GB2367359A - Bacterial identification method using PCR - Google Patents

Abstract

A method of detecting whether a contaminating non-viral microorganism is present in a manufacturing process comprises: <SL> <LI>(a) contacting a sample taken from the said manufacturing process with a primer which is complementary to a region of a target nucleic acid which is specific to the said microorganism; <LI>(b) carrying out an amplification reaction to amplify any of the said target nucleic acid present in the said sample; and <LI>(c) thereby detecting whether the said target nucleic acid is present in or absent from the said sample. </SL> The method is used for detection of gram-negative water borne bacterium; specifically sphingomonas pavcimobilis, sphingomonas parapavcimobilis and brenvundimonas vesicularis, by amplification of the 165 rRNA gene.

Description

IDENTIFICATION METHOD

Field of the Invention The invention relates to detecting contaminating microorganisms in manufacturing processes.

Background of the Invention During bulk sterile manufacturing processes, such as the production of pharmaceutical preparations and sterile devices, it is important that no contaminating microorganisms are added during processing and there are no contaminants in the final product. Microorganisms may invade the manufacturing plant via a number of different routes. For example they may be present in the water supply to the plant, in raw material used in the manufacturing process or may be present in the local environment. A standard viability test involves culturing microorganisms present in samples taken from various stages of the manufacturing process. False positives and perhaps false negatives can occur. False positives may result if the microorganisms enter the samples at the sampling stage. False negatives may result, for example, if the microorganisms are rendered non-viable or non-culturable following harsh treatment during the manufacturing process or if the microorganisms enter the manufactured product at offload. False results obtained using the standard viability test may lead to contaminated products reaching the market or may result in unnecessary plant closure and withdrawal of uncontaminated material from the market place.

16S ribosomal RNA (rRNA) is highly conserved between different species of bacteria. Sequencing of 16S rRNA is therefore used widely to identify bacteria using non-specific primers. This has lead to a phylogenetic map being built up slowly which reveals a small amount of variation in the sequence of 16S rRNA between different species of bacteria. Sequence specific primers complementary to the 16S rRNA molecules have been used as hybridisation probes for the protection of a single species or strain of mycoplasm or of bacteria (WO88/03957). Methods of identifying microorganisms by hybridisation of probes to ribosomal RNA have been described. These methods take advantage of the high copy numbers of ribosomal

RNA present in cells to increase the sensitivity of the assay. However, these methods are not applicable to the identification of non-viable or non-culturable bacteria in which the copy number of rRNA molecules is significantly reduced.

Polymerase chain reaction (PCR) technology is a well-established technique for the quick and accurate amplification of specific sequences of DNA and have many applications in medical diagnostics and forensic science as well as biological research.

Summary of Invention The inventors have developed a method for detecting contaminating microorganisms in a manufacturing plant. The inventors have designed primers which specifically hybridise to part of a gene that is unique to a single species of bacteria and which can be used to amplify bacterial DNA of that species present in a sample taken from a manufacturing process.

More specifically, the inventors have developed a PCR based method to detect bacteria of the Sphingomonas paucimobilis species in a pharmaceutical manufacturing plant. The inventors have designed primers which specifically hybridise to part of the 16S rRNA gene and which specifically amplify a fragment of 349 base pairs from Sphingomonas paucimobilis DNA but not from DNA from other gram-negative water-borne bacteria such as Brevundimonas vesicularis, E. coli and other Sphingomonas. A Bevundimonas vesicularis sequence differs from the Sphingomonas paucimobilis sequence by only 3 bases in the primer target sequence.

Amplification of genomic DNA sequences from specific microorganisms which are known to be likely contaminants in a manufacturing process provides a rapid, accurate and sensitive assay for identifying contaminants. The amplification method developed by the inventors may be used to detect viable, viable but nonculturable and non-viable microorganisms. The invention thus provides a powerful method for detecting the presence of contaminants present in trace quantities in plant, waters and swabs etc. and so aid remediation. The invention also provides a method for the quick identification of viable contaminating organisms in fermentation streams, thus reducing quarantine times.

