FR2851249A1 - Using VE-statins to inhibit recruitment of perivascular smooth muscle cells, for treating e.g. cancer and retinopathy, also new VE-statins, related nucleic acids and antibodies - Google Patents

Abstract

Use of a protein designated VE-statin (I) in preparation of a composition for inhibiting recruitment of perivascular cells of smooth muscle type. Use of a protein designated VE-statin (I) in preparation of a composition for inhibiting recruitment of perivascular cells of smooth muscle type. (I) is (a) a 275 amino acid (aa) sequence (1), murine VE-statin; (b) sequences with at least 70, best 95, % identity or at least 85, best 99, % similarity with (1); (c) the n-275 regions of (1), where n = 17-24; (d) a 255 aa sequence (2) or 254 aa sequence (3), the mature forms of murine and human VE-statins; (e) a 273 aa sequence (42), NCBI NP-057299, human VE-statin; and (f) the m-273 regions of (42), where m = 16-23. Independent claims are also included for: (1) isolated, purified VE-statins of sequence (a) or of item (b) above, excluding those with accession numbers AAF01322, NP-057299, BAB22222 and AAH12377; (2) a peptide fragment (II) of item (1) containing at least 7 aa; (3) isolated nucleic acid (III) that encodes proteins of (1) or is a 1539 bp sequence (d), encoding human VE-statin, also their complements, sense or antisense; (4) primers and probes that are fragments of at least 8 bp of (III), excluding the expressed sequence tag BI910383 and the cDNA fragment NM-016215; (5) recombinant vector that includes (III) or the fragments of (4) as an insert; (6) cells transformed with the vector of (5); (7) antibody (Ab) directed against the proteins of (1) or peptides of (2); (8) transgenic non-human animals containing cells transformed by (II); and (9) method of screening for agonists or antagonists of the proteins of (A). ACTIVITY : Cytostatic; Ophthalmological; Vasotropic; Antiarteriosclerotic. No details of tests for these activities are given. MECHANISM OF ACTION : VE-statins, soluble factors secreted by endothelial cells of the blood vessels, block recruitment of perivascular smooth muscle cells (but do not affect their proliferation), so inhibit angiogenesis.

Description

<Desc / Clms Page number 1>

 The present invention relates to a new soluble factor secreted by the endothelial cells of blood vessels, capable of blocking the recruitment of perivascular cells of the smooth muscle type, and to its applications, in particular for the treatment of pathologies such as cancer, retinopathies , atherosclerosis and restenosis.

 The invention encompasses the nucleic acids encoding said factor (genomic DNA and cDNA), the probes and primers derived therefrom, the corresponding protein and the peptide fragments and derived antibodies, as well as their applications.

 The process of angiogenesis results in the formation of new vessels from the vascular system, in response to many angiogenic factors. The capillaries in formation are composed essentially of endothelial cells and their stabilization, as well as their maturation into functional vessels, depend on the recruitment and interaction with perivascular cells composed of smooth muscle cells (SMCs) and pericytes (Carmeliet, Nat. Med., 2000, 6, 389-395). The complex molecular dialogue that occurs during this process is essential for the maintenance or pruning of neo-formed capillaries. Several molecules produced by each of the two cell types (endothelial cells and perivascular cells), which participate in these interactions have been identified: endothelial cells produce chemotactic, growth and survival factors [PDGF (Platelet-Derived growth factor: Zerwes et al. al., J. Cell Biol., 1987, 105, 2037-2041) and FGFs (Fibroblast Growth Factors: Schweigerer et al., Nature, 1987, 325, 257-259) that recruit smooth muscle cells to vessels neo-trained (Conway et al., Cardiovasc Res., 2001, 49, 507-521). Perivascular cells produce growth factors and chemotactic factors for endothelial cells such as VEGF (Vascular Endothelial Growth Factor: Ferrara et al., Growth factors, 1991, 5, 141-148) and FGF-2 (Winkles et al. al., PNAS, 1987, 84, 7124-7128), which participate in the initial formation and progression of the capillaries, and probably in the maturation of the capillaries. Perivascular and endothelial cells also produce angiopoietin 1 and 2 (Davis et al., Cell, 1996, 87, 1161-1169, Maisonpierre et al., Science, 1997, 277, 55-60, Witzenbichler et al. J. Biol Chem., 1998, 233, 18514-18521), which interact with the specific Tie-2 endothelial cell receptor and

<Desc / Clms Page number 2>

 opposite roles in the cohesion and survival of endothelial cells (Maisonpierre et al., supra), depending on the availability of VEGF (Lobov et al., P. N.A.S., 2002.99, 11205-11210). Perivascular cells also produce TGF-β (Transforming Growth Factor ss) which, after activation by cell contacts, inhibits proliferation and migration of endothelial cells (Orlidge et al., J. Cell Biol., 1987,105, 1455-1462, Sacchi et al., Oncogene, 1991, 6, 2149-2154, Sato et al., J. Cell Biol., 1989, 109, 309-315, Sato et al., J. Cell Biol. , 1990, 11, 757-763), induces differentiation of smooth muscle cells and extracellular matrix secretion, thereby stabilizing blood vessels (Dickson et al., Development, 1995, 121, 1845-1854, Li et al. Science, 1999, 284, 1534-1537). Direct contacts between perivascular cells and endothelial cells, and with the extracellular matrix also participate in this dialogue.

 Thus, the formation of a locally stable and functional vascular tree depends on all these complex interactions and the disruption of these exchanges has major pathological consequences, for example: in atherosclerosis, the recruitment and proliferation of cells Smooth muscle and damaged endothelium are the key factors of the initial lesion (Behrendt et al., Am. J. Cardiol., 2002, 90.40L-48L), - in solid tumors, the formation of an irregular vascular network and poorly structured is partly the result of a lack of coordination between these cells (Carmeliet, Nature, 2000, 407, 249-257).

 Among the molecules that have been identified, several growth factors and chemotactic factors are capable of inducing the initial recruitment and proliferation of smooth muscle cells around the capillaries (Berk, Physiol.

Rev., 2001, 81, 999-1030). Other factors suppress both proliferation and recruitment of perivascular smooth muscle cells, including TGF-β (Bjorkerud et al., Arterioscler, Thromb., 1991, 11, 892-902), tumor suppressor factor. PTEN (Huang et al., Arterioscl, Thromb Vase, Biol., 2002, 22, 745-751) and sphingosine 1-phosphate (Payne et al., FEBS Letter, 2002, 531, 54-57). , the factors that decrease and to the extreme specifically suppress the recruitment of smooth muscle cells when the blood vessels reach their maturity have not been identified.

<Desc / Clms Page number 3>

 Endothelial cells form a monolayer that lines the inner border of all blood vessels, in direct contact with the bloodstream. With the exception of certain areas, such as the renal glomerulus, adrenal cortex and choroid plexus, the endothelium forms a tight and selective barrier between the blood and the underlying tissues. Several proteins that are specifically or almost specifically expressed by endothelial cells represent markers capable of identifying these cells. These markers are involved in essential functions of endothelial cells such as proliferation, survival and maintenance of endothelial integrity. They include VEGF receptors, Flt-1 (De Vries et al., Science, 1992, 255, 989-991, Shibuya et al., Oncogene, 1990, 5, 519-524) and flk-1 (Terman et al. Biochem Biophys Res., Com., 1992, 187, 1579-1586, Yamgushi et al., Development, 1993, 118, 489-498), Tie receptors (Partanen et al., Mol Cell Biol. , 1992, 12, 1698-1707, Sato et al., PNAS, 1993, 90, 9355-9358, Schnürch et al., Development, 1993, 119, 957-968) or the adhesion molecule VE-cadherin (Vascular Endothelial-cadherin: Breier et al., Blood, 1996, 87, 630-641, Lampugnani et al., J. Cell Biol., 1992, 118, 1511-1522). An unknown function factor called vezfl (vascular endothelial zinc finger 1) or mDB1, homologue of the human ubiquitous transcription factor hDB1, has also been described as expressed specifically in endothelial cells in mice (Xiong et al., Developmental Biology, 1999 , 206, 123-141). Of these markers, none is secreted or acts on smooth muscle cells.

 Surprisingly, the inventors have isolated a new factor, called VE-statin, which is specifically expressed by the endothelial cells and they have shown that the VE-statin is a secreted protein that represses the recruitment of smooth muscle cells but has not no effect on their proliferation. This new soluble factor, which has no homology with known proteins, including known factors, secreted by endothelial cells, is useful for blocking the recruitment of smooth muscle cells responsible for the stabilization of neo-formed blood vessels in pathologies related to angiogenesis, such as cancer and retinopathies, but also to block the formation of atherosclerotic plaques and restenosis associated with vascular surgery, which are due to excessive recruitment of smooth muscle cells.

<Desc / Clms Page number 4>

 The inventors cloned the cDNA encoding the human and murine VE-statin and isolated the VE-statin gene which is located respectively on chromosome 9 in humans and on chromosome 2 in mice. The inventors have also shown that the 3681 bp cDNA described by Xiong et al. did not correspond to a single cDNA comprising a long 3 'non-coding region, but resulted from a cloning artifact having generated the concatenation of two cDNAs corresponding to two distinct mRNAs, the first located between positions 1 to 2329 corresponding to 1 CDNA encoding mDB 1 that is transcribed from a gene located on mouse chromosome 11 and not on chromosome 2 as described in Xiong et al. and the second located 135 bp downstream from the authentic polyA sequence of mDB1 (positions 2302-2329), corresponds to an incorrect and non-functional EV-statin cDNA sequence generated from an mRNA which is transcribed from of a gene located on chromosome 2 of the mouse.

 In contrast, with the cDNA encoding VE-statin which is functional and allows the expression of the active VE-statin protein of approximately 275 amino acids, which is secreted into the extracellular medium and inhibits the recruitment of smooth muscle cells. perivascular, the 3681 bp cDNA described in Xiong et al. allows the production of the active mDB protein but only a truncated, inactive VE-statin protein, and only in the event of internal reinitiation of translation from ATG at positions 2519-2521.

