FR2665710A1 - RECOMBINANT BACULOVIRUS EXPRESSING E AND NS1 PROTEINS FROM FLAVIVIRIDAE - RELATED VIRUSES OR FLAVIVIRIDAE - RELATED VIRUSES, DIAGNOSTIC AND THERAPEUTIC APPLICATIONS. - Google Patents

Abstract

A recombinant baculovirus comprises a cDNA coding for all or part of antigenic envelope protein E and/or a cDNA coding for all or part of non-structural antigenic protein NS1 of a virus belonging to Flaviviridae or a virus related thereto, and is inserted into the polyhedrin gene between nucleotide + 35 and nucleotide + 170 with the A of the polyhedrin's modified start codon having number + 1. Polypeptides obtained by means of this baculovirus, and the diagnostic and therapeutical uses thereof, are also described.

Description

 The present invention relates to a recombinant baculovirus expressing the E and NSI proteins of viruses belonging to Flaviviridae or Flaviviridae-related viruses (Flavi-like).

 By Flaviviridae is meant the family of viruses described by WESTAWAY et al. in Intervirology 24. 183-192 (1985) comprising the genus Flavivirus, the typical representative of which is the yellow fever virus (VFJ).

 By Flaviviridae-related viruses is meant the Pestiviruses (Marc S. Collett et al, J.

Gen. Vir (1989) 70, 253-266), including the virus of bovine viral diarrhea (BVDV), porcine cholera virus (HCV), sheep border disease virus (BDV), and hepatitis C (Roger
H. Miller in Proc. Natl. Acad. Sci. USA, vol. 87 pp.

2057-2061, March 1990).

VFJ is an enveloped virus containing a genome composed of a single-stranded RNA of positive polarity of 10862 bases. Viral RNA is the only mRNA synthesized during the replication cycle (DESPRES et al., (17)). The complete nucleotide sequences of 3 VJF strains were determined (Rice et al., (18), Desprès et al., (19), Hahn et al, (20), Dupuy et al, (21)). Sequence analysis revealed the presence of a 10233 base open reading frame encoding a polyprotein of 3411 amino acids (approximate MW of 375 kDa). The order of proteins on the viral genome: 5'-C-prM-E-NS1-NS2A-NS2B
NS3-ns4a -NS4B-NS5-3 'was deduced from the nucleic and peptide sequence data, each of the mature proteins being generated after co and post-translational cleavages by viral and cellular proteases.

 The envelope protein E (54 kDa apparent molecular weight) on the surface of virions is the most important antigen; it consists of a membrane-integrated protein that binds to cell receptors and induces neutralizing antibodies.

The non-structural NS1 glycoprotein (48 kDa apparent molecular weight) of undetermined function may play a role in the assembly and maturation of the virus. Immunization with protein
Purified NS1 or polypeptide fragments of NS1 expressed as fusion proteins by bacteria were found to protect mice and primates from challenge with VFJ. In addition, several monoclonal antibodies specific for NS1
VFJ possess complement-mediated cytolytic activity and have been shown to be able to passively protect test animals with homologous infectious virus (Schesinger et al, 1985 (1), Gould et al, 1986 (2)).

 These data strongly suggest that in preventing a viral infection, the immune recognition of the NS1 protein could provide an alternative to the direct neutralization of flaviviruses.

 It has been sought for some time to provoke an immune response by injecting animals with immunogenic proteins of these viruses produced by an appropriate vector, in particular the envelope protein (E) and the nonstructural glycoprotein (NS1) known to confer good protection.

 ZHAO et al. (Journal of Virology, dec.

 1987, p. 4019-4022, vol. 61 n- 12) have thus described the expression of the structural and non-structural proteins of the Dengue virus by a recombinant vaccinia virus.

Yi-Ming Zhang et al, (Journal of Virology, Aug. 1988, pp. 3027-3031, vol.62, N-8) described the expression of structural proteins C (capsid),
PreM (precursor of M) and glycoprotein of structure E (envelope) as well as nonstructural proteins NS1 and NS2A by a recombinant baculovirus.

 However, although the immunized animals are protected against the Dengue virus, none of these techniques has made it possible to obtain a sufficiently high antibody titre.

The object of the present invention is to provide an expression system for the immunogenic proteins of
Flaviviridae and Flaviviridae-related viruses at a high level, so as to confer effective immunological protection against infections caused by these viruses.

