952 as an antigen against an antibody that reacts in a hemagglutination test in a blood serum of a transfused patient. The HLA molecule is a gene product governed by a group of genes encoded by the MHC region existing within about 4000 kbp of 6p21.3 of the short arm of chromosome 6. This MHC region is HLA-A, B, C, which is expressed on the surface of most eukaryotic cell membranes, and class I which controls the antigen system.
Class II that controls gene regions and cell-specific HLA-DP, DQ, DR antigen systems expressed only in limited tissues or cells such as B cells and macrophages
It is composed of a gene region and a class III gene region that controls complement components and 21-hydroxylase.

Class II molecules are cell membrane antigens in which a 34 kDa glycoprotein (α chain) and a 29 kDa glycoprotein (β chain) are non-covalently bound. The α chain gene forms 7 clusters and the β chain gene forms 9 to 12 clusters (16 species) to form a multigene family. In the class II gene region, DP-DN-DM-DO-D from the centromere side
Each gene is located in the order of Q-DR. HLA-DP, D
The Q and DR antigens consist of many alloantigen types, and their polymorphism is mainly determined by the difference in the amino acid sequence of β chain (B1). The DR and DQ antigens are epitopes recognized by antibodies produced by B cells.

Each HLA molecule is composed of a domain structure in which about 90 amino acids are grouped together. Class II molecules are α1 (β1), α2 (β2)
It consists of domains, binding peptides (CP), TM, and CY regions. The α1 and β1 domains form the polymorphic site, and the α2 and β2 domains form the base of class II molecules.

Genetic polymorphisms in HLA molecules are formed by differences in the amino acid sequences encoded by the corresponding HLA genes. This is a reflection of the difference in the base sequence of each gene DNA, and the base sequences of almost all alloantigen types have been determined so far (Tissue Antigens, 4
5, 258-280, 1995). Regions showing polymorphism are class I
In the molecule, it concentrates on α1 and α2 domains, and α1 domain C
One common hypervariable region exists on each of the end side and the α2 domain N end side. In class II molecules, the hypervariable region exists in the α1 domain of the DQα chain and the β1 domain of the DRβ, DQβ, and DPβ chains, and polymorphisms are concentrated in three specific regions of each domain (Proc. Natl. Acad.Sci. USA, 84,
6234-6238, 1987). Substitution of amino acid residues in these hypervariable regions or differences in alloantigen types directly affect the affinity of HLA molecules for antigen peptides,
Not only does it change the type of antigen peptide that can bind to a particular HLA molecule, but it also affects the affinity for TCR,
As a result, it also changes the antigen presenting ability. And HLA
There is a difference in the ability of immune response to foreign antigens and self-antigens between individuals having different antigen types, which causes individual differences in immune response.

[0007] HLA polymorphisms can be easily detected by the progress of gene DNA analysis technology, and have become established as an essential clinical test in organ transplantation as HLA typing.

[0008]

The problem to be solved by the present invention is to provide a means for easily and simply typing HLA gene polymorphisms based on their nucleotide sequences.

[0009]

The present invention has completed the present invention by introducing a new means for sequence analysis in typing HLA gene polymorphisms. That is, the present invention is: HLA gene polymorphism selection chip characterized by making a polymorphism in the nucleotide sequence of the DRB1 (β1) gene of HLA below into a gene chip; 1) nucleotide sequences 111 to 134 or an abbreviation for this sequence Homologous sequence, 2) Base sequence 162 to 185 or a substantially homologous sequence of this sequence, 3) Base sequence 186 to 209 or a substantially homologous sequence of this sequence, 4) Base sequence 219 to 242 or this sequence Substantially homologous sequence, 5) Base sequences 249 to 272 or almost homologous sequence of this sequence, 6) Base sequences 282 to 305 or almost homologous sequence of this sequence, 7) Base sequences 303 to 326 or this sequence 8) Nucleotide sequence 333 to 356 or a substantially homologous sequence of this sequence. 2. Selection of HLA gene polymorphisms using the chip described in 1 above
Judgment method. 3. 3. HLA gene polymorphism measuring means including the chip of the preceding item 1. A probe used for genotyping an HLA-DR antigen selected from the following group; a polynucleotide comprising the sequence set forth in any one of SEQ ID NOs: 2 to 9 in the sequence listing or a complementary strand base sequence thereof, the polynucleotide or the sequence thereof A polynucleotide or a complementary chain base sequence thereof that hybridizes with a complementary chain base sequence under stringent conditions, a polynucleotide consisting of the sequence described in any one of SEQ ID NOs: 2 to 9 in the sequence listing or a complementary chain base sequence thereof A polynucleotide containing at least 15 consecutive base sequences, a polynucleotide consisting of the sequence set forth in any one of SEQ ID NOs: 2 to 9 in the sequence listing, or at least about 50% sequence homology with the complementary strand base sequence thereof A polynucleotide having: 5. HLA-DR antigen genotyping method selected from the following group; SEQ ID NO: 2 in the sequence listing of the preceding clause 4 or DRB1 * 01 typing method using a polynucleotide derived therefrom; SEQ ID NO: 3 in the sequence listing of the contract term 4 Alternatively, a method for typing DRB1 * 03, DRB1 * 11, DRB1 * 13, or DRB1 * 14 using a polynucleotide derived therefrom, SEQ ID NO: 4 in the sequence listing of the preceding 4 or DRB1 * 04 using a polynucleotide derived therefrom DRB1 * 07 using the SEQ ID NO: 5 in the sequence listing of the preceding clause 4 or the polynucleotide derived therefrom, DRB1 * 08 utilizing the SEQ ID NO: 6 in the sequence listing of the preceding clause 4 or the polynucleotide derived therefrom Alternatively, a method for typing DRB1 * 12, a method for typing DRB1 * 09 using the polynucleotide of SEQ ID NO: 7 of the Sequence Listing of SEQ. Typing methods of DRB1 * 10 utilizing the re nucleotides, DRB1 * 15 or DRB1 * 16 typing methods utilizing SEQ ID NO: 9 or 該由 come polynucleotide of the sequence listing referred to in the preceding paragraph 4. Consists of.

