JP2001078779A - Calpp protein, polynucleotide encoding the same and antibody - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new CALPP protein which comprises a CALPP protein containing a specific amino acid sequence and permits the productive control of immunoglobulin as a signal molecule transmitting the antigen stimulation of the B cell and the stimulation of CD 40 or the control of autoimmune diseases. SOLUTION: This CALPP protein is the new CALPP protein comprising the amino acid sequence represented by the formula, functions as the control molecule of calcium-binding protein dephosphoenzyme comprising a signal molecule transmitting the antigen stimulation of the B cell and the stimulation of CD 40 and is a functional molecule in the nucleus and cytoplasm of the B cell which transmits the stimulation of CD 40 to control the effective production of immunoglobulin, inhibits the multiplication of the abnormal antibody productive B cell and permits the control of autoimmune diseases. This CALPP protein is obtained by using a mouse DNA library as a template DNA, carrying out PCR using the partial sequence of CALPP gene as a primer, combining the resultant CALPP cDNA with a plasmid or the like to transduce into the host cell and cultivating the resultant transformant.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a calcium-binding protein phosphatase regulatory molecule which is a signal molecule that transmits B cell antigen stimulation and CD40 stimulation, a gene encoding the same, and an antibody recognizing the regulatory molecule. About.

[0002]

2. Description of the Related Art B cells actively undergo cell division in peripheral lymphoid tissues when subjected to immunostimulation, and differentiate into finally antibody-producing cells. In this process, B cells undergo rearrangement of immunoglobulin genes and somatic mutations in the V region, and the B cells become cells that produce effective antibodies with stronger binding to antigens, ie, activated B cells. Matures into cells. Activated B cells form germinal centers in secondary lymphoid follicles of lymphoid tissue. In the germinal center, activated B cells are stimulated by helper T cells and dendritic cells, also activated by antigen. In this process, it is considered that B cell clones having weak binding strength and B cell clones which react with their own antigens are selectively eliminated. This B cell differentiation stage is the most important process in producing effective antibody production, and artificially controlling this mechanism is closely related to artificially controlling the immune response.

[0003]

DISCLOSURE OF THE INVENTION The present invention provides a CALPP protein which is a functional molecule in the nucleus and cytoplasm of B cells which enables effective control of immunoglobulin production and control of autoimmune diseases. That is the task. Another object of the present invention is to provide a polynucleotide encoding the functional molecule. Another object of the present invention is to provide an antibody that recognizes the functional molecule.

[0004]

Means for Solving the Problems The amino acid sequence of the CALPP protein of the present invention (hereinafter referred to as CALPP) is the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing.

Further, the present invention comprises an amino acid sequence in which one or more amino acids in the CALPP amino acid sequence are deleted, substituted with another amino acid, or added with another amino acid, and the function of CALPP is preserved. C
An ALPP variant is provided.

The present invention also relates to the CALPP or C
A polynucleotide encoding an ALPP variant is provided. Typical polynucleotides are DNA and RN.
A, and the term polynucleotide is used herein to include those that have undergone a non-naturally occurring chemical modification. C encoding a naturally occurring CALPP
DNA (hereinafter referred to as CALPP cDNA) is composed of the base sequence shown in SEQ ID NO: 2 in the sequence listing.

[0007] Due to the degeneracy of the genetic code, at least a part of the base sequence of the polynucleotide can be replaced with another type of base without changing the amino acid sequence of the protein encoded by the polynucleotide. . Therefore, the polynucleotide encoding the CALPP of the present invention includes all patterns of degeneracy.

Further, the present invention provides an antisense polynucleotide comprising the nucleotide sequence of the antisense strand of the polynucleotide or a derivative of the antisense polynucleotide. The antisense polynucleotide is included in the polynucleotide, but in the present specification, particularly when explicitly expressing that the polynucleotide is an antisense strand, the antisense polynucleotide is a subordinate concept of the polynucleotide. Is used.

Further, the present invention provides a polynucleotide or an antisense polynucleotide, which is a part of the polynucleotides and is composed of 12 or more consecutive bases.

Further, the present invention provides a polynucleotide obtained by chemically modifying the polynucleotide. As described above, in the present specification, the term "polynucleotide" alone includes chemically modified ones, but in particular, when it is clarified that the product is chemically modified, it is chemically modified as a subordinate concept of a polynucleotide. The term polynucleotide is used.

The present invention also relates to CALPP or CAL
Antibodies that recognize PP variants are provided.

[0012]

BEST MODE FOR CARRYING OUT THE INVENTION 5'-terminal of the open reading frame of the nucleotide sequence of SEQ ID NO: 2 in the sequence listing,
A DNA consisting of several consecutive bases at each 3 'end is used as a primer, and a mouse cDNA is used as a template DNA.
By performing PCR using the library, a cDNA encoding the CALPP of the present invention can be prepared. As described below, the number of bases used in the primer is preferably 12 or more, and more preferably 16 or more.

[0013] A polynucleotide encoding a CALPP mutant can be obtained by artificially mutating a polynucleotide encoding CALPP. Specifically, it can be performed by a method such as site-directed mutagenesis or random mutagenesis. For example, CALPP cDNA is cut with a restriction enzyme,
Some bases can be deleted or added and re-coupled. Alternatively, the conditions are adjusted when amplifying CALPP cDNA by PCR, and the amplification product cDNA
Mutations can be introduced randomly.

Preparation of CALPP and CALPP mutants
It can be carried out by introducing cDNAs encoding them into an appropriate host and expressing them. The plasmid is introduced into a suitable host such as Escherichia coli or animal cells to obtain a transformant. The resulting transformant is cultured to express the protein,
It is possible to make ALPP. There are various textbooks on culturing transformants. At this time, as the host, any of bacteria such as Escherichia coli, yeast, and animal cells can be used, and animal cells are particularly preferable. To introduce a gene into a cell, a ribosome method, an electroporation method, or the like can be used.

The culture containing the CALPP or the CALPP mutant prepared in the transformant is collected and, if necessary, concentrated, solubilized, dialyzed, or subjected to various kinds of chromatography to obtain the CALPP or the CALPP of the present invention. CALP
It is possible to purify the P variant. For example, various affinity chromatography such as immunoprecipitation method, salting out method, ultrafiltration method, isoelectric point precipitation method, gel filtration method, electrophoresis method, ion exchange chromatography method, hydrophobic chromatography method and antibody chromatography method There are a chromatography, a chromatofocusing method, an adsorption chromatography method, a reverse phase chromatography method and the like, which may be selected as appropriate.

In the manufacturing stage, the CAL to be manufactured is
A PP or CALPP variant may be produced in a transformant as a fusion peptide with another polypeptide. In this case, in the purification step, an operation of treating with a chemical substance such as bromocyan or an enzyme such as a protease to cut out CALPP or a CALPP mutant is required.

A protein having an amino acid sequence in which one or more amino acids have been substituted, deleted or added in the amino acid sequence of the CALPP of the present invention, wherein the protein binding property to GANP is preserved is referred to as a CALPP mutant. The binding between the CALPP mutant and GANP can be confirmed by an in vitro binding assay shown in Example 2 described below.

The amino acid sequence of the CALPP mutant of the present invention can be determined from the nucleotide sequence of cDNA encoding the mutant. For example, it is possible using a commercially available program (for example, GENETYX (trademark) -MAC (manufactured by Software Development Corporation)).

For the sense strand or RNA of DNA, there are antisense DNA and antisense RNA each having a base sequence complementary to the base sequence. In the present specification, unless otherwise specified, DNA (cD
NA includes a sense strand and an antisense strand, and RNA refers to a single strand.
Antisense DNA or antisense RNA refers to those consisting of a single strand. The present invention includes all derivatives of the antisense polynucleotide. Derivatives are, for example, those obtained by substituting or deleting at least one part of the base, sugar, or phosphate of the antisense polynucleotide with another substance bound to the 3 ′ end or 5 ′ end of the antisense polynucleotide. It is a substance having a modification such as addition, or a substance having a base, sugar, or phosphate that does not exist in nature, or a substance having a skeleton other than the sugar-phosphate skeleton.