 More specifically, the 3681 bp cDNA described in Xiong et al. has a translation stop signal at positions 1594-1596 of the coding sequence DB1, a non-identifiable sequence in the databases and unrelated to VE-statin cDNAs (positions 2337-2471) and mutation from C to T in position 2602 but does not have the first 236 bp of VE-statin-a or the first 258 bp of VE-statin-b, nor a G base between bases in positions 2870 and 2871 and a base G between bases in positions 2902-2903.

 Consequently, in the event of an internal re-initiation of translation from ATG 2519-2521 corresponding to the initiator ATG of the statin, the abovementioned absences lead to a change in the reading frame under consideration and the formation of a protein of 138 amino acids of sequence MWGSGELLVA WFLVLAADGT TEHVYRPSRR VCTVGISGGS ISETFVQRVY QPYLTTCDGH

<Desc / Clms Page number 5>

 The first 117 amino acids correspond to the first 117 amino acids of the VE-statin, the remaining 21 amino acids no longer corresponding to the VE-statin because of the first change of frame (2870- 2871), then the second (2902-2903). These two frame changes induce the creation of a stop translation stop codon TGA at positions 2933-2935.

 In addition, additional mutations in the sequence of EVstatin are present downstream of the TGA stop codon at positions 2933-2935: mutation of G at C at position 3043, mutation of G at position C at position 3045, mutation of GG at TT positions 3073-3074, mutation of GG in CC at positions 3076-3077, presence of an intronic sequence at positions 3245-3410, absence of bases 1008-1085 of VE-statin-a, corresponding to bases 1030-1107 of the VE-statin-b, absence of base C between bases in positions 3448-3449, absence of base C between bases in positions 3465-3466, absence of CT sequence between bases in positions 3469-3470 , addition of bases GA between the bases in positions 3495-3496, absence of a base G between the bases in positions 3525-3526, and mutation of C in T of the base in position 3572.

 Thus, the specific expression pattern of endothelial cells described in Xiong et al., Corresponds to that of the VE-statin and not to that of vezfl mDB1 which is ubiquitous, since Xiong et al. used for in situ hybridization, a probe from this 3681 bp cDNA hybridizing both in the coding region of mDB1 and in the adjacent 3 'region described as non-coding but in fact corresponding to a sequence of Incorrect and nonfunctional VE-statin cDNA, as specified above.

 The subject of the present invention is therefore an isolated and purified protein, characterized in that it has a sequence selected from the group consisting of: the sequence SEQ ID NO: 1 which corresponds to the murine VE-statin, and sequences having - on the whole of the sequence SEQ ID NO: 1-, at least 70% identity or at least 85% similarity, preferably at least 80% identity or at least 90% similarity, and preferably at least

<Desc / Clms Page number 6>

 95% identity or at least 99% similarity with said sequence SEQ ID NO: 1, excluding sequences having access numbers AAF01322, NP ~ 057299, BAB22222 and AAH12377 in the NCBI database.

 The protein according to the invention represents a new soluble factor, secreted by the endothelial cells of the blood vessels, which factor, hereinafter referred to as VE-statin, is capable of blocking the recruitment of smooth muscular-type perivascular cells; the gene encoding said VE-statin is hereinafter referred to as VE-statin.

 The invention includes any protein (natural, synthetic, semisynthetic or recombinant) of any prokaryotic or eukaryotic organism, including a human or non-human mammal, comprising or consisting of an amino acid sequence of a protein VE-functional statin. It includes, in particular, natural proteins isolated from any prokaryotic or eukaryotic organism, as well as recombinant proteins produced in an appropriate expression system.

 According to an advantageous embodiment of the invention, said protein is a eukaryotic protein, preferably a mammalian protein.

 "Functional" is understood to mean a protein having a normal biological activity, in this case an inhibitory activity of the recruitment of perivascular cells of the smooth muscle type. This protein may comprise silent mutations inducing no substantial change in its activity and producing no phenotypic changes.

 A functional VE-statin protein has the following properties: It is produced in the form of an intracellular precursor of approximately 275 amino acids possessing (i) a cleavable signal peptide of approximately 20 amino acids, located at its NH 2 end, and (ii) 2 domains of the type of epidermal growth factor ("EGF-like" or "Epidermal growth factor-like" domains) characterized by the presence of conserved cysteine residues and glycine residues as predicted by the SMART software (v3.3 of 13 December 2001: http://smart.embl-heidelberg.de) or PROSITE (http://www.expasy.org/prosite/, version 17. 37 of 1-02-2003) said domains being located respectively

<Desc / Clms Page number 7>

 positions 107 to 136 and 141 to 178, with reference to the murine sequence SEQ ID NO: 1 (FIG. 2), it is produced in mammalian cells in the form of a soluble protein of approximately 30 kDa, secreted in the extracellular environment; this mature form is derived from the precursor by cleavage of the signal peptide, as well as by post-translational modifications, - it is constitutively expressed, specifically in the endothelial cells of all blood vessels from early embryonic precursors to mature cells in the adult , irrespective of their nature (artery or vein), of their size or of their tissue origin, - it inhibits the recruitment of perivascular cells of the smooth muscle type.

 The measurement of the inhibitory activity of the recruitment of smooth muscular-type perivascular cells is carried out by conventional techniques known in themselves in particular by the "wound test" (Gotlieb et al., J. Cell Physiol., 1979 , 100, 563-578) or by the "Boyden Chamber Test" (TW Jungi, J. Immunol.

Methods, 1978, 21, 373-382).

 The invention includes the precursor of the VE-statin (intracellular form) which has a signal peptide at its NH 2 end, as well as the mature protein (form secreted in the extracellular medium), derived from this precursor by cleavage of the signal peptide, as well as only by post-translational modifications.

 According to an advantageous embodiment of the invention, it has the sequence of mature murine or human VE-statin, which sequence is selected from the group consisting of: the sequences corresponding respectively to positions 17 to 275, 18 to 275, 19 to 275, 20 to 275, 21 to 275, 22 to 275, 23 to 275 and 24 to 275 of the sequence SEQ ID NO: 1, and

<Desc / Clms Page number 8>

 the sequences corresponding respectively to positions 16 to 273, 17 to 273, 18 to 273, 19 to 273, 20 to 273, 21 to 273, 22 to 273 and 23 to 273 of the sequence SEQ ID NO: 42.

 According to an advantageous arrangement of this embodiment, it has a sequence selected from the group consisting of the sequence SEQ ID NO: 2 (position 21 to 275 of the sequence SEQ ID NO: 1) and the sequence SEQ ID NO: 3 ( positions 20 to 273 of the sequence SEQ ID NO: 42), corresponding respectively to the mature murine and human VE-statin.

 According to the invention, the homology of a sequence with respect to the sequence SEQ ID NO: 1 is evaluated with respect to a sequence of length equivalent to that of the sequence SEQ ID NO: 1 (approximately 275 amino acids) that is, the homology is analyzed on the entire sequence SEQ ID NO: 1 and not only on a portion thereof and therefore, the percentage of residues that are the same or the same is determined on a number of about 275 amino acid residues.

More precisely:
The identity of a sequence with respect to a reference sequence is judged by the percentage of amino acid residues that are identical, when the two sequences, each of about 275 amino acids, are aligned, so that get the maximum of correspondence between them.

 A protein having an amino acid sequence having at least X% identity with a reference sequence is defined, in the present invention as a protein whose sequence of approximately 275 amino acids, may include up to 100-X alterations per 100 amino acids of the reference sequence, while retaining the functional properties of said reference protein, in this case its inhibitory activity of recruitment of smooth muscular-type perivascular cells. For the purpose of the present invention, the term alteration includes deletions, substitutions or consecutive or dispersed insertions of amino acids in the reference sequence. This definition applies, by analogy, to nucleic acid molecules.

 The similarity of a sequence with respect to a reference sequence is assessed according to the percentage of amino acid residues which are identical

<Desc / Clms Page number 9>

 or which are different by conservative substitutions, when the two sequences each of about 275 amino acids - are aligned so as to obtain the maximum of correspondence between them. For the purposes of the present invention, the term "conservative substitution" means the substitution of one amino acid for another that has similar chemical properties (size, charge or polarity), which generally does not modify the functional properties of the protein, the occurrence of its inhibitory activity of the recruitment of perivascular cells of the smooth muscular type.

 A protein having an amino acid sequence having at least X% similarity to a reference sequence is defined, in the present invention as a protein whose sequence of about 275 amino acids, may include up to 100-X non-alterations. -conservatives for 100 amino acids of the reference sequence. For the purposes of the present invention, the term non-conservative alterations includes deletions, non-conservative substitutions or consecutive or dispersed insertions of amino acids in the reference sequence.

 For example, of the known proteins, no identical or similar sequence was found; comparing the sequence SEQ ID NO: 1 according to the invention with the protein sequences available on the databases, using the BLAST software (http://www.ncbi.nlm.nih.gov/gorf/ bl2.html), shows that: - the rat protein CBL20 (NP 620804.190 amino acids) which has 90% identity on a 170 amino acid fragment of the sequence SEQ ID NO: 1, presents only 56% identity and 57% similarity over the entire sequence SEQ ID NO: 1, - the NG3 protein (human, rat and mouse respectively NP ~ 085155, XP 228000 and NP ~ 690886) has about 36% d identity and 50% similarity with murine VE-statin.

 The present invention also relates to a peptide, characterized in that it consists of a fragment of at least 7 amino acids of the VE-statin, as defined above; such peptides are particularly useful for the production of antibodies specifically recognizing VE-statin.

 According to the invention, said antibodies are either monoclonal antibodies or polyclonal antibodies.

<Desc / Clms Page number 10>

 These antibodies can be obtained by conventional methods, known per se, including in particular the immunization of an animal with a protein or a peptide according to the invention, in order to make it produce antibodies directed against said protein or said peptide.

 Such antibodies make it possible in particular to determine the expression profile of the VE-statin protein and a possible alteration of this profile in a tissue or a biological sample, and consequently to diagnose a genetic or acquired disease involving a dysfunction of this protein. postman.

