JP2002142767A - Method for detecting cancer and method for determining whether carcinogenesis advance or not - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for detecting cancer, by which early cancer can be detected and a method for determining whether advance of carcinogenesis from pre-cancer condition is present or not. SOLUTION: This method for detecting cancer comprises examining developing amount of fascin of collected cell to be examined or humor.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a method for detecting cancer and a method for determining whether or not cancer has progressed.

[0002]

2. Description of the Related Art It has been revealed that the progression from normal colon mucosa to colorectal adenoma and further to colorectal cancer is due to multi-step mutations in genes (ER. Fearon, Prince
ss Takamatsu Symp., 22 , 3748 (1991), Cancer and Chemotherapy, 20 , 677 683 (1993)). That is, a hypothesis was proposed that mutation of the APC & MCC gene occurs first, followed by mutation of the K-ras gene, and further, accumulation of mutations of the p53 gene, which is a pathway to canceration (ER. Fearon). and B.
Vogelstein, Cell, 61 , 759-767, (1990)). It is described that the accumulation of irreversible gene mutations in cells in this way leads to canceration. These phenomena are understood as a general theory that applies not only to colorectal cancer but also to many major organ cancers (A
L. Jackson & LA. Loeb, Semin. Cancer Biol., 8 , 421
429 (1998)). Therefore, it is extremely important to detect a gene change at an earlier stage in detecting early cancer. However, in reality, there are few model systems that progress from normal tissues or precancerous lesions to cancer, and the burden on patients is low. Due to the lack of a series of tissue banks obtained from individuals, the research itself has not progressed much. In other words, when considering earlier treatment,
Earlier cancer markers have not yet been met. Gene-chip, a new technology, is being used to search for markers of cancer malignancy. (Nature, 406 , 466-467 (2000) & Nature, 406 , 53
2-535 (2000)). However, research has not progressed because of the lack of a key pair bank for early cancer marker search.

[0003] The measurement of tumor markers in serum (for example, markers at serum levels such as CEA and CA19-9), which are currently widely used, is practically far from the level at which early cancer can be detected. It is mostly used for prediction or treatment monitoring (Am. J. Gastr
oenterol., 91 , 49-53 (1996)). Therefore, there is a strong demand from clinical sites to provide new markers that can be expected for early cancer detection.

[0004]

SUMMARY OF THE INVENTION It is an object of the present invention to provide a method for detecting cancer capable of detecting early cancer and a method for determining the presence or absence of progression of cancer from a pre-cancerous state.

[0005]

Means for Solving the Problems As described in detail in Examples below, the present inventors require inflammation to transition from colorectal adenoma to colorectal cancer, and chronic inflammation promotes canceration. Clarified that this would be a factor. A humoral factor contained in the cell stroma that promotes canceration is fascin (fasin).
cin) was identified by two-dimensional electrophoresis comparison between pre-cancerous cells and cancerous cells. Furthermore, in all of the colon cancer cell lines established this time and the known colon cancer cell lines, the mRNA amount of the fascin gene in the cells is clearly increased from the mRNA amount of the fascin gene in the cells in the precancerous state. I found that. Then, they conceived that it was possible to detect cancer by examining the expression level of fascin, and completed the present invention.

[0006] That is, the present invention provides a method for detecting cancer, comprising examining the expression level of fascin in the collected test cells or body fluid. The present invention also provides a method for determining the presence or absence of cancer progression in a test cell, comprising examining the expression level of fascin in the collected test cell or body fluid.

[0007]

DETAILED DESCRIPTION OF THE INVENTION As described above, in the method of the present invention,
The expression level of fascin in the collected test cells or body fluid is examined. The discovery of fascin itself is old, and its gene sequence and structure have been well studied and analyzed, including information on homology conservation relationships among various animal species (Reference review: Cell Motility an).
d the Cytoskeleton, 32 , 19 (1995)). It has been understood that its function is mainly to bind actin filaments. That is, since actin functions as a backing protein of the cell membrane, it is inferred that proteins regulating these are also closely related to cell motility. The nucleotide sequence of the cDNA encoding fascin was determined by GenBank Access
ion No. AF030165 (SEQ ID NO: 5).