The antisense polynucleotide derivative is
It is preferred that the derivative has at least one of nuclease resistance, tissue selectivity, cell membrane permeability, or binding strength enhanced. It is particularly preferable that the derivative is a derivative having a phosphorothioate bond as a skeleton structure.
The antisense polynucleotide derivative of the present invention also includes derivatives having these functions or structures.

The antisense polynucleotide of the present invention is capable of hybridizing to a polynucleotide encoding CALPP under standard conditions,
If the hybridizing polynucleotide is a polynucleotide in the coding region, it is possible to inhibit the biosynthesis of the polypeptide encoded by the polynucleotide. The antisense polynucleotide for inhibiting polypeptide biosynthesis preferably comprises 12 or more bases. On the other hand, it is inappropriate to incorporate a full-length antisense polynucleotide into cells even if it is too long. When the antisense polynucleotide is incorporated into cells to inhibit CALPP biosynthesis, an antisense polynucleotide consisting of 12 to 35 bases, preferably 16 to 30 and more preferably 18 to 30
It is preferable to use an antisense polynucleotide consisting of at least 25 bases.

In terms of ease of hybridization, it is generally advisable to design an antisense polynucleotide or a derivative thereof having a nucleotide sequence complementary to the nucleotide sequence of the region forming the RNA loop. Have been.

An antisense polynucleotide having a sequence complementary to the sequence near the translation initiation codon, ribosome binding site, capping site, or splice site can generally be expected to have a high expression suppressing effect. Accordingly, the antisense polynucleotide of the present invention or a derivative thereof, wherein a CALPP-encoding gene or mRNA has a translation initiation codon, a ribosome binding site,
Those containing a sequence complementary to the capping site and the splice site are expected to have a high expression suppressing effect.

As a method for producing the antisense polynucleotide and its derivative of the present invention, for example, natural DNA or RNA can be synthesized using a chemical synthesizer, or PCR can be performed using CALPP cDNA as a template. It is mentioned. Some derivatives such as a methylphosphonate type and a phosphorothioate type can be synthesized using a chemical synthesizer (for example, Model 394 manufactured by ABI). In this case, the desired antisense polynucleotide can be obtained by performing the operation according to the instructions attached to the chemical synthesizer and purifying the obtained synthetic product by HPLC using reverse phase chromatography or the like. Alternatively, a derivative thereof can be obtained.

The entire length of the polynucleotide or the antisense polynucleotide of the present invention or a part thereof is CALP
P gene, CALPP cDNA or CALPPmR
It can be used as a probe for detecting NA or a primer for PCR. Now, it is said that there are 3 × 10 ⁹ human proteins. 16 because bases of DNA 4 ¹⁶ types are present, can identify all proteins of human if any DNA of this length. That is, the length required as a probe or primer is theoretically 16 bases. Needless to say, it is desirable that the length be longer than this in practical use, but in practice, a probe consisting of 12 or more bases is often used. In addition, a non-coding region or a coding region can be used as a portion used as a probe or a primer. Those having a GC content of 30 to 70% are preferable because they do not easily cause a problem of the three-dimensional structure of the polynucleotide and easily hybridize.

Specific examples of the method for detecting the CALPP gene include Northern blot hybridization and RT-PCR (“Current Protocol”).
ols in Molecular Biology "
(Green Publishing Associate
ates and Wiley-Interscience
ce) Chapter 15.1.1-15.1.9 and ibid. 15.4.1-15.4.6) or in situ hybridization method (i.e. Chapter 1).
4.3.1-14.3.14) or in situ R
NA hybridization method (Blood, 80, 2)
044-2051, 1992). CALPP riboprobes can be used for in situ RNA hybridization. The CALPP riboprobe is prepared by adding CALP to a plasmid such as pBluescript.
It can be made by binding PCDNA and performing in vitro transcription using T7 polymerase.

The optimum hybridization conditions may differ depending on the length of the probe and the membrane used. That is, the hybridization conditions naturally have a certain width.

When chemically synthesizing DNA or RNA, chemical modification such as labeling, biotinylation, side chain methylation, or substitution of O for S in the phosphate group is often performed. Are known. For example, when chemically synthesizing the DNA described in SEQ ID NO: 2 in the sequence listing, it is possible to synthesize the DNA different from the DNA itself shown in the sequence listing by performing the above chemical modification. Further, even a cDNA obtained from a cDNA library can be labeled with a radioisotope. Therefore, the DNA and RNA of the present invention include the above-mentioned chemically modified DNA, RNA or antisense polynucleotide in its range. The chemically modified DNA or RNA of the present invention can exhibit both the function of encoding a protein and the function as a probe or primer, and the chemically modified antisense polynucleotide of the present invention can be used for protein biosynthesis. And a probe or primer.

Antibodies that recognize CALPP by immunizing animals other than humans and animals other than those from which CALPP is derived with CALPP or a CALPP variant or a polypeptide comprising an amino acid sequence specific thereto (CAL
PP antibody) or an antibody recognizing the CALPP variant (C
ALPP mutant antibody). This CAL
Recognition of the PP antibody or the CALPP variant antibody by the CALPP or the CALPP variant, respectively, is based on Western blotting, ELISA, immunostaining (for example, F
ACS measurement) and the like.

As an immunogen, a method in which a part of the protein is bound to another carrier protein such as bovine serum albumin even if it is a part of the protein is a commonly used method. A part of the protein may be synthesized using, for example, a peptide synthesizer. In addition, as a part of the protein,
It is preferably composed of 8 or more amino acid residues. It is well known that, for a substance whose antigenicity has been revealed, if a polyclonal antibody is obtained by immunization, a monoclonal antibody is produced by a hybridoma using lymphocytes of the immunized animal.
Therefore, the antibodies of the present invention also include monoclonal antibodies.

In the present invention, antibodies also include active fragments. An active fragment means a fragment of an antibody having antigen-antibody reaction activity,
Specifically, F (ab ') ₂ , Fab', Fab, Fv
And the like. For example, when the antibody of the present invention is digested with pepsin, F (ab ') ₂ is obtained, and when digested with papain, Fab is obtained. F (ab ') ₂ is 2-
Reduction with a reagent such as mercaptoethanol and alkylation with monoiodoacetic acid gives Fab '. Fv is a monovalent antibody active fragment in which a heavy chain variable region and a light chain variable region are linked by a linker. A chimeric antibody can be obtained by retaining these active fragments and substituting other portions with fragments of another animal.

The antibody of the present invention can be used for purification and detection of CALPP, elucidation of functions such as expression of CALPP, control of B cell function and suppression of autoimmune diseases, and studies of diseases based on these findings. It can be used for treatment or testing of.

For the detection of CALPP, a method using an antibody and a method using an enzymatic reaction are exemplified. As a method using an antibody, specifically, a labeled CALP
Method for detecting CALPP using P antibody, CALP
CALPP using P antibody and labeled secondary antibody of said antibody
Is detected. Labels include, for example, radioisotopes (RI), enzymes, avidin or biotin,
Alternatively, a fluorescent substance (FITC, rhodamine, or the like) is used.

Examples of the method utilizing an enzyme reaction include an ELISA method, an immunoagglutination method, a Western blot method, a method for identifying an immunoreactive molecule using flow cytometry, and a method similar thereto.

