FR2715937A1 - Two pathogenic or infectious agents associated with multiple sclerosis - Google Patents

Abstract

Compsn. (A) comprises 2 pathogenic and/or infectious agents, isolated or purified, associated with multiple sclerosis i.e. (1) agent (Ia) that is a human virus with reverse transcriptase activity and of the endogenous retroviral family, or its variant and (2) agent (Ib) or its variant. (Ia) and (Ib) are derived from the same viral strain, i.e. POL-2 (ECACC V92072202) or MS7PG (ECACC V93010816), or their variants. Alternatively (Ia) and (Ib) are produced by the same cell line, i.e. PLI-2 (ECACC 92072201) or LM7PC (ECACC 93010817) or other similar infected cell cultures.

Description

I

  MSRV1 and MSRV2 viruses associated together with Multiple Sclerosis and their nucleic constituents Multiple Sclerosis (MS) is a demyelinating disease of the central nervous system (CNS), the cause of which is still unknown.

  Numerous studies have supported the hypothesis of a viral etiology of the disease, but none of the known viruses tested has proven to be the causative agent sought: a review of the viruses sought for years in MS has been made by E. Norrby (Prog. Med. Virol., 1978; 24, 1-39) and RT Johnson (in "Handbook of clinical neurology, 47 Demyelinating diseases". Vinken P. and Bruyn GW, eds. Amsterdam, Elsevier science Publishing, 1985, 319-336). At the same time, the possibility of an exogenous and / or infectious factor is suggested by the existence of localized epidemics or "clusters" of MS as has been observed in the Feroes Islands between 1943 and 1960 (Cook 1980), in Sardinia (Rosati, 1988), in Norway (Riisse, 1991), as well as in studies on migrants (Elian, 1990). Among all the exogenous factors suggested, viruses have been studied most often and a viral etiology is classically mentioned.

  The observation, in MS, of phenomena assimilable to an autoimmunity reaction has led to an "essential" etiological autoimmune hypothesis (see: Lisak RP, Zweiman B. New Engl. J. Med. 1977; 297 , 850-853, and, Lassmann H. and Wisniewski HM Arch Neurol.

  1979; 36, 490-497). However, this autoimmunity directed against certain components of the CNS has been shown to be unspecific for MS and frequent in inflammations of the CNS, associated or not with an infection, as has been shown by Hirayama M. et al. (Neurology 1986; 36, 276-8), Kenneth G. Warren et al. (Annals of Neurology 1986; 20, 20-25), Suzumura A. et al. (Journal of Neuroimmunology 1986; 11, 137-47), and, Tourtelotte W. et al. (Journal of Neurochemistry 1986; 46, 1086-93). In addition, as noted by E.J. Field (The Lancet 1989; I, 1272.) none of the immunosuppressive therapies has produced decisive results against MS. It now seems likely that the "autoimmune" manifestations are induced by a mechanism of viral origin: co-sensitization to viral determinants associated with molecules of cellular origin, phenomena of molecular mimicry - as described by Fujinami RS and Oldstone MBA (in "Molecular mimicry: Cross-reactivity between microbes and host proteins as a cause of autoimmunity".

  Oldstone M.B.A., ed. Current Topics in Microbiology and Immunology, vol. 145, Berlin, Springer-Verlag, 1989) - or, according to P. Rudge (Journal of Neurology, Neurosurgery and Psychiatry, 1991 54, 853-855), by expression of retroviral superantigens.

  Research has supported a hypothesis that a retrovirus is the cause of the disease: the recent discovery by A. Gessain et al. (J. Infect.

  Disease 1988; 1226-1234), of neurological syndromes associated with the HTLV-I virus, originally known as an agent for adult T leukemia, has led many authors, such as H. Koprowski et al. (Nature 1985; 318, 154), M. Ohta et al. (J. Imunol. 1986; 137, 3440), E. P. Reddy et al. (Science 1989; 243, 529), S.J. Greenberg et al.

  (Proc. Natl. Acad. Sci. USA 1989; 86, 2878), J.H.

  Richardson et al. (Science 1989; 246, 821), S.L. Hauser et al. (Nature 1986; 322, 176) and A. Karpas et al.

  (Nature 1986; 322, 177), to seek an implication of this human retrovirus in MS, however without success or with results suggesting cross-reactions.

  In addition, there is an animal model very close to MS, induced by a retrovirus: the MAEDI-VISNA sheep virus. It is known that natural infection by this virus can cause two types of disease in this animal: Maedi, interstitial lymphocytic pneumonia which can occur during primary infection with this retrovirus and late demyelinating neurological pathology generally following a phase of prolonged latency, the Visna. The pathophysiology of natural Visna agrees with most clinical and biological data on MS, as reported by Johnson RT (Rev. Infect. Dis. 1985; 7, 66-67), Narayan O. and Cork LC (Rev. Infect. Dis. 1985; 7, 89-98), and Nathanson N. et al. (Rev. Infect. Dis. 1985; 7, 75-82). Experimental infection of sheep by intraventricular inoculation of neurovirulent strains of the VISNA virus has made it possible to establish the responsibility of this virus in the genesis of this demyelinating disease of sheep. As explained by Nathanson N. et al. (Rev.

  Infect. Say. 1985; 7, 75-82), Hoffman P.M. and Panitch H.S.

  (in, "Handbook of clinical neurology, 12: Viral diseases" RR Mc Kendall, ed. Elsevier science Publishing, Amsterdam, 1989, p 453-466), and A. Haase (Nature 1986; 322, 130-136), she differs from natural infection in its exacerbated neuropathological consequences, but remains close to MS. It is moreover notable that, in all the work carried out on this subject by the aforementioned authors, in particular, the Visna virus is regularly found in the choroid plexus cells of the brain which constitute a site of latency and occasional replication of the provirus. Visna; the location of these cells at the blood / cerebrospinal fluid (CSF) interface certainly explains this phenomenon.

  In addition, the Visna model provides additional data for the retrovirological approach to this type of disease. Indeed, it turns out that, within the framework of the natural infection of these sheep, epidemiological and biological coincidences have been observed between on the one hand the pathologies of Maedi-Visna and on the other hand, sheep adenomatosis pulmonary or Jaagsiekte, tumor pathology caused by another retrovirus, JSRV (De Martini JC et al. JNCI 1987; 79, 167-177 / Rosadio RH et al. Vet. Pathol. 1988; 25, 58-66 / Dawson M. et al. Br. Vet. J. 1990; 146, 531-537). JSRV is an endogenous retrovirus, or even the exogenous strain associated with a family of endogenous elements, whose infectious and oncogenic properties have been demonstrated (York D. F. et al. J. Virol. 1992; 66, 4930-4939). However, it is notable that in natural isolates from sheep affected by diseases attributed either to the Maedi-Visna retrovirus or to the Jaagsiekte retrovirus, the two retroviruses are generally found (Dawson M. et al. Br. Vet. J. 1990; 146, 531-537 / York DF et al. J. Virol. 1991; 65, 5061-5067). This coexpression and / or coinfection seems to indicate a synergistic role of these two retroviruses in the context of Maedi (De Martini J.C. et al. J.N.C.I. 1987; 79, 167-177). Thus, in certain techniques for the purification of natural isolates on a sucrose gradient, it has been possible to demonstrate the existence of two separate sedimentation peaks corresponding respectively to JSRV and to the Maedi-Visna retrovirus (York D.F. and coil. J. Virol.

  1991; 65, 5061-5067). These data allow us to glimpse the complexity of an analytical approach aiming to characterize a retroviral agent associated with a given disease, starting from natural isolates in which several pathogenic agents can coexist.

  Recently, a retrovirus, different from known human retroviruses, has been isolated from MS patients by H. Perron et al. (Res. Virol. 1989; 140, 551-561 / in: 'Current concepts in multiple sclerosis "Wiethôlter et al., Eds. Amsterdam, Elsevier, 1991, p. 111-116 / The Lancet 1991; 337, 862-863 The authors were also able to show that this retrovirus could be transmitted in vitro, that MS patients produced antibodies capable of recognizing proteins associated with the infection of leptomeningeal cells by this retrovirus and that the expression of the latter could be strongly stimulated by the immediate-early genes of certain herpesviruses (Perron et al. Herpes simplex virus ICPO and ICP4 immediate-early proteins strongly enhance expression of a retrovirus harboured by a leptomeningeal cell-line from multiple sclerosis. 1993. J. Gen Virol. 74; 65-72).

  All these results plead in favor of the role in MS of at least one unknown retrovirus or of a virus having a detectable reverse transcriptase activity according to the method published by H. Perron et al. (Res. Virol.

  1989; 140, 551-561) and qualified as "RT type LMI7".

  Recently, the Applicant's work has made it possible to obtain two continuous lines of cells infected with natural isolates originating from two different patients suffering from MS, by a culture method as described in patent application No. WO 93/20188. These two lines derived from human plexus choroid cells, called LM7PC and PLI-2, were deposited at the E.C.A.C. C. respectively on July 22, 1992 and January 8, 1993, under the numbers 92072201 and 93010817, in accordance with the provisions of the Budapest Treaty. Furthermore, viral isolates with RT activity of LM7 type have also been deposited at E.C.A.C.C. under the global name of "strains". The "strain" or isolate hosted by the PLI-2 line, called POL-2, was deposited on July 22, 1992 under the number V92072202. The "strain" or isolate hosted by the LM7PC line, called MS7PG, and was deposited January 8, 1993 under number V93010816.