 The subject of the present invention is a recombinant baculovirus, characterized in that it comprises a cDNA coding for all or part of the envelope antigenic protein E and / or a cDNA coding for all or part of the nonstructural antigenic protein NS1 d a virus belonging to Flaviviridae or a Flaviviridae-related virus inserted into the polyhedrin gene between nucleotide + 35 and the nucleotide of + 170, the A of the modified initiation codon of polyhedrin being numbered + 1.

 When the recombinant baculovirus comprises as an insertion segment a cDNA coding for all or part of E or a cDNA coding for all or part of E and NS1, it comprises, in addition, upstream of the cDNA a leader sequence which corresponds to the 3 'end of the 5' non-coding region of the SV40 virus VP1 protein gene comprising 11 nucleotides 3 'of the Hind III site (nt 1488 on the SV40 genome) and the initiation codon ATG of the VP1 protein.

 When the recombinant baculovirus has as cDNA a cDNA encoding all of NS1, no initiation codon was artificially introduced because the signal peptide of NS1 contains a large number of in-phase ATG; at least one of these serves to initiate the translation.

 In the case where the recombinant baculovirus comprises as an insertion segment a cDNA coding for all or part of E, a termination codon is present at the 3 'end. It was introduced in a step prior to insertion into the baculovirus vector.

 In the case where the recombinant baculovirus comprises as an insertion segment a cDNA coding for all or part of E which already includes a termination codon, it does not need to include an artificially added termination codon.

 The recombinant baculoviruses according to the invention comprising respectively a cDNA coding for all or part of the E and NS1 proteins, a cDNA coding for all or part of the E protein and a cDNA coding for all or part of the NS1 protein, are obtained by cotransfection. and homologous recombination of the plasmids having the respective cDNAs with the wild type Autoaranha California Nuclear Polvhedrosis (AcNPV) baculovirus genome as inserts.

A preferred recombinant plasmid, called pAc-E.NS1, comprising the cDNA coding for E and NS1 deleted from the potential terminal amino acid C of NS1, is advantageously obtained by the following steps:
a) digestion of a recombinant plasmid
SV40-VFJ comprising the cDNA encoding E and NS1, to introduce a termination codon at the carboxyl terminus of NS1. as a result, the expressed protein is deleted from its C-terminal amino acid;
b) digestion of this plasmid with Hind III or
Bgl II;
c) treating the ends with the Klenow fragment in the presence of the 4 deoxynucleotides triphosphate, so as to make the ends blunt;
d) digestion of the DNAs obtained by Apa I;
e) isolation and ligation of the DNA fragments obtained with the plasmid pVL-941 poly previously linearized with Bam H1 and treated with the fragment of
Klenow in the presence of the 4 deoxynucleotides triphosphate, then by the alkaline phosphatase, to generate a plasmid comprising the ATG initiator of the protein
VP1 of SV40 virus preceded by the 11 adjacent 5 'nucleotides delimited by a Hind III site. This sequence constitutes a 5 'non-coding region portion of the polyhedrin-VFJ chimeric mRNA, allowing the expression of
E and NS1. The 3 'region of the insert encodes the NS1 protein where the last C-terminal amino acid is deleted and replaced with the exogenous GGSS sequence.

Another preferred recombinant plasmid, called pAC-NS1, comprising the cDNA encoding NS1 deleted from its potential terminal amino acid C, is advantageously obtained by the following steps:
a) digestion of a recombinant plasmid
SV40-VFJ comprising the cDNA encoding E and NS1 deleted from its terminal amino acid C with Xba I;
b) filling with the Klenow fragment in the presence of the 4 deoxynucleotide triphosphates and ligating the fragments obtained to generate a plasmid comprising a leader sequence corresponding to the 3 'end of the 5' non-coding region of the VP1 protein gene of the SV virus Comprising the nucleotides 3 'of the Hind III site and the ATG initiation codon of the VP1 protein as well as the exogenous GGG GGA TCC TCT AGC TAG sequence downstream of the cDNA encoding E and NS1 deleted from its amino acid C terminal;;
c) digestion of the plasmid obtained in step b) with Tth 111 I, MluI and Pst 1,
d) ligation of the fragments obtained in step c) after filling the Tth 111I site with the Klenow fragment in the presence of the 4 deoxynucleotides triphosphate with a pVL-941 poly transfer vector obtained from pVL 941 by insertion of a multilinker at the 3 'end of the BamHl digested Bam HI site and filling of the Bam HI site with the fragment of
Klenow in the presence of 4 deoxynucleotides triphosphate.