[0035]

The present invention will be described in more detail with reference to the following Examples. <Example 1> Cloning of CALPP cDNA In order to obtain a novel protein that binds to GANP, the present inventor used a yeast two-hybrid screening system (Yeast two hybrid screeneni).
ng). In this method, two gene products are fused to a DNA junction site and a transcription activation site of a transcription factor, respectively, and the interaction between the two is detected using transcription activity as an index.

The yeast two-hybrid screening is
Matchmaker Two Hybrid System 2 (MATCH), a Clontech kit
Maker (registered trademark) Two-Hybrid Sy
stem2) (catalog number K1604-1) according to the attached manual. As a bait (bait for fishing for a binding protein), a gene obtained by introducing the pAS2-1-mouse GANP plasmid into Y190 yeast cells was used. The library used for screening is a pGAD10-mouse neonatal cDNA library (embryonic day 10) (Clontech). pAS2
-1-GA introduced into mouse GANP plasmid
NP cDNA is composed of bases 4236 to 5135 of SEQ ID NO: 4 in the sequence listing.

(1) The above cDNA library 5 × 1
0 by ⁶ clone match-maker two-hybrid system 2 (Clontech), Leu deficiency, Trp
Screening was performed according to the instructions attached to the above system, using the deficiency and His deficiency medium as an indicator, and a positive clone (GA, which is a bait) was screened.
Clones whose binding to NP was observed).

(2) The nucleotide sequence of the insert of the plasmid of the positive clone was determined using a DNA sequencer 37.
It was determined by Taq cycle sequencing using 3A (Perkin Elmer). The length of the insert was 1.5 kb.

(3) A primer 1 consisting of the following base sequence 1 was prepared from the insert sequence. Nucleotide sequence 1: ACAGCTCTAGATTCCTCTC
G (base sequence described in SEQ ID NO: 5 in the sequence listing) (4) Using the primer, λgt11-WEH
Using the I231 cDNA library as a template, PCR was performed in only one direction in the 5 ′ direction. The PCR operation was performed using Marathon (registered trademark) cDNA amplification kit (manufactured by Clontech). (5) Using the obtained PCR product as a DNA sequencer 373
A was determined by Taq cycle sequencing using A.

(6) A primer 2 consisting of the following base sequence 2 and a primer 3 consisting of the following base sequence 3 were prepared from the base sequence of the 1.5 kb insert and the PCR product. Nucleotide sequence 2: CCGCTCGAGCGGGGTACCA
CCATGGACTGGGAAAGACGT (base sequence described in SEQ ID NO: 6 in Sequence Listing) Base sequence 3: CCGCTCGAGCGGGAATTCC
CTGAAGTGAGATTTTCAAAGG (base sequence described in SEQ ID NO: 7 in Sequence Listing) (7) mRNA of B cell is extracted, and the extracted mRNA is extracted.
Was used as a template to isolate cDNA by RT-PCR. The nucleotide sequence is shown in SEQ ID NO: 2 in the sequence listing. This cDNA is a cDNA encoding a full-length protein. The protein encoded by the cDNA was named CALPP (calcium binding phosphatase binding protein). The amino acid sequence of the protein is shown in SEQ ID NO: 1 in the sequence listing.

CALPP has a characteristic calcium binding motif EF hand (sequence consisting of amino acids 286 to 298 of the amino acid sequence described in SEQ ID NO: 1 in the sequence listing), and has a protein phosphatase protein phosphatase 2A. It is a novel calcium-binding protein phosphatase regulatory molecule having a primary structure similar to that of the regulatory molecule. Regulation of protein dephosphorylation plays an important role in cell division, mutation, and gene repair.

CALPP is a molecule that binds to GANP, a germinal center-associated nuclear protein. The amino acid sequence of GANP is shown in SEQ ID NO: 3 in the sequence listing. GANP has a molecular weight of 2
10 kD. The nucleotide sequence of GANP cDNA is shown in SEQ ID NO: 4 in the sequence listing. GANP has the following functions.
GANP increases mRNA and protein expression in germinal centers. GANP moves from the cytoplasm to the nucleus and from the nucleus to the cytoplasm depending on the cell division cycle. GANP movement is thought to be related to cell division control. B cells contain CD40, an antigen stimulatory molecule and a germinal center stimulatory molecule
Stimulation via the molecule increases the expression of GANP,
The phosphorylation reaction increases. B by CD40 stimulation
GANP is involved in promoting effective production of immunoglobulins because the cells are activated and promote efficient production of immunoglobulins. Increased GANP expression is seen in peripheral lymph B cells of abnormal antibody-producing mice.

Since CALPP is a calcium-binding protein phosphatase controlling molecule that binds to GANP, its function is considered to be as follows. CALPP,
It is expressed in germinal center B cells and translocates between the nucleus and cytoplasm. Associated with calcium-dependent signals,
Controls the dephosphorylation of nuclear proteins. Related to cell division control. CALPP is a signal molecule that transmits CD40 stimulation. Thus, CALPP is considered to be responsible for controlling the effective production of immunoglobulins. Abnormal antibody-producing B cells bind to GANP and suppress their proliferation.

From the function of the above CALPP, CALPP
Is likely to be a target molecule for B cell function control. Specifically, the following uses are conceivable. A new immunopotentiator for inducing maturation of antibody-producing cells and raising an effective immune response. Abnormal B cell proliferation in autoimmune diseases,
A therapeutic agent for an autoimmune disease that controls an increase in autoantibody-producing B cell clones. Further, it is considered that the CALPP gene can be used for the purpose of the above-described gene therapy.

<Example 2> GA by in vitro binding assay
Detection of NP and CALPP According to the method described in Oncogene 11, vol. 1587, transcription and translation in vitro from GANP cDNA and CALPP cDNA, respectively (in vitro)
transcription / translation
n) binding assay (in vitro bind) using mouse GANP and mouse CALPP obtained in
ing assay). The outline of this method is shown below.

1) TNT expression system (TNT exp
response system) (promega) and T
Transcription and translation of plasmid DNA using 7S polymerase to produce a ³⁵ S-methionine labeled protein (C
ALPP and GANP) were synthesized. 2) 5 μl each of CALPP and GANP were mixed and incubated at 30 ° C. for 30 minutes. 3) Then, mix the mixture with 1 ml of ice-cold NP40 buffer (50 mM Tris-HCl (pH 7.5), 0.1 mL).
5 mM NaCl, 1% NP40, 3% BSA, 5
0 mM NaF, 0.1 mM sodium vanadate, 1 mM phenylmethylsulfonic acid fluoride (PM
SF), 20 μg / ml aprotinin)
Centrifugation was performed at 4000 rpm at 4 ° C. for 10 minutes. Supernatant 9
5 μl of anti-GANP antibody was added to 50 μl and reacted for 1 hour to immunoprecipitate the immunoprecipitate. The immunoprecipitate was collected using Protein Sepharose A beads (Pharmacia Biotech).

The anti-GANP antibody is a GANP cDNA fragment encoding the amino acids 679 to 1028 of the amino acid sequence shown in SEQ ID NO: 3 of the Sequence Listing, that is, the 2418th to 3rd nucleotides of the nucleotide sequence shown in SEQ ID NO: 4 of the Sequence Listing.
The cDNA fragment consisting of the 467th base was replaced with pGEX-4
A GST-GANP fusion protein produced by introduction into a T-1 vector (manufactured by Pharmacia Biotech) was immunized into a rat to prepare the same.

4) Washing the beads with 1 ml of NP40 buffer was repeated three times, and 10 mM Tris-
Wash once with HCl (pH 7.5) and add 20 μl of 2 × sample buffer (1 × sample buffer is 62.5 mM
Tris-HCl (pH 6.8), 5% 2-mercaptoethanol, 2% SDS, 10% glycerol,
0.003% bromophenol blue. ) And boiled for 5 minutes. The obtained protein was subjected to 12% SDS
-Fractionation was performed by PAGE electrophoresis (conventional method). As a result of the electrophoresis, in addition to GANP, CALPP bound to GANP was detected in the immunoprecipitate with the anti-GANP antibody.
It was confirmed that ANP and CALPP were bound.