 The subject of the present invention is also an isolated nucleic acid molecule, characterized in that it has a sequence selected from the group consisting of: the sequences encoding the VE-statin as defined above (cDNA or fragment of genomic DNA representing the VE-statin gene), the sequence SEQ ID NO: 4 (VE-statin-b) coding for the human veno-statin protein of 273 amino acids and the complementary sequences of the preceding, sense or anti -meaning.

 The invention encompasses the sequences of alleles of the VE-statin gene derived from any mammal, as well as the sequences of the natural or artificial mutants of the VE-statin gene coding for a functional VE-statin protein as defined above. .

 According to an advantageous embodiment of the invention, said sequence coding for the VE-statin is selected from the group consisting of: the sequences SEQ ID NO: 5 and 6 which correspond to the two species of cDNA (VE-statin- a and VE-statin-b) coding for the murine VE-statin protein; these cDNA species which differ in the first 169 base pairs of their 5 'untranslated sequence, encode the same 275 amino acid protein, - the sequence between positions 85512 and 98730 of the sequence having the number AL590226 in the GENBANK database, which sequence corresponds to the human gene, is located in the distal region of the long arm of chromosome 9 (region 9q34.3-qter, at 151.488 Mb, near marker WI-17482) and presents an exon-intron organization comprising 11

<Desc / Clms Page number 11>

exons and 11 introns and including alternative exons 1 (exon-la and exon-1b) corresponding to transcripts VE-statin-a and VE-statin-b (Table I),
Table I: Exon-intron organization of the human VE-statin gene

<Tb>
<tb> exon <SEP> size <SEP> (bp) <SEP> sequence <SEP> 3 '<SEP> from <SEP> site <SEP> intron <SEP> site <SEP> sequence <SEP>5'<SEP> from
<tb> the exon <SEP> donor <SEP> (kb) <SEP> acceptor <SEP> the exon
<tb> CGCGCCACCT
<tb> 1a <SEP> 172 <SEP> CTCTGGGAAG <SEP> gtaaggcagc <SEP> 3.29 <SEP> ccggggggag <SEP> CCTCCCTGCA
<tb> 1b <SEP> 189 <SEP> GCAGCATCAG <SEP> gtatggcagg <SEP> 1. <SEP> 58 <SEP> ctccaaccag <SEP> CAGCCCCCAG
<tb> 2 <SEP> 96 <SEP> CCTCCGCCAG <SEP> gtgagtccca <SEP> 3. <SEP> 19 <SEP> tgtgccccag <SEP> GCCACCCAGA
<tb> 3 <SEP> 122 <SEP> ACCGGCCCG <SEP> gtgagccaag <SEP> 0. <SEP> 19 <SEP> acccccgcag <SEP> CCGTAGGGTG
<tb> G
<tb> 4 <SEP> 117 <SEP> GCACCTACCG <SEP> gtgagtgccc <SEP> 0. <SEP> 93 <SEP> caccccacag <SEP> AACCATCTAT
<tb> 5 <SEP> 116 <SEP> TGTGGAGCAG <SEP> gtgagggcta <SEP> 0. <SEP> 19 <SEP> ccgcccacag <SEP> CAATATGCCA
<tb> 6 <SEP> 96 <SEP> TGCCAGTCAG <SEP> gtgaggctgg <SEP> 0. <SEP> 16 <SEP> tttcctgcag <SEP> ATGTGGATGA
<tb> 7 <SEP> 162 <SEP> AACCCGACAG <SEP> gtaaacagcc <SEP> 0. <SEP> 62 <SEP> ctgcccgcag <SEP> GAGTGGACAG
<tb> 8 <SEP> 65 <SEP> GCTGGAGGA <SEP> gtgaggcatt <SEP> 0. <SEP> 91 <SEP> gcacccacag <SEP> AAGCTGCAGC
<tb> G
<tb> 9 <SEP> 163 <SEP> CTGGGGTCCT <SEP> gtgagtgccc <SEP> 0. <SEP> 18 <SEP> ccaaccctag <SEP> GCTCCTGCAA
<tb> 10 <SEP> 415 <SEP> TGAAACGTGA
<Tb>
the sequence situated between the positions 4060576 and 4072108 of the sequence presenting the accession number Mm2 ~ WIFeb01 ~ 25 in the GENBANK database, which sequence which corresponds to the murine gene, is located on chromosome 2 (2B) and presents an exon-intron organization similar to that of the human gene (Table II).

Table II Exon-intron organization of the murine VE-statin gene

<Tb>
<tb> exon <SEP> size <SEP> (pb) <SEP> sequence <SEP> 3 '<SEP> of <SEP> site <SEP> intron <SEP> site <SEP> sequence <SEP>5'<SEP> from
<tb> the exon <SEP> donor <SEP> (kb) <SEP> acceptor <SEP> the exon
<tb> GAGATGCCCA
<tb> 1a <SEP> 147 <SEP> CTGTGGGAAG <SEP> gtaaggcact <SEP> 2. <SEP> 67 <SEP> cactcgggag <SEP> CTGGCAGGCT
<tb> 1b <SEP> 169 <SEP> GCAGCATCAG <SEP> gtatgcagga <SEP> 1. <SEP> 54 <SEP> tgacccgcag <SEP> CCCCCGGCA
<tb> G
<tb> 2 <SEP> 91 <SEP> CGGACCACAG <SEP> gtgagtcccc <SEP> 3.53 <SEP> tttgccttag <SEP> GCCACAAAAA
<tb> 3 <SEP> 125 <SEP> ACAGACCCAG <SEP> gtgaggaagg <SEP> 0. <SEP> 17 <SEP> ttccctgtag <SEP> CCGTAGAGTG
<tb> 4 <SEP> 117 <SEP> GCACCTACCG <SEP> gtgagtgctc <SEP> 0. <SEP> 96 <SEP> ctcaccacag <SEP> AACCATCTAC
<tb> 5 <SEP> 116 <SEP> TGTGGAGCAG <SEP> gtgagggcag <SEP> 0. <SEP> 16 <SEP> ctacccacag <SEP> CAATATGCCA
<tb> 6 <SEP> 96 <SEP> TGCCAGACAG <SEP> gtaagcaccc <SEP> 0. <SEP> 16 <SEP> tttcttacag <SEP> ATGTTGATGA
<tb> 7 <SEP> 165 <SEP> CCCACAGCAG <SEP> gtaaacttgc <SEP> 0. <SEP> 61 <SEP> ctgcccccag <SEP> GAGTGGACAG
<tb> 8 <SEP> 65 <SEP> GCTAGAACAG <SEP> gtgaggcttg <SEP> 0. <SEP> 40 <SEP> ttccaaacag <SEP> AAACTGCAGT
<tb> 9 <SEP> 124 <SEP> GATTCACTGA <SEP> gtgagcaggt <SEP> 0. <SEP> 18 <SEP> cctgccctag <SEP> GCTCCTGCAA
<tb> 9b <SEP> 9b ~ <SEP> 163 <SEP> CTGGGGTCCT <SEP> gtgagtccca <SEP> 0.14
<tb> 10 <SEP> 264 <SEP> TGAGACTTGA
<Tb>

The subject of the invention is also fragments of at least 8 bp of the nucleic acid molecules as defined above, excluding TSE.

<Desc / Clms Page number 12>

 having the accession number BI910383 in the NCBI database and the cDNA fragment having accession number NM ~ 016215 in the NCBI database.

 According to an advantageous embodiment of the invention, said fragments are selected from the group consisting of: the primers of sequence SEQ ID NO: 7 to 30, and the 789 bp fragment of the intron lb of the VE gene. murine statin (SEQ ID NO: 31).

 The nucleic acid molecules according to the invention are obtained by conventional methods, known in themselves, following the standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M.

AUSUBEL, 2000, Wiley and his Inc, Library of Congress, USA). For example, they can be obtained by amplification of a nucleic sequence by PCR or RTPCR, by screening of genomic DNA libraries by hybridization with a homologous probe, or by total or partial chemical synthesis.

 The fragments as defined above may in particular be used as probes or as primers for detecting / amplifying nucleic acid molecules (mRNA or genomic DNA) encoding a VE-statin protein as defined above or as probes for isolate the VE-statin gene from other species or alleles of this gene, in particular by screening a genomic DNA or cDNA library.

 These different nucleic acid molecules also make it possible either to determine the transcription profile of the VE-statin gene and a possible alteration of this profile in a tissue or a biological sample, or to highlight the VE-statin gene, variants allelic genes of this gene and a possible functional alteration of this VE-statin gene (substantial change in the inhibitory activity of smooth muscle-type perivascular cells) resulting from a mutation (insertion, deletion or substitution) of one or more nucleotides in the level of at least one exon of said gene or a chromosomal translocation involving said gene. As a consequence, these different nucleic acid molecules make it possible to diagnose a pathological state or a genetic disease involving a dysfunction of the VE-statin and to screen for substances capable of modulating (activating or inhibiting) the transcription of the VE-statin gene. .

<Desc / Clms Page number 13>

 The detection of a mutation in the VE-statin gene is carried out by conventional techniques which are known in themselves, for example: (i) by amplification of a region of said VE-statin gene which may contain a mutation, and then detection of said mutation by sequencing or by appropriate restriction enzyme digestion, of the PCR product obtained, or (ii) by hybridization with a labeled probe specific for a region of said VE-statin gene capable of containing a mutation, and then detection direct mismatches and / or digestion with an appropriate restriction enzyme.

 The subject of the present invention is also a recombinant vector, characterized in that it comprises an insert selected from the group consisting of the nucleic acid molecules encoding a VE-statin protein and their fragments as defined above.

 Preferably, said recombinant vector is an expression vector wherein said nucleic acid molecule or a fragment thereof is under the control of appropriate transcriptional and translational regulatory elements.

 These vectors are constructed and introduced into host cells by conventional methods of recombinant DNA and genetic engineering, which are known per se. Many vectors where one can insert a molecule of nucleic acid of interest to introduce and maintain it in a eukaryotic or prokaryotic host cell, are known per se; the choice of an appropriate vector depends on the use envisaged for this vector (for example replication of the sequence of interest, expression of this sequence, maintenance of the sequence in extrachromosomal form or integration into the chromosomal material of the host ), as well as the nature of the host cell.