Another preferred recombinant plasmid, designated pAC-E1, comprising the cDNA coding for the signal peptide of protein E followed by the E protein deleted at its C-terminal end (amino acids 286 to 720) is obtained by the following steps:
a) digestion of the plasmid pAC-E.NS1 previously described by Xho I and Apa I and an SV40-VFJ recombinant plasmid comprising the cDNA coding for the protein E with Apa I and Bgl II, and
b) ligation of the fragments FXho I-Apa I) of the plasmid pAC-E.NS1 obtained above and [Apa I-Bgl IIJ of the recombinant plasmid SV40-VFJ comprising the cDNA coding for the truncated protein E with a transfer vector PVL- 941 poly obtained from pVL 941 by insertion of a multilinker at the 3 'end of the site
Bam HI and digested with Xho I and Bam H I.

The recombinant baculoviruses are obtained by transfection and homologous recombination of the plasmids, preferably Autosraba california Nuclear Polyhedrosis Virus (Ac NPV) and express the proteins
E and NS1 after maturation (glycosylation, oligomerization ....) at high levels when propagated in eukaryotic insect cells, in particular SPodoPtera fruaiDerda cells.

 The proteins thus obtained are antigenic and therefore find application in in vitro diagnostic methods for viral infections caused by Flaviviridae or Flaviviridae-like viruses.

 The present invention thus also relates to an in vitro diagnostic method in humans or animals, by demonstrating antibodies directed against all or part of the protein E and / or the immunogenic NS1 protein as obtained. by a recombinant baculovirus according to the invention, in a biological sample from humans or animals, in which the immunogenic protein or proteins E and NS1 are brought into contact with the biological sample of the human or the animal may contain said antibodies and the presence of the bound antibodies is revealed.

 This method can be based on a radioimmunological method of the RIA, RIPA or IRMA type or an enzyme immunoenzymatic method of WESTERN-BLOT type on strips or ELISA type.

The subject of the present invention is also an in vitro diagnostic kit for infections caused by Flaviviridae or related viruses.
Flaviviridae for carrying out the above-mentioned method, comprising all or part of the immunogenic NS1 protein and / or protein E as obtained by a recombinant baculovirus according to the invention and further containing a specific antibody of an isotype of immunoglobulin.

The present invention also relates to a vaccine for the treatment and prevention of infections caused by Flaviviridae or Flaviviridae-related viruses in humans or animals, wherein the vaccinating agent consists of all or part of protein E and / or protein
NS1, obtained by a recombinant baculovirus according to the invention.

 The vaccinating agent can be administered in the form of purified protein (s) using the Fractionation properties of Triton X 114, or via a recombinant baculovirus as described above producing the peptide (s). immunogenic or through eukaryotic cells, such as insect cells, including SPodoPtera fruaiperda cells for the propagation of recombinant baculovirus and immunogenic proteins produced by him.

 The massive preparation of these recombinant proteins can be obtained either as a SnodoPtera fruqiPerda cell fermentor, or from insect larvae infected with the recombinant baculovirus.

 In addition to the immunogenic peptide sequence, the vaccine may contain an adjuvant with immunostimulatory properties.

 Among the adjuvants that can be used are mineral salts such as aluminum hydroxide, hydrophobic compounds or surfactants such as incomplete Freund's adjuvant, squalane or liposomes, synthetic polynucleotides, microorganisms or components of microorganisms such as murabutide, synthetic artificial molecules such as imuthiol or levamisole, or cytokines such as interferons a, ss, y or interleukins.

 The invention further relates to a monoclonal antibody directed against all or part of an E protein and / or NS1, obtained by a recombinant baculovirus as described above.

 The monoclonal antibodies according to the invention can be prepared according to a conventional technique. For this purpose, the polypeptides may be coupled, if necessary, to an immunogen, such as tetanus toxoid, with a coupling agent such as glutaraldehyde, a carbodiimide or bis-diazotized benzidine.