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION From the 90th position (1st in the sequence listing) to the 372nd position (2nd in the sequence listing) of the DRB1 (β1) gene of the HLA gene
One of the polymorphisms in the (83rd) sequence is shown in Sequence Listing 1. The nucleotide sequence polymorphisms in the region of this sequence are shown in FIGS. Based on this sequence, polymorphisms were roughly classified into 9 types based on the mutations in each sequence. 1 to 4 are classification I, FIGS. 5 to 8 are classification II-, and FIGS. 9 to 12 are classification II-.
13 to 16 are classification II-, FIGS. 17 to 20 are classification II-, FIGS. 21 to 24 are classification III, FIGS. 25 to 28 are classification IV, FIGS. 29 to 32 are classification V, and FIGS. 33 to 36 are classification VI. Indicates. In the figure, only the bases different from those in Sequence Listing 1 are shown.

Based on this classification, regions necessary and sufficient base sequences for these and further subdivision thereof were identified. As a result, the base sequences 111 to 134, the base sequences 162 to 185, the base sequences 186 to 209, the base sequences 219 to 242, and the base sequences 249 to 272.
No., base sequence 282-305, base sequence 303-
326th and nucleotide sequences 333 to 356 were identified.
HLA gene polymorphism analysis can be reliably identified by chipping all mutant sequences of each base in these sequence regions. Further, the substantially homologous sequence of this sequence means all sequences utilizing the meaning of the specified sequence region, and depending on the purpose, one to several base regions are mutated from the above sequence,
Allowed to be deleted or added. Of course, each complementary base is also included.

The polymorphic sequence of the region thus identified is
It is made into chips by a known gene chip making technique.
Prepared chips can be used as a chip kit as needed for sample HL
It is used for polymorphism determination of the A gene, and is used for creating data on the relationship between disease, immune function, etc. and polymorphism.

[0013] As a specific application example of the present invention, a probe used for genotyping HLA-DR antigens selected from the following group is exemplified. A polynucleotide comprising the sequence described in any one of SEQ ID NOs: 2 to 9 in the sequence listing or a complementary strand base sequence thereof, a polynucleotide hybridizing with the polynucleotide or a complementary strand base sequence thereof under stringent conditions, or The complementary strand base sequence, a polynucleotide consisting of the sequence described in any one of SEQ ID NOS: 2 to 9 in the sequence listing, or a polynucleotide containing at least 15 consecutive base sequences of the complementary strand base sequence, the sequence in the sequence listing A polynucleotide having the sequence homology of at least about 50% of the polynucleotide consisting of the sequence described in any one of Nos. 2 to 9 or its complementary strand base sequence.

In one embodiment, the polynucleotide according to the present invention and its complementary strand have SEQ ID NOs: 2 to 2 in the sequence listing.
9 and the complementary strand to the polynucleotide. These can be used, for example, for genotyping HLA-DR antigens. More preferable nucleotide sequences of the polynucleotides are shown in SEQ ID NOs: 2 to 9 in the sequence listing.

In another aspect, the present invention is stringent in the corresponding region of the amino acid sequence of the polypeptide or peptide of the present invention, for example, the polynucleotide consisting of the sequences of SEQ ID NOs: 2 to 9 in the sequence listing or its complementary strand. A polynucleotide that hybridizes under conditions. The hybridization conditions are, for example, Molecu.
lar Cloning; A Laboratory Manual, 2nd Edition, Sambrook
Et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989. Stringent hybridization conditions are generally known, and one example thereof is 50% formamide, 5 ×.
SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate, pH 7.
6, 5 x Denhart's solution, 10% dextran sulfate, and 20 μg / ml denatured sheared salmon sperm DNA in a solution at 42 ° C overnight, then at about 65 ° C at 0.1 ° C.
It may be a condition of washing in × SSC.

These polynucleotides do not necessarily have to be complementary sequences as long as they hybridize to the desired polynucleotide, particularly the polynucleotide consisting of the nucleotide sequences of SEQ ID NOs: 2 to 9 in the sequence listing or its complementary strand. For example, in homology to the nucleotide sequences of SEQ ID NOs: 2 to 9 in the sequence listing or its complementary sequence, at least about 50%, for example, about 70% or more, preferably about 80% or more, more preferably about 90% or more, More preferably, it is about 95% or more. The polynucleotide according to the present invention is a polynucleotide or oligo consisting of 10 or more, preferably 15 or more, more preferably 20 or more consecutive nucleotides in the nucleotide sequences of SEQ ID NOs: 2 to 9 in each sequence listing. It includes nucleotides and their complementary strands.