  From the above cultures and isolates, characterized by biological and morphological criteria, we then set out to characterize the nucleic material associated with the viral particles produced in these cultures.

  Thus, the objects of the invention are the following: - an association of two viruses associated with multiple sclerosis, namely, a first human virus, having a reverse transcriptase activity, and associated with a family of endogenous retroviral elements, or a variant of the first virus comprising at least one antigen recognized by at least one antibody directed against at least one corresponding antigen of said first virus, and a second virus, having a reverse transcriptase activity, or a variant of said second virus, these two viruses being from a single viral strain chosen from the strains called POL-2 respectively, deposited on 07.22.1992 with the ECACC under the access number V92072202 and MS7PG deposited on 08.01.93 with the ECACC under the number access V93010816, and among the variant strains consisting of viruses comprising at least one antigen which is recognized by at least one antibody directed against at least one cor antigen respondent of one or other of the viruses of the viral strains POL-2 and MS7PG mentioned above; - an association of two viruses associated with multiple sclerosis, namely, a first human virus having reverse transcriptase activity, and associated with a family of endogenous retroviral elements, or a variant of the first virus comprising at least one antigen recognized by at least one antibody directed against at least one corresponding antigen of said first virus, and a second virus having a reverse transcriptase activity, or a variant of the second virus, these two viruses being produced by the same cell line chosen from the strains called respectively PLI- 2 deposited on 07/22/1992 with the ECACC under the access number 92072201 and LM7PC deposited on the 08.01.93 with the ECACC under the access number 93010817, and by all infected cell cultures likely to produce a virus including at least one antigen which is recognized by at least one antibody directed against at least one corresponding antigen of one or other of the v irus produced by the aforementioned PLI-2 and LM7PC lines; an association of two viruses, namely a first virus whose genome comprises a nucleotide sequence having at least 50% and preferably at least 70% of homology with the nucleotide sequence SEQ ID N05 or its complementary sequence, SEQ ID N05 comprising end to end, SEQ ID N01, SEQ ID N03 and SEQ ID N04; SEQ ID Nol, SEQ ID N03 and SEQ ID N04 being described respectively in Fig 1, in Fig 9 and in Fig 20, or a variant of said first virus whose genome codes for a peptide sequence having at least 50% and preferably at least 70% homology with the peptide sequence coded by the nucleotide sequence SEQ ID Nol, described in FIG. 1, or its complementary sequence, and a second virus, the genome of which comprises a nucleotide sequence having at least 50% and preferably at least% homology with a nucleotide sequence chosen from SEQ ID N02, described in FIG. 19, or its complementary sequence, or a variant of said second virus whose genome codes for a peptide sequence having at least 50%, and preferably at at least 70% homology with the peptide sequence coded by the nucleotide sequence SEQ ID N02 or its complementary sequence; - A method of detecting a first virus, and / or a second virus, associated with multiple sclerosis, characterized in that at least two fragments are used, a first fragment whose nucleotide sequence is present at least 50% and preferably at least 70% homology with SEQ ID N05 or its complementary sequence, and / or a second fragment whose nucleotide sequence has at least 50% and preferably at least 70% homology with SEQ ID NO2 or its complementary sequence, each of said fragments being a probe or a primer; a diagnostic, prophylactic or therapeutic composition, characterized in that it comprises a combination of the invention and a first nucleotide fragment, and / or a second nucleotide fragment, as defined in the invention; - a method for detecting and / or identifying an association of viruses associated with multiple sclerosis, in a biological sample, characterized in that an RNA and / or a DNA specific to each said virus is exposed, and / or their RNA and / or DNA complementary to a combination of a first nucleotide fragment and a second nucleotide fragment, as defined in the invention; a method for detecting a first virus, and / or a second virus, associated with multiple sclerosis, characterized in that a first peptide partially or totally encoded by the first nucleotide fragment defined in the invention, and / or a second peptide partially or completely encoded by the second nucleotide fragment defined in the invention; - a diagnostic, prophylactic or therapeutic composition, characterized in that it comprises a first peptide and / or a second peptide, defined in the invention; a diagnostic, prophylactic or therapeutic composition, characterized in that it is obtained by preparation of a first specific ligand of the first peptide, and / or a second specific ligand of the second peptide, and by association of the first ligand and / or of the second ligand; - A nucleotide fragment, characterized in that its nucleotide sequence has at least 50%, and preferably at least 70% homology, with a sequence chosen from SEQ ID N01, SEQ ID N03, SEQ ID N04, and the sequence SEQ ID N05 comprising end-to-end SEQ ID N01, SEQ ID N03, SEQ ID N04.

  Before detailing the invention, various terms used in the description and the claims are now defined: - according to the invention, a nucleotide fragment or an oligonucleotide is a chain of monomers, characterized by the informational sequence of natural nucleic acids, susceptible to hybridize to a nucleotide fragment under predetermined conditions, the sequence being able to contain monomers of different structures and to be obtained from a natural nucleic acid molecule and / or by genetic recombination and / or by chemical synthesis, - Thus, a monomer can be a natural nucleotide of nucleic acid whose constituent elements are a sugar, a phosphate group and a nitrogenous base; in RNA the sugar is ribose, in DNA the sugar is deoxy-2-ribose; depending on whether it is DNA or RNA, the nitrogen base is selected from adenine, guanine, uracil, cytosine, thymine; or a nucleotide modified in at least one of the three constituent elements; for example, the modification can take place at the base level, generating modified bases such as inosine, methyl-5-deoxycytidine, deoxyuridine, dimethylamino-5-deoxyuridine, diamino-2,6-purine , bromo-5-deoxyuridine and any other modified base promoting hybridization, at the sugar level, namely the replacement of at least one deoxyribose with a polyamide (PE Nielsen et al, Science, 254, 1497-1500 (1991) ), at the phosphate group, for example its replacement with esters chosen in particular from diphosphate, alkyl and arylphosphonate and phosphorothioate esters, - by "informational sequence" means any ordered sequence of monomers, the chemical nature of which and the order in a reference direction constitute information of the same quality as that of natural nucleic acids, by hybridization is understood the process during which, under appropriate conditions, two nucleotide fragments , having sufficiently complementary sequences, pair to form a double strand, a probe is a nucleotide fragment comprising from 10 to 100 monomers, advantageously from 10 to monomers, having a specificity of hybridization under determined conditions to form a complex d hybridization with a nucleotide fragment having a nucleotide sequence included in the RNA of the virus of the invention, the DNA obtained by reverse transcription of said RNA and the DNA of which said RNA is the transcription product; a probe can be used for diagnostic purposes such as capture and / or detection probes or for therapy purposes, - the capture probe can be immobilized on a solid support by any suitable means, i.e. - say directly or indirectly, for example by covalence or passive adsorption, - the detection probe is marked by means of a marker chosen from radioactive isotopes, enzymes especially chosen from peroxidase and alkaline phosphatase and those capable of hydrolyzing a chromogenic, fluorigenic or luminescent substrate, chromophoric chemical compounds, chromogenic, fluorigenic or luminescent compounds, nucleotide base analogs, and biotin, - the probes used for diagnostic purposes of the invention can be used in all known hybridization techniques and in particular the so-called "DOT-BLOT" techniques (MANIATIS et al, Molecular I1 Cloning, Cold Spring Harbor, 1982), "SO UTHERN BLOT "(SOUTHERN. E.M., J. Mol. Biol., 98, 503 (1975), "NORTHEN BLOT" which is a technique identical to the "SOUTHERN BLOT" technique but which uses RNA as target, the SANDWICH technique (DUNN AR, HASSEL JA, Cell, 12, 23 (1977)); advantageously, the SANDWICH technique is used in the present invention comprising a specific capture probe and / or a specific detection probe, it being understood that the capture probe and the detection probe must have an at least partially different nucleotide sequence, a another application of the invention is an antisense therapy probe, said probe being capable of hybridizing in vivo on RNA and / or on DNA to block the phenomena of translation and / or

transcription,

  a primer is a probe comprising from 10 to 30 monomers, having a specificity of hybridization under conditions determined for the initiation of an enzymatic polymerization, for example in an amplification technique such as PCR (Polymerase Chain Reaction), in an elongation process, such as sequencing, in a reverse transcription method or the like, - the homology characterizes the degree of similarity of two compared nucleotide fragments.

  Since a virus possessing reverse transcriptase enzymatic activity can be genetically characterized in the form of both RNA and DNA, both DNA and viral RNA will be used to characterize the sequences relating to a viruses having such reverse transcriptase activity.