[0008] In the method of the present invention, the expression level of fascin is examined. Here, the "examination" method involves determining whether the expression level of fascin is increased as compared to non-cancerous cells. All possible methods are included. It is not always necessary to quantify the expression level, and for example, the case where fascin is detected by a method of measuring sensitivity such that fascin is not detected in non-cancerous cells is also included.

As a method of examining the expression level of fascin, there is a method of examining the mRNA level of the fascin gene in cells. Since the cDNA sequence of the fascin gene is already known as described above,
-Amplify fascin mRNA by nucleic acid amplification methods such as PCR method, NASBA method, TMA method, etc., and check the amount of amplification products, and perform these nucleic acid amplification methods simultaneously with amplification of control gene mRNA, and analyze the amount of amplification products Or (Duple
x PCR etc.). this is,
Performing by comparing the concentration of the amplification band or attaching a label such as a fluorescent label to the nucleotide used for the nucleic acid amplification method, separating the amplification product by electrophoresis, and measuring the label in the amplification band Is possible. Alternatively, TaqMan
(Product name) Well-known real-time detection R using probe
The amount of mRNA can also be measured by the T-PCR method. Further, the expression level of fascin can also be examined by examining the amount of fascin protein. This can be performed by detecting a fascin protein by a well-known protein purification method such as a well-known immunoassay method, two-dimensional electrophoresis, or chromatography.

The test cells to be used in the method of the present invention are not particularly limited, but cells constituting an organ are preferable, and cells constituting an organ can be used as test cells.
Organ cancer can be detected early. As described above, the process of canceration of an organ is a process in which gene mutations are accumulated, and such a process of canceration is basically common to various organs. The organ cells used are not limited at all. Preferred examples include digestive organs such as large intestine, small intestine, stomach, and duodenum, and particularly preferred examples include large intestine.

In the method of the present invention, it is preferable to examine the expression level of fascin in the test cells by the above-described method. The test cells can be collected by collecting them from an organ by biopsy, or when examining cells of the digestive tract, cell fragments falling off in feces can be used as test cells. In addition, since fascin is leached out of cells, the amount of fascin in body fluids near the organ to be tested or in the case of gastrointestinal cancer, in feces (here, feces is also included in the body fluid) should be examined. Can also examine the expression level of fascin. Alternatively, the amount of fascin in circulating body fluids such as blood can be examined. In this case, it is not known which organ is cancerous, but it can be used as a primary screening test to determine whether any organ is cancerous.

As will be specifically shown in the following examples, since fascin promotes the transition from a pre-cancerous state to a cancer, the method of the present invention using the expression of fascin as an index detects early cancer. It becomes possible to do.

[0013] In addition, the above-mentioned method makes it possible to determine whether or not the test cells have become cancerous. That is, even if the cells are not morphologically cancerous, it can be determined that canceration is progressing if the expression level of fascin is increased.

[0014]

EXAMPLES Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples.

1. Establishment of malignant cells a. Human colon adenoma cells used were provided by Dr. Tomoyuki Kitagawa, Cancer Research Institute Cancer Institute. (These cells were established from polyps of a patient with familial adenomatous polyposis and have FPCK-1
Named). Since the growth under the culture condition was extremely low, several strains of (substantially) high growth ability were isolated by MNNG treatment. The donated cell lines were the parent cell FPCK-1 and its sublines FPCK-1-1 and FPCK-1-5, for a total of three lines.

B. All cell lines are 5x in nude mice
10 did not engraftment be ^six subcutaneous implantation. However, it was found that when transplanted subcutaneously with a foreign substance (gelatin sponge or plastic plate) that causes inflammation, it survived. That is, the bioabsorbable gelatin sponge disappears about one month after subcutaneous transplantation.
x3 mm) was inserted subcutaneously and 5 × 10 ⁶ colonic adenoma cells were implanted into the sponge.
One of the mice survived as colorectal cancer. But FPCK
-1 and FPCK-1-5 did not survive.