Each of the sequences of the present invention can be used in the method of genotyping HLA-DR antigen in the following combinations. The term “derived from” means a polynucleotide consisting of a sequence corresponding to each number of SEQ ID NOS: 2 to 9 or its complementary chain base sequence, a polynucleotide of a sequence corresponding to each number or its complementary chain base sequence and string. At least 15 consecutive polynucleotides or their complementary strand base sequences that hybridize under mild conditions, or polynucleotides consisting of sequences corresponding to the respective numbers of SEQ ID NOs: 2 to 9 in the sequence listing or their complementary strand base sequences A concept including a polynucleotide containing a nucleotide sequence, a polynucleotide consisting of a sequence corresponding to each of SEQ ID NOS: 2 to 9 in the sequence listing, or a polynucleotide having a sequence homology of at least about 50% of the nucleotide sequence of its complementary strand. Is.

A method for typing DRB1 * 01 using SEQ ID NO: 2 in the Sequence Listing or a polynucleotide derived therefrom, DRB1 * 03, DRB1 * 11, DRB1 * utilizing a SEQ ID NO: 3 in the Sequence Listing or a polynucleotide derived therefrom 13, or DRB1 * 14
A method for typing DRB1 * 04 using SEQ ID NO: 4 in the sequence listing or a polynucleotide derived therefrom, a typing method for DRB1 * 07 using a sequence listing SEQ ID NO: 5 or a polynucleotide derived therefrom, a sequence listing SEQ ID NO: 6 or a method for typing DRB1 * 08 or DRB1 * 12 using the polynucleotide derived therefrom, SEQ ID NO: 7 in the Sequence Listing or a method for typing DRB1 * 09 using the polynucleotide derived from SEQ ID NO: 6, the sequence in the Sequence Listing No. 8 or a method of typing DRB1 * 10 using the polynucleotide derived therefrom, or a method of typing DRB1 * 15 or DRB1 * 16 using the polynucleotide of SEQ ID No. 9 or the sequence thereof.

[0019]

EXAMPLES The present invention will be described below with reference to examples.
The present invention is not limited to these.

[Example 1] The polymorphic sequences in the regions of nucleotide sequences 111 to 134 were compared, and it was found that they could be divided into 9 types. Therefore, the polymorphic sequences in this region were made into a gene chip.

[0020]

[Example 2] Polymorphisms in the regions of nucleotide sequences 162 to 185 were analyzed in classification II- and II-, and 1
Since there is a difference at No. 83, all polymorphic sequences in this region were made into a gene chip.

[0021]

[Example 3] Polymorphisms in the regions of nucleotide sequences 162 to 185 were analyzed in classification II- and II-, and 1
Since there is a difference at position 73, all polymorphic sequences in this region were made into a gene chip.

[0022]

[Example 4] Polymorphisms in the regions of nucleotide sequences 162 to 185 were analyzed in classification II- and II-, and 1
Since there is a difference at the 66th position, all polymorphic sequences in this region were made into a gene chip.

[0023]

[Example 5] Polymorphisms in the region of nucleotide sequences 186 to 209 were analyzed in classification II-, and there was a difference in 199th. Therefore, all the polymorphic sequences in this region were made into gene chips.

[0024]

[Example 6] Polymorphisms in the region of nucleotide sequences 219 to 242 were analyzed in classification II-, and there was a difference in 229th position. Therefore, all the polymorphic sequences in this region were made into gene chips.

[0025]

[Example 7] Polymorphisms in the regions of the nucleotide sequences 249 to 272 were analyzed in Class II- and analyzed from 259 to 2
Since there is a difference at position 63, all polymorphic sequences in this region were made into a gene chip.

[0026]

[Example 8] Polymorphisms in the region of nucleotide sequences 282 to 305 were analyzed in classification II-, and there was a difference in 288th. Therefore, all the polymorphic sequences in this region were made into gene chips.

[0027]

[Example 9] Polymorphisms in the regions of nucleotide sequences 303 to 326 were analyzed in classification II-, and 310, 31
Since there is a difference at position 9, all polymorphic sequences in this region were gene chipped.

[0028]

[Example 10] Polymorphisms in the regions of nucleotide sequences 333 to 356 were analyzed in classification II-, and 339 and 3 were identified.
Since there are differences at Nos. 46 and 347, all polymorphic sequences in this region were made into a gene chip.

[0029]

[Example 11] Polymorphisms in the regions of nucleotide sequences Nos. 303 to 326 were analyzed in classification II-, and there were differences at No. 320. Therefore, all polymorphic sequences in this region were made into gene chips.

[0030]

[Example 12] Polymorphisms in the regions of nucleotide sequences 333 to 356 were analyzed in classification II-, and there was a difference in nucleotide number 343. Therefore, all the polymorphic sequences in this region were made into gene chips.

[0031]

[Example 13] Polymorphisms in the region of nucleotide sequences 186 to 209 were analyzed in classification II-, and since there was a difference in 190th, all the polymorphic sequences in this region were made into gene chips.