  The invention will be better understood on reading the detailed description which follows, made with reference to the appended figures in which: FIG. 1 represents the nucleic acid sequence of the clone PSJl7, (SEQ ID N0l), - FIG. 2, gives an alignment of the nucleic sequence PSJ17 with that of a known retrovirus ERV9, - FIG. 3, corresponds to the amino acid sequence of the sequence PSJ17, - FIG. 4, gives the comparison of the protein sequences of SPJ17 and theoretical ERV9 (according to La Mantia et al. (1991)), - Figure 5 represents the sequences of the different MSRV-1B clones obtained after PCR in the "pol" region defined by Shih et al., - Figure 6, represents the tree phylogenic sequence MSRV-1B obtained by PCR in the "pol" region defined by Shih et al., - Figure 7, gives the definition of a functional reading frame for each type of family type MSRV-1B / "PCR pol ", - Figure 8 represents, according to Fig 8A, the alignment of the protein sequences deduced from the consensus A, B, C and D of MSRV-1B type with sequences of retroviral origin, according to Fig 8B the phylogenic tree and according to Fig 8C, the homology with respect to ERV9, - Figure 9 represents the MSRV-1B type consensus sequences obtained from viral RNA, derived from the LM7PC and PLI-2 lines, amplified by PCR in the "pol" region, as well as a general consensus comprising the amplification primers, and called SEQ ID N03, - - Figure 10 is a representation of the reverse transcriptase activity (RT) in dpm (disintegration per minute) in the sucrose fractions taken from a gradient of purification of the virions produced by cultured B cells from a patient with MS.

  FIG. 11 gives, under the same conditions as in FIG. 10, the assay of the reverse transcriptase activity in the culture of a line B obtained from a control free from multiple sclerosis, - FIG. 12 represents, according to FIG. 12A, the consensus and majority sequences of MSRV-1B type obtained from the B lymphocytes of a patient suffering from MS, with * MAJ corresponding to the majority sequence in which the bases conserved in all cases are represented by ATGC, the majority bases are represented by atgc and the deleted bases with respect to the consensus are represented by -, * VAR corresponding to the majority sequence (variation) in which the bases preserved with respect to the consensus are represented by., the minority bases are represented by atgc and the deleted bases with respect to the consensus are represented by - and * MIN corresponding to the minority sequences (exception) in which the b ases preserved with respect to the majority sequence are represented by. and the bases deleted with respect to the consensus by -, as well as, according to FIG. 12B, the translation of the majority sequence, with an: nucleic acids: - in bold, characters of small sizes: the restriction sites of the primers - in bold, uppercase characters, 3 'end of the primers - underlined, the majority nucleic sequence coding prot: protein sequence: - underlined: amino acids coded by the primers FIG. 13 represents the MSRV-2A type sequence obtained from LM7 cultures according to the main protocol of Shih et al., FIG. 14 represents the alignment of a protein sequence MSRV-2A obtained from the LM7 culture with known retroviral protein sequences; the amino acids conserved between the amplification product (Trad pol SHIH) and certain retroviruses are underlined in the alignment. This sequence is very far from all the retroviruses known to date, in particular from HTLV, in particular by the presence of a deletion in the 5 ′ region, - Figure 15, gives an example of a consensus sequence for the sequences of type MSRV-2B, - Figure 16 represents the definition of a consensus sequence of type MSRV-2B according to Fig 16A, a definition of a functional reading frame according to Fig 16B, a repetition of the primer 3 'according to Fig 16C and a sequence between VLPQG and YVDD according to FIG. 16D, FIG. 17 represents the alignment of a protein sequence MSRV-2B (with 1 or 2 primers 3 ′) with known retroviral protein sequences; the amino acids conserved (1st line) between the MSRV-2B consensus and certain retroviruses are underlined in the alignment.

  This sequence is very far from all the retroviruses known to date, in particular from HTLV, in particular by the presence of a deletion in the 5 ′ region and of an active site YVDD and not YMDD, - Figure 18, represents the consensus and majority sequences of MSRV-2B obtained from B lymphocytes of a patient suffering from MS, according to FIG 18A, * MAJ corresponding to the majority sequence in which the bases conserved in all cases are represented by ATGC, the majority bases are represented by atgc, and * VAR corresponding to the majority sequence (variation) in which the minority bases are represented by atgc as well as, the translation of the majority sequence, according to Fig 18B, in which the legend is as follows: an: acids nucleic acids: * in bold, small characters: the restriction sites of the primers * in bold, capital letters, 3 'end of the primers * underlined, the major nucleic sequence coding rity prot: protein sequence: * underlined: amino acids coded by the primers - Figure 19 gives a comparative analysis of nucleic (Fig 19A) and protein (Fig 19B) sequences of MSRV-2 type obtained from LM7 cultures , LM7PC and PLI-2 and B lymphocytes from a patient suffering from MS, according to the original or modified protocol of Shih et al., The consensus sequence being called SEQ ID N02, and with LigT4 corresponding to a sequence obtained from lines, according to the modified protocol, LBpatDuT4 corresponding to a sequence obtained from patient, according to the modified protocol and polSHIH corresponding to a sequence obtained from lines, according to the original protocol, - Figure 20, represents the alignment of the consensus MSRV-1B, with the "nested" PCR product M003- P004, as defined in Example 8, and the clone PSJ17 (MSRV-1A) with the following legend: * underlined: primer M003-BCD as described in the example e 8 primer P004-BCD as described in Example 8 * in bold: intermediate sequence between PSJ17 and MSVR-1B and shows that the sequences MSRV-1A and B belong to the same viral family and probably to the same viral strain and constitute two different parts of the same viral genome, it also represents the intermediate sequence PSJl7 and MSRVl-B, called SEQ ID N04.

  EXAMPLE 1 OBTAINING A PSJ17 CLONE DEFINING AN MSRV-1A FAMILY BY REACTION OF REVERSE TRANSCRIPTASE

  ENDOGENOUS ON A PREPARATION OF VIRION FROM THE LINE

PLI-2.

  This approach aims to obtain DNA sequences retrotranscribed from the RNA assumed to be retroviral in the isolate by using the reverse transcriptase activity present in this same isolate. This reverse transcriptase activity can theoretically only work in the presence of a retroviral RNA, linked to a primer tRNA or hybridized to short strands of DNA already retranscribed in retroviral particles (Lori F. et al. J. Virol. 1992; 66.5067-5074). Thus obtaining specific retroviral sequences in material contaminated with cellular nucleic acids was optimized thanks to the specific enzymatic amplification of the viral RNA portions by viral reverse transcriptase activity. The authors have, for this, determined the particular physicochemical conditions under which this enzymatic activity of reverse transcription on RNAs contained in virions could be effective in vitro; these correspond to the technical description of the protocols presented below (endogenous RT reaction, purification, cloning and sequencing).

  The molecular approach consisted in using a concentrated, but not purified, virion preparation obtained from culture supernatants of the PLI-2 line prepared according to the following method: the culture supernatants are collected twice a week, pre- centrifuged at 10,000 rpm for 30 minutes to remove cell debris, and then frozen at -80 C or used as in the following steps. The fresh or thawed supernatants are centrifuged on a cushion of PBS-glycerol 30% at 100,000 g (or 30,000 rpm in an LKB-HITACHI type 45 T rotor) for 2 h at 4 C. After removal of the supernatant, the sedimented pellet is taken up in a small volume of PBS and constitutes the fraction of concentrated but not purified virions. This concentrated but not purified viral sample was used to carry out a so-called endogenous reverse transcription reaction, as described below: a volume of 200 g of virions purified according to the protocol described above and containing a reverse transcriptase activity of approximately 1-5 million DPM is thawed at 37 C until a liquid phase appears, then placed on ice. A once concentrated buffer was prepared with the following components: Tris-HCl pH 8. 2.500 mM; 75 mM NaCl; 25 mM MgC12; DTT 75 mM and NP 40 0.10%. 100 µl of 5X buffer + 25 µl of a 100mM dATP solution + 25 µl of a 100mM dTTP solution + 25 µl of a 10OmM dGTP solution + 25 M1 of a 100mM dCTP solution + 100 M1 of water sterile distilled + 200 μl of the suspension of virions (TI activity of 5 million DPM) in PBS were mixed and incubated at 42 ° C. for 3 hours. After this incubation the reaction mixture is directly mixed with a buffered phenol / chloroform / isoamyl alcohol mixture (Sigma ref. P 3803), the aqueous phase is collected and a volume of sterile distilled water is added to the organic phase to re-extract residual nucleic material.

  The collected aqueous phases are combined and the nucleic acids contained are precipitated by adding 3M sodium acetate pH 5.2 to 1/10 of volume + 2 volumes of ethanol + 11l of glycogen (BoehringerMannheim ref. 901 393) and placing at -20 ° C of the sample for 4 h or overnight at + 4 ° C. The precipitate obtained after centrifugation is then washed with 70% ethanol and resuspended in 60 ml of distilled water. The products of this reaction were then purified, cloned and sequenced according to the protocol described below: blunt-ended DNA with unpaired adenines at the ends were generated: a "filling" reaction was first carried out: 25 M1 of the previously purified DNA solution were mixed with: 2M1 of a 2.5 mM solution containing, in equimolar amount, dATP + dGTP + dTTP + dCTP / 1 1 of T4 DNA polymerase (Boehringer- Mannheim ref . 1004 786) / 5/1 of 10X "incubation buffer for restriction enzyme" (Boehringer-Mannheim ref. 1417 975) / 1 Ml of a 1% solution of bovine serum albumin / 16 41 of sterile distilled water. This mixture was incubated for 20 minutes at 110C. 5041 of TE buffer and 11 l of glycogen (Boehringer-Mannheim ref. 901 393) were added thereto before extraction of the nucleic acids with phenol / chloroform / isoamyl alcohol (Sigma ref. P 3803), and precipitation with sodium acetate as previously described. The DNA precipitated after centrifugation is resuspended in 10 μl of 10 mM Tris pH 7.5 buffer. Then, 5g1 of this suspension was mixed with 20M1 of Taq 5X buffer, 20 J1 of 5mM dATP, 11i (5U) of Taq DNA polymerase (AmplitaqTM) and 54 41 of sterile distilled water.