Accordingly, the invention provides:

a method of detecting whether a contaminating non-viral microorganism is present in a manufacturing process, the said method comprising : (a) contacting a sample taken from the said manufacturing process with a primer which is complementary to a region of a target nucleic acid which is specific to the said microorganism; (b) carrying out an amplification reaction to amplify any of the said target nucleic acid present in the said sample; and (c) thereby detecting whether the said target nucleic acid is present in or absent from the said sample; a kit for detecting whether a contaminating non-viral microorganism is present in or absent from a sample taken from a manufacturing process, the said kit comprising a primer complementary to a region of a target nucleic acid which is specific to the said microorganism and other means for amplifying the said target nucleic acid from a sample; and use of a primer to detect whether a contaminating non-viral microorganism is present in or absent from a sample taken from a manufacturing process, wherein the said primer comprises a sequence complementary to a nucleotide sequence specific to the said microorganism; a method of detecting Sphigomonas paucimobilis, the said method comprising : (a) contacting a test sample with a primer which is complementary to a region of a target nucleic acid which is specific to Sphigomonas paucimobilis ; (b) carrying out an amplification reaction to amplify any of the said target nucleic acid present in the said sample; and (c) thereby detecting whether the said target nucleic acid is present in or absent from the said sample; a method of detecting Brevundimonas vesicularis, the said method comprising : (a) contacting a test sample with a primer which is complementary to a region of a target nucleic acid which is specific to Brevundimonas vesicularis ; (b) carrying out an amplification reaction to amplify any of the said target nucleic acid present in the said sample; and

(c) thereby detecting whether the said target nucleic acid is present in or absent from the said sample ; use of a primer which is complementary to a region of a target nucleic acid which is specific to Sphigomonas paucimobilis to detect whether Sphigomonas paucimobilis is present in or absent from a sample; use of a primer which is complementary to a region of a target nucleic acid which is specific to Brevundimonas vesicularis to detect whether Brevundimonas vesicularis is present in or absent from a sample.

Description of sequences in Sequence Listing SEQ ID NO : 1 is the sequence of a 416 base pair fragment of the 16S ribosomal RNA gene from a newly identified strain of Sphingomonas paucimobilis ; SEQ ID NO : 2 is the sequence of a 427 base pair fragment of the 16S ribosomal RNA gene from a newly identified strain of Brevundomonas vesicularis ; SEQ ID NO: 3 is the sequence of a 20 base pair primer specific for the 16S ribosomal RNA gene from Sphingomonas paucimobilis ; and SEQ ID NO: 4 is the sequence of a 23 base pair primer specific for the 16S ribosomal RNA gene from Sphingomonas paucimobilis.

Detailed description of the invention The present invention is concerned with the detection of contaminants in manufacturing processes. The present invention provides a method of detecting whether a contaminating non-viral microorganism is present in a manufacturing process, the said method consisting essentially of amplifying a target nucleic acid from the said microorganism from a sample taken from the said manufacturing process using a primer complementary to a region of the target nucleic acid which is specific to the said microorganism. The method of the present invention consists essentially of the following steps: (a) contacting a sample taken from the manufacturing process with a primer which is complementary to a region of a target nucleic acid which is specific to the said microorganism ;

(b) carrying out an amplification reaction to amplify any of the said target nucleic acid present in the said sample ; and (c) thereby detecting whether the said nucleic acid is present in the said sample and determining whether the said microorganism is present in the said manufacturing process.

The present invention provides a method for the rapid detection of non-viral microorganisms present in trace amounts, even if the microorganisms are nonculturable or non-viable. A microorganism may be rendered non-viable or nonculturable by extreme conditions such as high temperatures, nutrient deprivation or dessication. Preferably from 5 to 20, more preferably from 7 to 15, cells of the microorganism must be present in the test sample taken from the manufacturing process.

Preferably the method of the invention is used to detect adventitious non-viral microorganisms. The method of the invention may be used to detect procaryotic or eukaryotic microorganisms. Preferably the method of the invention is used to detect contaminating yeast or fungi, or more preferably bacteria. Preferably a fungus detectable by the method of the present invention is one that produces harmful secondary metabolites, for example mycotoxins.

The method provided by the present invention may be used to detect the presence of bacteria in general, or to detect bacteria of a specific genus, specific species or specific strain. Where there is a high risk of contamination with one or more specific bacteria, each bacteria can be specifically detected using primers specific for DNA unique to that bacteria, thus enabling the quick identification of the contaminant.