[0032]

[Example 14] Polymorphisms in the regions of nucleotide sequences 303 to 326 were analyzed in classification II-, and 309, 3
Since there is a difference at position 10, all polymorphic sequences in this region were gene-chiped.

[0033]

[Example 15] Polymorphisms in the regions of nucleotide sequences 111 to 134 were analyzed in classification III, and all of the polymorphic sequences in this region were gene-chiped because there was a difference in 124th region.

[0034]

[Example 16] Polymorphisms in the regions of nucleotide sequences 162 to 185 were analyzed in classification III, and 167, 18
Since there is a difference in No. 3, all polymorphic sequences in this region were made into a gene chip.

[0035]

[Example 17] Polymorphisms in the regions of the nucleotide sequences 186 to 209 were analyzed in classification III, and 191 and 19 were obtained.
Since there are differences in Nos. 8, 199 and 201, all the polymorphic sequences in this region were gene-chiped.

[0036]

[Example 18] Polymorphisms in the region of nucleotide sequences 219 to 242 were analyzed in classification III, and there was a difference in nucleotide number 229. Therefore, all the polymorphic sequences in this region were made into gene chips.

[0037]

[Example 19] Polymorphisms in the regions of nucleotide sequences 249 to 272 were analyzed in Group III, and were analyzed using 258, 25.
Since there are differences in the numbers 9, 260, 262, 263, 268, all polymorphic sequences in this region were made into gene chips.

[0038]

[Example 20] Polymorphisms in the regions of nucleotide sequences 282 to 305 were analyzed in Group III and analyzed 288, 29.
Since there are differences in Nos. 6, 297, 299, 300, 301, and 305, all polymorphic sequences in this region were made into gene chips.

[0039]

[Example 21] Polymorphisms in the regions of nucleotide sequences Nos. 303 to 326 were analyzed in Group III, and the results were 309, 31.
Since there are differences at 0 and 323, all polymorphic sequences in this region were made into gene chips.

[0040]

Example 22 Polymorphisms in the regions of nucleotide sequences 186 to 209 were analyzed in classification IV, and 186, 19 were analyzed.
Since there are differences in Nos. 1, 194, 199, 205, and 206, all polymorphic sequences in this region were made into gene chips.

[0041]

[Example 23] Polymorphisms in the regions of nucleotide sequences 219 to 242 were analyzed in classification IV, and 229, 23 were analyzed.
Since there were differences at the 5th and the 241st positions, all polymorphic sequences in this region were made into a gene chip.

[0042]

[Example 24] Polymorphisms in the regions of nucleotide sequences 249 to 272 were analyzed in classification IV, and 258 and 25 were analyzed.
Since there are differences in Nos. 9, 260, 261, 262, 263, and 267, all polymorphic sequences in this region were made into a gene chip.

[0043]

[Example 25] Polymorphisms in the regions of the nucleotide sequences 282 to 305 were analyzed in classification IV and analyzed 288, 29.
6, 297, 298, 299, 300, 301, 304
Since all of the polymorphic sequences in this region were gene chips, there was a difference in the number.

[0044]

[Example 26] Polymorphisms in the regions of nucleotide sequences Nos. 303 to 326 were analyzed in classification IV, and 307, 30
Since there are differences in Nos. 9, 310, 319 and 323, all polymorphic sequences in this region were made into a gene chip.

[0045]

[Example 27] Polymorphisms in the regions of nucleotide sequences 333 to 356 were analyzed in classification IV, and 343, 34 were analyzed.
Since there were differences in Nos. 6,347,353, all polymorphic sequences in this region were gene chipped.

[0046]

[Example 28] Polymorphisms in the region of nucleotide sequences 162 to 185 were analyzed in classification V, and there was a difference in sequence 178. Therefore, all the polymorphic sequences in this region were made into gene chips.

[0047]

[Example 29] Polymorphisms in the region of nucleotide sequences 186 to 209 were analyzed in classification V, and analyzed in 188, 198,
Since there is a difference at position 199, all polymorphic sequences in this region were made into a gene chip.

[0048]

[Example 30] Polymorphisms in the regions of nucleotide sequences 219 to 242 were analyzed in classification V, and 229, 232,
Since there is a difference at position 238, all polymorphic sequences in this region were made into a gene chip.

[0049]

[Example 31] Polymorphisms in the regions of nucleotide sequences 249 to 272 were analyzed in classification V, and 258, 259,
Since there are differences in Nos. 260, 261, 262, 263, and 267, all polymorphic sequences in this region were made into a gene chip.

[0050]

[Example 32] Polymorphisms in the regions of nucleotide sequences 282 to 305 were analyzed in classification V, and 285, 288,
296, 297, 299, 300, 301, 303, 3
Since there are differences in Nos. 04 and 305, all polymorphic sequences in this region were made into a gene chip.

[0051]

[Example 33] Polymorphisms in the regions of nucleotide sequences Nos. 303 to 326 were analyzed in classification V. Since there were differences in Nos. 309 and 310, all polymorphic sequences in this region were made into gene chips.

[0052]

[Example 34] Polymorphisms in the regions of nucleotide sequences 333 to 356 were analyzed in classification V, and 341, 346,
Since there is a difference at position 347, all polymorphic sequences in this region were made into a gene chip.