Hereinafter will be described in more detail in the case of the yellow fever virus (VFJ)
obtaining the recombinant baculoviruses according to the invention expressing all or part of the VFJ E and NS1 proteins,
the physicochemical, antigenic and immunogenic properties of the VFJ proteins E and NS1 produced by recombinant baculoviruses with reference to the appended figures in which
FIG. 1 represents a construction scheme of the plasmid pAc-E.NS1 making it possible to obtain the recombinant baculovirus Ac-E.NS1.

The coding sequence for E proteins and
NS1 of VFJ including the initiation codon taken from the VPI gene of SV40 virus, the signal peptide of protein E and the termination codon at the C-terminus of NS1 protein are isolated from plasmid pSV-E.NS1-. (TAG). The sequences representing the AcNPV virus genome and the VFJ cDNA are indicated by the thick lines and the hatched portions, respectively.

 FIG. 2 represents the organization of the polyhedrin gene sequences of plasmid pVL 941-poly serving as transfer vector for its homologous recombination with baculovirus, and of the recombinant plasmid pAc-E.NS1.

 The nucleotide sequence at the junction between the polyhedrin gene and the 5 'end of the region coding for E and NS1 proteins is shown in the figure. The ATG initiation codon and the TAG termination codon are overlaid with a dash. The amino acid sequence of the N and C ends of the translated polypeptide is shown in the figure. The numbering corresponds to that of the polyprotein precursor of the VFJ.

FIG. 3 represents the construction scheme of the plasmid pAc-E1 making it possible to obtain the recombinant baculovirus Ac-E1,
FIG. 4 represents the construction scheme of the plasmid pAc-NS1 making it possible to obtain the recombinant baculovirus Ac-NS1,
FIG. 5 represents the organization of the baculovirus pVL 941-poly sequences serving as transfer vector, and the recombinant plasmids pAc-E1 and pAc-NS1,
The nucleotide sequence at the junction between the polyhedrin gene and the 5 'end of the region coding for E and NS1 proteins is shown in the figure. The ATG initiation codon and the respective TGA and TAG termination codons of the cDNAs encoding E and NS1 are overcome by a trait. The amino acid sequence of the N and C ends of the translated polypeptide is indicated on the Fig.

FIG. 6 represents the results of immunizations carried out in Swiss mice with a lysate of Sodoptera fruaiperda cells (strain Sf9), infected with the wild Baculovirus AcNPV, the 17D virus or a lysate of Vero cells in-fected by the virus. 17D,
FIG. 7 represents the results of immunizations carried out in Swiss mice with an AcNPV baculovirus-infected Sf9 cell lysate and the recombinant baculoviruses of the invention Ac-E.NS1, Ac-E1 and Ac-NS1;
FIG. 8 represents the results of immunoprecipitation of a lysate obtained in RIPA buffer of vero cells infected with VFJ and labeled with methionine [S] in the presence of actinomycin D. radiolabeled ly sat (106 cpm in a volume 200 μl) is immunoprecipitated with 20 μl mouse serum taken prior to the 17D virus challenge in the presence of Protein A Sepharose (Pharmacia).

17D ip: immunized mouse sera with VFJ
intraperitoneally; 17D Lilies: mouse sera immunized with lysate
Vero cells infected with VFJ;
AcNPV: sera of immunized mice with ly
sat Sf9 cells infected by the ba
wild-type culovirus;
Ac-E.NS1: sera of immunized mice with ly
sat Sf9 cells infected with
recombinant baculovirus Ac-E.NS1;
Ac-E1: sera of immunized mice with ly
sat Sf9 cells infected by the ba
recombinant culovirus Ac-E1;
Ac-NS1 (A): sera of mice immunized with lycine
sat Sf9 cells infected by the ba
Ac-NS1 recombinant culovirus being dead
after the test with the virus infec
tious;
Ac-NS1 (B): sera of immunized mice with ly
sat Sf9 cells infected by the ba
Ac-NS1 recombinant culovirus that has survived
cues after the test with the virus infec
tious.

 The position of the proteins E and NS 1 is indicated by the arrows.

I - Construction of recombinant baculoviruses
The construction of the recombinant plasmids is carried out using the standard techniques described by Maniatis et al., (3).

