FR2826869A1 - suitable products treat ovarian cancer and in preventing relapses - Google Patents

suitable products treat ovarian cancer and in preventing relapses Download PDF

Info

Publication number
FR2826869A1
FR2826869A1 FR0108864A FR0108864A FR2826869A1 FR 2826869 A1 FR2826869 A1 FR 2826869A1 FR 0108864 A FR0108864 A FR 0108864A FR 0108864 A FR0108864 A FR 0108864A FR 2826869 A1 FR2826869 A1 FR 2826869A1
Authority
FR
Grant status
Application
Patent type
Prior art keywords
bcl
cells
cddp
nucleic acid
ovarian cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
FR0108864A
Other languages
French (fr)
Inventor
Laurent Poulain
Cathy Staedel
Pascal Gauduchon
Patrick Erbacher
Jean Paul Behr
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CENTRE REGIONAL DE LUTTE CONTRE LE CANCER - CENTRE FRANCOIS BACLESSE
CT REGIONAL DE LUTTE CONTRE LE
Original Assignee
CENTRE REGIONAL DE LUTTE CONTRE LE CANCER - CENTRE FRANCOIS BACLESSE
CT REGIONAL DE LUTTE CONTRE LE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin digitoxin or digoxin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/337Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • A61K33/24Heavy metals; Compounds thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Abstract

The invention relates to products for treating ovarian cancers and for preventing relapses. Said products contain (1) a non-viral nucleic acid vector comprising at least one imine polyethylene (IPE) or a derivative thereof, 2) a nucleic acid sequence comprising the gene <i>bcl-xS</i> or a functional fragment thereof and (3) at least one anti-tumoral agent which is active against ovarian cancer, as a combined preparation for sequential use in the treatment of ovarian cancer, the sequence of nucleic acid associated with said non-viral nucleic acid vector being administered after the anti-tumoral compound.

Description

<Desc/Clms Page number 1> <Desc / CRUD Page number 1>

PRODUITS APTES A TRAITER LES CANCERS DE L'OVAIRE ET A EN PRODUCTS SUITABLE FOR TREATING CANCER OVARIAN AND IN
PREVENIR LES RECHUTES. RELAPSE PREVENTION.

La présente invention est relative à des produits aptes à traiter les cancers de l'ovaire et à en prévenir les rechutes. The present invention relates to products suitable for treating cancers of the ovary and to prevent relapse.

Les cancers de l'ovaire représentent la première cause de mortalité par cancer gynécologique et se placent au quatrième rang des causes de décès par cancer chez la femme et leur incidence ne fait que progresser (de l'ordre de 4 % par an). Ovarian cancer is the leading cause of gynecological cancer death and are the fourth leading cause of cancer death in women, and their impact is only advance (around 4% per year). La gravité de ces cancers est liée en particulier à leur découverte tardive et à leur capacité à développer une forte chimiorésistance au cours des cycles de chimiothérapie, ce qui fait que le taux de mortalité suite à ce cancer a peu évolué durant ces quinze dernières années. The severity of these cancers is related in particular to their late discovery and their ability to develop a strong drug resistance during chemotherapy cycles, so that the mortality rate due to this cancer has changed little during the last fifteen years.

En France, le taux d'incidence du cancer de l'ovaire est estimé à In France, the incidence of ovarian cancer is estimated at
11,1/100. 11.1 / 100. 000 et s'accroît avec l'âge. 000 and increases with age.

L'étiologie des cancers de l'ovaire est peu connue ; The etiology of ovarian cancer is not known; la majorité de ces cancers est due à une transformation maligne de l'épithélium ovarien (cancers épithéliaux). the majority of these cancers is due to malignant transformation of ovarian epithelium (epithelial cancers). Ils présentent des propriétés particulières de croissance : ils peuvent se présenter à la fois sous forme de tumeurs solides envahissant l'ovaire, de sphéroïdes multicellulaires en suspension dans un liquide d'ascite dans la cavité péritonéale ou sous forme de nodules disséminés sur le péritoine. They have particular properties of growth: they can present both as solid tumors invading ovarian, multicellular spheroids suspended in ascites fluid in the peritoneal cavity or as nodules scattered over the peritoneum. La dissémination se réalise également par voie lymphatique ou sanguine, provoquant l'apparition de métastases ganglionnaires, pulmonaires ou hépatiques. The spread is also achieved by lymphatic or blood stream, causing the appearance of lymph node metastases, lung or liver.

Leur thérapie usuelle associe la chirurgie et une chimiothérapie basée essentiellement sur les sels de platine, tels que le cisplatine (cis-dichlorodiamino-platine (II) ou CDDP) ou le carboplatine (diaminecyclobutane-dicarboxyloplatine ou CBDCA), analogue du cisplatine, dont l'équivalence de dose a été établie (rapport CBDCA/CDDP de 4). Conventional therapy combining surgery and chemotherapy mainly based on platinum salts, such as cisplatin (cis-dichlorodiamino-platinum (II) or CDDP) or carboplatin (diaminecyclobutane-dicarboxyloplatine or CBDCA), analogue of cisplatin, whose equivalence dose has been established (compared CBDCA / CDDP 4).

Les différentes polychimiothérapies utilisant l'un des dérivés du platine ont constitué un progrès majeur dans le traitement de ces tumeurs. The various chemotherapies using a platinum derivatives have been a major advance in the treatment of these tumors. Aussi bien le cisplatine que le carboplatine sont administrés à des doses allant, selon le produit et selon les cas, de 100 à 650 mg/m2 par mois, sous la forme de perfusions en 1 à 24 heures (Poulain et al., Int. J. Cancer, 1998,78, 454-463, M. Marone et al., Clin. Both cisplatin as carboplatin are administered to up doses, depending on the product and in some cases, from 100 to 650 mg / m2 per month in the form of infusions in 1 to 24 hours (Poulain et al., Int. J. Cancer, 1998.78, 454-463, M. Marone et al., Clin.

Cancer Res., 1998,4, 517-524, JR Liu et al., Gynecol. Cancer Res., 1998.4, 517-524, JR Liu et al., Gynecol. Oncol., 1998,70, 398-403, Oncol., 1998.70, 398-403,

<Desc/Clms Page number 2> <Desc / CRUD Page number 2>

JK Taylor et al., Oncogene, 1999,18, 4495-4504, et JK Taylor et al., Nature Biotechnol., 1999,17, 1097-1100). JK Taylor et al., Oncogene, 1999.18, 4495-4504, and JK Taylor et al., Nature Biotechnol., 1999.17, 1097-1100).

Dans les polychimiothérapies, les principaux médicaments actuellement utilisés sont outre les dérivés du platine, les agents alkylants, tels que le méphalan, le chlorambucil, le cyclophosphamide ou le thiotepa, les anthracyclines, telles que In the polychemotherapy, the main drugs currently used are further platinum derivatives, alkylating agents such as mephalan, chlorambucil, cyclophosphamide or thiotepa, anthracyclines such as

Figure img00020001

l'adriamycin ou les taxanes. the adriamycin or taxanes. Les associations de polychimiothérapie suivantes sont de préférence préconisées : CDDP 100 mg/m2-cyclophosphamide 600 mg/m paclitaxel-carboplatine, cisplatine-carboplatine ou cisplatine 100 mg/m-cyclophosphamide 300 mg/m2-carboplatine 300 mg/m. The following polychemotherapy associations are preferably recommended: CDDP 100 mg / m 2 plus cyclophosphamide 600 mg / m paclitaxel-carboplatin, cisplatin, carboplatin or cisplatin 100 mg / m cyclophosphamide 300 mg / m 2 carboplatin 300 mg / m.

L'exérèse, aussi complète que possible, conditionne l'efficacité des traitements adjuvants. Excision, as complete as possible, to the efficacy of adjuvant treatments. Elle est classiquement suivie de 4 à 6 cures de chimiothérapie, espacées de 28 jours, comprenant principalement, en association ou non, les produits précités et notamment des sels de platine, du cyclophosphamide et de l'adriamycine. It is conventionally followed by 4 to 6 cycles of chemotherapy, spaced 28 days, mainly comprising, in combination or not, the aforementioned products and in particular platinum salts, cyclophosphamide and adriamycin.

La radiothérapie peut également intervenir, en particulier au niveau de zones massivement atteintes. Radiation therapy may also occur, especially at heavily affected areas.

Les carcinomes ovariens sont généralement sensibles à la chimiothérapie de première ligne mais paradoxalement la survie des patientes reste courte, du fait de l'acquisition de la chimiorésistance au cours des traitements, dans la très grande majorité des cas. Ovarian carcinomas are generally sensitive to first-line chemotherapy but paradoxically patient survival is short, due to the acquisition of drug resistance during treatment, in the vast majority of cases.

Les mécanismes de résistance sont notamment décrit dans Poulain et al., 1998 (précité) ; resistance mechanisms are described in particular in Poulain et al, 1998 (supra). ils concernent plus précisément : - l'altération de l'incorporation intracellulaire du CDDP, par diminution de l'incorporation intracellulaire de platine ou par élévation des taux intracellulaires de composés soufrés (glutathion, thiorédoxine), - les modifications des systèmes de réparation de l'ADN, - des altérations mitochondriales ou - des altérations dans l'expression de gènes impliqués dans le contrôle du cycle et/ou de la régulation de l'apoptose. they concern specifically: - the alteration of the intracellular incorporation of CDDP, by reducing platinum intracellular incorporation or by increasing intracellular levels of sulfur compounds (glutathione, thioredoxin), - changes in the repair systems DNA - mitochondrial alterations or - alterations in the expression of genes involved in the cycle control and / or regulation of apoptosis.

En particulier, le rôle des gènes homologues de la famille Bel-2 dans le cycle cellulaire et le contrôle de l'apoptose est mis en avant pour expliquer une partie des mécanismes de chimiorésistance : In particular, the role of the family of homologous genes Bel-2 in cell cycle control and apoptosis is put forward to explain some of the mechanisms of chemoresistance:

<Desc/Clms Page number 3> <Desc / CRUD Page number 3>

. . la surexpression de Bcl-2 est corrélée à la chimiorésistance de divers types de tumeurs, dont les cancers de l'ovaire. Bcl-2 overexpression is correlated with drug resistance of various kinds of tumors, including cancers of the ovary.

. . la protéine Bcl-x, présente deux isoformes issues d'un épissage alternatif : Bcl-xL, qui a une fonction anti-apoptotique, similaire à celle de Bcl-2 et Bcl-x protein has two isoforms arising from alternative splicing: Bcl-xL, which has an anti-apoptotic function, like that of Bcl-2 and
Bcl-xS (Brevet US 5,834, 309), qui a une fonction pro-apoptotique. Bcl-xS (US Patent 5,834, 309), which has a pro-apoptotic function.