[0053]

[Example 35] Polymorphisms in the regions of nucleotide sequences 111 to 134 were analyzed in classification VI, and 111, 11
4, 115, 117, 121, 125, 127, 129
Since all of the polymorphic sequences in this region were gene chips, there was a difference in the number.

[0054]

[Example 36] Polymorphisms in the regions of the nucleotide sequences 163 to 185 were analyzed in classification VI to give 163, 16
7, 171, 173, 176, 177, 178, 18
Since there are differences at 0 and 183, all polymorphic sequences in this region were made into gene chips.

[0055]

[Example 37] Polymorphisms in the regions of nucleotide sequences 186 to 209 were analyzed in classification VI to give 191, 19
Since there are differences at Nos. 8, 199, 202, and 208, all polymorphic sequences in this region were made into a gene chip.

[0056]

[Example 38] Polymorphisms in the regions of nucleotide sequences 249 to 272 were analyzed in classification VI, and 248 and 25 were analyzed.
Since there are differences at positions 9, 260, and 268, all polymorphic sequences in this region were gene chipped.

[0057]

[Example 39] Polymorphisms in the regions of nucleotide sequences 282 to 305 were analyzed in classification VI, and 288 and 29 were analyzed.
Since there are differences in Nos. 7, 298 and 299, all polymorphic sequences in this region were gene chipped.

[0058]

[Example 40] Polymorphisms in the regions of nucleotide sequences Nos. 303 to 326 were analyzed in classification VI to give 305, 30
7, 309, 310, 319, 320, 321, 32
Since there are differences in Nos. 2,323, all polymorphic sequences in this region were made into gene chips.

[0059]

[Example 41] Polymorphisms in the regions of nucleotide sequences 219 to 242 were analyzed in classification I, and since there were differences in 222, all the polymorphic sequences in this region were made into gene chips.

[0060]

[Example 42] Polymorphisms in the regions of the nucleotide sequences 282 to 305 were analyzed in Group I, and 287, 296,
Since there are differences at positions 297 and 299, all polymorphic sequences in this region were gene chips.

[0061]

[Example 43] Polymorphisms in the regions of nucleotide sequences Nos. 303 to 326 were analyzed in Class I, and were determined as 311, 319,
Since there are differences at 320 and 323, all polymorphic sequences in this region were made into gene chips.

[0062]

[Example 44] Polymorphisms in the regions of nucleotide sequences 333 to 356 were analyzed in Class I, and 343, 346,
Since there is a difference at position 347, all polymorphic sequences in this region were made into a gene chip.

[0063]

[Example 45] Method for producing probe A probe was produced at Japan Bioservice and 5 '
The following 9 types of probes with thiolized ends were synthesized.

[0064] Probe name Sequence-compatible allele RB1-1-2 GTGGCAGCTTAAGTTTGAAT DRB1 * 01 RB1-2-2 GGAGTACTCTACGTCTGAGT DRB1 * 03, DRB1 * 11, DRB1 * 13, DRB1 * 14 RB1-3-2 GGAGCAGGTTAAACATGAGT DRB1 * 04 RB1-4-2 GTGGCAGGGTAAGTATAAGT DRB1 * 07 RB1-6-2 GGAGTACTCTACGGGTGAGT DRB1 * 08, DRB1 * 12 RB1-7-2 GAAGCAGGATAAGTTTGAGT DRB1 * 09 RB1-8-2 GGAGGAGGTTAAGTTTGAGT DRB1 * 10 RB1-9-2 GTGGCAGCCTAAGAGGGAGT DRB1 * 15, DRB1 * 16

The relationship between the probe name and the sequence number is as follows. RB1-1-2 Sequence No. 2 RB1-2-2 Sequence No. 3 RB1-3-2 Sequence No. 4 RB1-4-2 Sequence No. 5 RB1-6-2 Sequence No. 6 RB1-7-2 Sequence No. 7 RB1- 8-2 SEQ ID NO: 8 RB1-9-2 SEQ ID NO: 9

Immobilization of probe 1 m of high density amino group-introduced slide made by Matsunami Glass Co., Ltd.
After soaking in M EMCS solution (DMSO: Ethanol = 1: 1) for 3 hours, wash the slide with the same solvent and then with 100% ethanol,
Air dried. Next, the probe prepared on this slide was adjusted to a concentration of 20 uM with 50 mM Tris-HCl (pH 6.8) buffer containing 10% trehalose, and spotted on the slide. In addition, spotting is performed by Affymetrix 417 Arrayer (Affymet
rix) was used. After spotting the probe, the probe was allowed to stand at room temperature for 3 hours or more, and then immersed in 2% BSA / PBS to block unreacted EMCS, thereby immobilizing the probe on the slide.

Sample Preparation Method Samples were prepared by performing asymmetric PCR with the following composition and method.