1. Construction of recombinant baculovirus pAc-E.NS1
The sequence coding for the E and NS1 proteins of the VFJ comprising the E signal peptide and the ATG initiation codon of the SV40 VPI protein is isolated from the plasmid pSV-E.NS1 in the form of a DNA fragment of 2. , 6 kbp, as described by Desprès et al, (4). Before insertion into the vector baculovirus, a phased-in codon is inserted at the 3 'end of this complementary DNA by digesting the plasmid pSV-E.NS1 with XbaI (unique site in the multilinker) and filling with the fragment of Klenow so as to generate the exogenous peptide sequence
GGSSS at the carboxy terminus of the NS1 protein (Figure 2). The blunt ends are circularized with T4 DNA ligase, thereby generating the plasmid pSV-E.NS1- (TAG) (Figure 1).

 To facilitate its insertion into the shuttle vector, the passenger DNA is isolated from pSV-E.NS1- (TAG) as two fragments of 0.70 kbp and 1.90 kbp as shown in Figure 1.

 The 0.70 kbp fragment containing the sequence coding for the N-terminal half of protein E including its signal peptide is cleaved with Hind III (nucleotide 1488 on the SV40 genome), filled with the Klenow fragment and digested. with Apa I (nucleotide 1603 on the VFJ genome).

The 1.90 kbp fragment containing the coding sequence for the C-terminal half of the E protein followed by the complete NS1 protein is digested with
Bgl II (3 'terminal site of recombinant SV40 DNA multilinker), filled with Klenow fragment and digested with Apa I.

Plasmid pVL 941-poly is obtained from plasmid pVL 941 described by Luckow and Summers (5) by insertion of a multilinker at the 3 'end of the BamHI site (FIG. 2). Plasmid pVL941-poly is digested with Bam HI, filled in with the Klenow fragment, dephosphorylated and used for insertion of the 0.70 and 1.90 kbp VFJ cDNA fragments. The substitution by the E and NS1 genes in the polyhedrin gene starts at nucleotide + 35, numbering the
A modified ATT initiation codon of polyhedrin by + 1. The recombinant plasmid containing the 2.6 kbp insert in the correct orientation is designated pAc-E.NS1. In the recombinant plasmid, the blunt ends of the Bam H1 site are ligated to those of the Hind III site generating the 5 '... GGATCAGCTTATGAAGATGG ... 3' sequence in the non-coding region, as shown in Figure 2.

This transfer vector is used to generate the recombinant baculovirus Ac-E.NS1 after transfection and homologous recombination with the AutoaraPha California Nuclear Polvhedrosis virus genome (Ac
NPV) using the conventional calcium phosphate precipitation techniques described by Summers and Smith (6).

 Occlusion-negative viral particles are plaque purified and propagated in SPodoPtera fruainerda Sf9 cells (clonal isolate 9 of the IPLB-Sf21-AE strain).

To confirm that all the cDNA of the
VFJ was transferred to the baculovirus genome, viral DNA was extracted from Ac-E.NS1 infected cells. In order to isolate the coding sequence for
E and NS1, we took advantage of the presence of two sites
Eco RV at both ends of the VFJ cDNA, one at position-96 on the polyhedrin1 gene and the other in the multilinker downstream of the insertion segment.

 After separation of the agarose gel digests, the inserted DNA having correct dimensions is revealed using a specific cRNA probe obtained from the plasmid pGX4-E1 (Ruiz Linares et al, (7)) .

2. Construction of the recombinant baculovirus Ac-E1
Recombinant baculovirus Ac-E1 contains 1 '
CDNA encoding the protein, isolated from plasmid pSV-E (Desprès et al., 4)). This cDNA encodes the signal peptide of the E protein (aa 271 to 285 of the 17D virus precursor polyprotein) followed by the E protein deleted from its C terminus (aa 286 to 720).

 The plasmid pAc-E1 is generated after ligating the fragments [Xho I-Apa II of the plasmid pAc-E.NS1 (previously described), and [Apa I-Bgl II3 of the plasmid pSV-E (DESPRES et al (4)). with the pVL 941-poly transfer vector digested with XhoI and BamHI (FIG. 3). The open reading frame of the transient DNA inserted into the polyhedrin gene is described in Figure 5.

3. Construction of recombinant baculovirus
Ac-NS1
The recombinant Baculovirus Ac-NS1 contains the 17D cDNA encoding the NS1 glycoprotein isolated from the plasmid pSV-E.NS1- (TAG) described above. This cDNA encodes the potential signal peptide of the NS1 protein (aa 758 to 778) followed by the NS1 protein (aa 779 to 1129). Plasmid pAc-NS1 was generated after ligation of ETth 111 I-Mlu I1 fragments (nt 2389 to 2947 of the viral genome) and [Mlu I-Pst 1) (nt 2947 to 3506, Pst 1 is a multilinker site) with the transfer vector pVL941-poly digested with BamH 1 and Pst 1 (FIG. 4). The open reading frame of the transient DNA inserted into the polyhedrin gene is described in Figure 5.