. . l'acquisition de la résistance au cisplatine, associée à la capacité des cellules traitées à progresser dans le cycle cellulaire au-delà de la phase G 1 : le défaut observé dans la régulation du cycle cellulaire pourrait intervenir au niveau de l'inhibiteur de cdk p21 CIPI/WAFI. acquired cisplatin resistance, coupled with the ability of treated cells to progress through the cell cycle beyond the G 1 phase: the defect observed in the cell cycle regulation could take place at the cdk inhibitor p21 CIPI / WAFI. En effet, le cisplatine exerce son effet cytotoxique en induisant une mort cellulaire par apoptose, résultant d'un dommage létal de l'ADN ; Indeed, cisplatin exerts its cytotoxic effect by inducing apoptotic cell death resulting from a lethal DNA damage; de plus, ce médicament interrompt la progression cellulaire et conduit ainsi à une accumulation des cellules dans des phases spécifiques du cycle, généralement avant l'apoptose. in addition, this drug interrupts cell progression and thus leads to an accumulation of cells in specific phases of the cycle, usually before apoptosis. On observe un dysfonctionnement du métabolisme de la p53 nucléaire de l'inhibiteur de cdk p21 dans les cellules résistantes au cisplatine. There is a metabolic dysfunction of nuclear p53 CDK inhibitor p21 in cells resistant to cisplatin.

Une diminution de la sensibilité à la chimiothérapie est liée à l'altération des taux de Bcl-2, Bax ou Bcl-x, qui interviennent dans le mécanisme de l'apoptose (M. Marone et al., Clin. Cancer Res., 1998,4, 517-524). Decreased sensitivity to chemotherapy is associated with the alteration of Bcl-2 ratio, Bax and Bcl-x, involved in the mechanism of apoptosis (Mr. Marone et al., Clin. Cancer Res. 1998.4, 517-524).

Le gène Bcl-2 (pour B cells lymphomas) a été découvert grâce à son expression constitutive dans certains lymphomes folliculaires humains du fait d'une translocation t (14,18) (q32, q32) le plaçant à proximité du promoteur fort du gène des immunoglobulines. The Bcl-2 gene (for B cells lymphomas) was discovered through its constitutive expression in some human follicular lymphomas due to translocation t (14,18) (q32, q32) placing it near the strong promoter of the gene immunoglobulins. La protéine Bcl-2 protège la cellule contre l'apoptose induite par une large gamme de stimuli. The Bcl-2 protects cells against apoptosis induced by a variety of stimuli. Elle est exprimée dans la membrane externe mitochondriale, le réticulum endoplasmique, et l'enveloppe nucléaire. It is expressed in the mitochondrial outer membrane, the endoplasmic reticulum, and the nuclear envelope. Les protéines de la famille Bcl-2 présentent une homologie de structure plus ou moins étendue, parfois même restreinte à deux domaines particuliers BH1 et BH2, impliqués dans la dimérisation de ces protéines, qui constitue un élément essentiel de la régulation de leur activité : ces protéines peuvent avoir des rôles opposés, puisque certaines interviennent dans l'induction de l'apoptose (Bax, Bcl-xS, Bad, Bak, Bik), alors que d'autres (Bcl-2, Bcl-xL, Mcll, Bfll, Al) sont impliquées dans sa répression. The proteins of the Bcl-2 family have a homology of more or less extended structure, sometimes restricted to two areas BH1 and BH2, involved in dimerization of the protein, which is an essential element of the regulation of their activity: these proteins can have opposite roles, as some are involved in the induction of apoptosis (Bax, Bcl-xS, Bad, Bak, Bik), while others (Bcl-2, Bcl-xL, Mcll, Bfll, al) are implicated in repression. Leur homo-ou dimérisation permet un déplacement d'équilibre d'une situation de survie et de croissance cellulaire vers une induction de la mort cellulaire programmée (JR Liu et al., Their homo-dimerization or allows a balance of moving from a situation of survival and cell growth to an induction of programmed cell death (Liu JR et al.

<Desc/Clms Page number 4> <Desc / CRUD Page number 4>

Gynecol. Gynecol. Oncol., 1998,70, 398-403 ; Oncol 1998.70, 398-403. JK Taylor et al., Nature Biotechnol., 1999,17, JK Taylor et al., Nature Biotechnol., 1999.17,
1097-1100). 1097-1100).

La résistance à l'apoptose, qui joue un rôle important dans les tumeurs qui sont réfractaires à une chimiothérapie, est régulée par le rapport protéines anti-apoptotiques/protéines pro-apoptotiques. Resistance to apoptosis, which plays an important role in tumors that are refractory to chemotherapy, is regulated by the ratio anti-apoptotic proteins / pro-apoptotic proteins.

JK Taylor et al., Nature Biotechnol., (précité), émettent l'hypothèse qu'en manipulant les taux de ces différentes protéines, les cellules peuvent devenir sensibles à l'apoptose, en réponse aux agents anti-tumoraux. JK Taylor et al., Nature Biotechnol., (Supra) hypothesize that by manipulating the levels of these proteins, cells may become susceptible to apoptosis in response to anti-tumor agents. Ils montrent en particu- lier qu'en modifiant le rapport Bcl-xL/Bcl-xS dans la cellule, en utilisant un oligo- nucléotide anti-sens, on peut obtenir une sensibilisation des cellules à l'apoptose. They show in particu- bind in varying the ratio Bcl-XL / Bcl-xS in the cell, using a oligo- antisense nucleotide, can be obtained sensitization of the cells to apoptosis.

Compte tenu du fait qu'une surexpression de Bcl-xL est associée à une diminution de l'apoptose dans les tumeurs, à une résistance aux agents anticancéreux et à une évolution clinique défavorable, ils émettent l'hypothèse qu'une intervention pharmacologique qui diminue les taux de Bcl-xL et augmente les taux de Bcl-xS pourrait constituer une chimiothérapie alternative intéressante. Given that overexpression of Bcl-xL is associated with decreased apoptosis in tumors, resistance to anticancer agents and unfavorable clinical course, they hypothesize that a pharmacological intervention that decreases Bcl-xL rates and increases Bcl-xS rate could be an interesting alternative chemotherapy.

Dans ce contexte, l'utilisation des membres de cette famille a été préconisée à des fins thérapeutiques. In this context, the use of family members has been advocated for therapeutic purposes.

Il a été proposé, pour augmenter l'expression de Bcl-xS, d'inhiber l'utilisation du site d'épissage 5'dans l'exon II de l'ARN bcl-xl, de manière à rediriger la machinerie d'épissage, à l'aide d'oligonucléotides antisens (JK Taylor et al., Nature Biotechnol., 1999, précité) : des cellules A549 (lignées de cellules carcinomes de poumons humains), transfectées par de la lipofectine (contrôle), l'oligonucléotide ISIS 22783 (Brevet US 6,172, 216) en présence de lipofectine ou un oligonucléotide contrôle en présence de lipofectine montrent que 1 Le traitement des cellules avec l'oligonucléotide ISIS 22783, qui cible l'exon 1 du transcrit Bcl-xL et est capable de modifier le rapport Bcl-xS/Bcl-xL de 17 % à 293 % sans réduire la quantité d'ARN Bcl-x totale dans les cellules A549, entraîne une augmentation d'un facteur 2 de l'apoptose, après traitement avec du cisplatine. It has been proposed to increase the expression of Bcl-xS, inhibit the use of the splice site 5'dans exon II of bcl-xl RNA, to redirect the splicing machinery , using antisense oligonucleotides (JK Taylor et al, Nature Biotechnol, 1999, supra..): A549 cells (human lung carcinoma cell lines), transfected with lipofectin (control), the oligonucleotide ISIS 22783 (US Patent 6.172, 216) in the presence of lipofectin or oligonucleotide control in the presence of lipofectin show that 1 treatment of cells with the oligonucleotide ISIS 22783, targeted exon 1 transcript Bcl-xL and is capable of changing the ratio Bcl-xS / Bcl-xL of 17% to 293% without reducing the total amount of Bcl-x RNA in A549 cells, resulting in an increase by a factor 2 of apoptosis after treatment with cisplatin .

Toutefois, ce document JK Taylor et al. However, this document JK Taylor et al. ne permet pas de conclure : . do not conclude. à l'effet de Bcl-xS ; the effect of Bcl-xS; en effet, il est notamment précisé dans cet article que compte tenu d'autres essais, dans lesquels on obtenait la même stimulation de l'apoptose, uniquement par diminution de la Bcl-xL, il semblerait que la diminu- Indeed, it is particularly clear in this article that given other tests, in which we obtained the same stimulation of apoptosis, only by decreasing the Bcl-xL, it seems that the decrease

<Desc/Clms Page number 5> <Desc / CRUD Page number 5>

tion du taux de Bcl-xL a un effet plus significatif sur l'induction de l'apoptose que l'augmentation de l'expression de Bcl-xS et . tion of the levels of Bcl-xL has a more significant effect on the induction of apoptosis that increasing the expression of Bcl-xS and. au rôle de Bcl-xS dans les tumeurs ovariennes ; the role of Bcl-xS in ovarian tumors; en effet, aucune des cellules mises en oeuvre dans ce document ne provient de tumeurs ovariennes. Indeed, none of the cells used in this document comes from ovarian tumors.

D'autres traitements ont également été proposés : - JS Han et al., Springer Semin. Other treatments have also been proposed: - JS Han et al, Springer Semin.. Immunopathol., 1998,19, 279-288 préconisent d'utiliser un vecteur viral (adénovirus) exprimant le gène bel-xS, qui diffuse uniquement à des distances limitées dans les tumeurs solides et qui est un inhibiteur fonctionnel de Bcl-2 et de Bcl-xL. Immunopathol., 1998.19, 279-288 recommend the use of a viral vector (adenovirus) expressing the bcl-xS gene, which broadcasts only for limited distances in solid tumors and is a functional inhibitor of Bcl-2 and Bcl-xL. L'utilisation d'un tel vecteur est particulièrement recommandée, du fait de ses propriétés de faible diffusion, dans le traitement des cancers qui induisent une dissémination dans une cavité : vessie, cancer ovarien (cavité péritonéale). The use of such a vector is particularly recommended, due to its low diffusion properties, in the treatment of cancers which induce release into a cavity: bladder, ovarian cancer (peritoneal cavity).