  This mixture is incubated for 2 h at 75 ° C. with an oil film on the surface of the solution. The DNA suspended in the aqueous solution taken from below the oil film after incubation is precipitated as described above and resuspended in 2 μl of sterile distilled water. The DNA obtained was inserted into a plasmid using the TA CloningTM kit. The 2g1 of DNA solution were mixed with 5g1 of sterile distilled water, 141 of a concentrated ligation buffer "10X LIGATION BUFFER", 241 of "pCRTM VECTOR" (25 ng / ml) and 141 of "TA DNA LIGASE ". This mixture was incubated overnight at 12 C. The following steps were carried out in accordance with the instructions of the TA Cloning kit (British Biotechnology). At the end of the procedure, the white colonies of recombinant bacteria (white) were subcultured to be cultured and allow the extraction of the plasmids incorporated according to the so-called "miniprep" procedure (Sambrook J., Fritsch EF, and Maniatis T. , Molecular cloning, a laboratory manual. Cold spring harbor laboratory press, 1989). The plasmid preparation of each recombinant colony was cut with an appropriate restriction enzyme and analyzed on agarose gel.

  The plasmids having an insert detected under UV light after labeling the gel with ethidium bromide, were selected for sequencing the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA cloning kit.

  The reaction prior to sequencing was then carried out according to the method recommended for the use of the sequencing kit "Prism ready reaction kit dye deoxyterminator cycle sequencing kit" (Applied Biosystems, ref. 401384) and the automatic sequencing was carried out with the "automatic sequencer" model 373 A Applied Biosystems according to the manufacturer's instructions.

  The discriminant analysis on the computer databases of the sequences cloned from the DNA fragments present in the reaction mixture made it possible to highlight three categories of sequences: the first corresponded to sequences completely unknown in the databases and without any relation to the genes described. The second, corresponded to sequences totally homologous to portions of known cellular genes. The third corresponded to sequences with more or less significant partial homologies with known sequences of retroviruses or retrotransposable genetic elements such as retroposons or retrotransposons.

  The origin of the sequences of the first category is difficult to define whereas for the second, it is explained by the expected presence of fragments of cellular DNA contaminating the fraction of nucleic acids extracted from the concentrated but non-viral sample. purified, after incubation under the conditions required for the endogenous reverse transcription reaction mentioned above.

  The origin of the sequences of the third category is clearly retroviral or of retroviral type. It is known that endogenous retroviral sequences related to a replicating retrovirus, or co-expressed in the same infected cell, can be packaged in the virions generated by a given retroviral strain (Linial ML and Miller AD in "Current topics in microbiology and immunobiology . Retroviruses, strategies of replication "vol. 157, p. 125-152; Swanstrom R. and Vogt PK editors, Springer-Verlag, Heidelberg 1990) and the presence of certain retroviral type sequences can be explained by this phenomenon.

  However, among the sequences in this category, one sequence was found most frequently and was found to represent the majority of the clones obtained under these conditions from the viral isolate "POL-2" from the culture of the line. PLI-2 between the fortieth and the sixtieth passage in culture after establishment of the continuous line according to the principle described in patent n WO-93/20188 in the name of the Applicant. The corresponding clone PSJ17 was completely sequenced and the sequence obtained, presented in FIG. 1, was analyzed using the "Geneworks" software on the updated "Genebank" databases. Analysis of the databases did not find an identical sequence already described. Only a partial homology could be found with certain known retroviral elements.

  The most interesting relative homology relates to an endogenous retrovirus called ERV-9, or HSERV-9, according to the references (La Mantia et al. Nucleic Acids Research 1991; 19, 1513-1520). Thus the sequence of the clone PSJ17 could be localized in the pol region coding for the reverse transcriptase of a retrovirus, or of a virus possessing an enzyme with reverse transcriptase activity, by alignment with the sequence described for HSERV-9, as presented in FIG. 2. The amino acid translation of the clone PSJ17 is presented in FIG. 3, and the comparison with this protein sequence and the theoretical protein sequence of ERV9 as described by La Mantia et al is presented. in figure 4.

  EXAMPLE 2: OBTAINING CLONES RELATED TO PSJ17, DEFINING AN MSRV-iA FAMILY, BY ENZYMATIC AMPLIFICATION (RT-PCR) ON A PREPARATION OF VIRION FROM THE PLI-2 LINE.

  Nucleic primers, PSJ17A and PSJ17B, were defined in the sequence of the clone PSJ17 and were used to search for the presence of RNA and / or DNA corresponding to a virus containing this sequence, in different biological samples. These are defined below: Primer sequence direction PSJ17 A: AAATTTCCTCACTACCTG Antisense primer sequence PSJ17 B: GGGTTTAAGAGTTGCACA The PCR reactions were carried out in a total volume of 100 μl, containing 200 ng of DNA, 33 gmol of each primer, 0.25 mM of each dNTP, 10 g of 10X buffer (10 times concentrated) and 2.5 μl of Taq enzyme. The amplification cycles are carried out as follows: denaturation 95 C / 5 minutes, hybridization of the primers 50 C to 55 C / 2 minutes, extension 72 C / 2.5 minutes, then for 33 cycles, 95 C / 2 minutes, 50 C at 55 C / 2 minutes, 72 C / 2.5 minutes, and finally 95 C / 2 minutes, 50 C at 55 C / 2 minutes and 72 C / 7 minutes.

  RT-PCR reactions, according to an RNA amplification method as described in patent application EP 0 569 272 Ai, were carried out in a total volume of 100 μl, containing 200 ng of RNA, 1 g1 of RNA Guard, 33 pmole of each primer, 0.25mM of each dNTP, 101 of 10X buffer, 2.5 U of Taq enzyme. and 0.4 µl of RT enzyme (10u) are also added to the samples. The amplification cycles are carried out as follows: denaturation of the RNA 65 C / 10 minutes, synthesis of the cDNA 50 C / 8 minutes then the cycles are identical to those of the PCR described above. Control reactions were carried out so as to control the absence of contaminants (reaction on water). The products were analyzed on 10% acrylamide gel.

  One of the properties of the Taq polymerase consists in adding an adenine to the 3 ′ end of each of the two DNA strands, the products resulting from the PCR and from the RT-PCR were purified according to the method described in the example 1 then directly cloned using the TA Cloning kit (British Biotechnology), then sequenced according to the protocol described in Example 1.

  The biological material used consists of virion purified from the isolate "POL-2" (ECACC n V92072202) according to the procedure described below: the culture supernatants are collected twice a week, pre-centrifuged at 10,000 rpm for 30 minutes to remove cellular debris, and then frozen at -80 C or used as in the following steps. The fresh or thawed supernatants are centrifuged on a cushion of PBS-glycerol 30% at 100,000 g (or 30,000 rpm in an LKB-HITACHI type 45 T rotor) for 2 h at 4 C. After removal of the supernatant, the sediment pellet is taken up in a small volume of PBS and constitutes the fraction of concentrated but not purified virions. The concentrated virus is then deposited on a sucrose gradient in a sterile PBS buffer (15 to 50% w / w) and ultracentrifuged at 35,000 rpm (100,000 g) for 12 h at +4 C in a bucket rotor. 10 fractions are collected and 2041 are taken from each fraction after homogenization to measure the reverse transcriptase activity according to the technique described by H. Perron et al.

  (Res. Virol. 1989; 140, 551-561). The fractions containing the LM7 RT activity peak are then diluted in sterile PBS buffer and ultracentrifuged for one hour at 000 rpm (1000 000 g) to sediment the viral particles. The pellet of purified virions thus obtained is then taken up in a small volume of a buffer suitable for the subsequent use which will be made of it (Ex. Guanidium Thiocyanate buffer for the extraction of RNAs; sterile PBS for storage at -80 ° C. ).

  In particular, a method of amplifying RNA as described in patent application EP 0 569 272 A1, used on purified RNA, using primers as described above, made it possible to amplify material nucleic acid on a fraction of virion purified on a sucrose gradient according to the method described above from the isolate "POL-2" (ECACC n V92072202). This nucleic material once cloned and sequenced according to the techniques described in Example 1, was found to be, in these purified virions, the same genetic material as that of the clone PSJl7 obtained from the sample of concentrated virions but not -purified contained in an isolate "POL-2". A PCR reaction with the same primers on the same material, but without a step of synthesis of a cDNA from the RNA present in the nucleic material of the sample analyzed, did not allow any amplification of nucleic material. These results clearly indicate that the sequence of the clone PSJ17 is present in the form of RNA and not of DNA, in the fractions containing the peak of reverse transcriptase activity of LM7 type, after purification on a sucrose gradient. These results are compatible with the presence of viral particles containing a genomic RNA including the sequence of the clone PSJ17 and an enzyme reverse transcriptase, linked to the presence of a retrovirus not characterized by its specific sequences hitherto, in the purified fractions of virions produced by the PLI-2 line.