[Sequence List] SEQUENCE LISTING <110> Sumitomo Electric Industries, Ltd. <120> CALPP Protein <130> 099Y0296 <160> 7 <210> 1 <211> 405 <212> PRT <213> Mus <400> 1 Met Asp Trp Lys Asp Val Leu Arg Arg Arg Leu Ala Ser Pro Asn Thr 1 5 10 15 Asp Pro Lys Arg Lys Lys Ser Glu Gln Glu Leu Lys Asp Glu Glu Met 20 25 30 Asp Leu Phe Thr Lys Tyr Tyr Ser Glu Trp Lys Gly Gly Arg Lys Asn 35 40 45 Thr Asn Glu Phe Tyr Lys Thr Ile Pro Arg Phe Tyr Tyr Arg Leu Pro 50 55 60 Ala Glu Asp Glu Val Leu Leu Gln Lys Leu Arg Glu Glu Ser Arg Ala 65 70 75 80 Val Phe Leu Gln Arg Lys Ser Arg Glu Leu Leu Asp Asn Glu Glu Leu 85 90 95 Gln Asn Leu Trp Phe Leu Leu Asp Lys His Gln Ile Pro Pro Met Ile 100 105 110 Gly Glu Glu Ala Met Ile Asn Tyr Glu Asn Leu Leu Lys Val Gly Glu 115 120 125 Lys Ala Gly Pro Thr Ala Ser Gln Phe Phe Thr Ala Lys Val Phe Ala 130 135 140 Lys Leu Leu His Thr Asp Ser Tyr Gly Arg Ile Ser Ile Met Gln Phe 145 150 155 160 Phe Asn Tyr Val Met Arg Lys Val Trp Leu His Gln Thr Arg Ile Gly 165 170 175 Leu Ser Leu Tyr Asp Val Ala Gly Gln Gly Tyr Leu Arg Glu Ser Asp 180 185 190 Leu Glu Asn Tyr Ile Leu Glu Leu Ile Pro Thr Leu Pro Gln Leu Asp 195 200 205 Gly Leu Glu Lys Ser Phe Tyr Ser Phe Tyr Val Cys Thr Ala Val Arg 210 215 220 Lys Phe Phe Phe Phe Leu Asp Pro Leu Arg Thr Gly Lys Ile Lys Ile 225 230 235 240 Gln Asp Ile Leu Ala Cys Ser Phe Leu Asp Asp Leu Leu Glu Leu Arg 245 250 255 Asp Glu Glu Leu Ser Lys Glu Ser Gln Glu Thr Asn Trp Phe Ser Ala 260 265 270 270 Pro Ser Ala Leu Arg Val Tyr Gly Gln Tyr Leu Asn Leu Asp Lys Asp 275 280 285 His Asn Gly Met Leu Ser Lys Glu Glu Leu Ser Arg Tyr Gly Thr Ala 290 295 300 Thr Met Thr Asn Val Phe Leu Asp Arg Val Phe Gln Glu Cys Leu Thr 305 310 315 320 Tyr Asp Gly Glu Met Asp Tyr Lys Thr Tyr Leu Asp Phe Val Leu Ala 325 330 335 Leu Glu Asn Arg Lys Glu Pro Ala Ala Leu Gln Tyr Ile Phe Lys Leu 340 345 350 Leu Asp Ile Glu Asn Lys Gly Tyr Leu Asn Val Phe Ser Leu Asn Tyr 355 360 365 Phe Phe Arg Ala Ile Gln Glu Leu Met Lys Ile His Gly Gln Asp Arg 370 375 380 Ile Leu Cys HisPhe Lys Met Ser Arg Met Lys Ser Leu Thr Trp Ser 385 390 395 400 400 Asn Gln Arg Ile Leu 405 <210> 2 <211> 1611 <212> DNA <213> Mus <400> 2 ccacgcgtcc gctcttaaca aactgcaaat gtagggtcct ctgagcggga gtcaacc 57 gac tgg aaa gac gtg ctt cgc cgg cgg tta gcg tcg ccc aac acg 105 gat cca aag agg aaa aaa agc gaa caa gaa tta aaa gat caa gaa atg 153 gat tta ttt acc aaa tac tac tca gag tgg aaa ggagt aca aac gag ttc tat aag acc ata ccc cgg ttt tat tac agg ttg cca 249 gct gaa gat gaa gtc tta cta cag aaa tta cga gag gaa tct aga gct 297 gtc ttt cta cag agg aaa agc aga ga gat ga ga gat ga ga gat ga ga g at g 345 cag aac tta tgg ttt ttg ctg gat aaa cac cag ata cca cct atg att 393 gga gag gaa gca atg atc aat tat gaa aat tta ttg aag gtt ggt gaa 441 aaa gct gga cca act gca agc caa ttt ttt act gcc 489 aaa ctc ctt cat aca gat tca tat gga cga att tcc atc atg cag ttc 537 ttt aac tac gtc atg cga aaa gtt tgg ctg cat cag aca aga ata gga 585 ctc agt tta tat gat gtt gct ggc catt gga tac gaa tca gac 633 ctg gag aac tac atc ctg gag ctg atc ccg acg ctg cca cag ctg gac 681 ggg ctg gag aag tcc ttc tac tcc ttc tat gtc tgc act gca gtc agg 729 aag ttc ttc ttc ttc ttc ttc ttc ttc ttc ttc ttg aag atc aaa att 777 caa gat att ttg gca tgc agt ttt cta gat gat tta ctg gag cta aga 825 gat gag gaa ttg tcc aaa gaa agt caa gaa aca aat tgg ttt tct gct 873 cct tct gcc ctg ggt gt ggt gg gg gg aat ctt gat aaa gat 921 cat aat ggc atg cta agt aaa gag gag ctc tcc cgt tac gga aca gca 969 acc atg acc aat gtc ttc tta gac cga gtt ttc cag gag tgt ctc act 1017 tac gat gga gaa ag gac ag ctg gac ttt gtt ctt gcc 1065 tta gaa aac aga aag gag cct gca gct ctg cag tac att ttc aaa ctg 1113 ctg gac att gag aac aag gga tac ctg aat gtc ttt tcc ctt aat tat 116a ttc tta agg cc aaa atc cat gga cag gac agg 1209 atc ctg tgt cat ttc aag atg tca agg atg aaa tct ttg aca tgg tca 1257 aac caa agg atc ctt tga aaatctcact tcaggattta atcaacagta 1305 atcaaggaga cacagtcact accattcta a ttgatctcaa tggcttctgg acctacgaga 1365 acagagaagc ccttgttgca aatgacaacg agaactctgc agatcttgat gacacatgat 1425 ctctgcaaaa tagacttctt cataaagatg cttgaatgct gcatgcaaca ctgttgaagc 1485 agaatcctta gaaacgttct aaataaaact catcacatgc ctgtacaaca taaaaaaaaa 1545 aaaaaaaaaa aaaagtcgac gcggccgcga tttccnggnc ctatgaattn taagnccacc 1605 aaatac 1611 <210> 3 <211> 1971 <212> PRT <213> Mus <400> 3 Met His Pro Val Asn Pro Phe Gly Gly Ser Ser Pro Ser Ala Phe Ala 1 5 10 15 Val Ser Ser Ser Thr Thr Gly Thr Tyr Gln Thr Lys Ser Pro Phe Arg 20 25 30 Phe Gly Gln Pro Ser Leu Phe Gly Gln Asn Ser Thr Pro Ser Lys Ser 35 40 45 Leu Ala Phe Ser Gln Val Pro Ser Phe Ala Thr Pro Ser Gly Gly Ser 50 55 60 His Ser Ser Ser Leu Pro Ala Phe Gly Leu Thr Gln Thr Ser Ser Val 65 70 75 80 Gly Leu Phe Ser Ser Leu Glu Ser Thr Pro Ser Phe Ala Ala Thr Ser 85 90 95 Ser Ser Ser Val Pro Gly Asn Thr