Preferably the microorganism detectable by a method of the invention is a gram-negative water born bacteria. Preferably the microorganism is Penicllium

chrysogenum, Acremonium ochraceum, Aphanocladium album, Apiospora mongagnei, Rhodotorula mucilaginosa, Hirtsutella sp., Geotrichum sp., Aspergillus fumigatus, Aspergillu flavus, Aspergillus sydowii, Paecilomyces lilacinus, Penicillium waksmanii Zaleski, Salmonella typhimurium, Mucor hiemalis, Aci. baumannii/calcoaceticus, Acinetobacter baumanii, Acinetobacter lwq, Acinetobacter spp, Acinetobacter spp, Aerococcus viridans, Aeromonas hydrophila,

A lc. xylo. ssp xylo, Alcaligenes sp., Aspergillus terreus, Aureo. spp/Coryn. aq., Bacillus badius, Bacillus Brevis, Bacillus megaterium, Bacillus cereus, Bacillus macerans, Bacillus megaterium, Bacillus sphaericus, Bacillus sphaericus, Chryseomonas luteola, Chyrsomooas luteola, Citrobacter sp, Coryn. jeic/Mm/Coryn. argentorat, Flavi. oryzihabitans or Ochrobac. anthropi, Lc. lactis lactis, Methylobacterium sp., Micrococcus spp, Ochrobactrum anthropi, Ochrobactrum anthropi Ps. paucimobilis, Ochrobactrum anthropi Ps. paucimobilis, Paecilomyces variotii, Penicillium citrinum, Penicillium simplicissimum, Penicillium simplissimum, Ps. mesophilica, Pseudomonas pickettii, Staph. warneri, Staphylococcus epidermidis, Staphylococcus warneri, Trichosporon beigelii or Xantho. maltophilia More preferably the microorganism is Sphigomonas paucimobilis, Sphigomonas parapaucimobilis or Brevundimonas vesicularis.

The present invention provides a method for the detection of microorganisms in a process for the production of a sterile or aseptically produced product. The production process is typically, but not necessarily, a bulk manufacturing process.

Preferably the process is for the production of sterile pharmaceutical preparations.

More preferably the process is for the preparation of a sterile active pharmaceutical ingredient or of a sterile pharmaceutical formulation or device such as a liquid or powder vial. The pharmaceutical formulation or active pharmaceutical ingredient may be produced by microbial fermentation. Preferably, the sterile pharmaceutical ingredient is one to which gram-negative water borne bacteria are resistant, for example an antibiotic such as a cephalosporin or penicillin. Typically the microorganism is not a host cell used for the production of pharmaceuticals such as DNA plasmids for use in gene therapy.

A microorganism may enter the manufacturing process through contaminated raw materials, a contaminated water supply, contaminated equipment, contamination on workers at the processing plant or as a result of inadequate cleaning procedures within the processing plant.

The source of the contaminating organism may be monitored by carrying out the method of the invention on samples taken from different stages of the manufacturing process. For example, the final product may be monitored for the. presence of a contaminating organism. The manufactured product may also be monitored for the presence of a contaminating organism at intermediate stages. Raw materials for use in the manufacture may also be tested to determine whether they contain contaminating microorganisms. All equipment and other material entering the processing plant may also be monitored for the presence of a contaminating organism.

The detection method provided by the invention may be carried out on samples from anywhere in the processing environment or from any stage during the manufacturing process. This enables the source of the contaminant to be readily identified which in turn facilitates eradication of the contaminant.

Samples taken from different stages of the manufacturing process will differ greatly in their physical characteristics. Samples include liquid samples, dry powders, swabs and filters. The amplification reaction may be carried out directly on a sample where possible, such as on a liquid sample. Any suitable nucleic acid extraction and isolation methods may be used to obtain samples suitable for use in aa amplification reaction.

The amplification reaction is preferably carried out using the polymerase chain reaction (PCR). PCR amplification may be carried out by any known method of PCR (see for example PCR Methods and Applications 3,268-71 (1994) and Proc.

Natl. Acad. Sci. 85,4397-4401 (1998) ).