- AP Simoes-Wust et al., Int. - AP Simoes-Wust et al., Int. J. cancer, 2000,87, 582-590 décrivent un traitement anti-sens bcl-xl pour induire l'apoptose dans les cancers du sein (carcinomes). J. Cancer, 2000.87, 582-590 describe an antisense bcl-xl treatment to induce apoptosis in breast cancer (carcinomas). L'oligonucléotide utilisé est le 2'-O-méthoxy-éthoxy nucléotide 4259 qui cible les nucléotides 687-706 de l'ARNm bel-xL, une séquence qui ne se retrouve pas dans le transcrit pro-apoptotique bcl-xS. The oligonucleotide used is the 2'-O-methoxyethoxy nucleotide 4259 targeting nucleotides 687-706 of the bel-xL mRNA, a sequence that is not found in the pro-apoptotic transcript bcl-xS. Un tel oligonucléotide présente plusieurs avantages : il est spécifique de bcl-xl, les modifications aux extrémités 5'et 3'par des résidus 2'-MOE lui permettant de présenter une affinité significativement augmentée pour sa cible et une stabilité dans le sérum. Such oligonucleotide has several advantages: it is specific for bcl-xl, modifications at the ends 5 '3'par 2'-MOE residues enabling it to have a significantly increased affinity for its target and stability in serum. Le traitement de cellules MCF7 avec cet oligonucléotide 4259 à une concentration de 600 nM pendant 20 heures diminue les taux d'ARNm bel-xi et de protéine correspondante de 80 % et de 50 %, respectivement. MCF7 cells treatment with this oligonucleotide 4259 at a concentration of 600 nM for 20 hours reduces bcl-x mRNA levels and corresponding protein of 80% and 50%, respectively.

Ce type de traitement est préconisé exclusivement dans les cancers du sein, dans la mesure où l'expression de Bcl-2 et de Bcl-xL (membres anti-apoptotiques de la famille) est souvent augmentée dans les cancers primaires du sein. This type of treatment is recommended only in the breast, since the expression of Bcl-2 and Bcl-xL (anti-apoptotic members of the family) is often increased in primary breast cancers.

En ce qui concerne le protocole mis en oeuvre, il est précisé que l'oligonucléotide est administré sous la forme d'un complexe avec la lipofectine. With regard to the protocol implemented, it is specified that the oligonucleotide is administered in the form of a complex with lipofectin.

- PJ Beale et al., Br. J. Cancer, 2000,82, 2, 436-440Dans cet article, les Auteurs ont cherché à déterminer si les taux des protéines de la famille Bcl- 2 sont corrélés avec la sensibilité ou la résistance au traitement avec les dérivés du platine, dans des tumeurs ovariennes (carcinomes). -.. PJ Beale et al, Br J Cancer, 2000.82, 2, 436-440Dans this article, the authors sought to determine whether the family proteins Bcl-2 rates are correlated with sensitivity or resistance to treatment with platinum derivatives, in ovarian tumors (carcinomas). Ils considèrent en particulier que : In particular, they consider that:

<Desc/Clms Page number 6> <Desc / CRUD Page number 6>

(1) la surexpression de la protéine Bcl-2 dans les tumeurs ovariennes confère une sensibilité au cisplatine, plutôt qu'une résistance ; (1) the overexpression of Bcl-2 in ovarian tumors confers sensitivity to cisplatin, rather than a resistor; (2) on n'observe aucune corrélation significative lorsque l'on compare la sensibilité au cisplatine in vitro aux taux de Bax, Bcl-xL ou Bak ; (2) there is no significant correlation when comparing the sensitivity to cisplatin in vitro the levels of Bax, Bcl-xL and Bak; (3) l'introduction de Bax, dans des lignées résistantes au cisplatine ou de Bcl-xL dans des lignées sensibles n'entraîne pas de modifications significatives de la chimiosensibilité. (3) introduction of Bax, in lines resistant to cisplatin or Bcl-xL into sensitive lines does not result in significant changes in chemosensitivity.

D'autres traitements pour pallier le phénomène de chimiorésistance, préconisent de potentialiser la cytotoxicité du cisplatine et du carboplatine dans les cancers de l'ovaire, ce qui permet de récupérer une sensibilité au traitement : . Other treatments to address the phenomenon of chemoresistance, advocate potentiate the cytotoxicity of cisplatin and carboplatin in ovarian cancer, allowing to recover sensitivity to treatment. par l'amphotéricine B (Poulain et al., Cancer Chemother. Pharma- col., 1997,40, 385-390) ; amphotericin B (Poulain et al, Cancer Chemother Pharmacol neck, 1997.40, 385-390...); toutefois, l'association cisplatine-AmB est trop néphro- toxique pour une utilisation clinique, alors que l'association carboplatine-AmB ne présente pas une telle néphrotoxicité. however, the cisplatin-AmB association is nephrotoxic too toxic for clinical use, while carboplatin-AmB association does not present such nephrotoxicity. D'autres modulateurs, tels que les méthylxanthines, sont préconisés, en association à l'AmB, pour atténuer la néphrotoxicité de l'association cisplatine-AmB ou . Other modulators, such as methylxanthines, are recommended in combination with AmB, to reduce nephrotoxicity of cisplatin-AmB or combination. par le gène cipl-wafl (Lincet et al., Cancer Letters, 2000,161, 17- 26). by the CIPL-wafl gene (Lincet et al., Cancer Letters, 2000.161, 17- 26).

Toutefois, les différents traitements préconisés dans l'art antérieur, pour les cancers de l'ovaire, ne permettent pas d'éviter la chimio-résistance observée ni d'éliminer les récidives ou rechutes à long terme. However, different treatments recommended in the prior art, for ovarian cancer, do not avoid chemo-resistance observed or eliminate the long-term recurrence or relapse.

En conséquence, la Demanderesse s'est donnée pour but de pourvoir à un traitement plus adapté et qui réponde mieux aux besoins de la pratique que les traitements proposés dans l'art antérieur, notamment en ce qu'il évite les récidives ou rechutes à long terme. Accordingly, the Applicant set itself the aim of providing a more appropriate treatment and better meet the needs of the practice that the treatment proposed in the prior art, especially in that it avoids the recurrence or relapse long term.

La présente invention a pour objet des produits contenant (1) un vecteur d'acide nucléique non viral comprenant au moins une polyéthylène imine (PEI) de poids moléculaire inférieur à 25 kDa, (2) une séquence d'acide nucléique comprenant le gène bcl-xS ou un fragment fonctionnel de celui-ci et (3) au moins un agent anti-tumoral actif sur le cancer de l'ovaire, comme préparation combinée pour une utilisation séquentielle dans le traitement des cancers de l'ovaire, la séquence The present invention relates to products containing (1) a non-viral nucleic acid vector comprising at least one polyethylene imine (PEI) having a molecular weight lower than 25 kDa, (2) a nucleic acid sequence comprising the gene bcl -xs or a functional fragment thereof and (3) at least one active anti-tumor agent of ovarian cancer, as a combined preparation for sequential use in the treatment of ovarian cancers, the sequence

<Desc/Clms Page number 7> <Desc / CRUD Page number 7>

d'acide nucléique associée audit vecteur d'acide nucléique non viral étant administrée après le composé anti-tumoral. nucleic acid vector associated with said non-viral nucleic acid is administered after the anti-tumor compound.

Une telle combinaison séquentielle permet, de manière inattendue, de résoudre à la fois le problème de la chimiorésistance et le problème des récidives ou rechutes à long terme. Such sequential combination allows, unexpectedly, to solve both the problem of drug resistance and the problem of long-term recurrence or relapse.

Conformément à l'invention : - le vecteur non viral est de préférence sélectionné dans le groupe constitué par les PEI linéaires de poids moléculaire < 25 kDa, les PEI sur lesquelles sont greffés un sucre ou un peptide, tel que le peptide de liaison aux intégrines (RGD) ; According to the invention: - non-viral vector is preferably selected from the group consisting of linear PEI of molecular weight <25 kDa PEI on which are grafted a sugar or a peptide, such as integrin binding peptide (RGD); lesdites PEI sont éventuellement associées à du polyéthylène glycol (PEG) ou de l'acide folique. said PEI are possibly associated with polyethylene glycol (PEG) or folic acid.

Des PEI linéaires utilisables comme vecteur non viral sont notamment décrites dans O. Boussif et al., (PNAS, 1995,92, 7297-7301), L. Poulain et al., (Cancer Gene Ther., 2000,7, 4,644-652), le Brevet américain 6,013, 240 au nom de Rhone-Poulenc Rorer, JS Rémy et al., (Adv. Drug Delivery Rev., 1998,30, 85-95), S. Linear PEI used as non-viral vector are described in particular Boussif O. et al., (PNAS, 1995.92, 7297-7301), L. Poulain et al., (Cancer Gene Ther., 2000.7, 4,644- 652), US Patent 6,013, 240 in the name of Rhone-Poulenc Rorer, JS Remy et al., (Adv. Drug Delivery Rev., 1998.30, 85-95), S.

Ferrari et al., (Gene Ther, 1997,4, 1100-1106), D. Goula et al., (Gene Ther., 1998,5, Ferrari et al., (Gene Ther, 1997.4, 1100-1106), D. Goula et al. (Gene Ther., 1998.5,
1291-1295), F. Labat-Moleur et al., (Gene Ther., 1996,3, 1010-1017). 1291-1295), F. Labat-Moleur et al., (Gene Ther., 1996.3, 1010-1017).

Des thio-dérivés de PEI d'environ 25 kDa, conjugués au peptide de liaison aux intégrines (PEI-RGD) sont décrits dans P. Erbacher et al., (Gene Ther., PEI-thio derivative of approximately 25 kDa conjugated to peptide binding to integrins (RGD-PEI) are described in P. Erbacher et al., (Gene Ther.,
1999,6, 138-145) ; 1999.6, 138-145); des PEI galactosylées sont décrites dans MA Zanta et al., (Bioconjugate Chem., 1997,8, 839-844) ; PEI galactosylated are described in Zanta MA et al. (Bioconjugate Chem, 1997.8, 839-844.); et le couplage de ligands membranaires aux PEI est décrit dans R. Kircheis et al., (Gene Ther., 1997,4, 409-418) - l'agent anti-tumoral actif sur le cancer de l'ovaire est de préférence sélectionné dans le groupe constitué par les dérivés du platine, les taxanes, les inhibiteurs des topoisomérases 1 et 2 et les associations de ces différents produits ; and the coupling membrane ligands to PEI is described in R. Kircheis et al., (Gene Ther, 1997.4, 409-418.) - the active anti-tumor agent of the ovarian cancer is preferably selected from the group consisting of platinum derivatives, taxanes, topoisomerase inhibitors 1 and 2 and combinations of these different products; lesdits agents anti-tumoraux sont éventuellement associés à d'autres agents anti-cancéreux et/ou à de l'amphotéricine B ou des dérivés de la caféine. said antitumor agents may be combined with other anticancer agents and / or amphotericin B or caffeine derivatives.