Ala Phe Ser Phe Lys Ser Thr Ser 100 105 110 Ser Val Gly Val Phe Pro Ser Gly Ala Thr Phe Gly Pro Glu Thr Gly 115 120 125 Glu Val Ala Gly Ser Gly Phe Arg Lys Thr Glu Phe Lys Phe Lys Pro 130 135 140 Leu Glu Asn Ala Val Phe Lys Pro Ile Pro Gly Pro Glu Ser Glu Pro 145 150 155 160 Glu Lys Thr Gln Ser Gln Ile Ser Ser Gly Phe Phe Thr Phe Ser His 165 170 175 Pro Val Gly Ser Gly Ser Gly Gly Leu Thr Pro Phe Ser Phe Pro Gln 180 185 190 Val Thr Asn Ser Ser Val Thr Ser Ser Ser Phe Ile Phe Ser Lys Pro 195 200 205 Val Thr Ser Asn Thr Pro Ala Phe Ala Ser Pro Leu Ser Asn Gln Asn 210 215 220 Val Glu Glu Glu Lys Arg Val Ser Thr Ser Ala Phe Gly Ser Ser Asn 225 230 235 240 Ser Ser Phe Ser Thr Phe Pro Thr Ala Ser Pro Gly Ser Leu Gly Glu 245 250 255 Pro Phe Pro Ala Asn Lys Pro Ser Leu Arg Gln Gly Cys Glu Glu Ala 260 265 270 Ile Ser Gln Val Glu Pro Leu Pro Thr Leu Met Lys Gly Leu Lys Arg 275 280 285 Lys Glu Asp Gln Asp Arg Ser Pro Arg Arg His Cys His Glu Ala Ala 290 295 300 Glu Asp Pro Asp Pro Leu Ser Arg Gly Asp His Pro Pro Asp Lys Arg 305 310 315 320 Pro Val Arg Leu Asn Arg Pro Arg Gly Gly Thr Leu Phe Gly Arg Thr 325 330 335 Ile Gln Glu Val Phe Lys Ser Asn Lys Glu Ala Gly Arg Leu Gly Ser 340 345 350 Lys Glu Ser Lys Glu Ser Gly Phe Ala Glu Pro Gly Glu Ser Asp His 355 360 365 Ala Ala Val Pro Gly Gly Ser Gln Ser Thr Met Val Pro Ser Arg Leu 370 375 380 Pro Ala Val Thr Lys Glu Glu Glu Glu Ser Arg Asp Glu Lys Glu Asp 385 390 395 400 Ser Leu Arg Gly Lys Ser Val Arg Gln Ser Lys Arg Arg Glu Glu Trp 405 410 415 Ile Tyr Ser Leu Gly Gly Val Ser Ser Leu Glu Leu Thr Ala Ile Gln 420 425 430 Cys Lys Asn Ile Pro Asp Tyr Leu Asn Asp Arg Ala Ile Leu Glu Lys 435 440 445 His Phe Ser Lys Ile Ala Lys Val Gln Arg Val Phe Thr Arg Arg Ser 450 455 460 Lys Lys Leu Ala Val Ile His Phe Phe Asp His Ala Ser Ala Ala Leu 465 470 475 480 Ala Arg Lys Lys Gly Lys Gly Leu His Lys Asp Val Val Ile Phe Trp 485 490 495 His Lys Lys Lys Ile Ser Pro Ser Lys Lys Leu Phe Pro Leu Lys Glu 500 505 510 Lys Leu Gly Glu Ser Glu Ala Ser Gln Gly Ile Glu Asp Ser Pro Phe 515 520 525 Gln His Ser Pro Leu Ser Lys Pro Ile Val Arg Pro Ala Ala Gly Ser 530 535 540 Leu Leu Seru Lys Ser Ser Pro Val Lys Lys Pro Ser Leu Leu Lys Met 545 550 555 560 His Gln Phe Glu Ala Asp Pro Phe Asp Ser Gly Ser Glu Gly Ser Glu 565 570 570 575 Gly Leu Gly Ser Cys Val Ser Ser Leu Ser Thr Leu Ile Gly Thr Val 580 585 590 Ala Asp Thr Ser Glu Glu Lys Tyr Arg Leu Leu Asp Gln Arg Asp Arg 595 600 605 Ile Met Arg Gln Ala Arg Val Lys Arg Thr Asp Leu Asp Lys Ala Arg 610 615 620 Ala Phe Val Gly Thr Cys Pro Asp Met Cys Pro Glu Lys Glu Arg Tyr 625 630 635 640 Leu Arg Glu Thr Arg Ser Gln Leu Ser Val Phe Glu Val Val Pro Gly 645 650 655 Thr Asp Gln Val Asp His Ala Ala Ala Val Lys Glu Tyr Ser Arg Ser 660 665 670 Ser Ala Asp Gln Glu Glu Pro Leu Pro His Glu Leu Arg Pro Ser Ala 675 680 685 Val Leu Ser Arg Thr Met Asp Tyr Leu Val Thr Gln Ile Met Asp Gln 690 695 700 Lys Glu Gly Ser Leu Arg Asp Trp Tyr Asp Phe Val Trp Asn Arg Thr 705 710 715 720 Arg Gly Ile Arg Lys Asp Ile Thr Gln Gln His Leu Cys Asp Pro Leu 725 730 735 Thr Val Ser Leu Ile Glu Lys Cys Thr Arg Phe His Ile His Cys Ala 740 745 750 His Phe Met Cys Glu Glu Pro Met Ser Ser Phe Asp Ala Lys Ile Asn 755 760 765 Asn Glu Asn Met Thr Lys Cys Leu Gln Ser Leu Lys Glu Met Tyr Gln 770 775 780 Asp Leu Arg Asn Lys Gly Val Phe Cys Ala Ser Glu Ala Glu Phe Gln 785 790 795 800 Gly Tyr Asn Val Leu Leu Asn Leu Asn Lys Gly Asp Ile Leu Arg Glu 805 810 815 Val Gln Gln Phe His Pro Asp Val Arg Asn Ser Pro Glu Val Asn Phe 820 825 830 Ala Val Gln Ala Phe Ala Ala Leu Asn Ser Asn Asn Phe Val Arg Phe 835 840 845 Phe Lys Leu Val Gln Ser Ala Ser Tyr Leu Asn Ala Cys Leu Leu His 850 855 860 Cys Tyr Phe Asn Gln Ile Arg Lys Asp Ala Leu Arg Ala Leu Asn Val 865 870 875 880 Ala Tyr Thr Val Ser Thr Gln Arg Ser Thr Val Phe Pro Leu Asp Gly 885 890 895 Val Val Arg Met Leu Leu Phe Arg Asp Ser Glu Glu Ala Thr Asn Phe 900 905 910 Leu Asn Tyr His Gly Leu Thr Val Ala Asp Gly Cys Val Glu Leu Asn 915 920 925 Arg Ser Ala Phe Leu Glu Pro Glu Gly Leu Cys Lys Ala Arg Lys Ser 930 935 940 Val Phe Ile Gly Arg Lys Leu Thr Val Ser Val Gly Glu Val Val Asn 945 950 955 960 Gly Gly Pro Leu Pro Pro Val Pro Arg His Thr Pro Val Cys Ser Phe 965 970 975 Asn Ser Gln Asn Lys Tyr Val Gly Glu Ser Leu Ala Thr Glu Leu Pro 980 985 990 Ile Ser Thr Gln Arg Ala Gly Gly Asp Pro Ala Gly Gly Gly Arg Gly 995 1000 1005 Glu Asp Cys Glu Ala Glu Val Asp Leu Pro Thr Leu Ala Val Leu Pro 1010 1015 1020 Gln Pro Pro Pro Ala Ser Ser Ala Thr Pro Ala Leu His Val Gln Pro 1025 1030 1035 1040 Leu Ala Pro Ala Ala Ala Pro Ser Leu Leu Gln Ala Ser Thr Gln Pro 1045 1050 1055 Glu Val Leu Leu Pro Lys Pro Ala Pro Val Tyr Ser Asp Ser Asp Leu 1060 1065 1070 Val Gln Val Val Asp Glu Leu Ile Gln Glu Ala Leu Gln Val Asp Cys 1075 1080 1085 Glu Glu Val Ser Ser Ala Gly Ala