The PCR conditions may require optimisation. Factors such as temperature, primer, nucleotides, salt concentration and cycle number and choice of polymerase enzyme may be varied in a series of amplification reactions carried out on DNA from a given microorganism to determine the optimum conditions. Typically, the optimum conditions chosen will be the conditions under which the PCR amplification reaction amplifies DNA from a specific microorganism but not from other closely related organisims.

A PCR amplification reaction may typically be carried out in 2mM MgCl2 with 240 fg DNA using Taq polymerase. Samples are typically first heated to 94 C for 5 minute then cycled 35 times through 94 C for 30 seconds, SSOC for 30 seconds and tic for 30 seconds before holding at 72 C for 7 minutes and cooling to 4Oc.

PCR products may be visualised on an agarose gel.

In addition to standard PCR reactions, quantitative PCR, nested PCR and fluorescence based PCR methods may be used.

For example, the presence of the microorganism may be determined using a fluorescent dye and quenching agent-based PCR assay such as the Taqman PCR detection system. In brief, this assay uses a microorganism specific primer. The specific primer is labelled with a fluorescent dye at its 5'end, a quenching agent at its 3'end and a 3'phosphate group preventing the addition of nucleotides to it.

Normally the fluorescence of the dye is quenched by the quenching agent present in the same primer. The allele specific primer is used in conjunction with a second non-specific primer capable of hybridising to the nucleic acid 5'to the first primer.

In the assay, when the allele comprising the polymorphism is present Taq DNA polymerase adds nucleotides to the non-specific primer until it reaches the specific primer. It then releases polynucleotides, the fluorescent dye and quenching agent from the specific primer through its endonuclease activity. The fluorescent dye is therefore no longer in proximity to the quenching agent and fluoresces. In the presence of the allele which does not comprise the polymorphism the mismatch between the specific primer and template inhibits the endonuclease activity of Taq and the fluorescent dye is not release from the quenching agent. Therefore by measuring the fluorescence emitted the presence or absence of the contaminating microorganism can be determined.

Where the levels of DNA in the sample are low, nested PCT may be used to increase the sensitivity of the PCR assay. Nested PCR involves a two stage amplification reaction, or a PCR stage followed by a hybridisation stage.

Quantitative PCR can be achieved using a number of different approaches, such as comparison to an external standard, most probable number (MPN) -PCR, co- amplification of an internal standard and competitive PCR (Jansson and Lesser (1996) Molecular Microbial Ecology Manual ed. Akkermans, van Elsas and de Bruijn pp. 2.7. 4., 1-19). A typical quantitative PCR reaction involves the addition of a known amount of a competitor DNA to the amplification reaction. The competitor DNA is capable of being amplified by the same primers as the DNA target from the microorganism being tested for but is designed to produce a PCR amplification product of a different length to the product produced by amplification of target DNA.

Comparison of the amounts of the different PCR products produced from the competitor and target DNAs enables quantification of the amount of target DNA present in the sample. Alternatively the competitor DNA may contain a restriction enzyme site not present in the target DNA and a restriction enzyme digest may be carried out on the PCR products to produce DNA fragments of different lengths for comparison.

Where the target nucleic acid is present at a high copy number in the test sample taken from the manufacturing process, hybridisation of the primer to the target DNA may be used to detect the presence of the contaminating microorganism.

Hybridisation techniques and conditions are well known in the art (see Sambrook et al (1989) Molecular Cloning: A Labaratory Manual). Typically hybridisation reactions are carried out at low stringency where it is desired to detect more than one microorganism and at a high stringency when only a specific species or strain is of interest.

The target nucleic acid for amplification in the PCR reaction is preferably genomic DNA. Any DNA sequence that is unique to the microorganism of interest may be amplified. Typically the DNA sequence will be the sequence of a gene of which the sequence from a large number of microorganisms has been determined.

Preferably the DNA sequence is that of a ribosomal gene, such as the gene for 5S rRNA or 23S rRNA. More preferably the DNA sequence is that ofthel6S rRNA gene where the microorganism is prokaryotic. Sequences from the 16S ribosomal RNA genes of a strain of Sphigomonas paucimobilis and of a strain of Brevundomonas vesicularis are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively. Where the microorganism is eukaryotic it is preferred that the target DNA sequence is that of the 18S rRNA gene.