Le plasmide Bc1-xS combiné avec l'agent antitumoral augmente de manière significative la mort des cellules cancéreuses de telle sorte que les rechutes ou récidives sont significativement diminuées. The Bc1-xS plasmid combined with the antitumor agent significantly increased the death of cancer cells so that relapses or recurrences were significantly reduced.

Lesdits produits sont avantageusement combinés dans le cadre d'une utilisation séquentielle dans le traitement des cancers de l'ovaire. Said products are advantageously combined in the context of sequential use in the treatment of ovarian cancer.

<Desc/Clms Page number 8> <Desc / CRUD Page number 8>

En effet, l'ordre d'administration des produits est essentiel : la séquence nucléique vectorisée doit impérativement être administrée après le composé antitumoral. Indeed, the order of administration of the products is essential: nucleic Vector sequence must always be administered after the anti-tumor compound.

La combinaison d'une séquence d'acide nucléique vectorisée (Bcl- xS associée à une PEI, telle que définie ci-dessus) et d'au moins un agent anti- tumoral, administrés dans l'ordre indiqué, présente les avantages suivants : - potentialisation de l'activité de l'agent antitumoral, ce qui permet de diminuer les doses de l'agent antitumoral - élimination de l'effet de chimiorésistance à l'agent antitumoral et rétablissement d'un niveau de sensibilité des cellules à l'agent antitumoral, tout à fait satisfaisant et - élimination des récidives ou rechutes à long terme. The combination of a nucleic acid sequence Vector (Bcl-xS associated with PEI as defined above) and at least one antitumor agent, administered in the order indicated, the following advantages: - potentiation of the activity of the antitumor agent, which reduces the dose of the antitumor agent - removal of the drug resistance effect to the antitumor agent and recovery of a cell level of sensitivity to antitumor agent, quite satisfactory and - elimination of long-term recurrence or relapse.

De manière plus précise, la combinaison séquentielle agent antitumoral et notamment cisplatine puis gène bcl-xS vectorisé par un vecteur non viral à base de PEI de poids moléculaire inférieur ou égal à 25 kDa, permet de détruire un nombre suffisant de cellules tumorales par apoptose, pour éviter les récidives, ce que l'on ne peut obtenir avec le gène Bcl-xS seul, ni avec l'agent antitumoral seul. More specifically, the sequential antitumor agent combination including cisplatin and bcl-xS gene vectorized by a non-viral vector based on PEI of molecular weight less than or equal to 25 kDa, is used to delete a sufficient number of tumor cells by apoptosis, to prevent recurrence, that can be obtained with Bcl-xS gene alone or with the antitumor agent alone.

Les complexes PEI/ADN seront préférentiellement administrés par voie intra-péritonéale, bien que la voie intraveineuse reste possible. Complex PEI / DNA will preferably administered intraperitoneally, although intravenous remains possible. Les complexes sont préparés de préférence dans une solution de glucose 5 % en utilisant un rapport N/P de 5 comme détaillé dans Poulain et al., Cancer Gene Ther. The complexes are preferably prepared in a 5% glucose solution using an N / P ratio of 5 as detailed in Poulain et al., Cancer Gene Ther. ; ; 2000,7, 4,644-652. 2000.7, 4.644 to 652.

Trois injections à 12 heures d'intervalle sont préférentiellement envisagées. Three injections at 12 hours interval are preferentially considered.

Outre les dispositions qui précèdent, l'invention comprend encore d'autres dispositions, qui ressortiront de la description qui va suivre, qui se réfère à des exemples de mise en oeuvre du procédé objet de la présente invention ainsi qu'aux dessins annexés, dans lesquels : - la figure 1A illustre les modifications, induites par une exposition à 5 ptg/ml de CDDP, du cycle cellulaire des lignées cellulaires tumorales ovariennes sensibles IGROV1 et OAW42. In addition to the foregoing, the invention also comprises other arrangements which will emerge from the description which follows, which refers to examples of implementation of the method of the present invention and to the accompanying drawings in which: - Figure 1A shows the changes induced by exposure to 5 ug / ml of CDDP, cell cycle ovarian tumor cell lines sensitive and OAW42 IGROV1.

- la figure 1B illustre le temps de récupération d'un état de prolifération normal des lignées cellulaires tumorales ovariennes sensibles IGROVI et OAW42, après une exposition à 5 ug/ml de CDDP. - Figure 1B illustrates the recovery time of a normal state of proliferation of ovarian tumor cell lines sensitive and IGROVI OAW42, after exposure to 5 ug / ml of CDDP.

<Desc/Clms Page number 9> <Desc / CRUD Page number 9>

- la figure 2 est un histogramme présentant l'évolution de la réponse de la lignée cellulaire sensible IGROV1 dans le temps, après une exposition à 5 ig/ml de CDDP. - Figure 2 is a bar graph showing the evolution of the response of the sensitive cell line IGROV1 over time, after exposure to 5 ug / ml of CDDP.

- la figure 3A illustre les modifications, induites par une exposition à 5 tg/ml de CDDP, du cycle cellulaire des lignées cellulaires résistantes IGROVI-RIO et SKOV3. - Figure 3A shows the changes induced by exposure to 5 tg / ml CDDP, cell cycle resistant cell lines IGROVI-RIO and SKOV3.

Figure img00090001

- la figure 3B illustre le temps de récupération d'un état de prolifération normal des lignées cellulaires IGROV1 et OAW42, IGROV1-R10 et SKOV3, après une exposition à 5 g/ml de CDDP. - Figure 3B illustrates the recovery time of a normal state of proliferation of the cell lines IGROV1 and OAW42, IGROV1-R10 and SKOV3, after exposure to 5 g / ml of CDDP.

- la figure 4 illustre l'évolution de la réponse de la lignée cellulaire résistante SKOV3 dans le temps, après une exposition à 5 ug/ml de CDDP. - Figure 4 illustrates the evolution of the response of the resistant cell line SKOV3 over time, after exposure to 5 ug / ml of CDDP.

- la figure 5 illustre les modifications, induites par une exposition à 20 g/ml de CDDP, du cycle cellulaire des lignées cellulaires sensibles IGROV1 et OAW42 (A) et des lignées cellulaires résistantes IGROVI-R10 et SKOV3 (B). - Figure 5 shows the changes induced by exposure to 20 g / ml of CDDP, cell cycle sensitive cell lines IGROV1 and OAW42 (A) and resistant cell lines IGROVI-R10 and SKOV3 (B).

- la figure 6A illustre l'expression basale de bcl-xL et bcl-xS dans les lignées cellulaires IGROVI (OVI) et OAW42 (OA) et les lignées cellulaires IGROV1-R10 (OVR) et SKOV3 (SK). - Figure 6A shows the basal expression of bcl-xL and bcl-xS in cell lines IGROVI (OVI) and OAW42 (OA) and cell lines IGROV1-R10 (OVR) and SKOV3 (SK).

- la figure 6B illustre la présence des protéines BCI-XL et Bcl-xs dans les lignées cellulaires IGROV1 (OVl) et OAW42 (OA) et les lignées cellulaires IGROV1-RlO (OVR) et SKOV3 (SK) évaluée par Western blot. - Figure 6B illustrates the presence of BCI-XL protein, and Bcl-xS in cell lines IGROV1 (OVI) and OAW42 (OA) and cell lines IGROV1-RLO (OVR) and SKOV3 (SK) assessed by Western blot.

- la figure 7A illustre l'expression de bcl-xL et bcl-xS dans le cytoplasme de cellules tumorales ovariennes mise en évidence par immunohistochimie. - Figure 7A illustrates the expression of bcl-xL and bcl-xS in the cytoplasm of ovarian tumor cells demonstrated by immunohistochemistry.

- la figure 7B illustre l'expression des protéines Bcl-xL et Bcl-xS dans des échantillons de tumeurs ovariennes, évaluées par Western blot. - Figure 7B illustrates the expression of Bcl-xL and Bcl-xS proteins in samples of ovarian tumors, as assessed by Western blot.

- la figure 8A illustre les modifications de l'expression de bcl-x dans les lignées cellulaires IGROV1, OAW42 et IGROV1-R10 et SKOV3,6h après une - Figure 8A illustrates the changes in the expression of bcl-x in cell lines IGROV1, OAW42 and IGROV1-R10 and SKOV3,6h after

Figure img00090002

exposition à 5 et 20 ug/ml de CDDP. exposure to 5 and 20 ug / ml of CDDP.

- la figure 8B illustre les modifications du taux des protéines Bcl-xL et Bcl-xS dans les lignées cellulaires IGROV1, OAW42 et IGROV1-R10 et SKOV3, 24h après une exposition à 5,20 et 100 fJ-g/mI de CDDP. - Figure 8B illustrates changes in the rate of Bcl-xL and Bcl-xS proteins in cell lines IGROV1, OAW42 and IGROV1-R10 and SKOV3, 24 hours after exposure to 5.20 and 100 fJ-g / ml of CDDP.

- les figures 9 et 10 illustrent l'efficacité d'un protocole combinatoire alliant chimiothérapie (avec différentes concentrations de CDDP) puis transfert - Figures 9 and 10 illustrate the effectiveness of a combinatorial protocol combining chemotherapy (with different concentrations of CDDP) and transfer

<Desc/Clms Page number 10> <Desc / CRUD Page number 10>

non viral de gène bcl-x pour surmonter la chimiorésistance des cancers de l'ovaire ; nonviral gene bcl-x to overcome drug resistance of ovarian cancer; ces figures illustrent le nombre de cellules viables (ordonnées) après transfection des cellules SKOV3 avec un plasmide Bcl-xS, 24 h après exposition au CDDP 5/lg/ml. these figures show the number of viable cells (ordinate) after transfection of SKOV3 cells with a plasmid Bcl-xS, 24 h after exposure to CDDP 5 / lg / ml.

Figure img00100001

- la figure lIA illustre les résultats obtenus avec un protocole combinatoire dans lequel des cellules SKOV3 sont transfectées par bol-xi puis exposée à 5/lg/ml de CDDP, pendant 2 h. - Figure lia shows the results obtained with a combinatorial protocol wherein SKOV3 cells are transfected with bowl-xi and then exposed to 5 / g / ml of CDDP for 2 h.

- la figure lIB illustre l'efficacité d'un protocole combinatoire dans lequel des cellules SKOV3 sont exposées à 5/lg/ml de CDDP pendant 2 h, puis transfectées par bc1-xS. - Figure lib illustrates the effectiveness of a combinatorial protocol wherein SKOV3 cells were exposed to 5 / g / ml of CDDP for 2 h, then transfected with bc1-xS.