Ala Tyr Val Ala Ala Ala Leu Gly 1090 1095 1100 Val Ser Asn Ala Ala Val Glu Asp Leu Ile Thr Ala Ala Thr Thr Gly 1105 1110 1115 1120 Ile Leu Arg His Val Ala Ala Glu Glu Val Ser Met Glu Arg Gln Arg 1125 1130 1135 Leu Glu Glu Glu Lys Gln Arg Ala Glu Glu Glu Arg Leu Lys Gln Glu 1140 1145 1150 Arg Glu Leu Met Leu Thr Gln Leu Ser Glu Gly Leu Ala Ala Glu Leu 1155 1160 11 65 Thr Glu Leu Thr Val Thr Glu Cys Val Trp Glu Thr Cys Ser Gln Glu 1170 1175 1180 Leu Gln Ser Ala Val Lys Ile Asp Gln Lys Val Arg Val Ala Arg Cys 1185 1190 1195 1200 Cys Glu Ala Val Cys Ala His Leu Val Asp Leu Phe Leu Ala Glu Glu 1205 1210 1215 Ile Phe Gln Thr Ala Lys Glu Thr Leu Gln Glu Leu Gln Cys Phe Cys 1220 1225 1230 Lys Tyr Leu Gln Arg Trp Arg Glu Ala Val Ala Ala Arg Lys Lys Phe 1235 1240 1245 Arg Arg Gln Met Arg Ala Phe Pro Ala Ala Pro Cys Cys Val Asp Val 1250 1255 1260 Asn Asp Arg Leu Gln Ala Leu Val Pro Ser Ala Glu Cys Pro Ile Thr 1265 1270 1275 1280 Glu Glu Asn Leu Ala Lys Gly Leu Leu Asp Leu Gly His Ala Gly Lys 1285 1290 1295 Val Gly Val Ser Cys Thr Arg Leu Arg Arg Leu Arg Asn Lys Thr Ala 1300 1305 1310 His Gln Ile Lys Val Gln His Phe His Gln Gln Leu Leu Arg Asn Ala 1315 1320 1325 Ala Trp Ala Pro Leu Asp Leu Pro Ser Ile Val Ser Glu His Leu Pro 1330 1335 1340 Met Lys Gln Lys Arg Arg Phe Trp Lys Leu Val Leu Val Leu Pro Asp 1345 1350 1355 1360 Val Glu Glu Gln Thr Pro Glu Ser Pr o Gly Arg Ile Leu Glu Asn Trp 1365 1370 1375 Leu Lys Val Lys Phe Thr Gly Asp Asp Ser Met Val Gly Asp Ile Gly 1380 1385 1390 Asp Asn Ala Gly Asp Ile Gln Thr Leu Ser Val Phe Asn Thr Leu Ser 1395 1400 1405 Ser Lys Gly Asp Gln Thr Val Ser Val Asn Val Cys Ile Lys Val Ala 1410 1415 1420 His Gly Thr Leu Ser Asp Ser Ala Leu Asp Ala Val Glu Thr Gln Lys 1425 1430 1435 1440 Asp Leu Leu Gly Thr Ser Gly Leu Met Leu Leu Leu Pro Pro Lys Val 1445 1450 1455 Lys Ser Glu Glu Val Ala Glu Glu Glu Leu Ser Trp Leu Ser Ala Leu 1460 1465 1470 Leu Gln Leu Lys Gln Leu Leu Gln Ala Lys Pro Phe Gln Pro Ala Leu 1475 1480 1485 Pro Leu Val Val Leu Val Pro Ser Ser Arg Gly Asp Ser Ala Gly Arg 1490 1495 1500 Ala Val Glu Asp Gly Leu Met Leu Gln Asp Leu Val Ser Ala Lys Leu 1505 1510 1515 1520 Ile Ser Asp Tyr Ile Val Val Glu Ile Pro Asp Ser Val Asn Asp Leu 1525 1530 1535 Gln Gly Thr Val Lys Val Ser Gly Ala Val Gln Trp Leu Ile Ser Gly 1540 1545 1550 Cys Pro Gln Ala Leu Asp Leu Cys Cys Gln Thr Leu Val Gln Tyr Val 1555 1560 15 65 Glu Asp Gly Ile Ser Arg Glu Phe Ser Arg Arg Phe Phe His Asp Arg 1570 1575 1580 Arg Glu Arg Arg Leu Ala Ser Leu Pro Ser Gln Glu Pro Ser Thr Ile 1585 1590 1595 1600 Ile Glu Leu Phe Asn Ser Val Leu Gln Phe Leu Ala Ser Val Val Ser 1605 1610 1615 Ser Glu Gln Leu Cys Asp Ile Ser Trp Pro Val Met Glu Phe Ala Glu 1620 1625 1630 Val Gly Gly Ser Gln Leu Leu Pro His Leu His Trp Asn Ser Pro Glu 1635 1640 1645 His Leu Ala Trp Leu Lys Gln Ala Val Leu Gly Phe Gln Leu Pro Gln 1650 1655 1660 Met Asp Leu Pro Pro Pro Gly Ala Pro Trp Leu Pro Val Cys Ser Met 1665 1670 1675 1680 Val Ile Gln Tyr Thr Ser Gln Ile Pro Ser Ser Ser Gln Thr Gln Pro 1685 1690 1695 Val Leu Gln Ser Gln Ala Glu Asn Leu Leu Cys Arg Thr Tyr Gln Lys 1700 1705 1710 Trp Lys Asn Lys Ser Leu Ser Pro Gly Gln Glu Leu Gly Pro Ser Val 1715 1720 1725 Ala Glu Ile Pro Trp Asp Asp Ile Ile Thr Leu Cys Ile Asn His Lys 1730 1735 1740 Leu Arg Asp Trp Thr Pro Pro Arg Leu Pro Val Thr Leu Glu Ala Leu 1745 1750 1755 1760 Ser Glu Asp Gly Gln Ile Cys Val Ty r Phe Phe Lys Asn Leu Leu Arg 1765 1770 1775 Lys Tyr His Val Pro Ser Ser Trp Glu Gln Ala Arg Met Gln Thr Gln 1780 1785 1790 Arg Glu Leu Gln Leu Ser His Gly Arg Ser Gly Met Arg Ser Ile His 1795 1800 1805 Pro Pro Thr Ser Thr Phe Pro Thr Pro Leu Leu His Val His Gln Lys 1810 1815 1820 Gly Lys Lys Lys Glu Glu Ser Gly Arg Glu Gly Ser Leu Ser Thr Glu 1825 1830 1835 1840 Asp Leu Leu Arg Gly Ala Ser Ala Glu Glu Leu Leu Ala Gln Ser Leu 1845 1850 1855 Ser Ser Ser Leu Leu Glu Glu Lys Glu Glu Asn Lys Arg Phe Glu Asp 1860 1865 1870 Gln Leu Gln Gln Trp Leu Ser Gln Asp Ser Gln Ala Phe Thr Glu Ser 1875 1880 1885 Thr Arg Leu Pro Leu Tyr Leu Pro Gln Thr Leu Val Ser Phe Pro Asp 1890 1895 1900 Ser Ile Lys Thr Gln Thr Met Val Lys Thr Ser Thr Ser Pro Gln Asn 1905 1910 1915 1920 Ser Gly Thr Gly Lys Gln Leu Arg Phe Ser Glu Ala Ser Gly Ser Ser 1925 1930 1935 Leu Thr Glu Lys Leu Lys Leu Leu Glu Arg Leu Ile Gln Ser Ser Arg 1940 1945 1950 Ala Glu Glu Ala Ala Ser Glu Leu His Leu Ser Ala Leu Leu Glu Met 1955 1960 19 65 Val Asp Met 1970 <210> 4 <211> 6429 <212> DNA <213> Mus <400> 4 gttgcggtgc ggtgggcccg gtagaggctg cacgcagact gtgggcgagc acaagcgctg 60 gcgacagtgg ccgtatctgg cggacttgct cctccctccg cggcctccgc tgtcccttgt 120 gtctttgccg agttgctgaa ggccttcact agtcttcgct cgaaggcgtc tgttaaccta 180 gcggccggct tccggagtgt taagcatcgg ggataaaaag ctattatttc tagaccaggg 240 catcgcaagt tcgagttacc gggagaaaaa tgagatggtc atcctgagga tgaaggagag 300 