The primer for use in the PCR amplification reaction is capable of hybridising to the target nucleic acid. The nucleotide sequence of the primer is designed to be complementary to the nucleotide sequence of the target nucleic acid.

The design of the primer is determined by comparative analysis of gene sequences from a large number of microorganisms. The public databases EMBL Genbank and the Ribosomal Database Project contain a large amount of sequence information which may be used for the comparative analysis of gene sequences.

Typically the sequence of a gene is compared between different microorganisms and conserved and variable regions are determined. A primer for use in detecting a large number of different microorganisms, for example bacteria in general, is designed to be complementary to the conserved regions of a gene. A primer for use in detecting microorganisms of a single genus is designed to be complementary to variable regions of a gene that are distinct between different genera but conserved in all members of the genus of interest. A primer for use in detecting microorganisms of a single species is designed to be complementary to variable regions of a gene that are distinct between different species but conserved in all members of the species of interest. A primer for use in detecting microorganisms of a single strain is designed to be complementary to variable regions of a gene that are unique to the strain of interest.

Comparative analysis of sequences from different microorganisms may be performed by any suitable method. The UWGCG Package, for example, provides the BESTFIT program which can be used to line up sequences (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395).

The PILEUP and BLAST algorithms can be used to line up sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J Mol Evol 36: 290-300 ; Altschul, S, F et al (1990) J Mol Biol 215 : 403-10.

Software for performing BLAST analyses is publicly available through the National Centre for Biotechnology Information (http ://www. ncbi. nlm. nih. gov/). This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments ; or the end of either sequence is reached.

The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.

The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e. g. , Karlin and Altschul (1993) Proc. Na. 4cad. Sci.

USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N) ), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0. 01, and most preferably less than about 0. 001.

A typical primer is from 10 to 50, preferably from 15 to 40, more preferably from 20 to 30 nucleotides in length. Typically a specific primer will be complementary to a region of a gene that has from 2 to 50 bases, preferably from 2 to 40,2 to 30, 2 to 20 or 3 to 10 bases that differ from genes of other microorganisms that are not of interest.

The nucleotide sequence of a primer for use in a method of the invention is typically complementary to the sequence of the target nucleic acid. The primer may be only partially complementary to the target sequence. For example, the primer may have from 1 to 4, for example 2 or 3, bases that are not complementary to the target sequence provided that under the conditions used in the PCR reaction the primer hybridises specifically to the target DNA and not to DNA sequences of other microorganisms. Preferably the primer is totally complementary to the target sequence.

It is preferred that the region of the target nucleic acid to which the primer is complementary is unique to the microorganism or group of microorganisms of interest.

Where the method of the invention is used to detect the presence a number of different microorganisms, such as bacteria in general, or all bacteria of a given genus

or species, the PCR products obtained may be sequenced (using strain, species or genus specific sequencing primers) to identify the contaminating microorganism.

The present invention provides a kit for carrying out a method of the invention. A kit for detecting whether a microorganism is present in a manufacturing process consists essentially of a primer complementary to a sequence which is unique to a target nucleic acid of the said microorganism and other means for amplification of the said target nucleic acid. Other means may include one or more buffer solutions and/or a polymerase, which is preferably a heat stable polymerase such as Taq polymerase.

The present invention provides the use of a primer to detect whether a contaminating microorganism is present in a manufacturing process, wherein said primer comprises a sequence complementary to a nucleotide sequence specific to said microorganism.

The present invention further provides the use of a PCR reaction to detect whether a contaminating microorganism is present in a manufacturing process, wherein said PCR reaction utilises a primer which comprises a sequence complementary to a nucleotide sequence specific to said microorganism.

The present invention also provides a method of specifically detecting a bacteria of the Sphigomonas paucimobilis or Brevundimonas vesicularis species, said method comprising: (a) contacting a test sample with a primer which is complementary to a region of a target nucleic acid which is specific to Sphigomonas paucimobilis or

Brevundimonas vesicularis ; (b) carrying out an amplification reaction to amplify any of the said target nucleic acid present in the said sample; and (c) thereby detecting whether the said target nucleic acid is present in the said sample.

The present invention also provides a kit for detecting whether bacteria of the Sphingomonas paucimobilis species are present in a sample and a kit for detecting whether a bacteria of the Brevundimonas vesicularis species are present in a sample.