C. Next, 1 × 10 ⁵ colonic adenoma cells were adhered on a plastic plate (10 × ⁵ × 1 mm), and transferred together with the plastic plate subcutaneously, FPCK-1 cells did not engraft, and FPCK-1-5 cells Grew as colorectal cancer in 1 out of 20 mice, and FPCK-1-1 cells grew as colorectal cancer in 13 of 20 mice.

D. In addition, it has been found that prolonged inflammation is required for the transformation of FPCK-1-1 cells into colorectal cancer. This is because exposure to inflammation for about one month does not result in cancer,
It is assumed from the above results that canceration is caused by coexistence with prolonged inflammation. Further, only the plastic plate was transferred subcutaneously to nude mice, and after 100 days, only the plastic plate was removed, and stromal cells that adhered and proliferated around the plastic plate were left subcutaneously, and 5 × 10 ⁶ FPCK-1-1 cells were placed in the stromal tissue. 6 even if transplanted individually
All the examples showed that the cells grew and became cancerous, indicating that chronic inflammation is a factor promoting canceration. Cells in which FPCK-1-1 adhered to the plastic plate became cancerous due to chronic inflammation were established in a culture strain and named FPCKpP1-1 to FPCKpP1-6.

2. Characteristics of cancer cells transformed with inflamed sites as beds and their traits a. The difference in the frequency of cancer transformation from colorectal adenoma cells to colorectal cancer can be attributed to the degree of gene mutation in colorectal adenoma cells. Therefore, when we performed a gene mutation detection experiment, FPCK-1 cells had mutations in both the germline and somatic cells of the APC gene, but no other ras, p53, etc. mutations, and chromosomes 1p, 5p , 5q, 11p, 12p, 17p, 18p, 18q, 22q L
OH was not observed, whereas in FPCK-1-1 cells, 17, 18
LOH of p, 18q is added. FPCK-1-5 cells were similar to FPCK-1 within the range examined. LOH detection is M
iyaki, M. et al., Cancer Res., 50: 7166-7173, 1990
And Kawaguchi et al., Jpn.J. Cancer Res., 82: 138
According to -141, 1991, determination was made by Southern blotting using a normal polymorphic DNA marker as a probe.

B. When FPCK-1-1 cells were administered as drinking water containing 1% of the iNOS inhibitor aminoguanidine (AG) to a canceration model obtained by transplantation of FPCK-1-1 cells onto a plastic plate, the average incubation period before the tumor appeared was 97.9. +/- 31.2 days compared to 44.8 +/- 12.5 days without treatment,
Furthermore, comparing the growth of the engrafted cancer cells with the average tumor volume 150 days after transplantation, 28.4 +/- 19.7
whereas a mm ^3, in the non-administration group was significantly suppressed and 68.8 +/- 45.8 mm ^3. Histologically also AG administered a constant area per iNOS, 8-OhdG, positive number of Nitorotairoshin (number positive / 10 ⁴ o m ²⁾ was significantly suppressed, iNOS is 4.5 +/- 1.0 vs.
8.5 +/- 5.2, 8-OhdG is 81.0 +/- 9.1 vs. 96.5 +/- 15.9,
Nitrotyrosine is 8.8 +/- 4.2 vs. 15.3 +/- 5.1
The results were the tumor tissues 100 days after transplantation in the AG administration group versus the non-administration group.

3. Isolation and identification of growth-promoting factor As shown in 1 above, cultured fibroblasts were established from this stromal tissue, and FPCK-1-1 was contained in the conditioned medium (CM).
A humoral factor that promoted cell growth about twice was included. This factor has a molecular weight of 100 kDa or more, and heat (37, 5
(6, 100 ° C), resistant to neuramidase treatment,
It was sensitive to trypsinization. The fibroblasts producing this factor were only stromal cells reacted with a plastic plate, and production from fibroblasts and NIH3T3 and C3H10T1 / 2 cells established from subcutaneous tissues of nude mice was not observed. In order to identify the causative factors associated with these cancers, the proteins between FPCK-1-1 cells and FPCKpP1-3 cells were compared by two-dimensional electrophoresis. As a result, among several spots, fascin was found to increase with canceration.