 The subject of the present invention is also prokaryotic or eukaryotic cells transformed by a recombinant vector as defined above.

 The recombinant vectors and the transformed cells as defined above are particularly useful for the production of VE-statin proteins and peptides according to the invention or in substitutive gene therapy.

 The present invention also relates to a non-human transgenic mammal, characterized in that it contains cells transformed with at least one nucleic acid molecule as defined above.

<Desc / Clms Page number 14>

 Non-human transgenic mammals and transformed cells as defined above are useful as tools for the study of the VEstatin gene and the product of this gene.

 The subject of the present invention is also a medicinal product, characterized in that it comprises at least one molecule selected from the group consisting of: naked nucleic acid molecule encoding a VE-statin protein as defined above, a vector recombinant as defined above or a VE-statin protein as defined above.

 The present invention also relates to the use of human ester (SEQ ID NO: 42, accession number NCBI NP 057299) for the preparation of a medicament for inhibiting the recruitment of smooth muscular-type perivascular cells.

 Such a drug which is capable of inhibiting the recruitment of smooth muscular-type perivascular cells is useful for blocking the recruitment of smooth muscle cells responsible for the stabilization of neo-formed blood vessels in angiogenesis-related pathologies, such as the cancer and retinopathies, but also to block the formation of atherosclerotic plaques and restenosis associated with vascular surgery, which are due to excessive recruitment of smooth muscle cells.

 The present invention also relates to a method for screening an agonist or antagonist of the VE-statin, characterized in that it comprises at least the following steps: a) bringing into contact with perivascular smooth muscle cells , with a VE-statin protein as defined above and a substance to be tested, b) the measurement by any appropriate means of the effect of said test substance on the migration of said smooth muscle cells, and c) the selection of substances capable of increasing or decreasing the migration of said smooth muscle cells, compared to the control (VE-statin alone).

 The study of the effect on the migration of perivascular smooth muscle cells is carried out, either by direct measurement of migration by conventional techniques known in themselves in particular by the "test of the wound" (Gotleb et al.

<Desc / Clms Page number 15>

 al., supra), by the "Boyden's chamber test" (TW Jungi, supra) or from explants of blood vessels cultured ex-vivo on collagen (Villaschi et al., Am J Pathol., 1993). , 143, 181-190), or by indirect measurements, in particular by analysis of the activation of the Rac factor, for example by detection of Rac (immunofluorescence) or local actin polymerization, at the level of the migration front cellular.

In addition to the foregoing, the invention also comprises other arrangements which will emerge from the description which follows, which refers to examples of implementation of the VE-statin gene and its products (cDNAs VE-statinea and VE-statin-b and VE-statin protein) according to the present invention as well as in Table III summarizing the sequences of the Application:
Table III: List of sequences

<Tb>
<tb> Number <SEP> Sequence
<tb> identification
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 1 <SEP> Protein <SEP> VE-statin <SEP> murine <SEP> (precursor)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 2 <SEP> Protein <SEP> VE-statin <SEP> murine <SEP> (mature)
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 3 <SEP> Protein <SEP> VE-statin <SEP> human <SEP> (mature)
<tb> SEQ <SEP> ED <SEP> NO: <SEP> 4 <SEP> cDNA <SEP> human VE-statin-b <SEP>
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 5 <SEP> cDNA <SEP> VE-statin-a <SEP> murine
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 6 <SEP> cDNA <SEP> VE-statin-b <SEP> murine
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 7 <SEP> to <SEP> 30 <SEP> primers <SEP> VE-statin
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 31 <SEP> fragment <SEP> from <SEP> 789 <SEP> pb <SEP> from <SEP> intron <SEP> lb <SEP> of the <SEP> gene
<tb> murine
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 32 <SEP> to <SEP> 41 <SEP> other <SEP> primers <SEP> used <SEP> in <SEP><SEP> examples
<tb> SEQ <SEP> ID <SEP> NO: <SEP> 42 <SEP> Protein <SEP> VE-statin <SEP> human <SEP> (precursor <SEP>: <SEP>
<tb> accession number <SEP><SEP> NCBI <SEP> NP ~ 057299 <SEP>) <SEP>
<Tb>
and the accompanying drawings in which: - Figure 1 illustrates the demonstration of the chimeric nature of the cDNA encoding vezfl (mDB1) described by Xiong et al. (supra): FIG. 1A: The sequence encoding vezfl (mDB1), represented by a rectangle, is followed by a long 3 'sequence described by Xiong et al. as a nontranslated sequence. Unexpectedly, the inventors have demonstrated the presence in this sequence, of an internal polyA sequence 2302-2336 corresponding to the authentic polyA sequence of the cDNA encoding vezfl (mDB1), and an EcoRI site. The arrows indicate the position of the different pairs of primers (couples 1 to 4) used for the RT-PCR amplification.

<Desc / Clms Page number 16>

FIG. 1B: amplification of the fragments of the vezfl cDNA by RT-PCR. El 0.5 mouse embryo total RNA (0.28 g) was analyzed by RT-PCR using primer pairs 1 to 4. Amplification of fragments overlapping the poly A2302- sequence 2336 / EcoRI is not possible (tracks 2 and 3 corresponding to pairs of primers 2 and 3), whereas the amplification of regions located on either side of this sequence results in the production of size products. expected (tracks 1 and 4 corresponding to the pairs of primers 1 and 4).

 FIG. 2 illustrates the structure of the VE-statin cDNAs: the complete sequence of the VE-statin-a murine cDNA is presented (SEQ ID NO: 5.1371 bp) and the almost complete sequence of the VE-statin cDNA -b murine, which differs from that of the VE-statin-a cDNA at the first 169 base pairs, is shown in italics. The coding sequence shown in capitals encodes a protein of 275 amino acids (SEQ ID NO: 1), corresponding to an estimated molecular weight of 29.7 kDa. The minimal sequence of Kozak is boxed, the signal peptide cleavage site is indicated by an arrow, the sequences of the 2 EGF-like domains are underlined and the conserved cysteine and glycine residues are indicated in bold.

 FIG. 3 illustrates the sequence of the VE-statin gene: the upper part corresponds to the schematic representation of the structure of the human and murine VE-statin genes. Numbers and horizontal lines represent the exons. Exons 1a and 1b result from alternative transcription initiation sites and encode the transcripts VE-statin-a and VE-statin-b, respectively. The translation initiation ATG is located in exon 3 and the stop codon in exon 10. Both genes have short SINE (Short Interspersed Nuclear Element) dispersed sequences. The polyadenylation signals are ATAATAAAGC and ACAATAAAAA, respectively in murine and human genes. The lower part illustrates the chromosomal localization of human and murine genes by hybridization (FISH) using probes specific for the VE-statin gene.

 FIG. 4 illustrates the analysis of the expression of the VE-statin transcripts: FIG. 4A: Northern-blot analysis of the expression of the VE-statin-a (top panel) and the VE-statin- b (bottom panel) in different tissues, in the mouse. VE-statin transcripts (1.6 kb, indicated by an arrow) are expressed at higher levels in the kidney, lungs and heart). The numbers indicate the size of the

<Desc / Clms Page number 17>

 markers (kpb). No signal was detected at the expected position for the 4.2 kb vezfl transcript described in Xiong et al., Supra.

FIG. 4B: RT-PCR analysis of the expression of the VE-statin (total) transcripts, VEstatin-a and VE-statin-b, compared with the controls (dblet gadph) in the El 0.5 mouse embryo , in the heart and in different cell lines.

Expression of VE-statin is detected in mouse tissues and in endothelial cells but not in fibroblasts while dblest is expressed in all tissues and cells.

FIG. 4C: by an RNase protection test of the transcripts VE-statin-a and VE-statin-b, from tRNA (Control: Ctrl), from mouse embryonic RNA E10.5 or from RNA of endothelial cells (H5V). VE-statin-a has 5 transcription initiation sites spanning a region of about 60 bp (indicated by arrows), while VE-statin-b has a unique initiation site. The numbers on the left indicate the position of the markers.

 FIG. 5 illustrates the in situ expression profile of the VEstatin and dbl genes: upper panel: analysis by in situ hybridization of gene expression: VE-statin (A, D, G), vegfr-2 (B) , E, H) and dbl (C, F, I), in the mouse embryo E7.5 (A to C) and El 0.5 (D to 1). In the E7.5 stage, the VE-statin gene (A) and the vegfr-2 gene (B) are expressed in the primary blood islets and in the yolk sac (indicated by arrows). The vegfr-2 gene is also expressed in the intra-embryonic mesoderm (B, star). The expression of dbl is not detected at this stage of embryonic development (C). In the E10.5 stage, the VE-statin (D) and vegfr-2 (E) genes are expressed similarly in the forming blood vessels. Increased magnification of the caudal region of the embryo shows that the expression profiles of the VE-statin (G) and vegfr-2 (H) genes at the level of the endothelium (dorsal aorta (arrow)) and vessels of the hind limbs (arrowheads) are superimposable.

 At this stage, dbl is expressed ubiquitously in the embryo, with a higher level of expression in the neural epithelium (F, arrow).

The expression of dbl is never detected in the endothelium (I). The scale represents 100 m in A to C and G to I and 1 mm in D to F.

<Desc / Clms Page number 18>

- Lower panel: analysis of the expression of the VE-statin gene in embryo E10.5 (J to L), E13.5 (M to P), the newborn baby of 3 days (Q) and the adult (R).