II - Expression of recombinant baculoviruses
A / Expression of recombinant baculovirus
Ac-E.NS1
1. Detection of recombinant E and NS1 proteins
Vero cells infected with VFJ or SF9 cells infected with different baculoviruses were approximately 10 plaque forming units (PFU) per cell.

a) Marking proteins in cells
Sf9 and Vero.

Before labeling, the cells are washed twice and incubated in methionine-free medium for 60 minutes. Sf9 cells are radiolabeled for 180 minutes at 27 hours post infection (h pi) with 100 μCi of C methionine per ml. Vero cells (African green monkey kidney cell lines) infected with VFJ are pretreated at 8 hrs with 5 μg / ml of actinomycin
D (act D) and labeled at 25 h for 3 hours with 100 μCi of [35 S] methionine per ml in the presence of actinomycin D. When labeled in the presence of tunicamycin (5 μg / ml), the cells are pretreated for 60 min. with this drug.

 For pulse-chase assays, infected cells are labeled for 30 minutes with 200 Ci / ml [35 S] methionine per ml. After the labeling period, the cells are washed and incubated with an excess of cold methionine for varying periods of time.

After labeling or flushing, the proteins present in the supernatant are precipitated by the addition of 9 volumes of 95% ethanol and incubation at -20 ° C. for 18 hours as described by Desprès et al. (4). To analyze the intracellular proteins, the cells are washed twice with cold phosphate buffered saline (PBS) and lysed with cold RIPA buffer (50 mM Tris HCl pH 7.5, 150 mM NaCl, 10 mM EDTA; , 1% SDS, 1% Triton X 100, 1% deoxycholate) containing 25 μg / ml aprotinin (Sigma). After 5 minutes of incubation at 0 ° C., the cell extracts are clarified by centrifugation for 5 minutes. in a minicentrifuge. The proteins are immunoprecipitated using the protocol described by
Ruiz-Linares et al, (7) and resolved on gels
SDS-12% polyacrylamide.

b) Western blot analysis
Proteins separated on SDS-polyacrylamide gel are electrophoretically transferred onto nitrocellulose filters (Schleicher and Schuell,
FRG). The membrane is saturated with the wash buffer (20 mM Tris HCl pH 7.5, 500 mM NaCl) containing 3% fetal bovine serum and incubated overnight at 4 C with rabbit antiserum diluted 1: 1. Directed against the NS1 protein (Schlesinger et al, (1)) or a TrpE-E fusion protein obtained by insertion of the cDNA encoding the E protein into the 3 'region of the TrpE gene of the tryptophan operon in the plasmid
PATH described by C. Dieckmann and A. Tzagoloff (J. Biol.

Chem. 1985, 260, p. 1513-1520). After several washes, the membrane is incubated successively at room temperature with biotinylated rabbit anti-rabbit Ig serum diluted 1/500 and with a complex diluted 1/500 biotinylated horseradish streptavidin-horseradish (Amersham). After washing, the bound antibodies are visualized by reacting the membrane with 0.06% 4-chloro-1-naphthol (Sigma) and 0.015% hydrogen peroxide.

c) Endo-s-N-acetyl-D-glucosaminidase H (Endo-H) and F (Endo-F) treatment
Sf9 cells infected with recombinant baculovirus or VFJ infected Vero cells are labeled as described above and immunoprecipitated cell extracts using anti body directed against VFJ proteins. The immune complexes are treated with Indo-H (20 mU / ml) or
Endo-F (1 U / ml) (Boehringer) using the technique described by Jarvis and Summers (22).

d) Extraction with Triton X 114
The cells are rinsed with PBS, suspended in a 2% Triton X 114 solution (BDH) in 50 mM Tris-HCl pH 7.5 containing 25 μg / ml aprotinin and incubated for 10 min at room temperature. 'C. The aqueous and detergent phases are obtained by incubation in a water bath at 37 ° C. and then by centrifugation at 37 ° C. in a minicentrifuge at 3000 rpm. The aqueous phase is recovered and after several washes with E buffer (10 mM tris-HCl pH 7.5, 150 mM NaCl, 5 mM EDTA), the detergent phase is obtained. The aqueous and detergent phases diluted with 5 volumes of buffer E are precipitated overnight with 9 volumes of 95% ethanol at -20 ° C.