That is, proteins between FPCK-1-1 cells and FPCKpP1-3 cells were compared by two-dimensional electrophoresis by two-dimensional electrophoresis. The method is as follows:
After washing with (PBS), recover with rubber policeman 120
Centrifuge at 0 rpm, 4 ° C. After washing twice more with PBS, 100
Microliter of cell pellet is sonicated with 10 volumes of sonication buffer (10 mM Tris-HCl, pH 7.4, 5 mM MgCl ₂ , 50 μl
g / ml RNase, 1 mM phenylmethylsulfonyl fluoride
(PMSF). The cell suspension was treated with an ultrasonic crusher (Tomy Se
(iko Co., Ltd). At this time, a 15 second interval was left between each break to keep the sample at ice temperature. Then, let stand on ice for 5 minutes, and then DNase I (50 μg
/ ml) and left still for 15 minutes at ice temperature. Thereafter, solid urea is added to 9M. 1x lysis buffer (9.2M urea, 2% Nonidet-P40; 1.6% pH range5)
Add 7% and 0.4% pH range 3.5-10 and 2% Ampholine (trade name, LKB) consisting of 5% 2-mercaptoethanol and store at -70 ° C.

In two-dimensional electrophoresis, 10% is applied to a two-dimensional gel.
Polyacrylamide was used. First dimension electrophoresis for acidic polypeptides: 4% (w / v) 2% Ampholines (trade name)
Using a polyacrylamide gel containing (1.6%, pH 5-7; 0.4%, pH 3.5-10), electrophoresed at 18 ° C, 200 V for 1 hour, 400 V for 12.5 hours, and 800 V for 1 hour (IEF) . The gel used for electrophoresis for basic polypeptides is 2% Ampholines (trade name)
Using the above gel except (1.0% pH 7-9, 1.0% pH 8-9.5), run at 450 V for 4 hours (NEPHGE).

For the separated protein spots, spots having differences after transfer to the membrane were cut out, and amino acid sequencing was attempted after extraction. An attempt was made to determine the amino acid sequence directly from the cut out spots. However, because of the failure, the protein extracted from the cut out spots was subjected to CNBr treatment, and the resulting three fragments were separated by HPLC, followed by automatic amino acid sequencing again. Operation. As a result, the amino acid sequences of the following three fragments could be determined. That is, among the obtained sequences SLIWHYNEN, there are few sequences with high certainty. Therefore, when the MXLI motif was searched for homology by computer processing (Tagldent Search on the ExPASy www Server), the molecular weight, Taking the pI etc. into consideration, it was concluded that fascin was the protein in which the difference found this time was clearly recognized from the equivalence of the sites cleaved by enzymatic digestion.

4. Method for confirming difference in mRNA abundance between colon cancer and non-cancer tissue site by RT-PCR Primer (forward primer; ggcaaggatgagctcttttga (SEQ ID NO: 1), reverse primer; ccccagtgcttggaatagaag) that sandwiches a part of the coding region of fascin
(SEQ ID NO: 2)), and corresponding primers for β-actin detection were synthesized, and conditions for comparison by multiplex PCR were determined. As a result, it was revealed that fascin also increases with malignancy at mRNA level. The details of the conditions are as follows.

RT conditions Extract RNA with Trizol (trade name) (1 dish), 5 la
0.1 M DTT in buffer (4.0 μl); 1.5 μl, 5 mM MgCl2
2.0 μl, 2.5 mM dNTPs; 4.0 μl, 5 μM Fascin specific primer (described above); 1.0 μl, reverse transcriptase MML-V; 1.0
μl, RNA (3 μg); 6.5 μl, total 20.0 μl, 65 ° C
× 10min → Leave at 4 ℃, then 37 ℃ × 60min → 95 ℃ × 5min
→ The reaction was carried out at 4 ° C.