The expression of the VE-statin gene is detected in the arteries of the 3rd and 4th branchial arches (J, respectively arrow and arrowhead); the vein of the umbilical artery (K) and in endothelial cell precursors of the cephalic mesenchyme (L). At day 13.5 after conception, the VE-statin gene is expressed in the endothelial (M) endothelial cells, in the primary pulmonary vascular network (N), in the blood vessels surrounding the ribs (0) and in the the vascular network associated with the retinal pigment layer (P). After birth, the expression of the VE-statin gene is detected in the renal artery (Q, arrow), the renal vein (arrowhead), in the glomerular capillary network (Q, star) and in the peritubular capillaries ( Q, arrow open). In the pregnant female, the VE-statin gene is strongly expressed in the endothelial cells of the blood vessels of the mesometrial decidus (R, arrow). a: atrium, cm: cephalic mesenchyme, gl: glomerulus, Li: liver, Rv: renal vein, Lu: lungs, md: mesometer, n: neural epithelium, Ra: renal artery, rb: you: renal, na: artery umbilical, uv: umbilical, v: ventricle. The scale represents 100 m.

 FIG. 6 illustrates the analysis of the expression, the localization and the secretion of the VE-statin: FIG. 6A: the cDNAs of the VE-statin-a and of the VE-statin-b have been translated in vitro to confirm the presence of a translation initiation site common to both transcripts; only one form of VE-statin, corresponding to the expected molecular weight of 30 kDa, is produced from both transcripts. ctrl: control; a: VE-statin-a; b: VE-statin-b, - FIG. 6B: the expression of VE-statin (transcripts and protein) was analyzed respectively by RT-PCR, compared with that of GAPDH (first two lines) and by Western- Blot (last line), from 3T3 cells transfected with the pcDNA3-VE-statin-HA (+) plasmid or the pcDNA3 (-) control plasmid. The arrow indicates the specific expression of the VE-statin in the cells transfected with the pcDNA3-VE-statin-HA vector, FIG. 6C: the cellular localization of the VE-statin was analyzed by direct fluorescence immunofluorescence or by -localization in transfected 3T3 cells resp.

<Desc / Clms Page number 19>

 the plasmids pcDNA3-VE-statin-GFP (VE-stat-GFP, left) and pcDNA3-VE-statin-HA (VE-stat-HA + PDI, right); 24 hours after transfection, the cells were stained with Hoechst stain and observed directly by fluorescence microscopy (GFP, left) or previously incubated with primary anti-HA and disulfide anti-isomerase antibodies (specific marker endoplasmic reticulum), then with secondary antibodies labeled respectively with fluorescein isothiocyanate (FITC) or rhodamine (right).

FIG. 6D: 3T3 fibroblasts were transfected with the plasmid pcDNA3-VE-statin-HA (VE-stat) or the control pcDNA3 (-) plasmid or else non-transfected (mock). The next day, the culture medium was replaced by medium alone (left panel) or medium containing brefeldin A (brief) or monensin (Mon), (right panel). Cells were cultured for an additional 6 h, then the secreted EV-statin in the extracellular medium was immunoprecipitated from the filtered culture supernatant and then detected by Western blotting. The arrow indicates the secreted VE-statin; ns: non-specific band.

 FIG. 7 illustrates the effect of the VE-statin on the proliferation and the migration of the smooth muscle cells: FIG. 7A shows that the EV-statin has no effect on the proliferation of the smooth muscle cells (AoSMC ) seeded at low density and cultured for 8 days in control medium (- # -) or medium containing VE-statin (- # -), added PDGF-BB (50 ng / ml); the cells were counted daily and the medium was changed every other day.

FIGS. 7B and 7C show that VE-statin inhibits the migration of smooth muscle cells (AoS ™); the AoS ™ cells are cultured to confluence, then the cell mats are damaged with razor blades and the cells are cultured for an additional 2 days in the presence of VE-statin-containing medium with or without PDGF-BB (80). ng / ml; VE-statin; VE-statin + PDGF) or control medium (Ctrl; Ctrl + PDGF). B: cells with a phase contrast microscope: the black bar indicates the position of the lesion. C: number of cells having migrated corresponding to the average standard deviation, was determined on 3 to 7 separate fields.

<Desc / Clms Page number 20>

Example 1 and methods
The oligonucleotides are synthesized by GENSET and GENOSYS and the RT and PCR reagents are provided by PERKIN ELMER. The polyadenylation sites are predicted using the Hamming clustering method for the prediction of TATA and Poly-A sites (http://www.itba.mi.cnr.it/webgene). The SINE ALU / MIR sequences were located using the Repeat Master web server (16/07/00 version: http://ftp.genome.washington.edu/cgi-bin/RepeatMasker). Protein domains were predicted using SMART software (v3.3 of 13 December 2001: http://smart.embl-heidelberg.de).

1) Cells
The following murine or human primary lines or cultures were used: L929 (murine fibroblast), H5V (murine cardiac endothelioma), 3T3 (murine fibroblast), MBE (murine brain capillary), MAE (murine aortic endothelial cells), EOMA ( murine endothelioma), 1G11 (murine lung endothelial cell line) and AoS ™ (primary human aortic smooth muscle cell culture, CLONETICS). The cells are cultured at 37 ° C., in a humid atmosphere (5% CO2 -95% air), under the conditions recommended by the manufacturer.

2) RT-PCR
Total RNA is extracted using the TRIzol # reagent (LIFE TECHNOLOGIES). Reverse transcription reactions are performed from 1 g of RNA, using random hexameric oligonucleotides, according to the manufacturer's instructions (PERKIN ELMER). The PCR reactions are carried out in PCR II buffer (PERKIN ELMER) containing the reverse transcription products, 150 M of each of the NTPs and 1.25 IU of AmpliTaq Gold®, in a final volume of 50 μg.
For the RT-PCR reactions of FIG. 1, the following pairs of primers were used: ## EQU1 ##
TTT CGT CTT GCC AGC TAC TAT CC (SEQ ID NO: 33) - Couple 2: ACC TGC CCA CTC CTA TGA (SEQ ID NO: 34)
TGT CAG TCT CC ATG GAA CC (SEQ ID NO: 35) - Torque 3: TGA ACC TGC CCA CTC CTA TGA (SEQ ID NO: 36)

<Desc / Clms Page number 21>

GAG GCC TTG CGG TCA GAG TCA (SEQ ID NO: 37) - Couple 4: CTA CAC CAC TTA CAG ATG C (SEQ ID NO: 7)
GAG GCC TTG CGG TCA GAG TCA (SEQ ID NO: 8)
After a denaturation step at 95 ° C. for 2 min, the amplification was carried out for 35 cycles comprising: a denaturation step at 94 for 30 s, a hybridization step at 53 ° C. for 30 s and an extension step at 72 C for 1 min.

 PCR amplifications were carried out under conditions similar to the previous ones, using the pairs of primers, the concentration of MgCl 2, the hybridization temperature and the following number of cycles: mDB1 primers (2 mM, 53.4 C, 35 cycles) : TGA ACC TGC CCA CTC CTA TGA (SEQ ID NO: 38) TTT CGT TTC GCC AGC TAC TAT CC (SEQ ID NO: 39).

 MVE-statin primers (1 mM, 57.8 C, 30 cycles): AGG CTA CCC CAC TTA CAG ATG C (SEQ ID NO: 9) GAG GCC TTG CGG GAG TCA CC (SEQ ID NO: 10).

 MVE-statin-a primers (2 mM, 54.7 C, 32 cycles): AGA AGT TCA GTG GTG AGG (SEQ ID NO: 11) TTT TTT TGT GGC CTG TGG TCC GG (SEQ ID NO: 12).

 MVE-statin-b primers (2 mM, 57.4 C, 32 cycles): TGG GCA GCA GAC ATT CC (SEQ ID NO: 13) TTT TTT TGT GGC CTG TGG TCC GG (SEQ ID NO: 14).

 MGAPDH primers (3 mM, 61 C, 25 cycles): ACG GCA AAT TCA ACG GCA CAG TCA (SEQ ID NO: 40) CAT TGG GGG TAG GAA CAC GGA AGG (SEQ ID NO: 41).

 HVE-statin primers (2mM, 65C, 27 cycles, 372bp product) CCTGCAGGATGGCGGGGTGACA (SEQ ID NO: 25) GCGGCCGAGCTGCTGGAAGGAG (SEQ ID NO: 26) -3 'hVE-statin-a (2mM, 62b) primers C, 30 cycles, 188 bp product) CGCGCCACCTGAGATGC (SEQ ID NO: 27) CCGGTCCTGGGGGCTGCTTCC (SEQ ID NO: 28)

<Desc / Clms Page number 22>

HVE-statin-b primers (ImM, 61 C, 30 cycles, 176 bp product) CCCCAGCAAGGGCTAGGGTCCAT (SEQ ID NO: 29) TGGCGGAGGAGAATCAGTCAT (SEQ ID NO: 30)
The PCR reactions are carried out using a thermocycler (Gene Amp PCR system 2400 or 9600, PERKIN ELMER). The amplification products are separated by agarose gel electrophoresis (1%) and visualized in UV light, after staining with ethidium bromide.

3) Cloning
E10.5 mouse embryo total RNA was retro-transcribed and incubated with 50 ng of each of the ACA AAA primers AGA AGA AGG CTA CC (SEQ ID NO: 15) and CAG CGG AGC TGT CCT GGG CG ( SEQ ID NO: 16), in a mixture High Fidelity PCR master mix (BOEHRINGER). The amplification was carried out under the following conditions: 94 C for 2 min, then 35 cycles of 94 C-30 s, 54 C-30 s and 72 C-1 min, followed by a final step of elongation at 72. C for 7 min. The 416 bp product was purified, cloned into the PCR II-TOPO vector (INVITROGEN), sequenced and used as a probe to screen the mouse and ovarian embryo cDNA libraries (106 and 1.6x, respectively). 106 phages). The complete VE-statin-a and VE-statin-b cDNA was then cloned into the pcDNA3 expression vector (STRATAGENE) and used to generate different VE-statin specific probes for Northern-blot and hybridization analyzes. in situ.

 The pGFP-VE-statin vector was constructed by cloning the sequence encoding the VE-statin between the HindIII and BamHI sites of the pEGFP-Nl vector (BD-CLONTECH). The pHA-VE-statin expression vector was constructed by cloning the sequence encoding the influenza hemagglutinin (HA) epitope, in phase with the sequence encoding the VE-statin, between the HindIII sites. and BamHI of the pcDNA3 expression vector (STRATAGENE).