- la figure 12 illustre les résultats obtenus avec un protocole dans lequel le transfert de gène précède de 24 h l'exposition au cisplatine (un effet protecteur peut être observé après exposition à 5/lg/ml de CDDP seul). - Figure 12 illustrates the results obtained with a protocol in which the above gene transfer 24 h exposure to cisplatin (a protective effect can be observed after exposure to 5 / g / ml of CDDP alone). Dans ce cas, la transfection de Bcl-xS n'augmente pas la cytotoxicité du CDDP et protège même les cellules vis-à-vis de cet agent. In this case, transfection of Bcl-xS does not increase the cytotoxicity of CDDP and protects even vis-à-vis cells of this agent. Ces résultats montrent bien l'importance de l'ordre d'administration des produits. These results show the importance of the order of administration of the products.

Il doit être bien entendu, toutefois, que ces exemples sont donnés uniquement à titre d'illustration de l'objet de l'invention, dont ils ne constituent en aucune manière une limitation. It should be understood, however, that these examples are given only as an illustration of the object of the invention, which they do not in any way constitute a limitation.

Exemple 1 : Matériels et méthodes Example 1: Materials and Methods
Lignées cellulaires cell lines
Les lignées IGROVI (Bénard et al., Cancer Res., 1985,45, 4970- The IGROVI lines (Benard et al., Cancer Res., 1985.45, 4970-

Figure img00100002

4979), OAW42 (Wilson et al., J : A//. CcT., 1984, 72, 513-521) et SKOV3 (Fogh et al., A/. Cc-T., 1977, 59, 221-226) sont des lignées établies à partir d'adénocarcinome humain de l'ovaire. 4979), OAW42 (Wilson et al, J. A // CTC 1984, 72, 513-521) and SKOV3 (Fogh et al, A / CCT 1977, 59, 221-226..... ) are lines established from human adenocarcinoma of the ovary. La lignée IGROV1-RIO, obtenue par traitements successifs de la lignée IGROV1 par des doses croissantes de cisplatine, présente une résistance au cisplatine 10 fois supérieure à celle de la lignée parentale (Poulain et al., Int. J. Cancer, 1998,78, 454-463), comme le démontrent les résultats du test XTT. The IGROV1-RIO line, obtained by successive treatment of the line IGROV1 by increasing doses of cisplatin, cisplatin has a resistance 10 times greater than that of the parental line (Poulain et al., Int. J. Cancer, 1998.78 , 454-463), as demonstrated by the results of the XTT test.

Les lignées IGROV1 et SKOV3 sont cultivées dans du milieu RPMI 1640 (GIBCO-BRL) contenant 10% de sérum de veau foetal (GIBCO-BRL), 2 mM de L-glutamine (GIBCO-BRL), 33 mM de bicarbonate de sodium et 20 mM d'Hepes. The IGROV1 lines and SKOV3 are cultured in RPMI 1640 medium (GIBCO-BRL) containing 10% fetal calf serum (GIBCO-BRL), 2mM L-glutamine (GIBCO-BRL), 33 mM sodium bicarbonate and 20 mM Hepes. La lignée OAW42 est cultivée dans du milieu DMEM (GIBCO-BRL) contenant 10 % de The OAW42 line is cultured in DMEM medium (GIBCO-BRL) containing 10%

<Desc/Clms Page number 11> <Desc / CRUD Page number 11>

sérum de veau fcetal, 2 mM de L-glutamine (GIBCO-BRL), 1 mM de pyruvate de sodium et 20 UVI d'insuline bovine (GIBCO-BRL). calf serum fcetal, 2mM L-glutamine (GIBCO-BRL), 1 mM sodium pyruvate and 20 UVI bovine insulin (GIBCO-BRL).

Les cellules sont cultivées à 37 C dans une atmosphère humide, en présence de 5 % de C02 et divisées deux fois par semaine par trypsination. The cells are cultured at 37 C in a humidified atmosphere with 5% C02 and split twice a week by trypsinization.

Les cellules IGROV1, d'aspect polygonal (caractéristique des cellules épithéliales), poussent en monocouche et sont capables, une fois la confluence atteinte, de former des dômes libérés dans le milieu et de réadhérer sur un nouveau support. The IGROV1 cells of polygonal appearance (characteristic of epithelial cells), grow as a monolayer and are able, after reaching confluence, form domes released into the medium and rejoin on a new medium. Ces cellules sont tumorigènes chez la souris nude. These cells are tumorigenic in nude mice. La courbe de croissance de la lignée IGROV1 présente une phase de latence suivie d'une phase exponentielle avant d'atteindre un plateau après 6 jours de culture. The growth curve of the line IGROV1 has a lag phase followed by an exponential phase before reaching a plateau after 6 days of culture. En début de phase exponentielle la population de cellules en suspension représente 1/5 de la population totale alors qu'à la fin de cette phase elle représente 1/10 de la population totale. In early log phase population of suspended cells represents 1/5 of the total population while at the end of this phase it represents 1/10 of the total population. Le temps de doublement des cellules est de 27h. The doubling time of the cells is 27h.

Les cellules OAW42 (Wilson et al., 1984, précité) présentent un aspect similaire à celui des cellules IGROV1, bien que de plus grande taille, mais ne présentent pas les mêmes caractéristiques de croissance. The OAW42 cells (Wilson et al., 1984, supra) have an appearance similar to that of IGROV1 cells, although larger, but do not have the same growth characteristics. En effet, leur temps de doublement est de l'ordre de 40h, et la confluence provoque un arrêt de croissance et une dégénérescence progressive de la culture en absence de repiquage. Indeed, their doubling time is about 40 hours, and the confluence causes growth arrest and progressive degeneration of the culture in the absence of transplanting.

La lignée SKOV3 est issue d'un adénocarcinome ovarien humain (Fogh et al., 1977, précité). The SKOV3 cell line is derived from a human ovarian adenocarcinoma (Fogh et al., 1977, supra). Ces cellules, qui ne poussent qu'en monocouche et supportent difficilement la confluence, présentent un aspect fibroblastique. These cells, which only grow in monolayer and difficult to support confluence, exhibit a fibroblast appearance. Leur courbe de croissance montre qu'elles ont un temps de doublement de 26 h. Their growth curve shows that they have a doubling time of 26 h.

Traitement avec le cisplatine Treatment with cisplatin
Le cisplatine [cis-diamino-dichloro-platine II (CDDP)] fourni par Roger-Bellon (CisplatyF) est dilué à 1 mg/ml dans de l'eau distillée stérile et conservé à-20 C. Les cellules en phase exponentielle de croissance sont traitées pendant 2 heures à 37 C avec différentes concentrations de CDDP dans du milieu sans sérum. Cisplatin [cis-diamino-dichloro-platinum II (CDDP)] provided by Roger Bellon (CisplatyF) is diluted to 1 mg / ml in sterile distilled water and stored at -20 C. Cells in exponential phase growth were treated for 2 hours at 37 C with different concentrations of CDDP in serum free medium. Après traitement, les cellules sont rincées et incubées dans du milieu de culture. After treatment, the cells were rinsed and incubated in culture medium.

Test au XTT Test XTT
Les cellules sont ensemencées sur une plaque à 96 puits (104 cellules/puits) puis 2 jours plus tard, pendant la phase exponentielle de croissance, les The cells are seeded on a 96-well plate (104 cells / well) then 2 days later, during the exponential phase of growth,

<Desc/Clms Page number 12> <Desc / CRUD Page number 12>

cellules sont traitées avec des doses croissantes de CDDP. cells were treated with increasing doses of CDDP. La cytotoxicité du cisplatine est mesurée par le test de coloration au XTT-PMS, qui mesure la viabilité cellulaire, 6 jours après l'exposition au CDDP, en utilisant le protocole décrit par Scudiero et al., Cancer Res., 1988,48, 4827-4833. The cytotoxicity of cisplatin was measured by the staining test XTT-PMS, which measures cell viability, 6 days after exposure to CDDP, using the procedure described by Scudiero et al., Cancer Res., 1988.48, 4827-4833.

RT-PCR RT-PCR
1 ig d'ARN total, extrait à l'aide du kit RNAeasy (QIAGEN) sont rétro-transcrits en ADNc, en présence de 200 UI de transcriptase inverse (Superscript II, GIBCO-BRL), en suivant les instructions du fabricant. 1 ug of total RNA extracted using the RNAeasy kit (QIAGEN) are reverse transcribed into cDNA in the presence of 200 IU of reverse transcriptase (Superscript II, GIBCO-BRL) following manufacturer's instructions. L'ADNc obtenu est amplifié à l'aide des amorces 5'-CGCAGAAGGGGTCCTGGTGA-3'et 5'CAGCTCCTTCTTCTGCTCCGGGGT-3', comme décrit dans Maronne et al. The resulting cDNA is amplified with the 5'-3 'primers 5'CAGCTCCTTCTTCTGCTCCGGGGT CGCAGAAGGGGTCCTGGTGA-3', as described in Maronne et al. précité. supra.

La réaction de PCR est réalisée en présence de 2 mM MgCl2, 250 mM dNTP, 10 pmoles de chacune des amorces et 5 UI de Taq polymérase (EUROBIO) dans les conditions suivantes : dénaturation à 94 C pendant 40 sec, hybridation à 58 C pendant 60 sec et extension à 72 C pendant 40 sec (30 cycles), à l'aide d'un thermocycleur AmplitronR (BIOBLOCK). The PCR reaction is performed in the presence of 2 mM MgCl2, 250 mM dNTPs, 10 pmol of each primer and 5 U of Taq polymerase (EUROBIO) under the following conditions: denaturation at 94 C for 40 sec, annealing at 58 C for 60 sec and extension at 72 C for 40 sec (30 cycles), using a thermocycler AmplitronR (Bioblock). Après électrophorèse des produits obtenus en gel d'agarose à 2 %, deux fragments distincts, correspondant respectivement à Bcl-xS et Bcl-xL sont observés. After electrophoresis of the products obtained in agarose gel of 2%, two separate fragments corresponding to Bcl-xL and Bcl-xS are observed. Le fragment correspondant à la forme longue est beaucoup plus abondant que celui correspondant à la forme courte. The fragment corresponding to the long form is much more abundant than that corresponding to the short form.