Duplex PCR (fascin, actin) 10 La universal buffer 2.5 μl, 2.5 mM dNTP 2.0 μl
l, 5mM Fascin forward primer (described above) 2.5
μl, 5 mM Fascin reverse primer (described above); 2.5
μl, 5 mM β-actin forward primer (ttcgag
caagagatggccacggct (SEQ ID NO: 3)) 0.5 μl, 5 mM β
-Actin reverse primer (atactcctgcttgct gatc
cacat (SEQ ID NO: 4)) 0.5 μl, Taq polymerase 0.2 μl
l, 13.3 μl of deionized distilled water was added to 1.0 μl of RT-Product, and a total of 25.0 μl of the reaction product was heated at 94 ° C. × 5 minutes → [94 ° C. × 20
Seconds → 56 ° C. × 30 seconds → 72 ° C. × 30 seconds] → 72 ° C. × 7 minutes The PCR amplification reaction was performed in 30 cycles. In addition, the region of 875 nt to 1066 nt of the coding region of the fascin cDNA described in GenBank Accession No. AF030165 (SEQ ID NO: 5) is amplified by this PCR.

Duplex PCR was performed using the established mutant strain, and increase in the expression of the fascin gene was confirmed. The value of the expression increase rate was calculated using the ATTO Lane Analyzer 3.0 (densitograph s
(oftware library) software. FIG. 1 shows the measurement results.

5. Comparison of the expression of fascin between colorectal cancer and adjacent normal tissues in 13 cases of surgically resected specimens of fresh colorectal cancer (including patients with familial adenomatous polyposis) by the method described in 4 showed an increase in 10 out of 13 cases. Was. The result is shown in FIG.

6. Examination of Fascin Gene Expression Profile in Cancer Cell Lines According to the method described in 4, the human colon cancer cell lines of line 8 (CHCY-
(1, Colo320, DLD-1, DM314, HT29, KM12, SW840, WiDr)
When the expression of fascin was compared, it was revealed that fascin was highly expressed in all cell lines. The result is shown in FIG.

[0031]

According to the present invention, a method for detecting cancer capable of detecting early cancer and a method for judging the presence or absence of progress of canceration from a pre-cancerous state are provided for the first time. According to the method of the present invention, early cancer can be detected, which is very useful for prevention and treatment of cancer.

[0032]

[Sequence List] <110> FUJIREBIO INC. <120> Method for detecting cancer and method for evaluating whether process to cancer is proceeding <130> 00683 <160> 4

<210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as forward primer for amplifying a region in fascin cDNA <400> 1 ggcaaggatg agctcttttg a 21

<210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer for amplifying a region in fascin cDNA <400> 2 ccccagtgct tggaatagaa g 21

<210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer for amplifying a region in be ta-actin cDNA <400> 3 ttcgagcaag agatggccac ggct 24

<210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Nucleic acid used as reverse primer for amplifying a region in be ta-actin cDNA <400> 4 atactcctgc ttgctgatcc acat 24