4) 5 'RACE and isolation of genomic fragments.

 The 5'-RACE assay was performed on normal human ovarian cDNA and E7.5 mouse embryo using the Marathon-ready cDNA kit (CLONTECH). The amplifications were carried out using High Fidelity PCR master mix (BOEHRINGER) and GENEAMP thermocyclers, according to

<Desc / Clms Page number 23>

 the manufacturer's instructions.

 The murine and human nested primer pairs are, respectively, CGG AGC CCC ACA TGG TCT GCA TC (SEQ ID NO: 17) and TCT TTT TGT GGC CTG TGG TCC GG (SEQ ID NO: 18), CCA CAT CAG CAG CAC CTC CTG AGA G (SEQ ID NO: 19) and GAG CCC CTC ATG GCC TGT GCC TCC A (SEQ ID NO: 20). The isolation of the VE-statin gene was carried out, both by standard hybridization of phage libraries (1 to 1.8 × 10 clones), using cDNA and genomic DNA probes specific for the VE gene. -statin, and by amplification of fragments by PCR using the murine Genome Walker kit (CLONTECH) and different specific primer pairs. The PCR fragments thus obtained were subcloned into the PCR vector II-TOPO and sequenced using a DNA sequencer (Abiprism 377, APPLIED SYSTEM).

5) RNase protection test
2 specific genomic fragments of approximately 850 to 900 bp comprising 150 to 175 bp of exon 1a or 1b were amplified from a 17 kbp genomic fragment of the VE-statin, using the High Fidelity mixture PCR master mixR (ROCHE). The amplified fragments were cloned into the pCR-TOPO vector and probes specific for VE-statin a or b were synthesized using, respectively, the primers TCC CAC AGG GAC AGG GAC AGG GGA TGG ACA GAG CC (SEQ ID NO: 21) and ATG CTG CCC AGG TCC GGC TGA GGC CAC TLC TGC TG (SEQ ID NO: 22) and Riboprobe Kit Gemini System III kit (Promega), according to the manufacturer's instructions. The RNase protection test was performed using 5 g of total El 0.5 mouse embryo RNA, H5V endothelial cells or yeast tRNA (control), using the RPA kit. III (AMBION). The reactions were analyzed by 6M polyacrylamide-8M gel electrophoresis and the gels were dried and autoradiographed.

6) Northern-blotting
Membranes for Northern Blot, prepared from different human or murine tissues (CLONTECH), were incubated at 68 ° C. for one hour with probes specific for human or murine VE-statin-a or with an antisense probe. VE-statin-b, labeled with 32P in a hybridization solution

<Desc / Clms Page number 24>

 ExpressHybR (CLONTECH). The membranes were then washed at 50 ° C. in 2 × SSC containing 0.05% SDS, dried and then autoradiographed.

7) In situ Hybridization Mapping (FISH)
Clone BAC 611D20 obtained from a genomic library (INCYTE), was used as a specific human probe. A plasmid comprising a 17 kbp fragment of mouse genomic DNA was used as a specific murine probe. BAC DNA and plasmid DNA were isolated according to standard techniques, following standard protocols (QIAGEN). One g of DNA was labeled, using the FITC-Nick translation kit, according to the manufacturer's recommendations (VYSIS). 100 ng of labeled DNA was mixed with 20 g of human Cot-1 DNA (GIBCO-BRL), precipitated with ethanol, and taken up in 10 l of hybridization buffer (4X SSC, IX Denhardt's, 0, 02 M NaPO4 pH 6.7.1 g / ml salmon sperm DNA, 10% Dextran sulphate, 50% formamide). The metaphase chromosomes were denatured in 70% formamide, 2X SSC for 2 min at 70 ° C and dehydrated immediately in cold ethanol. The human and murine chromosome spreads were hybridized with the corresponding probes for 16 to 18 hours at 37 ° C. in a humid chamber.

 The slides were analyzed using an epifluorescence microscope (Axisphot 2, ZEISS), the images were recorded using the Quips software (VYSIS).

8) Hybrid mapping (RH mapping)
The primer pair GCT TGG TGG TGG TGC CTA TG (SEQ ID NO: 23) and TTA TTA TGA CAA AGA TGG AG (SEQ ID NO: 24) was used to screen the Stanford radiation hybrid G3 array . The reactions were carried out in PCR buffer containing 3 mM MgCl 2, 5 nmol of each of the primers, 30 ng of DNA template and 0.5 IU of AmpliTaq Gold polymerase (APPLIED BIOSYSTEM), using a device Gene Amp PCR System 9700 (APPLIED BIOSYSTEM). The amplification was carried out under the following conditions: 35 cycles comprising 95 C-15 s, 55 C-19 s and 72 C-30 s, then the products were analyzed by agarose gel electrophoresis (2%) and staining. with ethidium bromide. A 163 bp PCR product was detected.

<Desc / Clms Page number 25>

9) Hybridization in situ
In situ hybridization was performed using the following probes: a 1.3 kbp fragment of the cDNA3-encoded VE Statin cDNA (INVITROGEN), a 1 kbp fragment of murine VEGFR-2 cDNA cloned into pGEM-T-easy or a 800 bp fragment of murine DB1 cDNA cloned into PCRII-TOPO. The sense and antisense probes were synthesized from the linearized plasmids, using 350 M of digoxigenin-labeled NTPs (ROCHE), as described in Wilkinson et al., Methods Enzymol., 1993, 225, 361. -373. In situ hybridization was performed on 5 m paraffin sections, as described in Queva et al., Oncogene, 1993, 8, 2511-2520 and Mattot et al., J. Cell. Sci., 1995, 108, 529-535. Digoxigenin was detected as described in Wilkinson et al., Using NBT # and BCIP (ROCHE) for the detection of alkaline phosphatase activity. The slides were mounted in Dako-glycergelR (DAKO) and examined using a DM LB (LEICA) microscope. Images were recorded using a camera (JVC KY-F55B) and QWin software (LEICA).

10) Production of the recombinant VE-statin
Expression vectors of the VE-statin, called pcDNA3VE-statin-HA and pEGFP-VE-statin, containing the cDNA of the VE-statin in phase, respectively with an epitope of the hemagglutinin of the influenza virus and the protein GFP fluorescers, under the control of the CMV promoter, were constructed as described in Example 1.3.

 3T3 cells (15000 cells / cm 2) were inoculated into 78.5 cm culture flasks and then transfected the next day with 5 g of recombinant pcDNA3-VE-statin-HA or pcDNA3-VE-statin-GFP vector, or else pcDNA3 (control) vector, using the EXGEN 500 # reagent (EUROMEDEX), according to the manufacturer's recommendations. After 6 h of incubation, the medium was replaced with serum-free culture medium and 24 h later, the culture supernatant containing secreted ve-statin and control medium was harvested.

11) Analysis of the cellular localization of the VE-statin by immunofluorescence
Cells (35000 3T3 and H5V cells) are seeded on glass slides 14 mm in diameter; 24 h later the cells are transfected with 50 ng of one of the following plasmids: pcDNA3-VE-statin-HA, pEGFP-VE-statin,

<Desc / Clms Page number 26>

 pcDNA3 or pEGFP-NI (controls). At 48 h (24 h post-transfection), the cells are washed with PBS, fixed for 20 min at 4 ° C., in PBS containing 4% paraformaldehyde, and then they are stored in PBS (collocation experiments). with cells transfected with pcDNA3-VE-statin-HA) or they are stained for 3 min with Hoechst's reagent (1 g / ml), rinsed, then the slides are mounted before being analyzed (direct fluorescence experiments with cells transfected with pEGFP-VE-statin or pcDNA3). For colocalization experiments, cells stored in PBS are incubated for 10 min in PBS containing 50 mM NH 4 Cl, permeabilized for 4 min in PBS containing 0.1% Triton X-100, blocked for 10 min in PBS. PBS containing 10% goat serum, then incubated for 1 hour at room temperature, with a disulfide-bonded rabbit anti-isomerase antibody (1/250, STRESSGEN) and a mouse anti-HA monoclonal antibody (1/200, BABCO), in PBS containing 10% goat serum. The slides were then incubated for 1 hour at room temperature with secondary antibodies coupled to rhodamine or fluorescein isothiocyanate (1/500, JACKSON IMMUNORESEARCH LABORATORIES).

The slides are mounted in antifade-extended medium (MOLECULAR PROBES) and observed using a fluorescence microscope (Axioplan 2, ZEISS). The images are recorded using video recording equipment (PRINCETON INSTRUMENTS INC.) 12) Analysis of the secretion of the VE-statin
3T3 cells (15000 cells / cm 2) were inoculated in 78.5 cm culture flasks and then transfected the next day with 5 g of recombinant pcDNA3-VE-statin-HA or pEGFP-VE-statin vector, or of pcDNA3 vector. (control), using the EXGEN 500 # reagent (EUROMEDEX), according to the manufacturer's recommendations. After 6 h of incubation, the medium was replaced by complete culture medium. Twenty-four hours later, the medium was changed again and the cells were incubated for 5 h in the presence of Brefeldin A (GolgiPlug®, PHARMINGEN) or monensin (GolgiStop, PHARMINGEN). The culture supernatant (5 ml) was then collected, filtered (0.22 m) and added with: sodium deoxycholate (0.5%), Igal6 CA630 (1%), SDS (0.1%), inhibitors of proteases (Complete, ROCK MOLECULAR BIOCHEMICALS) and polyclonal antibody

<Desc / Clms Page number 27>

 anti-HA (50 l, EUROGENTEC), then the mixture thus obtained was incubated overnight at 4 C, with rotary stirring. 50 μl of G-Sepharose protein (Protein-G Sepharose Fast Flow beads, AMERSHAM PHARMACIA) were then added, and the incubation was continued under the same conditions for 1 hour. The beads were washed 4 times with PBS buffer and lysed in RIPA buffer containing protease inhibitors. The samples were analyzed by polyacrylamide gel electrophoresis in the presence of SDS (12% SDS-PAGE) followed by a Western blot, using an anti-HA monoclonal antibody (1/500, EUROGENTEC). The VE-Statin was then revealed by luminescence, according to the manufacturer's instructions (Aurora @, ICN).