[0068]     10 x Ex Taq Buffer (Takara Shuzo) 10 uL     2.5mM dNTPs (dATP, dCTP, dGTP, dTTP) (Takara Shuzo) 8 uL     10uM DR-F1 primer 0.5 uL     10uM DR-R1 (Cy5) primer 5 uL     template * 1 uL     Ex Taq Polymerase (Takara Shuzo) 0.5 uL     Water 75 uL                                                           100 uL      94 ° C 5min     94 ℃ 20sec, 59 ℃ 20sec, 72 ℃ 20sec; 40 cycles     72 ° C 7min     4 ° C ∞     DR-F1 primer sequence: 5'- ccggatccttcgtgtccccacagcacg     DR-R1 (Cy5) primer sequence: 5'- Cy5-ccgctgcactgtgaagctct     (The 5'end of the DR-R1 (cy5) primer was labeled with the fluorescent substance Cy5)

DRB1 * 0101, DRB1 * 0301 shown in FIGS.
1, DRB1 * 0406, DRB1 * 07011, DRB1 * 08022, DRB1 * 09012,
DRB1 * 10011, DRB1 * 11011, DRB1 * 1201, DRB1 * 13011, DRB
1 * 1427, DRB1 * 15011 and DRB1 * 16021 were evaluated using samples prepared by subjecting each DRB1 gene cloned as a template to PCR. In addition, Genome No. 2 (HLA type: DRB1 * 09012, 11011), Genome No. 5 (HLA type: DRB1 * 0
8022, 09012), Genome No. 12 (HLA type: DRB1 * 08032, 09
012), Genome No. 13 (HLA type: DRB1 * 0101, 04051) and Genome No. 15 (HLA type: DRB1 * 04051, 1201) were evaluated using a sample prepared by subjecting genomic DNA to PCR as a template.

Operation method Hybridization is GeneTAC Hybridization Stat
The following operations were performed using ion (Genomic Solutions Co., Ltd.). That is, the reaction is 6 x SSPE, 0.5% S
After hybridization at 45 ° C for 15 hours in DS, 2
x 1 min x 6 washes with SSPE. The hybridization solution used had the following composition.

[0071] 20 x SSPE (pH7.4) 45 uL 5% SDS 15 uL Asymmetric PCR product 25 uL Water 65 uL Total 150 uL

After hybridization and washing, the cells were rinsed with purified water for a few times, air-dried, and then GenePix4.
A hybridization pattern was obtained with a 000B array scanner (manufactured by Aoxn). After that, the obtained image is GenePix
Analysis was performed using Pro analysis software (manufactured by Axon), and the fluorescence intensity of each spot was calculated. The results are shown in FIGS.

Results DRB1 * 0101 reacted only with probe RB1-1-2. DRB1 * 130
11 reacted with the probes RB1-2-2 and RB1-6-2, but the reaction with the probe RB1-2-2 could be strongly judged. DRB1 * 0406
Reacts with probes RB1-3-2 and RB1-4-2,
The reaction with RB1-3-2 was strongly determinable. DRB1 * 0711
Reacted only with probe RB1-4-2. DRB1 * 08022 reacted only with probe RB1-6-2. DRB1 * 09012 is probe RB1
Reacted only with -7-2. DRB1 * 10011 reacted only with probe RB1-8-2. DRB1 * 11011 is probe RB1-2-2 and RB1-6
Although it reacted with -2, the reaction with probe RB1-2-2 could be strongly judged. DRB1 * 1201 reacted only with probe RB1-6-2. DRB1 * 13011 reacted with probes RB1-2-2 and RB1-6-2, but the reaction with probe RB1-2-2 could be strongly judged. DRB1 * 1427 reacted with probes RB1-2-2 and RB1-6-2, but the reaction with probe RB1-2-2 could be strongly judged. DRB1 * 15011 reacted only with probe RB1-9-2. D
RB1 * 16021 reacted only with probe RB1-9-2. Genome N
o.2 (HLA type: DRB1 * 09012, 11011) is probe RB1-2-
2 and RB1-7-2 and weakly reacted with probe RB1-6-2. Genome No. 5 (HLA type: DRB1 * 08022, 09012) reacted with probes RB1-6-2 and RB1-7-2. Genome No.12 (HL
A type: DRB1 * 08032, 09012) is probe RB1-6-2 and RB1
Reacted with -7-2. Genome No. 13 (HLA type: DRB1 * 0101, 0
4051) reacted with probes RB1-1-2 and RB1-3-2. Genome No. 15 (HLA type: DRB1 * 04051, 1201) is probe RB1-3
Reacted with -2 and RB1-6-2.

From the above results, it is possible to type DRB1 * 01 by using the sequence shown in probe RB1-1-2, and by using the sequence of probe RB1-2-2,
RB1 * 03, DRB1 * 11, DRB1 * 13 or DRB1 * 14 can be typed, and by using the sequence shown in probe RB1-3-2, DRB1 * 04 can be typed and probe RB1-4 -By using the sequence shown in 2, it is possible to type DRB1 * 07, by using the sequence shown in probe RB1-6-2, it is possible to type DRB1 * 08 or DRB1 * 12, probe RB1 By using the sequence shown in -7-2, DRB1 * 09 can be typed, and by using the sequence shown in probe RB1-8-2, DRB1 * 10 can be typed, probe RB1-9 By using the sequence shown in -2, typing of DRB1 * 15 or DRB1 * 16 was possible.

[0075]

INDUSTRIAL APPLICABILITY In the present invention, polymorphisms of DRB1 gene are classified, and an efficient gene chip design for polymorphism analysis is achieved.