  Furthermore, the above-mentioned RT-PCR reaction (patent application EP 0 569 272 A1) was applied to biological samples, obtained from MS-free control patients, obtained under conditions identical to the fractions of the above-mentioned sacchorosis gradient. mentioned, with the difference that no specific reverse transcriptase activity of type "LM7" was detected there. The fractions of the same sucrose density as the peaks of reverse transcriptase activity listed (approximately 1.17 g / ml) were thus used. In these samples originating respectively from a culture of leptomeningeal cells from a patient suffering from Strumpell-Lorrain disease, from a culture of choroid plexus from a patient who died of a stroke, from a line of B lymphocytes (lymphoblastoid line spontaneous) of a patient suffering from an unspecified genetic disease, all being free of MS, this RT-PCR reaction with the primers contained in the "PSJ17" region did not make it possible to amplify nucleic material or, when an amplification was visualized in one case, the amplified material was found to have no relation to the "PSJ17" sequence (partial homology of the primers with cellular genes). Thus, in these samples from non-MS controls and coming from sucrose fractions homologous to those which contain viral particles associated with reverse transcriptase activity in the "POL-2 / PLI-2" and "MS7PG / LM7PC" samples from MS, this retroviral sequence was not found associated with RNA. These results are compatible with the absence of production of retroviral particles containing the sequence lu clone I1J1J ckli cl pIA l cell culture from patients free from MS.

  On the other hand, these sequences could be detected by this same PCR technique, as described above, in biological samples such as various human cells, sera obtained after formation of the blood clot, cerebrospinal fluids obtained by lumbar puncture. and may contain cellular debris, where human DNA was present. This is true in MS patients, but also in control and healthy controls. A southern blot study with the clone PSJ17 used as probe, confirmed that the sequence of the clone PSJ17 was related to a family of endogenous retroviruses present in the human genome. Given the relative homology with the endogenous retrovirus ERV-9, it is possible that the retrovirus containing the sequence PSJ17 is a member of a family of endogenous retroviruses related to ERV-9, or of a new family of endogenous retroviruses close to 'ERV-9, or an exogenous strain to which the endogenous ERV-9 family would be related, insofar as no homology with a known exogenous retrovirus has been identified for ERV-9, unlike all endogenous retroviral sequences characterized to date, as it appears in the

table 1.

  These results are therefore compatible with an expression of RNA from a family of endogenous retroviruses which the applicant has named MSRV-1A, having a relative homology with ERV-9, but containing a consensus of nucleic sequences with the reference clone PSJ17 .

  This MSRV-1A virus can be expressed differently between MS patients and MS-free people, by any type of cell capable of expressing this retrovirus. These results are also compatible with the presence of an exogenous retrovirus MSRV-1A, having a relative homology with ERV-9, but containing a consensus ie nuclear sequences with the reference clone PSJ17, hosted and expressed by certain infected cells in patients. with MS and not in healthy or MS-free controls.

  The sequence obtained in the clone PSJ17 and described above will be best used for the strict detection of RNA specifically expressed in patients with MS and, consequently, of peptides or proteins containing the amino acid sequence encoded by this sequence RNA or a related consensus thereof and derived from a variant MSRV-1A. Similarly, the use of these peptide sequences can therefore be envisaged to obtain antigens which will make it possible to detect the immune response to these antigenic motifs expressed in vivo in patients suffering from MS, insofar as the corresponding RNAs are expressed in vivo and allow the corresponding protein synthesis, in an original way in MS or any other pathology individualized and found associated with this same phenomenon of retroviral expression.

  EXAMPLE 3 OBTAINING CLONES DEFINING AN MSRV-1B FAMILY BY "NICHEATED" PCR AMPLIFICATION

  POL REGIONS PRESERVED RETROVIRUSES ON PREPARATIONS

  VIRIES FROM LM7 AND PLI-2 LINES.

  A PCR technique derived from the technique published by Shih et al. has been used. This technique makes it possible, by treatment of all the components of the reaction medium with DNase, to remove all traces of contaminating DNA. At the same time, by using different but overlapping primers in two successive series of PCR amplification cycles, it makes it possible to increase the chances of amplifying a cDNA resulting from a quantity of RNA initially low and further reduced in the sample by the parasitic action of DNAse on RNA; this, all the more so the DNase is used under conditions of excess activity which make it possible to eliminate all traces of contaminating DNA before inactivation of this enzyme remaining in the sample by heating at 85 ° C. for 10 minutes. This variant of the PCR technique described by Shih et al was used on virion fractions, purified as above for the frozen supernatants of LM7 cultures, this time from the spontaneous B lymphoblastoid line from a new case of MS, the PLI-2 culture (ECACC n 92072201) and the LM7PC culture (ECACC n 93010817), the latter two cultures having been obtained according to the methods which have been the subject of patent n WO 93/20188.

  After cloning with the TA cloning kit of the products amplified by this technique and analysis of the sequence using the automatic sequencer according to what is described in Examples 1 and 2, the sequences were analyzed using the Geneworks software, on the latest version (no 79, November 93) to date of the Genebank database.

  This technique was first applied to two fractions of purified virions as described in Example 2 on sucrose from the isolate "POL-2" produced by the PLI-2 line on the one hand, and from the isolate MS7PG produced by the LM7PC line on the other hand. The cloned and sequenced sequences from these two samples correspond to four categories. A first category of sequence corresponds to sequences amplified from retroviral nucleic material contaminating the reverse transcriptase of MoMuLV used for the step of synthesis of complementary DNA, as has already been reported previously. The second category, found in the majority of clones (55% of clones from POL-2 isolates from PLI-2 cultures, and 67% of clones from MS7PG isolates from LM7PC cultures) corresponds to a family of "pol" sequences close but different from the endogenous human retrovirus called ERV-9 or HSERV-9. The third category corresponds to sequences very highly homologous to the sequence assigned to a virus named by the applicant MSRV-2B and described in Examples 6 and 7. The fourth category corresponds to various sequences generally found in a copy, as well as a of endogenous retroviral type, however never found by other approaches or in other samples from culture expressing LM7 type reverse transcriptase activity.

  The second category of sequences representing the majority of clones consists of sequences whose variability makes it possible to define four subfamilies of sequences. These subfamilies are close enough to each other that they can be considered as quasi-species originating from the same retrovirus, as is well known for the HIV-1 retrovirus for example (Meyerhans et al., Cell 1989 ; 58, 901-910), or as the result of the expression of several endogenous proviruses co-regulated in producer cells, since they belong to the same family of endogenous retroviruses and therefore sensitive to the same regulatory signals possibly generated by the replicative provirus (Linial ML and Miller AD in "Current topics in microbiology and immunobiology. Retroviruses, strategies of replication" vol. 157, p. 125-152; Swanstrom R. and Vogt PK editors, Springer-Verlag, Heidelberg 1990). This new family of endogenous retroviruses or, alternatively, this new retroviral species from which we have obtained in culture the generation of quasi-species, and which contains a consensus of the sequences described below is called MSRV-1B by the applicant.

  In FIG. 5 are presented the sequences of the different MSRV1B clones sequenced during this experiment. These sequences have a nucleic acid homology ranging from 70% to 88% with the HSERV9 sequence referenced X57147 and M37638 in the Genebank database. The phylogenetic tree of these sequences is presented in FIG. 6. In this figure, the subfamilies A, B, CD represent the sequences which were found predominantly in similar experiments repeated later, in the RNA samples. pure from virions purified with isolates MS7PG and POL-2. From these families of sequences, four "consensus" nucleic sequences representative of different quasi-species of an optionally exogenous MSRV-1B retrovirus or of different subfamilies of an endogenous MSRV-1B retrovirus, have been defined. These representative consensuses are presented in Figure 7, with the translation into amino acids. A functional reading frame exists for each subfamily of these MSRV-1B sequences and it can be seen that the functional open reading frame each time corresponds to the amino acid sequence coming in second line under the nucleic acid sequence. An alignment of the consensus A, B, C, D and of a general consensus translated into protein with the known retrovirus sequences is presented in FIG. 8. The general consensus of the sequence MSRV-1B obtained by this PCR technique in the region "pol" is shown in Figure 9.

  EXAMPLE 4 OBTAINING CLONES DEFINING AN MSRV-1B FAMILY BY "NICHEATED" PCR AMPLIFICATION

  POL REGIONS PRESERVED RETROVIRUSES ON PREPARATIONS

  OF B LYMPHOCYTES FROM A NEW CASE OF MS.

  The same PCR technique modified according to the technique of Shih et al. was used to amplify and sequence the RNA nucleic material present in a fraction of purified virions at the peak of “LM7 type” reverse transcriptase activity on a sucrose gradient, according to the protocols described in Example 2, from a spontaneous lymphoblastoid line, obtained by self-immortalization in culture of B lymphocytes of an MS patient seropositive for Epstein-Barr virus (EBV) after cultivation of blood lymphoid cells in an appropriate culture medium containing an appropriate concentration of cyclosporine A. A representation of the reverse transcriptase activity in the sucrose fractions taken from a gradient of purification of the virions produced by this line (Duc.) is presented in FIG. 10. Similarly, the culture supernatants of a line B obtained under the same conditions from a control free from multiple sclerosis were treated under the same conditions and the do wise of reverse transcriptase activity in fractions of the sucrose gradient was negative everywhere (background) and is shown in Figure 11.