13) Analysis of the Effect of VE-Statin on Proliferation and Cell Migration
The effect of VE-statin on cell proliferation was tested under the following conditions: AoS ™ cells were seeded in culture dishes (4 cm 2, 35000 cells / cm 2) and cultured for 24 h, then the medium was replaced by control medium) or VE-statin-containing medium, prepared as described above (Example 1. 10), supplemented with PDGF (PDGF-BB: B chain homodimer, 50 ng / ml). Each day, the cells were harvested by trypsination and then counted with a hemacytometer (Coulter @, COULTRONICS).

Alternatively, the effect of VE-statin on cell migration was tested by the wound test, under the following conditions: AoS ™ cells (50000 cells) were seeded in culture dishes (28 cm2) and cultured until confluence, then the cell mats were damaged with a razor blade and rinsed twice with medium alone. The following media were then added to the cultures: control medium with or without PDGF-BB (80 ng / ml) and medium containing VE-statin, with or without PDGF-BB (80 ng / ml). After 48 h of incubation, the cells were rinsed with PBS, fixed for 20 min at 4 ° C. with PBS containing 4% paraformaldehyde, rinsed again with PBS and observed under a microscope.

Example 2 Characterization of human and murine VE-statin cDNAs (FIGS. 1 and 2)
Analysis of the 3 'non-coding sequence of the vezf-1 cDNA which encodes the mouse homolog of the human DB factor (Xiong et al., Develop.

Biology, 1999, 206, 123-141) unexpectedly revealed the presence of a

<Desc / Clms Page number 28>

 internal polyA sequence, located downstream of the coding sequence of the vezf-1 protein (positions 2302 to 2336, with reference to the sequence of FIG. 4 of Xiong et al., cited above), which could represent the authentic polyA sequence of vezf -1, immediately followed by an EcoRI site. These results indicate that the 3681 bp cDNA described by Xiong et al. (supra) could correspond to the concatenation of two cDNAs corresponding to two distinct mRNAs; the sequence (1-2336) corresponding to the vezf-1 cDNA (mDB1) and the 1.35 kbp sequence located downstream of the polyA sequence (2302-2336) from a cDNA distinct from that of vezf-1. 1 (mDB1), were experimentally verified. On the one hand, despite numerous attempts, it was impossible to amplify the complete 3681 bp sequence corresponding to the cDNA described by Xiong et al. On the other hand, the formal proof was provided by the RT-PCR analysis of total mouse embryo RNA, using pairs of primers hybridizing on either side of the polyA 2302-2336 sequence which showed that it was impossible to amplify a fragment overlapping the polyA 2302-2336 sequence (lanes 2 and 3 of Figure 1). On the other hand, products corresponding to those expected are obtained when the PCR amplification is carried out with two primers hybridizing in the region upstream (lane 1 of FIG. 1) or downstream (lane 4 of FIG. polyA sequence.

 The 1.35 kbp cDNA was cloned from a mouse ovary library and two embryonic cDNA libraries, using an E10.5 mouse embryo cDNA probe. corresponding either to the 3 'region of the 3681 bp vezf-1 cDNA (positions 2480-2894, VE-statin probe), or to the mDB coding sequence of the same cDNA (positions 1478-2294, control probe).

 Of 82 complete cDNA clones obtained, none hybridized with both the VE-statin probe and the mDB 1 probe, while 40 hybridized with the mDB probe and 42 with the VE-statin probe. The longest clone hybridizing with the VE-statin probe has a 1.37 kbp sequence (VE-statin-a: SEQ ID NO: 5 and FIG. 2).

 The 5'-RACE analysis from an E11 mouse embryo library confirmed that the 1.37 kbp sequence would correspond to a complete cDNA called VE-statin-a and identify a second one. VE-statin cDNA (VE-

<Desc / Clms Page number 29>

 statin-b, 1.4 kbp: ID NO: 6 and Figure 2) which differs from the VE-statin-a cDNA at the first 169 base pairs.

 In humans, two transcripts VE-statin-a and VE-statin-b have also been isolated. The complete VE-statin-b transcript (SEQ ID NO: 4) was isolated by 5'RACE, from the partial sequence (GENBANK NM-016215); the product obtained contains an additional 236 bp 5 'of the sequence deposited in GENBANK. The comparison of the human sequence with the murine sequences (multiple alignment using the software CLUSTAL.W (1.8)) shows that the human EVstatin-b cDNA has 73% identity with the VE-statin-b cDNA. murine and 59% with VE-statin-a murine cDNA. The VE-statin-a cDNA comprises EST BI 910383.

Example 3: VE-statin gene (FIG. 3, Tables 1 and II)
The murine gene was isolated from two independent mouse genomic DNA libraries, subcloned and sequenced. It has a size of more than 10 kbp and includes 11 exons and 11 introns (Figure 3 and Table II), including two alternative exons (exon-la and 1b), corresponding to the transcripts VE-statin-a and VE-statin- b. Exon 9 can be spliced alternatively, as some cDNA clones show variations in this exon.

 The structure of the human gene has an organization similar to that of the murine gene (Figure 3), including most intron-exon junctions and the presence of short scattered nuclear elements.

 The genes were localized by hybridization (FISH) using probes of the VE-statin gene, on chromosomes 9 (9q34.3-qter) and 2 (2B) respectively in humans and mice (FIG. ). Hybrid mapping (RH mapping) confirmed the position of the human gene in the distal region of the long arm of chromosome 9, near the marker WI-17482, at the position of 151.488 Mb (with reference to the sequence of the UDV database http://bioinformatics.weizman.ac.il/udb/ and Santa Cruz: http://genome.ucsc.edu).

 By comparison, the human dbl gene was located on chromosome 17 (Genbank accession number NT 010651) and the db1murin gene on chromosome 11, further confirming that the dbl and VE-statin genes are distinct genes.

<Desc / Clms Page number 30>

 The transcription initiation sites of the VE-statin transcripts were specified by complementary analyzes to that performed by 5'RACE, namely: Primer extension and protection tests with RNase, starting from Total embryo or endothelial cell (H5V) RNA and genomic fragments corresponding to VE-statin-a and VE-statin-b. These experiments showed that the transcript VE-statin-a has several transcription initiation sites, the longest transcript covering about 75 bases upstream of the first identified base, the initiation sites are distributed over approximately 60 pb (Figure 4C). This variant is expressed at much lower levels than the transatin-b transcript, both in endothelial cells and in the embryo (Figure 4C). In contrast, the VE-statin-b transcript has a unique transcription site presumably due to the presence of a CATAAAAAGC box, located 42 base pairs upstream of the first base of the transcript (Figure 4C).

EXAMPLE 4 Demonstration of Specific Expression of VE-Statin in Endothelial Cells (FIGS. 4 and 5)
Expression of VE-statin (transcripts VE-statin-a and VE-statinb) was analyzed by RT-CPR from different cell lines in vitro. Both variants are expressed in endothelial cells (EOMA, H5V and 1G11) but not in fibroblasts (353 and L 929), (Figure 4B). By comparison, mDB1 is expressed at an equivalent level in all the lines tested.

 Expression of VE-statin-a and VE-statin-b transcripts was also analyzed by Northern blot in adult tissues, using probes corresponding to the specific 5 'region of each cDNA. A major 1.6 kb transcript is recognized by each of the probes (Figure 4A); this size corresponds to that of the cDNAs of the VE-statin. The expression of VE-statin-a and -b is detected at high levels in the heart, lungs and kidneys and under these conditions it is not detectable in other tissues (Figure 4A).

 The expression profile of the VE-statin gene was also analyzed by in situ hybridization in the mouse embryo and compared to that of the dbl gene and that of the specific endothelial factor vegfr-2, used as a control of mesodermal expression. early and then endothelial specific. At E7.5, the expression of the VE-statin gene is detected exclusively in the primary blood islets in which

<Desc / Clms Page number 31>

 differentiate the first endothelial cells. In contrast, dbl is not detected in these primitive blood islands, and as has already been shown, vegfr-2 expression is detected both in primary blood islets and in the intraembryonic mesoderm (Breier et al. al., Blood, 1996, 87, 630-641, Yamaguchi et al., Development, 1993, 118, 489-498). At E10.5, the expression of the VE-statin gene is superimposed on that of vegfr-2 in the endothelial cells of the vein and the umbilical artery, the arteries of the 3rd and 4th gill arches, the dorsal aorta, and cephalic mesenchyme (Figure 5). As shown for the human gene, dbl expression is ubiquitous at this stage of embryonic development in mice, with higher expression in the neural epithelium (Figure 5) but is never detected in vessels blood in training. At 13.5 days post-conception, the expression pattern of the VE-statin gene is still restricted to endothelial cells, as shown by its expression in the facial mesenchyme, brain, liver, endocardium, lungs and peribital vascular network, or in the retinal pigment layer (Figure 5).

 The expression profile of the VE-statin gene has also been studied after birth in the kidney, since the blood vessels still develop and remodel themselves in this organ. In neonates aged 3 days, the expression of the VE-statin gene is restricted strictly to the endothelium. Interestingly, the VE-statin gene is expressed in both veins and arteries (Figure 5), indicating that its expression is not restricted to the arterial or venous vascular network at this stage. The expression of the VE-statin gene is also detected in the perilobular and fenestrated glomerular capillaries and in the arcuate and interlobular arteries, indicating that in this organ its expression is not associated with any particular type of vessel. In the pregnant female, the expression of the VE-statin gene was also detected in the blood vessels of the uterine mesometrium decidus. Interestingly, vegfr-2 gene expression was detected at much lower levels in this organ.

Example 5: VE-Statin Protein (FIGS. 2 and 6A)
The translation initiation codon of the VE-statin protein has been located at codons AUG281-283 and AUG309-311, respectively of the murine and human transcript-a, due to the identification of the following elements:

<Desc / Clms Page number 32>

 the presence of a minimal translation initiation sequence (Kozak sequence, J. Cell Biol., 1989, 108, 229-241) in both species, the presence of stop codons in the other open frameworks reading, and - the high degree of similarity (79% identity) between the human and murine sequences, from this point (Figure 2).