cttcccctgg caacagataa tttaaagagg agagctactt gtgtatagtc catatttatt 360 gccttcagat aattggcttg aag atg cac ccg gtg aac ccc ttc gga ggc agc 413 agc cca agt gct ttt gcg gta tct tcc agc acc acg gga aca tat cag 461 act aaa tca cca ttt cga ttt ggc cag cct tcc ctt ttt gga cag aac 509 agc aca ccc agc aag agc ctg gcg ttt tca caa gta cca agc ttt gca 557 aca ccc tct gga gga agc cat tct tcc tcc ttg cca gcc caa acc tca agt gtg gga ctc ttc tct agt ctc gaa tcc aca cct 653 tct ttc gca gct act tcg agt tcc tct gtg ccc ggc aat acg gca ttc 701 agc ttt aag tca acc tct agc gtt ggg gtt ttc cca agt ggc gct act 749 ttt ggg cca gaa acc gga gaa gta gca ggt tct ggc ttt cgg aag acg 797 gaa ttc aag ttt aaa cct ctg gaa aat gca gtc ttc aaa ccg ata ccg gca gag gag cag gag gag cag gag gag gag gag gag gag gag gcc acc cag agc cag att tct tct gga 893 ttt ttt aca ttt tcc cat ccc gtt ggt agc ggg tct gga ggc ctg acc 941 cct ttt tct ttc cca cag gtg aca aat agt tcg gtg act agc tca agt 989 ttt atc ttt act agt aat act cct gcc ttt gcc tct 1037 cct ttg tct aac caa aat gta gaa gaa gag aag agg gtt tct acg tca 1085 gcg ttt gga agc tca aac agt agc ttc agt act ttc ccc aca gcg tca 1ct cca gga ccc ttc cca gct aac aaa cca agc ctc cgc 1181 caa gga tgt gag gaa gcc atc tcc cag gtg gag cca ctt ccc acc ctc 1229 atg aag gga tta aag agg aaa gag gac cag gat cgc tcc ccg ag gaga 1277 gca gaa gac cct gat ccc ctg tcc agg ggc gac 1325 cat ccc cca gat aaa cgg cca gtc cgc ctc aac aga ccc cgg gga ggt 1373 act ttg ttt ggc cgg aca ata cag gag gtc ttc aaa agc aatca gat agca gat gat cgc ctg ggc agc aag gaa tcc aag gag agt ggc ttt gcg gaa 1469 cct ggg gaa agt gac cac gcg gcc gtc cca gga ggg agt cag tcc acc 1517 atg gta cct tcc cgc ctt cca gct gg g a g a g g g g gat gag aaa gaa gat tct ctc agg gga aag tct gtg cgc cag agt 1613 aag cga agg gaa gag tgg atc tac agc ctc ggg ggc gtg tct tct tta 1661 gag ctc aca gcc atc cag tgc aag aac atac 1c aga gcc atc ctg gag aaa cac ttc agc aaa atc gct aaa gtc cag cgg 1757 gtc ttc acc aga cgc agc aag aag ctc gcc gtg att cat ttt ttc gac 1805 cac gca tcg gca gcc gg gag agg agg aag ag 1853 gac gtg gtt atc ttt tgg cac aag aag aaa ata agt ccc agc aag aaa 1901 ctc ttt ccc ctg aag gag aag ctt ggt gag agt gaa gcc agc cag ggc 1949 atc gag gac tcc ccc ttt cag cac gcc gtg 1997 agg cct gca gcc ggc agc ctc ctc agc aaa agc tct cca gtg aag aag 2045 ccg agt ctt ctg aag atg cac cag ttt gag gcg gat cct ttt gac tct 2093 gga tct gag ggc tcc ggt tgg gc gtg tca tct ctt agc 2141 acc ctg ata ggg act gtg gca gac aca tct gag gag aag tac cgc ctt 2189 ctg gac cag aga gac cgc atc atg cgg caa gct cga gtg aag agg acg 2237 gac ttg gac gtt gcc ggg act tgc cct gac atg tgt 2285 ccc gag aag gag cgg tac ttg agg gag acc cgg agc cag ctg agc gtg 2333 ttt gaa gtt gtc cca ggg act gac cag gtg gac cat gca gca gcc gtg tcc tct ag gat cag gag gag ccc ctg cca cat 2429 gag ctg aga ccc tca gca gtt ctc agc agg acc atg gac tac ctg gtg 2477 acc cag atc atg gac caa aag gaa ggc agc ctt cgg gat tgg tat gac 2525 ttcc gc ggt ata cgg aag gac ata aca cag cag 2573 cac ctc tgt gat ccc ctg acg gtg tct ctg atc gag aag tgt acc cga 2621 ttt cac att cac tgt gcc cac ttt atg tgt gag gag cct atg tct tcc gac acc aat gag aac atg acc aag tgt cta cag agt 2717 ctg aag gag atg tac cag gac ctg agg aac aag ggt gtt ttt tgt gcc 2765 agt gaa gca gag ttt cag ggc tac aat gtc ctg ctt aat ctc aac ga 2813 g c att ttg aga gaa gtg cag cag ttc cac cct gac gtt agg aac 2861 tcc cca gag gtg aac ttc gct gtc cag gct ttt gct gca ttg aac agc 2909 aat aat ttt gtg aga ttt ttg tt ct g g tt c aaa ctg gtt aat gcg tgc ctg tta cac tgt tac ttt aat cag atc cgc aag gat gcc 3005 ctc cgg gca ctc aat gtt gct tat act gta agc aca cag cgc tct acc 3053 gtc ttc ccc ctg gat ggt gtc gtc gc gtc gtc gc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc gtc 3101 gaa gag gcg aca aac ttc ctc aat tac cat ggc ctc act gta gct gat 3149 ggc tgt gtt gag ctg aat cgg tcg gca ttc ttg gaa ccg gag gga tta 3197 tgc aag gcc agg agg tca gtg gg tag gt g tca 3245 gtt ggg gaa gtt gtg aat gga ggg ccg ttg ccc cct gtt cct cgc cat 3293 aca cct gtg tgc agc ttc aac tcc cag aat aag tac gtt gga gag agc 3341 ctg gct acg gag ctg ccc gc ctg ccc gc ctg ccc gc gg gac cca 3389 gca ggt ggt ggc aga gga gag gac tgt gag gca gag gtg gac ttg cca 3437 aca ttg gcg gtc ctc cca cag ccg cct cct gca tcc tca gcc acg ccg 3485 gcg ctt cat gtc cag cca cc gca gca ccc agc ctt ctc 3533 cag gcc tcc acg cag cct gag gtg ctg ctt cca aag cct gcg cct gtg 3581 tac tct gac tcg gac ctg gta cag gtg gtg gac gag ctc atc cag gag ggt gg gc gag ggt gg gg gag ggt gg gg gag ggt gg gag 3629 gct gg agc tcc gct ggg gca gcc tac 3677 gta gcc gca gct ctg ggc gtt tcc aat gct gct gtg gag gat ctg att 3725 act gct gcg acc acg ggc att ctg agg cac gtt gcc gct gag gaa gtt 3773 tcc atg ag gaga cg ag c ag gag gaa gag aag caa cga gct gag