  Fraction 3 of the gradient corresponding to the SEP line B and the same fraction without reverse transcriptase activity of the non-SEP control gradient, were analyzed by the same RT-PCR technique as previously, derived from Shih et al., Followed by the same cloning and sequencing steps as described in Examples 1 and 2.

  Analysis of the randomly selected recombinant clones provided the same four categories of sequences as above. The first category (type 1) corresponds to the amplification of retroviral material contaminating the reverse transcriptase of MoMuLV. The second category (type 2) corresponds to the MSRV-1B type sequences as defined in Example 3. The third category corresponds to sequences very highly homologous to the sequence attributed to a virus named by the applicant MSRV-2B and described in examples 6 and 7.

  The results are presented in Table 2. It is quite remarkable that the MSRV-1B type sequences are found in the only material associated with a "LM7 type" reverse transcriptase activity peak originating from the lympLolastolle i line. 1II. s these were not found with the material of the control B lymphoblastoid line (non-MS) in 26 randomly selected recombinant clones. Only contaminating sequences of the Mo-MuLV type and sequences without any particular retroviral analogy were found in this control. The difference in results is obviously highly significant (chi-2, p <0.001). The analysis of the MSRV-1B type sequences obtained from line B of this MS patient is presented in FIG. 12.

  EXAMPLE 5 OBTAINING CLONES DEFINING AN MSRV-2A FAMILY BY AMPLIFICATION OF THE POL REGIONS

  PRESERVED RETROVIRUSES ON A VIRION PREPARATION

FROM LM7 LINE.

  The molecular approach consisted in using a PCR technique making it possible to amplify a relatively conserved region of the pol gene of exogenous and endogenous retroviruses, but also of viruses coding for an enzyme with reverse transcriptase activity such as in particular the hepatitis B virus. , which was published by Shih et al.

  (Shih A., Misra R., and Rush M.G. Detection of multiple, novel reverse transcriptase coding sequences in human nucleic acids: relation to primate retroviruses. J. Virol. 1989; 63, 64-75). This technique was used on the RNA extracted from a preparation of purified virions obtained according to the protocol described in Example 1, from the supernatants of the original LM7 culture (Perron et al. Res. Virol. 1989; 140, 551-561) kept frozen at -80 C since then. Prior to the PCR reaction, the sample RNA was transcribed into complementary DNA (cDNA) using the "cDNA synthesis system plus" kit (Amersham), according to the manufacturer's instructions and based on a value approximate to a log near the amount of RNA present in our sample.

  After PCR amplification according to the technique of shih et al., The nucleic material obtained was deposited on a gel with 2% agarose and the band visualized under ultraviolet light after labeling with ethidium bromide in a region of molecular weight of approximately 100 base pairs were cut and the nucleic acids contained, extracted according to the usual protocol (Sambrook J., Fritsch EF, and Maniatis T., Molecular cloning, a laboratory manual. Cold spring harbor laboratory press, 1989). then clones using the TA cloning KITe kit as described in Examples 1 and 2 (British Biotechnology) and the procedures recommended in the protocols attached to the kit.

  After spreading the transformed bacteria on the growth medium appropriate to the kit protocols, a few dozen recombinant clones were subcultured and amplified in order to obtain a sufficient quantity of plasmid according to the technique known as "miniprep" described in Sambrook J., Fritsch EF, and Maniatis T. (Molecular cloning, a laboratory manual. Cold spring harbor laboratory press, 1989). The insert of the plasmids thus purified was sequenced by automatic sequencing according to the protocol mentioned in Example 1.

  The sequences obtained were then analyzed using Mac Vector and Geneworks software on a Genebank computer database, for the nucleic sequences, and Swiss Prot, for the amino acid sequences deduced from the reading frames highlighted in the sequences. nucleic acids. Analysis of the sequences obtained from a viral sample from thawed LM7 supernatants purified at the peak of reverse transcriptase activity on a sucrose gradient, revealed three categories of sequences. A first category, corresponding to artefactual associations of the nucleic primers used for PCR amplification, a second category corresponding to sequences without a consistent open reading frame and a third category corresponding to retroviral sequences in the "pol" region expected by the primers used, and having at least one substantial open reading frame.

  In this third category, we could distinguish sequences strictly homologous to murine leukaemia virus strains which were found by the same methodological approach, in control tubes bringing together only water and the reverse transcriptase enzyme from Moloney-murine leukaemia virus used for the synthesis of cDNA. It was obvious that these sequences came from nucleic contaminants associated with this murine retrovirus enzyme used for this reaction step. We could also distinguish sequences represented by a number of clones ranging from one to three, and strictly homologous to known human endogenous retroviruses. These same sequences were detected in non-MS control samples, treated under the same conditions. Finally, we could also distinguish a sequence represented by a majority population of clones (approximately 42% of the clones), relative to the individual representativeness of the other sequences (always less than 5%, even 10% for a small number), and showing partial homologies with known retroviruses in the expected "pol" region.

  The interrogation of the Genebank database updated to date (version 79, November 93) did not reveal any identical sequence or with significant homologies.

  This sequence is shown in Figure 13.

  It has an open reading frame in phase with the two PCR primers found at the ends but it is shorter than all of the known retroviral sequences in the region expected between these primers. A "deletion" of 45 base pairs (15 amino acids) is observed there following the sequence of the "upstream" primer, as shown in FIG. 14, while the sequences preceding the "downstream" primer " are presented.

  However, the reading frame is open and uninterrupted over the entire sequence including the primers and the deduced amino acid sequence has significant homology with the corresponding region of known retroviruses, as shown in FIG. 14. In the internal sequence of the primers PCR, amino acids E, R, Q, P and D, normally fairly well conserved in this pol region of retroviruses and viruses with known reverse transcriptase activity (shih et al. J. Virol.

  1989; 63, 64-75) are found preserved in the correct positions in the reading frame of our original sequence.

  Finally, since this sequence is sufficiently divergent from the retroviral sequences already described in the databases, it can be argued that it is a sequence belonging to a new virus which the applicant has called MSRV-2A. This virus is a priori similar, according to the analysis of the sequences obtained, to a retrovirus, but, given the technique used to obtain this sequence, it may as well be a RNA virus whose genome code for an enzyme which incidentally has reverse transcriptase activity as is the case, for example, for the hepatitis B virus, HBV (Shih et al. J. Virol. 1989; 63, 64-75).

  EXAMPLE 6 OBTAINING CLONES DEFINING AN MSRV-2B FAMILY BY "NICHEATED" PCR AMPLIFICATION

  POL REGIONS PRESERVED RETROVIRUSES ON PREPARATIONS

  VIRIES FROM LM7 AND PLI-2 LINES.

  A PCR technique derived from the technique published by Shih et al. has been used. This technique makes it possible, by treatment of all the components of the reaction medium with DNase, to remove all traces of contaminating DNA. At the same time, by using different but overlapping primers in two successive series of PCR amplification cycles, it makes it possible to increase the chances of amplifying a cDNA resulting from a quantity of RNA initially low and further reduced in the sample by the parasitic action of DNAse on RNA; this, all the more so the DNase is used under conditions of excess activity which make it possible to eliminate all traces of contaminating DNA before inactivation of this enzyme remaining in the sample by heating at 85 ° C. for 10 minutes. This variant of the PCR technique described by Shih et al, was used on purified virion fractions, as described in Example 2, as previously for the frozen supernatants of the LM7 cultures, this time derived from spontaneous B lymphoblastoid line originating of a new case of MS, the PLI-2 culture (ECACC n 92072201) and the LM7PC culture (ECACC n 93010817), the latter two cultures having been obtained according to the methods which have been the subject of patents n WO 93 / 20188.

  After cloning with the TA cloning kit of the products amplified by this technique and analysis of the sequence using the automatic sequencer according to what is described in examples 1 and 2, the sequences were analyzed using the Geneworks software, on the latest version (79, November 93) to date of the Genebank database.

  This technique was first applied to two fractions of virions purified on sucrose from the "POL-2" isolate produced by the PLI-2 line on the one hand, and from the MS7PG isolate produced by the LM7PC line on the other hand. The cloned and sequenced sequences from these two samples correspond to four categories. A first category of sequence corresponds to sequences amplified from retroviral nucleic material contaminating the reverse transcriptase of MoMuLV used for the step of synthesis of complementary DNA, as has already been reported previously. The second category, found in the majority of clones (55% of clones from POL-2 isolates from PLI-2 cultures, and 67% of clones from MS7PG isolates from LM7PC cultures) corresponds to a family of "pol" sequences , named by the applicant MSRV-1B and described in examples 3 and 4, similar but different from the endogenous human retrovirus called ERV-9 or HSERV-9, however in a region other than the homology mentioned previously with the sequence of the clone PSJ17 defining the MSRV-1A family as described in Examples 1 and 2. The third category corresponds to sequences very highly homologous to the sequence attributed to a virus named by the applicant MSRV-2A and obtained previously from the supernatants of culture LM7 ( see example 5) by the unmodified technique of shih et al. However, the proportion of clones in this category is lower than that previously found on the viral isolate from the LM7 culture (5% of the clones from the POL-2 isolates from the PLI-2 culture, and, 6% of the clones from MS7PG isolates from LM7PC cultures). The fourth category corresponds to various sequences generally found in one copy, as well as one of endogenous retroviral type, however never found by other approaches or in other samples from culture expressing reverse transcriptase activity of LM7 type.