[0076]

[Sequence listing free text] SEQ ID NO: 1: HLA-DRB
Part of the 1 (β1) gene. SEQ ID NO: 2: Part of HLA-DRB1 * 01 gene. SEQ ID NO: 3: HLA-DRB1 * 03 gene or HL
A-DRB1 * 11 gene or HLA-DRB1 * 1
3 genes or a part of HLA-DRB1 * 14 gene. SEQ ID NO: 4: Part of HLA-DRB1 * 04 gene. Sequence number 5: A part of HLA-DRB1 * 07 gene. SEQ ID NO: 6: HLA-DRB1 * 08 gene or HL
Part of the A-DRB1 * 12 gene. Sequence number 7: A part of HLA-DRB1 * 09 gene. SEQ ID NO: 8: Part of HLA-DRB1 * 10 gene. SEQ ID NO: 9: HLA-DRB1 * 15 gene or HL
Part of the A-DRB1 * 16 gene.

[0077]

[Sequence list]                                SEQUENCE LISTING         <110> International Reagents Corporation <120> Gene Chip <130> NP01-1123 <140> <141> <150> JP P2001-145934 <151> 2001-05-16 <160> 9 <170> PatentIn Ver. 2.1 <210> 1 <211> 283 <212> DNA <213> Homo sapiens <220> <223> A part of HLA-DRB1 (beta1) Gene <400> 1 ggggacaccc gaccacgttt cttgtggcag cttaagtttg aatgtcattt cttcaatggg 60 acggagcggg tgcggttgct ggaaagatgc atctataacc aagaggagtc cgtgcgcttc 120 gacagcgacg tgggggagta ccgggcggtg acggagctgg ggcggcctga tgccgagtac 180 tggaacagcc agaaggacct cctggagcag aggcgggccg cggtggacac ctactgcaga 240 cacaactacg gggttggtga gagcttcaca gtgcagcggc gag 283 <210> 2 <211> 20 <212> DNA <213> Homo sapiens <220> <223> A part of HLA-DRB1 * 01 gene <400> 2 gtggcagctt aagtttgaat 20 <210> 3 <211> 20 <212> DNA <213> Homo sapiens <220> <223> A part of HLA-DRB1 * 03 gene or HLA-DRB1 * 11 gene or       HLA-DRB1 * 13 gene or HLA-DRB1 * 14 gene <400> 3 ggagtactct acgtctgagt 20 <210> 4 <211> 20 <212> DNA <213> Homo sapiens <220> <223> A part of HLA-DRB1 * 04 gene <400> 4 ggagcaggtt aaacatgagt 20 <210> 5 <211> 20 <212> DNA <213> Homo sapiens <220> <223> A part of HLA-DRB1 * 07 gene <400> 5 gtggcagggt aagtataagt 20 <210> 6 <211> 20 <212> DNA <213> Homo sapiens <220> <223> A part of HLA-DRB1 * 08 gene or HLA-DRB1 * 12 gene <400> 6 ggagtactct acgggtgagt 20 <210> 7 <211> 20 <212> DNA <213> Homo sapiens <220> <223> A part of HLA-DRB1 * 09 gene <400> 7 gaagcaggat aagtttgagt 20 <210> 8 <211> 20 <212> DNA <213> Homo sapiens <220> <223> A part of HLA-DRB1 * 10 gene <400> 8 ggaggaggtt aagtttgagt 20 <210> 9 <211> 20 <212> DNA <213> Homo sapiens <220> <223> A part of HLA-DRB1 * 15 gene or HLA-DRB1 * 16 gene <400> 9 gtggcagcct aagagggagt 20

[Brief description of drawings]

[Fig. 1] 90th to 3rd of DRB1 (β1) gene of HLA gene
Shows the polymorphism category I of the 72nd sequence.

[Fig. 2] 90 to 3 of DRB1 (β1) gene of HLA gene
A continuation of the polymorphism Category I of the 72nd sequence is shown.

[FIG. 3] 90th to 3rd of DRB1 (β1) gene of HLA gene
A continuation of the polymorphism Category I of the 72nd sequence is shown.

[FIG. 4] 90th to 3rd DRB1 (β1) genes of HLA gene
A continuation of the polymorphism Category I of the 72nd sequence is shown.

FIG. 5: 90 to 3 of DRB1 (β1) gene of HLA gene
The polymorphism class II- of the 72nd sequence is shown.

[FIG. 6] 90th to 3rd DRB1 (β1) genes of HLA gene
A continuation of the polymorphism class II-of the 72nd sequence is shown.

FIG. 7: 90 to 3 of DRB1 (β1) gene of HLA gene
A continuation of the polymorphism class II-of the 72nd sequence is shown.

FIG. 8: 90 to 3 of DRB1 (β1) gene of HLA gene
A continuation of the polymorphism class II-of the 72nd sequence is shown.

[FIG. 9] 90th to 3rd DRB1 (β1) genes of HLA gene
The polymorphism class II- of the 72nd sequence is shown.