gag 3821 gaa cgg ttg aag caa gag aga gaa ctg atg tta act cag ctg agc gag 3869 ggt ctg gcc gca gag ctg aca gaa ctc acg gtg aca gag tgt gtg tg tg gtg tg cg tg gtg gag cag agt gca gta aaa ata gac cag aag 3965 gtc cgt gtg gcc cgc tgt tgt gaa gcc gtc tgt gca cac ctg gtg gat 4013 ttg ttt ctt gct gag gaa att ttc cag act gca aaa gag aca ctc cag 40c aag tat cta caa cgg tgg agg gag gct gtt 4109 gca gct cgg aag aaa ttc cgg cgt cag atg cgg gcc ttc cct gca gcg 4157 cca tgc tgt gtg gat gtg aat gac cgg ctg cag gca cta gtg ccc gc ag tgc ccc att act gag gag aac ctg gcc aag ggt ctt ttg gac 4253 ctg ggc cac gca ggc aaa gta ggc gtc tcc tgt acc agg ttg agg cgg 4301 ctt aga aac aag aca gct cac cag ata aag gtc ca cag ctg ctg agg aat gct gca tgg gca cct ctg gac ctg cca tcc att 4397 gtg tct gag cac ctc ccc atg aag cag aag cga agg ttt tgg aaa ctg 4445 gtg ctg gtg ttg cct gat gg cg gag gag gag gag cg gag gag cg 4493 aga ata cta gaa aac tgg cta aag gtc aaa ttc aca gga gat gac agc 4541 atg gtg ggt gac ata gga gat aat gct ggt gat atc cag acc ctc tca 4589 gtc ttt aat aca ctt agt agt aaa ggg gtt ca aac 4637 gtg tgt ata aag gtg gct cat ggc acc ctt agt gac agt gcc ctt gat 4685 gct gtg gag acc cag aag gac ctg ttg gga acc agt ggg ctc atg ctg 4733 ctg ctt ccc ccg aaa gg gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag gag ag gaa ctg 4781 tcc tgg ctg tcg gct tta ctg cag ctc aag cag ctt ctg cag gcc aag 4829 ccc ttc cag cct gcc ctg ccg ctg gtg gtc ctc gtg ccc agc tcc aga 4877 ggg gag gcc gc gc gg gg gg gg gg gg gg gg gg gg gg gag gcc gcc ggt ctg atg tta cag gat 4925 ttg gtt tca gcc aag ctg att tcc gat tac att gtt gtt gag att cct 4973 gac tct gtt aat gat tta caa ggc aca gtg aag gtt tct gga gca gtc cga tc gc ctg atc tgt gcc cta gac ctt tgc tgc cag 5069 acc ctt gtt cag tat gtt gag gat ggg atc agc cgc gag ttc agc cgt 5117 cgg ttt ttc cac gac agg aga gag agg cgc ctg gct agc ctg ccc tcc atgag acc ttg ttc aac agt gtg ctg cag ttc 5213 ctg gcc tct gtg gta tcc tct gag cag ctg tgt gac atc tcc tgg cct 5261 gtc atg gaa ttt gcc gaa gtg gga ggc agc cag ctg ctt cct cac cac gac gc cta gcg tgg ctg aaa caa gct gtg ctt 5357 ggg ttc cag ctt cca cag atg gac ctt cca ccc cca ggg gcc ccc tgg 5405 ctc cct gtg tgt tcc atg gtc att cag tac acc tcc cag att ccc agc cca cagg ccagca gtc ctc cag tcc cag gcg gag aac ctg ctg 5501 tgc aga aca tac cag aag tgg aag aac aag agc ctc tct cca ggc cag 5549 gag ttg ggg cct tct gtt gcc gag atc ccg tgg gat gac atc atc acc tgc atc aat cat aag ctg agg gac tgg aca ccc ccc agg ctc cct 5645 gtc aca tta gag gcg ctg agt gaa gat ggt caa ata tgt gtg tat ttt 5693 ttc aaa aac ctt tta aga aaa tac cac gtt ccc tc gc ctt gcc gcc aga atg cag acg cag cgg gaa ctg cag ctg agt cat gga cgt tcg 5789 ggg atg agg tcc atc cat cct cct aca agc act ttt cct act cca ttg 5837 ctt cat gta cac cag aaa ggg aag aaa aag gaa gag ag gag gg 5885 ggg agc ctc agt aca gag gac ctc ctg cgg ggg gct tct gca gaa gag 5933 ctc ctg gca cag agt ctg tcc agc agt ctt ctg gaa gag aag gaa gag 5981 aac aag agg ttt gaa gat caa ctt cag cag tgg tta tcg caa gac tca 6029 cag gca ttc aca gag tca act cgg ctt cct ctc tac ctc cct cag acg 6077 cta gtg tcc ttt cct gat tct atc aaa act cag acc atg gtg aaa aca 6125 tct aca agt cct cag aat tca gga aca gtt ag ca ttc tca 6173 gag gca tcc ggt tca tcc ctg acg gaa aag ctg aag ctc ctg gaa agg 6221 ctg atc cag agc tca agg gcg gaa gaa gca gcc tcc gag ctg cac ctc 6269 tct gca ctg gtg g atg gg g ctgtctgacg ggagacggat 6319 ctctaattca taatgctttg tctgtattca attgtgttat agatgctgtt ggaaatgtga 6379 ctattaatta tgcaaataaa ctttttgaat cattccaaaa aaaaaaccat 6429 <210> 5 <211> 20 <212> c ag <c> c <c> c <c> c <c> c <c> c <c> c <c> c <c> c <c> c <c> c <c> c> c <c> c> c> c> c> c> c> c> c> c> c> cg 212> DNA <213> Synthetic DNA <400> 6 ccgctcgagc ggggtaccac catggactgg aaagacgt 38 <210> 7 <211> 40 <212> DNa <213> Synthetic DNA <400> 7 ccgctcgagc gggaattccc tgaagtgaga ttttcaaagg 40

Claims (7)

[Claims] 1. A CALPP protein comprising the amino acid sequence of SEQ ID NO: 1 in the sequence listing. 2. An amino acid sequence comprising the amino acid sequence of SEQ ID NO: 1 in which one or more amino acids are deleted, substituted with another amino acid, or added with another amino acid, and the sequence of the sequence listing A CALPP protein which binds to a protein consisting of the amino acids 679 to 1028 of the amino acid sequence of No. 3. 3. A polynucleotide encoding the protein according to claim 1 or 2. 4. An antisense polynucleotide of the polynucleotide according to claim 3, or a derivative of the antisense polynucleotide. 5. The polynucleotide according to claim 3, comprising continuous 12 or more bases. 6. The polynucleotide according to claim 3, wherein the polynucleotide is chemically modified. 7. An antibody that recognizes the protein according to claim 1 or 2.