  The third category of sequences obtained in this experiment, is identical to the "pol" sequence of MSRV-2 type obtained previously, with a few mutations which can be explained by normal variability of the viral genome and by errors of the enzymes reverse transcriptase and taq-polymerase used in this technique.

  However, during this second approach, using a modification of the technique described by Shih et al., An a priori artefactual duplication of the downstream primer ("primer 3 ') was observed. This may stem from the configuration of the overlapping primers used for the two series of PCR amplification cycles ("semi-nested" technique). The consensus sequence of these clones is presented in FIG. 15. The corresponding functional reading frame, a representation of the duplication of the downstream primer (3 ′ primer) as well as the amino acid sequence visualizing the internal motif of the regions conserved in the most of the retroviruses (VLPQG and YVDD) are presented in FIG. 16. A comparison of the amino acid sequences of the MSRV-2B type obtained during this experiment and during the previous one shows only one difference in the region commonly cloned, namely the replacement of the methionine M found in the region of the PCR primer with a valine V, thus substituting the YVDD motif for the YMDD motif.

  The analysis in the databases of this last sequence, obtained by this modified technique on separate viral samples, does not change the fact that no significant homology is found with sequences already listed in the Genebank database . However, a certain analogy of the amino acid sequence with the equivalent region of known retroviruses exists, as is presented in FIG. 17. This analogy involves, as in the clones resulting from the previous technique, a deletion following the primer upstream. This sequence is, here too, compatible with an unknown retroviral genome or with an RNA viral genome (transcribed into cDNA in our protocol) coding for an enzyme having reverse transcriptase activity. In fact, the hepatitis B and cauliflower mosaic viruses (CaMV) which are not retroviruses but which have a polymerase with reverse transcriptase activity have been able to be amplified according to the technique of Shih et al. In addition, as also shown in FIG. 17, CaMV (clone CaMV QG-YM) has a deletion in this region but, unlike the sequence of MSRV-2 type, it is located on the side of the downstream primer (3 'primer).

  EXAMPLE 7 OBTAINING CLONES DEFINING AN MSRV-2B FAMILY BY "NICHEATED" PCR AMPLIFICATION

  POL REGIONS PRESERVED RETROVIRUSES ON PREPARATIONS

  OF B LYMPHOCYTES FROM A NEW CASE OF MS.

  Finally, the same PCR technique modified according to the technique of Shih et al. was used to amplify and sequence the RNA nucleic material present in a fraction of purified virions at the peak of “LM7 type” reverse transcriptase activity on a sucrose gradient, according to the protocols described in Examples 1 and 2, starting from a spontaneous lymphoblastoid line, obtained by self-immortalization in culture of B lymphocytes of an MS patient seropositive for Epstein-Barr virus (EBV) after cultivation of blood lymphoid cells in an appropriate culture medium containing an appropriate concentration of cyclosporin A. A representation of the reverse transcriptase activity in the sucrose fractions taken from a gradient of purification of the virions produced by this line (Duc.) is presented in FIG. 10. Similarly, the culture supernatants of a line B obtained under the same conditions from a control free from multiple sclerosis were treated under the same conditions e t the assay of reverse transcriptase activity in the fractions of the sucrose gradient was negative everywhere (background noise) and is presented in FIG. 11.

  Fraction 3 of the gradient corresponding to the SEP line B and the same fraction without reverse transcriptase activity of the non-SEP control gradient, were analyzed by the same RT-PCR technique as previously, derived from Shih et al., Followed by the same cloning and sequencing steps, as described in Examples 1 and 2.

  Analysis of the recombinant clones selected at random provided the same four categories of sequences as described in Examples 3, 4 and 6. The results are presented in Table 2. It is quite remarkable that the sequences of MSRV- type 2 were found in the only material associated with a peak of “LM7 type” reverse transcriptase activity originating from the B lymphoblastoid line of MS. These sequences were not found with the material of the control B lymphoblastoid line (non-MS) in 26 randomly selected recombinant clones. Only contaminating sequences of the Mo-MuLV type and sequences without any particular retroviral analogy were found in this control. The difference in results is obviously highly significant (chi-2, p <0.001). The analysis of the MSRV-2B type sequences obtained from line B of this MS patient is presented in FIG. 18.

  Analysis of the MSRV-2 type sequences obtained in all the fractions of purified virions originating respectively from cultures LM7, LM7PC, PLI-2 and from the lymphoblastoid line B of MS (Duc.), By the two PCR techniques derived from the technique published by Shih et al., is presented in FIG. 19. It can be seen there that the nucleic acid sequence is very conserved there, with a few mutations, and that the only variation in amino acid sequence observed in these clones relates to methionine or the valine of the 3 'primer site YMDD / YVDD.

  EXAMPLE 8 PCR amplification of the nucleic sequence contained between the 5 'region defined by the clone "pol MSRV-iB" and the 3' region defined by the clone PSJ17 (MSRV-1A).

  Five oligonucleotides, M001, M002-A, M003-BCD, P004 and P005, were defined to amplify RNA from purified POL-2 virions. Control reactions were carried out in order to control the presence of contaminants (reaction on water).

  The amplification consists of an RT-PCR step according to the protocol described in Example 2 followed by a "nested" PCR according to the PCR protocol described in Example 2.

  In the first RT-PCR cycle, the primers M001 and P004 or P005 are used. In the second PCR cycle, the primers M002-A or M003-BCD, and the primer P004 are used. The primers are positioned as follows: M002-A M003-BCD M001 P004 P005

POL-2 RNA

  <-..........> <---------------------.> pol MSRV-1 SJ17 Their composition is: primer M001: GGTCITICCICAIGG primer M002-A: TTAGGGATAGCCCTCATCTCT primer M003-BCD: TCAGGGATAGCCCCCATCTAT primer P004: AACCCTTTGCCACTACATCAATTT primer P005: GCGTAAGGACTCCTAGAGCTATT Alignment of the consensus MSRV-1B with the amplification product "clone-and17" P17 " (MSRV-1A) showing the family community of the isolates MSRV-1A and MSRV-1B, as well as the nucleic sequence of the region between MSRV-1B and MSRV-1A are presented in FIG. 20.

  It should be recalled here that in the natural animal model of MS represented by the sheep's Visna, co-existence, co-isolation, co-purification and even, in certain pathological situations studied from this angle, cooperation , of two viruses, the Maedi-Visna retroviruses and JSRV (pulmonary ovine adenomatosis retrovirus) is known and frequently demonstrated in natural (and non-experimental) diseases, as reported by De Martini JC et al. . (J.N.C.I. 1987; 79, 167-177), Rosadio R.H. et al. (Vet. Pathol. 1988; 25, 58-66), Dawson M. et al. (Br. Vet. J. 1990; 146, 531-537) and York D. F. et al. (J. Virol. 1991; 65, 5061-5067).

  However, the Maedi-Visna virus is an exogenous retrovirus directly responsible for the neurological pathology of sheep while the JSRV is an endogenous retrovirus responsible for cancer, pulmonary ovine adenomatosis.

  The cooperation between these two viruses has been studied and shown in a third sheep pathology, maedi which is a form of interstitial lymphocytic pneumonia, but this synergy has not been studied or researched in the case of Visna, the demyelinating disease of central nervous system.

  Under these conditions, we can consider that the presence of two different viral elements, co-isolated in a natural human pathology such as MS, finds a logical precedent from a conceptual point of view in the model of sheep mentioned above.

  These viruses can therefore be at the origin of different pathologies but also cooperate in certain pathogenic processes.

  Under these conditions, it should be understood that the diagnostic and therapeutic applications resulting from the discovery of the MSRV-1 and MSRV-2 viruses containing the sequences defined in this patent, with the variations that these viruses may naturally present, could overlap in the context of MS.

  For example, endogenous retroviruses of the MSRV-1 type could interfere in a variable way, according to the MSRV-1 genotypes carried by different individuals, with infection by an exogenous virus of the MSRV-2 type which would be more specifically associated with the induction of multiple sclerosis disease. They could therefore modulate the pathogenicity of the latter. Under these conditions, genotyping of genes of the MSRV-1 type carried by an individual in a family or a region at risk, would make it possible to make a diagnosis of "individual risk". The diagnosis of an MSRV-2 infection should be compared with this MSRV-1 typing, to assess the risk of clinical disease.

  In addition, certain severe or, conversely, mild forms of MS could be characterized by the presence of a particular endogenous MSRV-1 haplotype, and thus, a prognosis on the clinical course could be given. In addition, such genetic elements could be the subject of complementary therapy using the methods of gene therapy or, more simply, inhibitors of retroviral expression active on endogenous retroviruses.