A kit for detecting whether a bacterium of the Sphingomonas paucimobilis species is present in a sample consists essentially of a primer complementary to a sequence

specific to Sphingomonas paucimobilis and means for PCR amplification of a target nucleic acid. A kit for detecting whether a bacterium of Brevundimonas vesicularis species is present in a sample consists essentially of a primer complementary to a sequence specific to Brevundimonas vesicularis and means for PCR amplification of a target nucleic acid.

The invention provides the use of a primer which is complementary to a region of a target nucleic acid which is specific to Sphingomonas paucimobilis to detect whether a bacterium of the Sphingomonas paucimobilis species is present in or absent from a sample. Preferably the primer is specific to the 16S rRNA gene sequence of the newly identified strain of Sphingomonas paucimobilis shown in SEQ ID NO: 1. More preferably the primer has the sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4. Typically the primer is used in an amplification reaction to detect the presence of Sphingomonaspaucimobilis.

The invention provides the use of a primer which is complementary to a region of a target nucleic acid which is specific to Brevundimonas vesicularis to detect whether a bacterium of the Brevundimonas vesicularis species is present in or absent from a sample. Preferably the primer is specific to the 16S rRNA gene sequence of the newly identified strain of Brevundimonas vesicularis shown in SEQ ID NO: 2. Typically the primer is used in an amplification reaction to detect the presence of Brevundimonas vesicularis.

The present invention also provides the use of a PCR reaction to detect whether a sample is contains DNA of a bacterium of the Sphingomonas paucimobilis species or of the Brevundimonas vesicularis species. Preferably the PCR reaction is used to amplify the DNA of 16S rRNA genes from the strain of Sphingomonas

paucimobilis shown in SEQ ID NO : 1 or the strain of Brevundimonas vesicularis shown in SEQ ID NO : 1.

The following Examples illustrate the invention.

Example 1: Primer Design

The 16S ribosomal RNA (rRNA) sequence of a newly identified strain of Sphingomonaspaucimobilis was compared to rRNA sequences from other organisms (including the closely related newly identified strain of Brevundimonas vesicularis) and analysis of the variant regions of the sequence led to the design of two PCR primers : PAUC15'ACATGCAAGTCGAACGATGC3'and PAUC2 5'TACAACCCTAAGGCCTTCATCAC 3'.

Example 2: PCR Development Genomic DNA was prepared from cell cultures of Sphingomonas paucimobilis, Brevundimonas vesicularis, E. coli NM522 and Pseudomonas putida by standard techniques.

The following PCR reactions were set up in a volume of 50 ul : Primary buffer (2mM MgC12) 44gel Primer PAUC1 1.5 l Primer PAUC2 1. 5 l

DNA* 2 l Taq polymerase (Qiagen) (5U/il) 0. 5 Ill * 20 ng, 8 ng, 2 ng, 800 pg, 200 pg or 80 pg Sphingomonaspaucimobilis DNA.

The samples were first heated to 940 C for 5 minutes. The samples were then heated to 94 C for 30 seconds, cooled to 55 C for 30 seconds and heated to tic for 30 seconds. These three steps were repeated 25 times before holding at 72 C for 7 minutes and cooling to 4 C.

A PCR product of 349 base pairs was obtained, with 80pg DNA producing a clearly visible product on an agarose gel.

The PCR reaction was repeated adding 800 pg Sphingomonas paucimobilis DNA and similar amounts of Brevundimonas vesicularis (the 16S rRNA gene of which differs from the 16S rRNA gene of Sphingomonas paucimobilis by only 3

bases in the primer target sequence) E coli NM522 and Pseudomonas putida DNA in parallel reactions. A PCR product was only observed with Sphingomonas paucimobilis DNA.

The sensitivity of the PCR amplication was tested by repeating the reaction with a series of dilutions (NIL, 12 fg, 120 fg, 1.2pg, 12 pg and 120 pg) of Sphingomonas paucimobilis DNA and calculating the minimal amount of DNA

required to produce a visible product. Inclusion of 1. 2 pg in a 50 JlI PCR reaction to which 10 u. l gel loading buffer was added before loading 5 u. l of the 60 u. l sample on an agarose gel produced a clearly visible PCR product on the gel. This means that approximately 100 fg of the PCR product is detectable. Up to 25 u. l of a sample can be loaded on a gel. Therefore, the minimal amount of DNA required for the PCR amplification reaction would be 100 (60/25) = 240 fg. Each cell contains approximately 17 fg DNA. Therefore a minimum of 14 cells per sample are required to detect the presence of of Sphingomonas paucimobilis DNA by this method.