 These open reading frames are translated into proteins of 275 (SEQ ID NO: 1) and 273 amino acids (SEQ ID NO: 42) respectively in mice and humans, corresponding to estimated molecular weights of 29.8 kDa and 29.6 kDa.

In vitro translation experiments verified that these open reading frames were functional; the VE-statin-a and VE-statin-b cDNAs both translate into a major protein of about 30 kDa, corresponding to the expected molecular weight according to the coding sequence (Fig. 6A); no other specific product has been detected.

 The human and murine sequences have 78% identity and 87% similarity between them.

 The search in databases of domains analogous to those of other proteins has demonstrated the presence of: a cleavable signal peptide of 19 and 20 amino acids located at the NH 2 -terminal end of the human and murine sequences respectively and two domains similar to the domains of epidermal growth factor (EGF-like domains) characterized by the conservation of essential cysteine residues of said EGF-like domains (Figure 2).

 No resemblance between VE-statin and known factors has been identified.

EXAMPLE 6 Analysis of Expression, Localization and Secretion of VEstatin (FIGS. 6B, 6C, 6D)
Assays were performed from cells transfected with the recombinant vectors pEGFP-VE-statin and pcDNA3-VE-statin-HA, which overexpress VE-statin as a fusion protein with GFP or epitope HA haemagglutinin influenza virus (Figure 6B).

 The cellular localization of the fusion proteins was analyzed by

<Desc / Clms Page number 33>

 immunofluorescence in endothelial cells (1G11) and fibroblasts (3T3, FIG. 6C). The VE-statin prevents the migration of GFP into the nucleus (FIG. 6C, left panel) and co-immunofluorescence experiments, respectively with an anti-vinculin and anti-cytochrome C antibody, show that the VE-statin does not is neither associated with the cytoskeleton nor with the mitochondria. In contrast, ESstatin is present in the endoplasmic reticulum, as shown by its co-localization with the disulfide-bonded isomerase which is a specific marker of this compartment (Figure 6C, right panel).

 Since VE-statin (human and murine) has a signal peptide, the presence of this protein on the surface of the plasma membrane and in the extracellular medium has been analyzed as follows: - the presence of EV -statin on the cell surface was verified from 3T3 cells transfected with plasmid pcDNA3-VE-statin-HA, labeled with biotin using a coupling agent unable to cross the plasma membrane (sulfo-NHS -biotin). After solubilization, the membrane proteins (labeled with biotin) were immunoprecipitated with streptavidin beads.

Under these conditions, the VE-statin is not detectable in the immunoprecipitated material, indicating that it is not exposed on the surface of the cells.

 the presence of the EV-statin in the extracellular medium was analyzed from transfected cells under the same conditions, and then the culture supernatant was harvested 48 hours after transfection and analyzed by immunoprecipitation.

Under these conditions, the VE-statin is secreted in the extracellular medium (FIG. 6D, left panel), this secretion is partially or strongly inhibited in the presence of secretion inhibitors, respectively monensin and brefeldin A.

 The results illustrated in Figure 6 (6B, 6C and 6D) demonstrate that VE-statin is produced in cells as a soluble factor secreted into the extracellular medium by the conventional protein secretion pathway.

The apparent molecular weight of the secreted VE-statin is greater than the apparent molecular weight predicted from its amino acid composition, indicating that VE-statin undergoes post-translational modifications during secretion.

<Desc / Clms Page number 34>

Example 7: Analysis of the effect of VE-statin on the migration and proliferation of smooth muscle cells (FIG. 7)
The effect of VE-statin on the proliferation and migration of smooth muscle cells was tested using recombinant VE-statin, produced as described in Example 1.10 and primary cultures of human aortic smooth muscle cells ( AoSMC) under the conditions as described in Example 1.13.

 More specifically, the effect of VE-statin on smooth muscle cell proliferation was analyzed on AoS ™ cells seeded at low density and cultured for 8 days in control medium or in medium containing VE-statin. , in the presence or absence of PDFG-BB; PDGF-BB being added to maintain proliferation stimulation. The results show that EV-statin has no effect on the growth of AoS ™ cells, in the presence or absence of PDGF-BB, as demonstrated by the perfect superimposition of growth curves of treated and untreated cells. by the EV-statin (Figure 7A).

 The effect of VE-statin on smooth muscle cell migration was analyzed using the wound test on confluent cultures of AoS ™ cells. The results show that after two days of culture in medium containing VE-statin, the migration is reduced to that observed with the basal medium and the PDGF-BB has almost no effect on the migration of the cells. AoS ™ (Figures 7B and 7C). In comparison, the migration in the presence of control medium, with and without PDGF-BB is respectively 3.4 times and 2 times greater than in the presence of VE-statin (Figures 7B and 7C). Similar results were obtained by the Boyden Chamber test.

 As is apparent from the foregoing, the invention is not limited to those of its modes of implementation, implementation and application which have just been described more explicitly; it encompasses all the variants that may come to the mind of the technician in the field, without departing from the scope or scope of the present invention.

Claims (16)

1) Use of a protein called VE-statin, selected from the group consisting of: - the sequence SEQ ID NO: 1 which corresponds to the murine VE-statin, - the sequences having - on the entire sequence SEQ ID NO : 1-, at least 70% identity or at least 85% similarity, preferably at least 80% identity or at least 90% similarity, and preferably at least 95% identity or at least 99% similarity with said sequence SEQ ID NO: 1, the sequences corresponding to positions 17 to 275, 18 to 275, 19 to 275, 20 to 275, 21 to 275, 22 to 275, 23 to 275 and 24 to 275 respectively. 275 of the sequence SEQ ID NO: 1, SEQ ID NO: 2 and 3, respectively corresponding to the mature murine and human VE-statin, the sequence SEQ ID NO: 42 corresponding to the NCBI access number NP 057299 , corresponding to the human EV-statin, and the sequences corresponding respectively to positions 16 to 273, 17 to 273, 18 to 273, 19 to 273,20 to 273, 21 to 273, 22 to 273 and 23 to 273 of the sequence SEQ ID NO: 42, for the preparation of a medicament for inhibiting the recruitment of smooth muscular-type perivascular cells.  2) Isolated and purified protein, called VE-statin, characterized in that it has a sequence selected from the group consisting of: - the sequence SEQ ID NO: 1 which corresponds to the murine VE-statin, and - the sequences having - on the whole sequence SEQ ID NO: 1-, at least 70% identity or at least 85% similarity, preferably at least 80% identity or at least 90% similarity, and preferred at least 95% identity or at least 99% similarity with said sequence SEQ ID NO: 1, excluding sequences having access number AAF01322, NP-057299 BAB22222 and AAH12377 in the database of NCBI. <Desc / Clms Page number 36>  3) Protein according to claim 2, characterized in that it is a mammalian protein.  4) Protein according to claim 2 or claim 3, characterized in that it has a sequence selected from the group consisting of: - sequences respectively corresponding to positions 17 to 275, 18 to 275,19 to 275, 20 to 275 , 21 to 275, 22 to 275, 23 to 275 and 24 to 275 of the sequence SEQ ID NO: 1, and the sequences corresponding respectively to positions 16 to 273, 17 to 273, 18 to 273, 19 to 273, 20 to 273 , 21 to 273, 22 to 273 and 23 to 273 of the sequence SEQ ID NO: 42.  5) Protein according to claim 4, characterized in that it has a sequence selected from the group consisting of the sequences SEQ ID NO: 2 and 3.  6) Peptide, characterized in that it consists of a fragment of at least 7 amino acids of the protein according to any one of claims 2 to 5.  7) isolated nucleic acid molecule, characterized in that it has a sequence selected from the group consisting of: the sequences coding for the protein according to any one of claims 2 to 5, the sequence SEQ ID NO: 4 coding the human VE-statin as defined in claim 1, and the complementary sequences of the preceding, sense or antisense.  8) An isolated nucleic acid molecule according to claim 7, characterized in that it is selected from the group consisting of: the sequences SEQ ID NO: 5 and 6, the sequence situated between the positions 85512 and 98730 of the sequence having the access number AL590226 in the GENBANK database, and the sequence located between the positions 4060576 and 4072108 of the sequence having the access number Mm2 ~ WIFeb01 ~ 25 in the GENBANK database. <Desc / Clms Page number 37>  9) Probe or primer, characterized in that it consists of a fragment of at least 8 bp of the nucleic acid molecule according to claim 7 or claim 8, excluding the TSE having the number BI910383 in the NCBI database and the cDNA fragment having access number NM ~ 016215 in the NCBI database.  10) Probe or primer, characterized in that it is selected from the group consisting of primers of sequence SEQ ID NO: 7 to 30.  11) recombinant vector, characterized in that it comprises an insert selected from the group consisting of the nucleic acid molecules according to claim 7 or claim 8 and their fragments as defined in claim 9.  12) Cells characterized in that they are transformed by a recombinant vector according to claim 11.  13) Antibodies, characterized in that they are directed against the protein according to any one of claims 2 to 5 or the peptide according to claim 6.  14) A medicament, characterized in that it comprises a molecule selected from the group consisting of: a protein according to any one of claims 2 to 5, a peptide according to claim 6, a nucleic acid molecule according to claim 7 or claim 8 and a recombinant vector according to claim 11.  15) non-human transgenic mammal, characterized in that it contains cells transformed with at least one nucleic acid molecule according to claim 7 or claim 8.  16) A method for screening an agonist or antagonist of a protein according to any one of claims 2 to 5, characterized in that it comprises at least the following steps: a) contacting muscle cells perivascular smooth tissue, with a protein according to any one of claims 2 to 5, and a test substance, <Desc / Clms Page number 38>  b) the measurement by any appropriate means of the effect of said test substance on the migration of said smooth muscle cells, and c) the selection of substances capable of increasing or decreasing the migration of said smooth muscle cells, compared to the control .