Immunoblotting immunoblotting
Après 6 heures de traitement avec le CDDP, les cellules ou les broyats de tumeurs congelées sont lysés pendant 30 min sur de la glace, dans un tampon contenant 150 mM NaCI, 50 mM Tris-HCl, pH 8,0, 1 % Triton X-100,4 mM PMSF, 2 mM aprotinine et 5 mM EDTA. After 6 hours of treatment with the CDDP, the cells or frozen tumor homogenates are lysed for 30 min on ice in a buffer containing 150 mM NaCl, 50 mM Tris-HCl, pH 8.0, 1% Triton X -100.4 mM PMSF, 2 mM aprotinin and 5 mM EDTA. Les lysats sont clarifiés par centrifugation à The lysates are cleared by centrifugation

Figure img00120001

10000 g pendant 15 min à 4 C et la concentration en protéine est mesurée par le test de Bradford (BIO-RAD). 10000 g for 15 min at 4 C and the protein concentration is measured by the Bradford assay (BIO-RAD). Une fraction d'extrait cellulaire (100 ig de protéines) est séparée par électrophorèse en gel de 10% polyacrylamide-SDS, transférée sur une membrane de nitrocellulose par électrotransfert, 30 minutes à 500 mA dans du Trisglycine-méthanol (Hybond, AMERSHAM). A cell extract fraction (100 .mu.g of proteins) is separated by gel electrophoresis in 10% polyacrylamide-SDS, transferred to a nitrocellulose membrane by electroblotting, 30 minutes at 500 mA in Trisglycine-methanol (Hybond, Amersham). La membrane est incubée toute la nuit à 4 C dans un tampon T-TBS (132 mM NaCI, 20 mM Tris-cl pH 7,6 et 0,1 % Tween 20) contenant 5 % de poudre de lait écrémé. The membrane is incubated overnight at 4 C in a T-TBS buffer (132 mM NaCl, 20 mM Tris-cl pH 7.6 and 0.1% Tween 20) containing 5% skim milk powder. La membrane est incubée, lh à température ambiante, avec l'anticorps primaire (anti-Bcl-x, L/S 651186 E, PHARMINGEN) dilué au 1/1000 dans le tampon T-TBS contenant 5 % de poudre de The membrane was incubated lh at room temperature with primary antibody (anti-Bcl-x L / S 651 186 E, Pharmingen) diluted to 1/1000 in T-TBS buffer containing 5% powder

<Desc/Clms Page number 13> <Desc / CRUD Page number 13>

lait écrémé. skimmed milk. Après 3 lavages avec le tampon T-TBS, la membrane est incubée, 1 h à température ambiante, avec l'anticorps secondaire conjugué à la peroxydase (anticorps After 3 washes with TBS-T buffer, the membrane was incubated 1 hr at room temperature with secondary antibody conjugated with peroxidase (antibody
NA 934, AMERSHAM) dilué au 1/5000 dans le même tampon que l'anticorps primaire. NA 934, Amersham) diluted to 1/5000 in the same buffer as the primary antibody. Après, 4 lavages avec le tampon T-TBS et un lavage à l'eau, l'immuno- réaction est révélée par chimioluminescence (kit ECL, AMERSHAM). After 4 washes with T-TBS buffer and washing with water, the immune reaction is revealed by chemiluminescence (ECL kit, Amersham). Des marqueurs colorés de faible poids moléculaire (BIORAD) servent de référence. Colored low molecular weight markers (BIORAD) used as reference.

Immunohistochimie immunohistochemistry
Une fois les coupes de 4 am réalisées dans les blocs de paraffine, elles sont étalées sur lames polysilanisées de façon à favoriser l'adhérence du tissu sur la lame lors des différentes étapes qui suivent. Once the cuts 4 am carried out in the paraffin blocks, they are plated onto polysilanisées blades so as to promote adhesion of the fabric on the blade at different stages that follow. Les lames peuvent être stockées entre deux papiers cartonnés à l'abri de l'air et de la lumière jusqu'à utilisation. The blades can be stored between two cardboard paper away from air and light until use. Les lames sont ensuite déparaffinées par passages successifs de 5 minutes dans 3 bains de toluène, puis dans des bains d'alcool à 100 (x2), 95 , 70 et 50 . The slides were then deparaffinized by successive passages of 5 minutes in 3 changes of toluene and then 100 in alcohol baths (x2), 95, 70 and 50.

Elles sont ensuite incubées dans un bain de TBS-H202 1 % durant They are then incubated in a bath of TBS-1% during H202
10 min, avant de subir 3 passages de 4'15"au micro-onde 750W dans du tampon citrate 10mMpH6. 10 min, before being subjected to 3 passes 4'15 "microwaved in citrate buffer 750W 10mMpH6.

Après blocage de l'activité peroxydase endogène par incubation dans une solution de peroxyde d'hydrogène à 1 % dans du PBS, les coupes sont transférées dans du tampon PBS. After blocking of endogenous peroxidase activity by incubation in a solution of hydrogen peroxide at 1% in PBS, the slices are transferred in PBS buffer. Après une pré-incubation de 20 min dans du tampon TBS contenant 20 % de sérum de chèvre, les lames sont incubées, 1 h à température ambiante, avec l'anticorps primaire anti-Bcl-x (anticorps S18, SANTA-CRUZ) dilué au 1/500 dans du tampon PBS contenant 0,5 % de sérum albumine bovine (BSA). After a preincubation of 20 min in TBS buffer containing 20% ​​goat serum, the slides are incubated 1 hr at room temperature with anti-Bcl-x primary antibody (S18 antibody, Santa Cruz) diluted 1/500 in PBS buffer containing 0.5% bovine serum albumin (BSA).

Après des lavages extensifs, les complexes immuns sont amplifiés à l'aide du kit HRP duet (DAKO), en suivant les instructions du fabricant. After extensive washing, immune complexes are amplified using the kit duet HRP (Dako), following the manufacturer's instructions. Enfin, l'activité immunoperoxydase est révélée par incubation, 5 min à température ambiante, dans une solution de DAB (10 mg/ml, SIGMA) dans un tampon 50 mM Tris-HCI, pH 7,6, 0,03 % H202. Finally, immunoperoxidase activity is revealed by incubation of 5 min at room temperature in a DAB solution (10 mg / ml, Sigma) in buffer 50 mM Tris-HCl, pH 7.6, 0.03% H202. Les lames sont rapidement contre-colorées à l'hématoxyline. The blades are quickly against-stained with hematoxylin.

Protocole de transfection du plasmide plasmid transfection protocol

Figure img00130001

La transfection est effectuée comme décrit dans Poulain et al., Cancer Gene Ther., 2000, 7, 4, 644-652. Transfection is performed as described in Poulain et al., Cancer Gene Ther., 2000, 7, 4, 644-652.

<Desc/Clms Page number 14> <Desc / CRUD Page number 14>

Exemple 2 : Efficacité de la chimiothérapie sur des lignées cellulaires tumorales ovariennes (IGROV1, OAW42). Example 2: Efficacy of chemotherapy on ovarian tumor cell lines (IGROV1, OAW42).

Les cellules tumorales ovariennes IGROVI et OAW42 décrites à l'exemple 1 sont exposées 2 h à différentes concentrations de CDDP. The ovarian tumor cells and IGROVI OAW42 described in Example 1 were exposed for 2 h at different concentrations of CDDP. Les modifications de leur cycle cellulaire et le temps de récupération d'un état de prolifération normal sont observés. The changes of their cell cycle and the recovery time of a normal state of proliferation were observed.

On constate l'élongation de la phase S et l'accumulation des cellules dans les phases G2-M (figure 1A). There is the elongation of the S-phase and accumulation of cells in the G2-M phases (Figure 1A). Les principales différences concernent l'induction de l'apoptose et la survie à long terme des cellules traitées. The main differences concern the induction of apoptosis and long-term survival of treated cells. Alors que les cellules While cells

Figure img00140001

hautement sensibles (OAW42) sont accumulées en phase S et entrent massivement en apoptose dès 48 h après l'exposition à 5 jtg/ml de CDDP, les cellules moins sensibles (IGROV1) n'entrent pas en apoptose avant 72 h à 96 h après l'exposition à 5 u. highly sensitive (OAW42) are accumulated in S phase and massively undergo apoptosis within 48 h after exposure to 5 jtg / ml CDDP, less sensitive cells (IGROV1) do not undergo apoptosis 72 hours before to 96 hours after exposure to 5 u. g/ml de CDDP. g / ml of CDDP. Cependant, dans les deux cas, la quasi-totalité des cellules meurt après 4 jours ; However, in both cases, almost all cells die after 4 days un très faible nombre de cellules sont alors maintenues dans un état quiescent pour plusieurs semaines, avant de récupérer un modèle de croissance normal et la régénération d'une population apte à proliférer. a very small number of cells are maintained in a quiescent state for several weeks, before recovering a normal pattern of growth and regeneration of a population able to proliferate.

Le délai avant de récupérer un état de prolifération est de 2 à 4 semaines pour les cellules IGROV1 et est de 8 semaines pour les cellules OAW42 (figure 1B). The time to recover a state of proliferation is 2 to 4 weeks for IGROV1 cells and is 8 weeks for OAW42 cells (Figure 1B). Après 4 semaines, l'effet de l'exposition à 5) g/ml de CDDP n'est plus After 4 weeks, the effect of exposure to 5) g / ml of CDDP is no longer

Figure img00140002

visible sur les histogrammes des cellules IGROV1 (figure 2). visible in the histograms of IGROV1 cells (Figure 2).

Quand les cellules sensibles sont exposées à 20 p. When sensitive cells are exposed to 20 percent. g/ml de CDDP, un fort blocage en phase GO-G 1 est observé et les cellules entrent massivement en apop- tose après 24 h à 48 h (figure 5A). g / ml of CDDP, a strong blocking GO-G 1 phase is observed and the cells come into massively apop- tose after 24 h to 48 h (Figure 5A).

Dans cette situation, aucune récidive n'intervient, la population tumorale ovarienne est totalement éliminée. In this situation, no recurrence is reached, the ovarian tumor population is totally eliminated.

Exemple 3 : Chimiorésistance de lignées cellulaires tumorales ovariennes (SKOV3, IGROV1-R10) Example 3: chemoresistance of ovarian tumor cell lines (SKOV3, IGROV1-R10)
Les cellules tumorales ovariennes SKOV3 et IGROV1-R10 décrites à l'exemple sont exposées 2 h à différentes concentrations de CDDP. The ovarian tumor cells and SKOV3 IGROV1-R10 described in Example 2 pm are exposed to different concentrations of CDDP. Les modifications de leur cycle cellulaire et le temps de récupération d'un état de prolifération normal sont observés. The changes of their cell cycle and the recovery time of a normal state of proliferation were observed.

<Desc/Clms Page number 15> <Desc / CRUD Page number 15>

On constate un ralentissement de la progression du cycle cellulaire, l'accumulation des cellules en phase G2-M et l'induction de l'apoptose (figure 3A). There is a delay of progression of the cell cycle, the accumulation of cells in G2-M phase and inducing apoptosis (Figure 3A).