FIG. 10 shows a continuation of polymorphism classification II- of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 11 shows the continuation of polymorphism classification II- of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 12 shows a continuation of polymorphism classification II- of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 13 shows the polymorphism classification II − of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 14 shows a continuation of the polymorphism classification II- of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 15 shows the continuation of the polymorphism classification II- of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 16 shows a continuation of polymorphism classification II- of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 17 shows classification II-of polymorphisms in the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 18 shows the continuation of polymorphism classification II- of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 19 shows the continuation of the polymorphism classification II- of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 20 shows a continuation of polymorphism classification II- of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 21 shows classification III of polymorphisms in the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 22 shows the continuation of polymorphism classification III of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 23 shows a continuation of the polymorphism classification III of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 24 shows a continuation of the polymorphism classification III of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 25 shows classification IV of polymorphisms in the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 26 shows a continuation of classification IV of polymorphisms in the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 27 shows a continuation of classification IV of polymorphisms in the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 28 shows the continuation of classification IV of polymorphisms in the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 29 shows classification V of polymorphisms in the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 30 shows a continuation of polymorphism classification V of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 31 shows a continuation of polymorphism classification V of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 32 shows a continuation of the polymorphism classification V of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 33 shows classification VI of polymorphisms in the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 34 shows the continuation of classification VI of polymorphisms in the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 35 shows the continuation of polymorphism classification VI of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 36 shows the continuation of polymorphism classification VI of the 90th to 372nd sequences of the DRB1 (β1) gene of the HLA gene.

FIG. 37 shows the fluorescence intensity of each spot as the test result of Example 45.

FIG. 38 is a continuation of FIG. 37. The test result of Example 45 shows the fluorescence intensity of each spot.

FIG. 39 is a continuation of FIG. 38. The test result of Example 45 shows the fluorescence intensity of each spot.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁷ Identification code FI Theme Coat (reference) G01N 33/566 C12N 15/00 A (72) Inventor Kazuhiko Takeda 1-1-2, Muroya, Nishi-ku, Kobe City International Reagents (72) Inventor Hidetoshi Inoko, Incorporated company of stock company F-term (reference) 1-19-35 Midorien, Izumi-ku, Yokohama-shi, Kanagawa 4B024 AA11 CA01 HA12 4B029 AA07 BB20 CC08 FA01 FA09 4B063 QA01 QA18 QQ42 QQ52 QR32 QR55 QR82 QS34 QX01

Claims (5)

[Claims] 1. A HLA gene polymorphism selection chip comprising a polymorphism of a nucleotide sequence of the DRB1 gene region of the following HLA as a gene chip: 1) nucleotide sequence 111 to 134 or this sequence 2) base sequence 162 to 185 or a substantially homologous sequence of this sequence, 3) base sequence 186 to 209 or a substantially homologous sequence of this sequence, 4) base sequence 219 to 242 or this Substantially homologous sequence, 5) Base sequences 249 to 272 or almost homologous sequence of this sequence, 6) Base sequences 282 to 305 or almost homologous sequence of this sequence, 7) Base sequences 303 to 326 or Substantially homologous sequence of this sequence, 8) Base sequence 333 to 356 or a substantially homologous sequence of this sequence. 2. A method for selecting / determining HLA gene polymorphisms using the chip according to claim 1. 3. A method for measuring an HLA gene polymorphism, which comprises the chip according to claim 1. 4. A probe used for genotyping an HLA-DR antigen selected from the following group; a polynucleotide comprising the sequence described in any one of SEQ ID NOs: 2 to 9 in the sequence listing or a complementary strand base sequence thereof, Or a polynucleotide that hybridizes with a complementary strand base sequence thereof under stringent conditions or a complementary strand base sequence thereof, a polynucleotide consisting of the sequence described in any one of SEQ ID NOs: 2 to 9 in the sequence listing or a polynucleotide thereof A polynucleotide comprising at least 15 consecutive base sequences of a complementary strand base sequence, a polynucleotide consisting of the sequence described in any one of SEQ ID NOs: 2 to 9 of the sequence listing, or at least about 50% of the complementary strand base sequence thereof. A polynucleotide having sequence homology or. 5. A method of genotyping an HLA-DR antigen selected from the following group; A method of typing DRB1 * 01 using SEQ ID NO: 2 in the sequence listing of claim 4 or a polynucleotide derived therefrom; A method for typing DRB1 * 03, DRB1 * 11, DRB1 * 13, or DRB1 * 14 using a polynucleotide of SEQ ID NO: 3 of the Sequence Listing or a polynucleotide derived therefrom, and SEQ ID NO: 4 of the Sequence Listing or a polynucleotide derived therefrom. A method for typing DRB1 * 04 using nucleotides, SEQ ID NO: 5 in the sequence listing of claim 4 or a method for typing DRB1 * 07 using a polynucleotide derived therefrom, SEQ ID NO: 6 in the sequence listing for claim 4 or the origin thereof A method for typing DRB1 * 08 or DRB1 * 12 using the polynucleotide of claim 4, SEQ ID NO: 7 in the sequence listing of claim 4, or a method of typing DRB1 * 09 using the polynucleotide derived therefrom, the sequence listing of claim 4. Typing methods of DRB1 * 10 utilizing the SEQ ID NO: 8 or 該由 come polynucleotide, DRB1 * 15 or DRB1 * 16 typing methods utilizing SEQ ID NO: 9 or 該由 come polynucleotide sequence table according to claim 4.