The proteins are analyzed on polyacrylamide gels.

e) Immunofluorescence assays
S.fruaiPerda cells grown on coverslips are infected with AcNPV or the recombinant virus for 24 hours at 27 ° C. The cells are fixed with formaldehyde and, if necessary, permeabilized with 0.1% Triton X 100 in PBS as previously described (Desprès et al., (8)). Fixed permeabilized cells or not are incubated for 20 min. at room temperature with anti VFJ mouse antiserum (1: 40 dilution) or with a 1: 20 dilution of either E-specific monoclonal antibody (AcMc) 864 (Gould et al.

(9)) t is the NS1 specific monoclonal antibody 8G4 (Schlesinger et al (10)). An anti-mouse immunoglobulin conjugated to fluorescein isothiocyanate (Silenius) is used as the second antibody.

2 / Expression of Recombinant Baculovirus Ac-E.NS1 E and NS1 Proteins
The recombinant plasmid Ac-E.NS1 contains the VFJ cDNA which encodes a protein precursor polyprotein E and NS1, having a theoretical molecular weight of 100 kDa (865 amino acid residues). To confirm that these proteins are expressed and undergo proper maturation in Sf9 cells, infected cells are labeled with
Ac-E.NS1 using [35S] methionine for 3 hours at 27 hr This time was found to be optimal for labeling recombinant proteins.

 When the viral proteins are immunoprecipitated with a mouse immune serum directed against VFJ or with monoclonal antibodies specific for E and NS1, the recombinant proteins E and NS1 migrate with the same mobilities as the authentic proteins obtained from Vero cells infected with the VFJ. When the cells are treated with tunicamycin, a protein N-glycosylation inhibitor, the authentic NS1 protein and the recombinant NS1 protein co-migrate with an apparent molecular weight of 43 kDa. Neither the recombinant protein nor the authentic E protein are glycosylated as it may have been judged from the lack of effects of the drug on their electrophoretic mobility.

 The antigenicity of recombinant proteins is analyzed using monoclonal antibodies directed against E and NS1 proteins. The neutralizing 2C9 (Schlesinger et al, (10)) and 864 (above) monoclonal antibodies recognize the envelope protein synthesized by the VFJ 17D-204 vaccine strain and react with the recombinant protein E expressed by the hybrid virus. SV40-VFJ (Desprès et al., (4)). Both types of monoclonal antibodies also react with the recombinant E protein synthesized in insect cells.

Since these monoclonal antibodies recognize the native form but not the denatured form of the E protein (Desprès et al., (4)), it can be concluded that the folding of the recombinant protein is similar to that of the authentic protein. Both types of monoclonal antibodies immunoprecipitate additional polypeptides that migrate faster than E protein and could be similar to the degradation products already found in cells infected with VFJ, as described by Schlesinger et al, (11) and Cane et al. Gould (12).

The 8G4 monoclonal antibody immunoprecipitates the VFJ NS1 protein produced in infected Vero cells as well as the non-glycosylated form synthesized in the presence of tunicamycin. Recognition by the 8G4 monoclonal antibody is greatly affected when the protein is treated with SDS and dithiotreitol, indicating that the epitope is conformation dependent. Monoclonal antibody 8G4 also reacts with recombinant NS1 protein obtained from Ac-E.NS1-infected Sf9 cells. In addition to the 48 kDa recombinant protein, a minor polypeptide with an apparent molecular weight of 47 kDa is immunoprecipitated from an insect-infected insect cell lysate.
Ac-E.NS1.

 Detailed analyzes of Sf9 cells infected with recombinant Baculovirus Ac-E.NS1 revealed the existence of two large polypeptides with apparent molecular weights of approximately 100 kDa, which represents the size expected for the uncleaved precursor. These polypeptides react with mouse immune sera directed against the structural and non-structural proteins of VFJ as well as monoclonal antibodies specific for E and NS1. The largest polypeptide (105 kDa) migrates with the same mobility as the non-structural NS5 protein of VFJ. When the synthesis is carried out in the presence of tunicamycin, only the fastest-migrating band is detected, suggesting that the polypeptides with faster and slower mobilities represent non-glycosylated and glycosylated forms respectively. These results indicate that the 100 kDa polypeptide is in fact the uncleaved precursor of recombinant E and NS1 proteins.