Chaque événement semble intervenir d'une façon très accélérée en comparaison des cellules sensibles. Each event seems to occur in a way very fast compared to the sensitive cells. Ainsi, malgré une mort cellulaire massive, le délai avant la réapparition de cellules aptes à proliférer est quasi éliminé, et la réapparition intervient entre environ 5 et 7 jours pour les cellules SKOV3, et entre 8 et 12 jours pour les cellules IGROV1-RIO (figure 3B). Thus, despite a massive cell death, time to recurrence of cells able to proliferate is virtually eliminated, and the reappearance takes about 5 to 7 days for SKOV3 cells, and between 8 and 12 days for IGROV1-RIO cells ( Figure 3B).

Après ce temps, les histogrammes ne présentent plus de trace d'exposition à S llg/ml de CDDP (figure 4). After this time, the histograms show no trace of exposure to S llg / ml of CDDP (Figure 4).

Quand les cellules tumorales ovariennes résistantes sont exposées à 20/lglml de CDDP, elles sont capables de progresser dans le cycle cellulaire (figure 5B). When the resistant ovarian tumor cells are exposed to 20 / lglml CDDP, they are able to progress through the cell cycle (Figure 5B). Les cellules IGROV1-R10 s'accumulent en phase G2-M, ce qui n'est pas le cas des cellules SKOV3. The IGROV1-R10 cells accumulate in G2-M, which is not the case of SKOV3 cells.

La plupart des cellules subissent alors une apoptose après 48 h, mais une faible population d'entre elles restent capables de ré-engager un nouveau cycle cellulaire et de re-coloniser un flacon de culture en environ 4 à 5 semaines. Most cells then undergo apoptosis after 48 hours, but a small population of them are able to re-initiate a new cell cycle and re-colonize a culture flask in about 4 to 5 weeks.

Exemple 4 : Expression basale de bcl-x dans les lignées tumorales ovariennes. Example 4: Basal Expression of bcl-x in ovarian tumor lines.

Par RT-PCR, l'ARNm de bcl-x a été mis en évidence dans toutes les lignées cellulaires étudiées, mais seulement sous sa forme longue (forme L) (figure 6A). RT-PCR, the mRNA of bcl-x was highlighted in all cell lines studied, but only in his long form (Form L) (Figure 6A). Une analyse par Western blot démontre en effet que 2 à 3 bandes d'environ 30 kDa, correspondant à la protéine Bcl-xL, sont présentes dans toutes les lignées cellulaires étudiées, alors que la protéine Bcl-xS reste indétectable (figure 6B). A Western blot analysis demonstrating that indeed 2-3 bands of approximately 30 kDa, corresponding to the Bcl-xL protein, are present in all cell lines studied, whereas Bcl-xS protein remains undetectable (Figure 6B).

Le niveau de la protéine Bcl-xL est assez similaire dans les lignées cellulaires IGROV1, IGROV1-R10 et SKOV3, mais est visiblement inférieur dans la lignée cellulaire OAW42. The level of Bcl-xL protein is quite similar in cell lines IGROV1, IGROV1-R10 and SKOV3, but is visibly lower in OAW42 cell line.

L'expression de Bcl-x a été également évaluée par histochimie sur un panel de 60 spécimens de tumeurs ovariennes. The expression of Bcl-x was also evaluated by immunohistochemistry on a panel of 60 ovarian tumor specimens. 90% d'entre elles expriment Bcl-x dans le cytoplasme des cellules tumorales (figure 7A). 90% of them express Bcl-x in the cytoplasm of tumor cells (Figure 7A). Le Western blot réalisé sur ces échantillons n'a mis en évidence que la forme longue de la protéine, Bcl-xL (figure 7B). Western blot performed on these samples has revealed that the long form of the protein, Bcl-xL (Figure 7B).

<Desc/Clms Page number 16> <Desc / CRUD Page number 16>

Exemple 5 : Modifications de l'expression de bcl-x après une exposition au cispla- tine des différentes lignées cellulaires tumorales ovariennes sensibles et résis- tantes. Example 5: Changes of the expression of bcl-x after exposure to cispla- tine different ovarian tumor cell lines sensitive and resistant aunts.

Les cellules sont exposées 2 h à différentes concentrations de CDDP puis les modifications d'expression de l'ARNm de bcl-x sont étudiées. The cells were exposed for 2 h at different concentrations of CDDP and the changes of mRNA expression of bcl-x are studied.

En réponse à une exposition à 20 g/ml de CDDP, le niveau d'ARNm est diminué dès 6 h après exposition au CDDP dans les lignées cellulaires In response to exposure to 20 g / ml of CDDP, the mRNA level is reduced for more than 6 h after exposure to CDDP in cell lines
OAW42 et IGROV1, alors qu'il est maintenu à un niveau élevé dans les lignées cellulaires SKOV3 et IGROV1-R10 (figure 8A). OAW42 and IGROV1, while it is maintained at a high level in the cell lines SKOV3 and IGROV1-R10 (Figure 8A).

Les mêmes résultats ont été observés au niveau de la protéine 24 h après l'exposition (figure 8B). The same results were observed at the protein level 24 hours after exposure (Figure 8B).

En réponse à une exposition à 5 ptg/ml de CDDP, le niveau de l'ARNm de bcl-x et le niveau de protéine restent stables dans les lignées cellulaires In response to exposure to 5 ug / ml of CDDP, the level of mRNA of bcl-x and the level of protein are stable in the cell lines
IGROV1, IGROVI-RIO et SKOV3,6 h et 24 h, respectivement, après l'exposition. IGROV1, IGROVI-RIO and SKOV3,6 h and 24 h, respectively, after exposure.

Dans le cas de la lignée cellulaire OAW42, le niveau d'ARNm reste stable 6 h après exposition mais le niveau de protéine est largement réduit 24 h après exposition. In the case of the OAW42 cell line mRNA level remains stable after 6 hours exposure, but the protein level is greatly reduced 24 hours after exposure.

Exemple 6 : Niveau d'expression de Bcl-x et sensibilité au CDDP. Example 6: Expression level of Bcl-x and sensitivity to CDDP.

Le niveau d'expression de la protéine Bcl-x est similaire dans les cellules IGROV1, IGROVI-RIO et SKOV3, mais sensiblement inférieur dans les cellules OAW42, ces dernières étant également les plus sensibles au CDDP (cf exemple 1, figure 5A). The expression level of the Bcl-x protein is similar in IGROV1 cells, and SKOV3 IGROVI-RIO, but substantially lower in OAW42 cells, the latter also being the most sensitive to CDDP (see Example 1, Figure 5A).

Aussi, ont été étudiées les modifications d'expression de Bcl-x, en réponse au CDDP dans les différentes lignées cellulaire tumorales ovariennes. Also, have been studied the changes of expression of Bcl-x, in response to CDDP in different tumor cell lines ovary.

Le CDDP est capable d'induire une répression de l'expression de Bcl-x dans les lignées cellulaires sensibles (IGROV1, OAW42) mais pas dans les lignées cellulaires résistantes (IGROVI-RIO, SKOV3). CDDP is capable of inducing repression of the expression of Bcl-x in the sensitive cell lines (IGROV1, OAW42) but not in the resistant cell lines (IGROVI-RIO, SKOV3). Néanmoins cette répression peut être observée seulement dans des conditions où une apoptose massive et précoce est observée : IGROV1 exposées à 20 J. g/ml de CDDP et OAW42 exposée à 5 ou 20 jn. However, this suppression can be observed only under conditions where a massive and early apoptosis is observed: IGROV1 exposed to 20 J. g / ml of CDDP and OAW42 exposed to 5 or 20 jn. g/ml de CDDP et dans lesquelles aucune récidive n'est observable. g / ml of CDDP and wherein no recurrence is not observable.

La corrélation entre les variations de l'ARN de bcl-x et le niveau de protéine après une exposition au CDDP suggère que le niveau de protéine est principalement contrôlé au niveau de l'ARN. The correlation between changes in bcl-x RNA and protein level after exposure to CDDP suggests that the protein level is mainly controlled at the level of RNA.

<Desc/Clms Page number 17> <Desc / CRUD Page number 17>

Exemple 7 : Efficacité in vitro de la combinaison d'un agent antitumoral (CDDP) et du transfert non viral d'un gène impliqué dans l'induction de l'apoptose (belx) pour surmonter la chimiorésistance des cancers de l'ovaire. Example 7: In vitro efficacy of the combination of an antitumor agent (CDDP) and nonviral transfer of a gene involved in the induction of apoptosis (belx) to overcome the drug resistance of cancers of the ovary.

A. Exposition à l'agent antitumoral après transfection (figure A. Exposure to the antitumor agent after transfection (Figure
11A). 11A).

Dans ce sens, le protocole combinatoire n'est pas efficace. In this sense, the combinatorial protocol is not effective.

B. Transfection après exposition à l'agent antitumoral. B. Transfection after exposure to the anti-tumor agent.

Des cellules tumorales ovariennes SKOV3 (figures 9,10 et 11B), résistantes au CDDP, sont exposées 2 heures à différentes concentrations de CDDP. Of SKOV3 ovarian tumor cells (9.10 and 11B), resistant to CDDP, are exposed for 2 hours at different concentrations of CDDP.

Environ 24 h après cette exposition, les cellules sont transfectées par le vecteur non viral PEI (22kDa) porteur du gène bcl-xS. About 24 hours after exposure, the cells are transfected with the non-viral vector PEI (22kDa) bearer of the bcl-xS gene. La viabilité des cellules exposées à ce protocole combinatoire est alors observée au cours du temps par comparaison avec des cellules n'ayant subi aucun traitement, des cellules exposées au CDDP ou des cellules transfectées. The viability of cells exposed to the combinatorial protocol is then observed over time compared with cells not having undergone any treatment, cells exposed to CDDP or transfected cells. Les résultats sont présentés dans les figures 9 et 10 ci-dessous. The results are presented in Figures 9 and 10 below.

Les cellules exposées à 5 pg/ml de CDDP ou transfectées ont une viabilité réduite par rapport au témoin 72 h après le début du traitement mais récupèrent progressivement un état de prolifération normal entre 72 h et 168 h. Cells exposed to 5 pg / ml of CDDP transfected or have a reduced viability compared to controls 72 hours after the start of treatment, but progressively recover a normal state of proliferation between 72 h and 168 h.

Les cellules subissant le protocole combinatoire présentent une viabilité largement réduite 72 h après l'exposition à 5 fg/ml de CDDP par rapport aux autres cellules exposées au CDDP seul ou seulement transfectées ; Cells undergoing the combinatorial protocol exhibit greatly reduced viability 72 h after exposure to 5 fg / ml of CDDP compared to other cells exposed to CDDP alone or transfected only; cette viabilité réduite persiste jusqu'à 168 h. this reduced viability persists up to 168 h.