Example 3: Comparison of PCR from bacteria, from filter-bound bacteria, from filter-bound DNA and from DNA in solution.

The PCR reaction was carried out as described in Example but 35 cycles were carried out. Neat Sphingomonas paucimobilis culture, 0. 22um (NC) filterbound Sphingomonas paucimobilis culture, Sphingomonas paucimobilis DNA in solution and 0. 22 m (NC) filter-bound bound Sphingomonas paucimobilis DNA were added to parallel PCR reactions.

Good PCR products were obtained with DNA in solution and with neat bacterial cultures but no PCR product was visible for samples bound to filters.

By carrying out PCR reactions to which DNA in solution and either wet or dry filters had been added it was discovered that the presence of the filter inhibited the PCR reaction. Eluates containing the bound material from various filters including hydrophobic filters, such as 0. 22jam GVHP Durapore filters, and hydrophilic filters, such as NC and CA NA NON ST filters with pore diameters of 0. 22 m, 0. 45u. m or 0. 1 u. m, were found to contain DNA that could be amplified by PCR. DNA equivalent to that obtained from only 7 to 8 cells was sufficient to produce a detectable PCR product using DNA eluted from a 0. 22 m GVHP Durapore membrane filter.

SEQUENCE LISTING

< 110 > GLAXO GROUP LTD.

< 120 > IDENTIFICATION METHOD < 130 > P79834 < 140 > < 141 > < 160 > 4 < 170 > PatentIn Ver. 2.1 < 210 > 1 < 211 > 416 < 212 > DNA < 213 > Sphingomonas paucimobilis < 400 > 1 ggcatcctaa cacatgcaag tcgaacgatg ccttcgggca tagtggcgca cgggtgcgta 60 acgcgtggga atctgcccct gggttcggaa taacagcgag aaattgctgc taataccgga 120 tgatgacgaa agtccaaaga tttatcgccc agggatgagc ccgcgtagga ttagctagtt 180 ggtgaggtaa gagctcacca aggcgacgat ccttagctgg tctgagagga tgatcagcca 240 cactgggact gagacacggc ccagactcct acgggaggca gcagtgggga atattggaca 300 atgggcgaaa gcctgatcca gcaatgccgc gtgagtgatg aaggccttag ggttgtaaag 360 ctcttttacc cgggatgata atgacagtac cgggagaata agctccggct aactcc 416 < 210 > 2 < 211 > 427 < 212 > DNA < 213 > Brevundimonas vesicularis < 400 > 2 cgaacgctgg cggcaggcct aacacatgca agtcgaacga actcttcggg agttagtggc 60

ggacgggtga gtaacacgtg ggaacgtgcc tttaggttcg gaataactca gggaaacttg 120 tgctaatacc gaatgtgccc ttcgggggaa agatttatcg cctttagagc ggcccgcgtc 180 tgattagcta gttggtgagg taaaggctca ccaaggcgac gatcagtagc tggtctgaga 240 ggatgatcag ccacattggg actgagacac ggcccaaact cctacgggag gcagcagtgg 300 ggaatcttgc gcaatgggcg aaagcctgac gcagccatgc cgcgtgaatg atgaaggtct 360 taggattgta aaattctttc accggggacg ataatgacgg tacccggaga agaagcccgg 420 ctaac 425 < 210 > 3 < 211 > 20 < 212 > DNA < 213 > Sphingomonas paucimobilis < 400 > 3 acatgcaagt cgaacgatgc 20 < 210 > 4 < 211 > 23 < 212 > DNA < 213 > Sphingomonas paucimobilis < 400 > 4 tacaacccta aggccttcat cac 23

Claims (26)