  According to another example, the expression of an endogenous retrovirus of the MSRV-1 type could be transactivated by a regulatory protein encoded and expressed by a virus of the MSRV-2 type. Thus, it is conceivable under these conditions that a diagnosis should detect an infection by MSRV-2 but also a particular immune reaction against (or a particular expression of) MSRV-1, to be able to characterize the state of "sclerosis in active plates ". Thus again, an immune response against MSRV-2 or the direct detection of one of its antigens or of a nucleic sequence belonging to it, in the absence of abnormal expression of an endogenous type MSRV-1, could characterize a "latent" stage of the disease. Also, regular regular control (detection of RNA or viral proteins) or indirect (immunity) of the state of expression of endogenous MSRV-1 populations, could constitute an extremely early prognostic control of passage to clinical disease if it was accompanied by a characteristic modification of this expression. This type of "diagnostic or prognostic" follow-up could make it possible to rationalize a therapeutic approach and optimize its effectiveness.

  According to another example, these two viruses could both be exogenous, although one of them is phylogenetically close to an endogenous retrovirus family, and present a synergy as can be encountered in particular in the case well known hepatitis delta, whose causative agent, the VHD virus has a defective genome dependent on the HBV virus, agent of hepatitis B. This known example demonstrates that two diseases affecting the same organ and differentiable, for the study clinical, essentially on severity criteria, can coexist by superposition of one (hepatitis delta) on the other (hepatitis B) whose presence is required due to the dependence of the genome of HDV on HBV. Such a scenario, or any other type of interaction, can therefore be conceived in the case of two exogenous viruses, and even an endogenous retrovirus, associated with MS. In a case similar to that of hepatitis B and delta, we could dissociate, by the respective diagnoses related to MSRV-1 and MSRV-2, forms of MS with a single associated virus, and forms, a priori more serious, with two associated viruses.

  According to another example which is inspired by analogical reasoning supported by the knowledge of viral hepatitis, it is also conceivable that several independent viruses can cause an inflammatory syndrome of the central nervous system, the clinical variants of which are grouped under the name "sclerosis in plaques ", as well as" hepatitis "caused alternately by HAV, HBV, HCV, HEV or the combination of HBV and VHD. Under these conditions, the diagnosis of the various viruses associated with "multiple sclerosis" would make it possible to specify the type of virus involved and, thereby, the measures of prophylaxis and the therapeutic methods to be used for each patient, while treatment global anti-inflammatory or immunosuppressant is currently offered without effective discrimination of the causality of the disease, in all patients with MS.

  These viruses can also be at the origin of other individualized pathologies, and in particular, in the case of MSRV-1 whose expression is markedly increased in immortalized or transformed cells of continuous lines compared to the same cells in primary culture, an association with tumor processes, certain cancers or hyperproliferative syndromes, is conceivable.

  Alternatively, one of the two viruses may prove, alone and to the exclusion of the other, to play a role in the pathogenesis of MS and, therefore, only the diagnostic and therapeutic applications of the latter would be of interest for multiple sclerosis. But, as in the example of the aforementioned visna and jaagsiekte, it could be that the other virus can independently induce a completely different type of disease in humans.

  Main endogenous huLmans retrovirtis Name Length Number of copies Relation to References ___ __ __ __ __ _ _! (Kb) exogenous retroviruses 4- 1 8.8 5-1 (10 MoMuLV Marlin, IN AS, 1981 51- 1 6 35-50 MoMuLV Slcele, Science, 1984 ERV-I 3 - 4 I MoMuLV / B3aEV Blonrer, PNAS, 1982 ERV-3 9.9 1 B3aEV O'Connell, Virology, 1984 Ill.NI-2 9 5 () MMTV Callalhan, PINAS, 1982 I IERV -K 9.5 50 MMTV Ono, J, Virol., 1987 luRRS-P '8 - 9 20) -4 (0 MoMuLV Kroger, J. Virol., 1987 R'lV-iJ .. 5.8 1! (.) 1 TLV -I / BLV Mager, J. Virol., 1987 IlIERS- I 5 - 6 1 1'LV-I Pei, (IcInioîics, 1991 M7-rel 4 - 1) 300 MI baboon RV Noda, Nucl. Acids Res., 1982 S71 6 1 SSAV Werner, Virology, 1990) ERV-9 8 35-40)? l.a Manuia, Nucl. Acids Res., 1991 11s5 5 - 1)? FelV / Fv-4 Levy, J. CGen. Virol., 199 (0 EIIS- 3.2 - 9.5 7 1 - 11V-I lorwilz, J. Virol., 1992 EIIS-2 3.2 - 9.5? HIV-1

TABLE 2

  BREAKDOWN OF SEQUENCES OBTAINED BY PCR

  MODIFIED FROM SHIIH AND COLL FROM C LYMPHOCYTE CULTURE OF A PATIENT WITH SCLEROSIS

  IN PLATES VERSUS A PATIENT CONTROLLED

  TYPE I TYPE 2 TYPE 3 TYPE 4 MSRV-2B _ Lympho B 0 11 4 8 MS patient 0% 48% 17% 35% Lympho B 5 O O 21 non MS patient 19% 0% 0% 81%

Claims (9)

  1 / Association of two viruses associated with multiple sclerosis, namely, a first human virus, having reverse transcriptase activity, and associated with a family of endogenous retroviral elements, or a variant of the first virus comprising at least one recognized antigen by at least one antibody directed against at least one corresponding antigen of said first virus, and a second virus, having a reverse transcriptase activity, or a variant of said second virus, these two viruses being derived together from the same viral strain chosen from the strains respectively named POL-2, deposited on 07.22.1992 with the ECACC under the access number V92072202 and MS7PG deposited on 08.01.93 with the ECACC under the access number V93010816, and among the variant strains consisting of viruses comprising at least one antigen which is recognized by at least one antibody directed against at least one corresponding antigen of one or other of the viruses of the vir strains ales POL-2 and MS7PG mentioned above.   2 / Association of two viruses associated with multiple sclerosis, namely, a first human virus having reverse transcriptase activity, and associated with a family of endogenous retroviral elements, or a variant of the first virus comprising at least one antigen recognized by at least one antibody directed against at least one corresponding antigen of said first virus, and a second virus having a reverse transcriptase activity, or a variant of the second virus, these two viruses being produced by the same cell line chosen from the strains respectively named PLI2 deposited on 22.07.1992 with the ECACC under the access number 92072201 and LM7PC deposited on 08.01.93 with the ECACC under the access number 93010817, and by all infected cell cultures likely to produce a virus comprising at least an antigen which is recognized by at least one antibody directed against at least one corresponding antigen of one or the other of the viruses produced by the aforementioned PLI-2 and LM7PC lines.   3 / Association of two viruses, namely a first virus whose genome comprises a nucleotide sequence having at least 50% and preferably at least% of homology with the nucleotide sequence SEQ ID N01 or its complementary sequence, or a variant of said first virus whose genome codes for a peptide sequence having at least 50% and preferably at least% of homology with the peptide sequence coded by the nucleotide sequence SEQ ID N05 or its complementary sequence, and a second virus, whose genome comprises a nucleotide sequence having at least 50% and preferably at least 70% homology with a nucleotide sequence chosen from SEQ ID N02 or its complementary sequence, or a variant of said second virus whose genome codes for a peptide sequence having at least 50%, and preferably at least 70% homology with the peptide sequence encoded by the nucleotide sequence e SEQ ID N02 or its complementary sequence 4 / Method for detecting a first virus, and / or a second virus, associated with multiple sclerosis, characterized in that at least two fragments are used, one first fragment whose nucleotide sequence has at least 50% and preferably at least 70% homology with SEQ ID N05 or its complementary sequence, and / or a second fragment whose nucleotide sequence has at least 50% and preferably at least 70% homology with SEQ ID N02 or its complementary sequence, each of said fragments being a probe or a primer.   5 / A diagnostic, prophylactic or therapeutic composition, characterized in that it comprises an association according to claim 4 and a first nucleotide fragment, and / or a second nucleotide fragment, as defined in claim 4.   6 / Method for detecting and / or identifying an association of viruses associated with multiple sclerosis, in a biological sample, characterized in that an RNA and / or a DNA specific to each said virus is exposed, and / or their RNA and / or DNA complementary to a combination of a nucleotide fragment and a second nucleotide fragment, as defined in claim 4.   7 / A method of detecting a first virus, and / or a second virus, associated with multiple sclerosis, characterized in that a first peptide partially or totally encoded by the first defined nucleotide fragment is used in claim 4, and / or a second peptide partially or completely encoded by the second nucleotide fragment defined in claim 4.   8 / A diagnostic, prophylactic or therapeutic composition, characterized in that it comprises a first peptide and / or a second peptide, defined in claim 7.   9 / Diagnostic, prophylactic or therapeutic composition, characterized in that it is obtained by preparation of a first ligand specific for the first peptide, and / or a second ligand specific for the second peptide, and by association of the first ligand and / or second ligand.   10 / Nucleotide fragment, characterized in that its necleotide sequence has at least 50%, and preferably at least 70% homology, with a sequence chosen from SEQ ID Nl01, SEQ ID N03, SEQ ID N04, and the sequence SEQ ID N05 comprising end-to-end SEQ ID Nl01, SEQ ID N03, SEQ ID N04.