Les cellules exposées à 20 tg/ml de CDDP ou transfectées par bcl-x après une exposition à 20 ug/ml de CDDP ont une viabilité largement réduite 72 h après le traitement et cet effet persiste jusqu'à 168 h après le traitement. Cells exposed to 20 tg / ml of CDDP or transfected with bcl-x after exposure to 20 ug / ml of CDDP have a greatly reduced viability 72 h after treatment and this effect persists up to 168 h after treatment.

Cependant, le protocole combinatoire permet d'anéantir totalement la population et, contrairement à la seule exposition à 20 Ilglml de CDDP, aucune récidive n'est possible, les cellules étant dans un état incapable d'évoluer vers la prolifération. However, the combinatorial protocol allows totally annihilate the population and, unlike the single exposure to 20 Ilglml CDDP, no recurrence is possible, the cells are in a state incapable of evolving towards proliferation.

Ainsi que cela ressort de ce qui précède, l'invention ne se limite nullement à ceux de ses modes de mise en oeuvre, de réalisation et d'application qui viennent d'être décrits de façon plus explicite ; As is apparent from the foregoing, the invention in no way limited to those of its methods of implementation, execution and application which have just been described more explicitly; elle en embrasse au contraire toutes les it embraces on the contrary all

<Desc/Clms Page number 18> <Desc / CRUD Page number 18>

variantes qui peuvent venir à l'esprit du technicien en la matière, sans s'écarter du cadre, ni de la portée, de la présente invention. variants which may occur to the specialist in the field, without departing from the framework or the scope of the present invention.

Claims (5)

  1. REVENDICATONS 1 ) Produits contenant (1) un vecteur d'acide nucléique non viral comprenant au moins une polyéthylène imine (PEI) de poids moléculaire inférieur à 25 kDa, (2) une séquence d'acide nucléique comprenant le gène bcl-xS ou un fragment fonctionnel de celui-ci et (3) au moins un agent anti-tumoral actif sur le cancer de l'ovaire, comme préparation combinée pour une utilisation séquentielle dans le traitement des cancers de l'ovaire, la séquence d'acide nucléique associée audit vecteur d'acide nucléique non viral étant administrée après le composé anti-tumoral. REVENDICATONS 1) Products containing (1) a non-viral nucleic acid vector comprising at least one polyethylene imine (PEI) having a molecular weight lower than 25 kDa, (2) a nucleic acid sequence comprising the bcl-xS or a gene functional fragment thereof and (3) at least one active anti-tumor agent of ovarian cancer, as a combined preparation for sequential use in the treatment of ovarian cancer, the nucleic acid sequence associated said vector non-viral nucleic acid is administered after the anti-tumor compound.
  2. 2 ) Produits selon la revendication 1, caractérisés en ce que le vecteur non viral est de préférence sélectionné dans le groupe constitué par les PEI linéaire < 25 kDa, les PEI sur lesquelles sont greffés un sucre ou un peptide. 2) Products according to claim 1, characterized in that the non-viral vector is preferably selected from the group consisting of linear PEI <25 kDa PEI on which are grafted a sugar or a peptide.
  3. 3 ) Produits selon la revendication 1 ou la revendication 2, caractérisé en ce que lesdites PEI sont associées à du polyéthylène glycol (PEG) ou de l'acide folique. 3) Products according to claim 1 or claim 2, characterized in that said PEI are associated with polyethylene glycol (PEG) or folic acid.
  4. 4 ) Produits selon l'une quelconque des revendications 1 à 3, caractérisés en ce que l'agent anti-tumoral actif sur le cancer de l'ovaire est de préférence sélectionné dans le groupe constitué par les dérivés du platine, les taxanes, les inhibiteurs des topoisomérases 1 et 2 et les associations de ces différents produits. 4) Products according to any one of claims 1 to 3, characterized in that the active anti-tumor agent of the ovarian cancer is preferably selected from the group consisting of platinum derivatives, taxanes, topoisomerase inhibitors 1 and 2 and combinations of these different products.
  5. 5 ) Produits selon l'une quelconque des revendications 1 à 4, caractérisés en ce que lesdits agents anti-tumoraux sont associés à d'autres agents anticancéreux et/ou à de l'amphotéricine B ou des dérivés de la caféine. 5) Product according to any one of claims 1 to 4, characterized in that said anti-tumor agents are associated with other anticancer agents and / or amphotericin B or caffeine derivatives.
FR0108864A 2001-07-04 2001-07-04 suitable products treat ovarian cancer and in preventing relapses Withdrawn FR2826869A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
FR0108864A FR2826869A1 (en) 2001-07-04 2001-07-04 suitable products treat ovarian cancer and in preventing relapses

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0108864A FR2826869A1 (en) 2001-07-04 2001-07-04 suitable products treat ovarian cancer and in preventing relapses
PCT/FR2002/002350 WO2003004064A3 (en) 2001-07-04 2002-07-04 Products for treating ovarian cancers and for preventing relapses

Publications (1)

Publication Number Publication Date
FR2826869A1 true true FR2826869A1 (en) 2003-01-10

Family

ID=8865111

Family Applications (1)

Application Number Title Priority Date Filing Date
FR0108864A Withdrawn FR2826869A1 (en) 2001-07-04 2001-07-04 suitable products treat ovarian cancer and in preventing relapses

Country Status (2)

Country Link
FR (1) FR2826869A1 (en)
WO (1) WO2003004064A3 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7816630B2 (en) * 2003-04-12 2010-10-19 Eichenauer Heizelemente Gmbh & Co. Kg Device for receiving ceramic heating elements and method for the manufacture thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5834309A (en) * 1993-06-22 1998-11-10 Arch Development Corporation Vertebrate apoptosis gene: compositions and methods

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002024232A3 (en) * 2000-09-25 2003-01-30 Richard J Cristiano Pei: dna vector formulations for in vitro and in vivo gene delivery

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5834309A (en) * 1993-06-22 1998-11-10 Arch Development Corporation Vertebrate apoptosis gene: compositions and methods

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BETTINGER T ET AL: "SIZE REDUCTION OF GALACTOSYLATED PEI/DNA COMPLEXES IMPROVES LECTIN-MEDIATED GENE TRANSFER INTO HEPATOCYTES", BIOCONJUGATE CHEMISTRY, AMERICAN CHEMICAL SOCIETY, WASHINGTON, US, vol. 10, 1999, pages 558 - 561, XP000952655, ISSN: 1043-1802 *
CHUNG-HUA FU CHAN KO TSA CHIH [CHINESE JOURNAL OF OBSTETRICS AND GYNECOLOGY], (2000 FEB) 35 (2) 94-7. *
DATABASE MEDLINE [online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; WANG H ET AL: "Synergistic Efficacy of Adenovirus-mediated bcl - Xs Gene Therapy and Cisplatin in Ovarian Cancer Cell.", XP002193940, retrieved from STN Database accession no. 2002083677 *
KIM, RYUNGSA (1) ET AL: "Enhancement of antitumor effect by intratumoral injection of bax cDNA plasmid in combination with anticancer drugs in gastric tumor in nude mice.", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING, (MARCH, 2000) NO. 41, PP. 730-731. PRINT.. MEETING INFO.: 91ST ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH. SAN FRANCISCO, CALIFORNIA, USA APRIL 01-05, 200, XP002193939 *
RYUNGSA KIM ET AL.: "An analysis of the therapeutic efficacy of protracted infusion of low-dose 5-fluorouracil and cisplatin in advanced gastric cancer", J. INFECT. CHEMOTHER., vol. 6, 2000, pages 222 - 228, XP002193938 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7816630B2 (en) * 2003-04-12 2010-10-19 Eichenauer Heizelemente Gmbh & Co. Kg Device for receiving ceramic heating elements and method for the manufacture thereof

Also Published As

Publication number Publication date Type
WO2003004064A3 (en) 2003-11-06 application
WO2003004064A2 (en) 2003-01-16 application

Similar Documents

Publication Publication Date Title
Pham et al. The dietary isothiocyanate sulforaphane targets pathways of apoptosis, cell cycle arrest, and oxidative stress in human pancreatic cancer cells and inhibits tumor growth in severe combined immunodeficient mice
Singh et al. Rottlerin induces autophagy which leads to apoptotic cell death through inhibition of PI3K/Akt/mTOR pathway in human pancreatic cancer stem cells
Burnett et al. Current progress of siRNA/shRNA therapeutics in clinical trials
Haney et al. Exosomes as drug delivery vehicles for Parkinson's disease therapy
Günther et al. Polyethylenimines for RNAi-mediated gene targeting in vivo and siRNA delivery to the lung
Harris et al. Glutathione and thioredoxin antioxidant pathways synergize to drive cancer initiation and progression
Yu et al. Curcumin alleviates diabetic cardiomyopathy in experimental diabetic rats
Brand et al. Metabolism and transport of the citrus flavonoid hesperetin in Caco-2 cell monolayers
John et al. Epithelial barriers in intestinal inflammation
Are et al. Anaplastic thyroid carcinoma: biology, pathogenesis, prognostic factors, and treatment approaches
Stover et al. Systemic delivery of liposomal short-chain ceramide limits solid tumor growth in murine models of breast adenocarcinoma
Choi et al. Pretreatment of sildenafil attenuates ischemia-reperfusion renal injury in rats
Banerjee et al. 3, 3′-Diindolylmethane enhances chemosensitivity of multiple chemotherapeutic agents in pancreatic cancer
Prosser et al. Molecular therapy for hepatic injury and fibrosis: where are we?
US20070298056A1 (en) Delivering functional nucleic acids to mammalian cells via bacterially-derived, intact minicells
Granados-Principal et al. New advances in molecular mechanisms and the prevention of adriamycin toxicity by antioxidant nutrients
Xu et al. Poly (ester amine)-mediated, aerosol-delivered Akt1 small interfering RNA suppresses lung tumorigenesis
Boulikas et al. Recent clinical trials using cisplatin, carboplatin and their combination chemotherapy drugs
Kimoto et al. Pulmonary carcinogenesis induced by ferric nitrilotriacetate in mice and protection from it by Brazilian propolis and artepillin C
Li et al. Modulating endogenous NQO1 levels identifies key regulatory mechanisms of action of β-lapachone for pancreatic cancer therapy
Gao et al. Anticancer effect and mechanism of polymer micelle-encapsulated quercetin on ovarian cancer
US20080119425A1 (en) Clusterin Antisense Therapy for Treatment of Cancer
Watanabe et al. In vivo siRNA delivery with dendritic poly (L-lysine) for the treatment of hypercholesterolemia
US20040147473A1 (en) Methods of treatment of a bcl-2 disorder using bcl-2 antisense oligomers
WO2011156119A1 (en) Combination therapy methods for treating proliferative diseases

Legal Events

Date Code Title Description
ST Notification of lapse