1. CLAIMS 1. A method of detecting whether a contaminating non-viral microorganism is present in a manufacturing process, the said method comprising: (a) contacting a sample taken from the said manufacturing process with a primer which is complementary to a region of a target nucleic acid which is specific to the said microorganism; (b) carrying out an amplification reaction to amplify any of the said target nucleic acid present in the said sample; and (c) thereby detecting whether the said target nucleic acid is present in or absent from the said sample.
2. 2. A method according to claim 1 wherein said microorganism is nonviable or non-culturable.
3. 3. A method according to claim 1 or 2 wherein said microorganism is a bacterium.
4. 4. A method according to claim 3, wherein said bacterium is a gramnegative water borne bacterium.
5. 5. A method according to claim 3 or 4, wherein said bacterium is

   Sphigomonas paucimobilis, Sphigomonas parapaucimobilis or Brevundimonas vesicularis.
6. 6. A method according to claim 1 or 2 wherein said microorganism is a fungus.
7. 7. A method according any one of the preceding claims wherein said nucleic acid is DNA.
8. 8. A method according to claim 7 wherein said DNA comprises a ribosomal gene.
9. 9. A method according to claim 8, wherein the said ribosomal gene is 16S RNA.
10. 10. A method according to claim 8, wherein the said ribosomal gene is 18S RNA.
11. 11. A method according to any one of the preceding claims, wherein the said primer is species-specific.
12. 12. A method according to any one of claims 1 to 10, wherein the said primer is strain-specific.
13. 13. A method according to claim 11, wherein the said bacterium is Sphigomonas paucimobilis and the said amplification is carried out using the following primers: 5'ACATGCAAGTCGAACGATGC3' 5'TACAACCCTAAGGCCTTCATCAC 3'.
14. 14. A method according to any one of the preceding claims, wherein the said amplification reaction is a Polymerase chain reaction (PCR).
15. 15. A method according to any one of the preceding claims, wherein the said manufacturing process is the manufacture of a sterile or aseptically produced product.
16. 16. A method according to any one of the preceding claims, wherein the said manufacturing process is the manufacture an active pharmaceutical agent.
17. 17. A method according to claim 16, wherein said pharmaceutical agent is one to which gram-negative water borne bacteria are resistant.
18. 18. A method according to any one of claims 1 to 15, wherein said manufacturing process is the manufacture of a sterile device or sterile formulation.
19. 19. A method according to any one of the preceding claims, wherein the said sample is a sample of the final product, a sample of an intermediate product, a sample of a raw material, a sample of the water supply, a sample of any other material entering the processing plant or a swab of the production area.
20. 20. A kit for detecting whether a contaminating non-viral microorganism is present in or absent from a sample taken from a manufacturing process, the said kit comprising a primer complementary to a region of a target nucleic acid which is specific to the said microorganism and other means for amplifying the said target nucleic acid from a sample.
21. 21. Use of a primer to detect whether a contaminating non-viral microorganism is present in or absent from a sample taken from a manufacturing process, wherein the said primer comprises a sequence complementary to a nucleotide sequence specific to the said microorganism.
22. 22. A method of detecting Sphigomonas paucimobilis, said method comprising : (a) contacting a test sample with a primer which is complementary to a region of a target nucleic acid which is specific to Sphigomonas paucimobilis ; (b) carrying out an amplification reaction to amplify any of the said target nucleic acid present in the said sample; and (c) thereby detecting whether the said target nucleic acid is present in or absent from the said sample.
23. 23. A method of detecting Brevundimonas vesicularis, said method comprising : (a) contacting a test sample with a primer which is complementary to a region of a target nucleic acid which is specific to Brevundimonas vesicularis ; (b) carrying out an amplification reaction to amplify any of the said target nucleic acid present in the said sample; and (c) thereby detecting whether the said target nucleic acid is present in or absent from the said sample.
24. 24. Use of a primer which is complementary to a region of a target nucleic acid which is specific to Sphigomonas paucimobilis to detect whether Sphigomonas paucimobilis is present in or absent from a sample.
25. 25. Use of a primer which is complementary to a region of a target nucleic acid which is specific to Brevundimonas vesicularis to detect whether Brevundimonas vesicularis is present in or absent from a sample.
26. 26. A method according to claim 22 or 23 or a use according to claim 24 or 25, wherein the said target nucleic acid is the DNA encoding 16S ribosomal RNA.