[0037] <210> 5 <211> 1720 <212> DNA <213> Homo sapience <400> 5 cagggggttc gtgacgccgg ctgggtctgg gggctgtggg ccagccgagc cgacccgggc 60 ttctggggga ccgcgggggc cgtgagcact cagagggtgc atcccaggcc cctccgggga 120 cccggccagc ctgaagatgc cgacgaacgg cctgcaccag gtgctgaaga tccagtttgg 180 cctcgtcaac gacactgacc gctacctgac agctgagagc ttcggcttca aggtcaatgc 240 ctcggcaccc agcctcaaga ggaagcagac ctgggtgctg gaacccgacc caggacaagg 300 cacggctgtg ctgctccgca gcagccacct gggccgctac ctgtcggcag aagaggacgg 360 gcgcgtggcc tgtgaggcag agcagccggg ccgtgactgc cgcttcctgg tcctgccgca 420 gccagatggg cgctgggtgc tgcggtccga gccgcacggc cgcttcttcg gaggcaccga 480 ggaccagctg tcctgcttcg ccacagccgt ttccccggcc gagctgtgga ccgtgcacct 540 ggccatccac ccgcaggccc acctgctgag cgtgagccgg cggcgctacg tgcacctgtg 600 cccgcgggag gacgagatgg ccgcagacgg agacaagccc tggggcgtgg acgccctcct 660 caccctcatc ttccggagcc gacggtactg cctcaagtcc tgtgacagcc gctacctgcg 720 cagcgacggc cgtctggtct gggagcctga gccccgtgcc tgctacacgc tggagttcaa 780 ggcgggcaag ctgg ccttca aggactgcga cggccactac ctggcacccg tggggcccgc 840 aggcaccctc aaggccggcc gaaacacgcg acctggcaag gatgagctct ttgatctgga 900 ggagagtcac ccacaggtgg tgctggtggc tgccaaccac cgctacgtct ctgtgcggca 960 aggggtcaac gtctcagcca atcaggatga tgaactagac cacgagacct tcctgatgca 1020 aattgaccag gagacaaaga agtgcacctt ctattccagc actgggggct actggaccct 1080 ggtcacccat gggggcattc acgccacagc cacacaagtt tctgccaaca ccatgtttga 1140 gatggagtgg cgtggccggc gggtagcact caaagccagc aacgggcgct acgtgtgcat 1200 gaagaagaat gggcagctgg cggctatcag cgattttgtc ggcaaggacg aagagttcac 1260 cctcaagctc atcaaccggc ccatcctggt gctgcgcggc ctggacggct tcgtctgcca 1320 ccaccgcggc tccaaccagc tggacaccaa ccgctccgtc tacgacgtct tccacctgag 1380 cttcagcgac ggcgcctacc ggatccgagg ccgcgacgga gggttctggt acacgggcag 1440 ccacggcagc gtgtgcagcg acggcgaacg cgccgaggac ttcgtcttcg agttccgtga 1500 gcgcggccgc ctggccatcc gcgcccggag cggcaagtac ctgcgcggcg gcgcctcggg 1560 cctgctgcgg gccgatgccg acgccccggc cgggaccgcg ctttgggagt actgaggccg 1620 cgcccagacc agcctgtcgc gc attaaaac cgtgtctctc ccgcaaaaaa aaaaaaaaaa 1680 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1720

[Brief description of the drawings]

Fig. 1 RT-P in various established human colorectal cancer cell lines
The amount of fascin mRNA measured by CR was determined by comparing the amount of fascin mRNA in its parent strain, human colon adenoma cell line FPCK-1-1.
It is a figure shown in comparison with the amount of RNA.

FIG. 2 is a diagram comparing the expression of fascin between colorectal cancer and adjacent normal tissue by the method described in the Examples for fresh colorectal cancer surgically removed specimens.

[FIG. 3] Eight human colon cancer cell lines (CHCY-1, Colo320, DLD-1, DM314, HT29, KM12, SW84) by the method described in the Examples.
FIG. 2 is a diagram comparing the expression of fascin in 0, WiDr).

 ──────────────────────────────────────────────────続 き Continued on the front page F term (reference) 4B024 AA12 BA80 CA20 HA11 4B063 QA01 QA13 QA18 QQ02 QQ03 QQ53 QR08 QR62 QS02 QS25

Claims (12)

[Claims] 1. A method for detecting cancer, comprising examining the expression level of fascin in a collected test cell or body fluid. 2. The method according to claim 1, which is performed by examining the expression level of fascin in the test cells. 3. The method according to claim 1, wherein examining the expression level of fascin in the test cells is performed by examining the amount of fascin gene mRNA in the test cells. 4. The method according to claim 1, wherein examining the expression level of fascin in the test cell or body fluid is performed by examining the amount of fascin protein. 5. The method according to claim 1, wherein the test cells are cells of an organ cancer, and the cancer is an organ cancer. 6. The method according to claim 5, wherein the organ cancer is colorectal cancer. 7. A method for determining the presence or absence of progression of canceration, comprising examining the expression level of fascin in a collected test cell or body fluid. 8. The method according to claim 7, which is carried out by examining the expression level of fascin in the test cells. 9. The method according to claim 7, wherein examining the expression level of fascin in the test cells is performed by examining the amount of fascin gene mRNA in the test cells. 10. The method according to claim 7, wherein examining the expression level of fascin in the test cell or body fluid is performed by examining the amount of fascin protein. 11. The test cell is a cell of an organ cancer,
The cancer according to any one of claims 7 to 10, wherein the cancer is an organ cancer.
The method described in the section. 12. The cancer according to claim 11, wherein the organ cancer is colorectal cancer.
The described method.