Detection of oligomeric and membrane-associated forms of NS1 protein
The oligomerization of NS1 in mosquito and mammalian cells infected with different flaviviruses has been described by Winkler et al. (13, 14), Mason (15) and Schlesinger et al. (16). The question is raised as to whether the NS1 protein also forms oligomers in lepidopteran cells infected with Ac-E.NS1 virus. It was thus necessary to establish conditions for detecting NS1 oligomers in mammalian cells infected with VFJ.

The NS1 dimers formed during Dengue virus infection are resistant to reducing treatments and by SDS but sensitive to heat denaturation. Primate cells infected with VFJ strain 17D-204 are labeled for 30 min at 25 hr in the presence of actinomycin D and removed for varying periods of time. The proteins obtained from the cell lysates are dissolved in a Laemmli buffer and analyzed on polyacrylamide gel before and after heat denaturation. In the denatured samples, the protein
48 kDa NS1 is detected as a weak band after a 30 min labeling period, and becomes larger after 60 min incubation. When the samples are not denatured by heat, the 48 kDa protein is detected at the end of the tagging without accumulating during the hunt. Concomitantly, a new viral band with an apparent molecular weight of 72 kDa appears, which becomes more intense during the hunt.

 The 72 kDa polypeptide is eluted from the gel and shown to represent an oligomeric form of the NS1 protein. The isolated polypeptide is analyzed by Western blot using rabbit immune serum raised against VFJ NS1 protein (Schlesinger et al., (1)). The 72 kDa polypeptide reacts with the specific serum and after denaturation with heat dissociates to form the 48 kDa NS1 protein.

 After treatment of the cell extracts with Triton X 114, the transmembrane proteins with hydrophobic anchoring sequences are efficiently distributed in the detergent phase, while the more hydrophilic, cytosolic and secreted proteins remain in the aqueous phase. The presence of the VFJ envelope protein or recombinant E protein expressed by the Ac-E.NS1 virus in the detergent phase is revealed by direct analysis of the labeled and confirmed cytoplasmic extract by Western-blot analysis at rabbit immune serum against the VFJ protein E. Protein E is extracted completely and completely in the detergent phase as expected for a transmembrane protein.

The presence of NS1 oligomers in the detergent phase is clearly revealed. However, Wertern-blot analyzes with rabbit antiserum directed against the VFJ NS1 protein show that the 72 kDa NS1 oligomer is extracted in both the aqueous phase and the detergent phase. After denaturation by heat, the oligomeric form is dissociated and converted to a protein of 48 kDa. In the absence of heating, most products appear as oligomers. When N-glycosylation is blocked with tunicamycin, the presence of a 62 kDa polypeptide in the unheated sample is observed. When the sample is heated, this polypeptide disappears while the unglycosylated form of NS1 appears (apparent molecular weight of 43 kDa). This result suggests that the 62 kDa protein is the unglycosylated form of the 72 kDa protein and that the oligomerization of NS1 takes place without necessarily having oligosaccharide groups attached to the NXT / S or ASN X Thr / Ser sites present on the glycoprotein. No distinct band other than that corresponding to NS1 appears after heating, suggesting that the 72 kDa polypeptide is a homo-oligomer. The molecular weight difference between 72 and 62 kDa probably corresponds to the molecular weight of 4 oligosaccharides, since the NS1 monomer has glycans residues at both sites.
N-glycosylation which together contribute to 5 kDa (Desprès et al, (4)).

The NS1 protein expressed by the recombinant Baculovirus Ac-E.NS1 is detected by Western-blot with the immunized serum directed against the NS1 protein of the
VFJ both in the monomeric form gp48 and in the oligomeric form gp72. If the monomeric form is specifically detected in the aqueous phase, the oligomeric form is found in the aqueous and detergent phases of Triton XI 14. These results mean that the oligomerization and membrane association of the NS1 recombinant protein takes place in the insect cells infected with the recombinant Baculovirus Ac-E.NS1 and at a temperature of 27 C.

 These experiments confirm that the E envelope protein of VFJ or Ac-E.NS1 virus has the properties of an integral membrane protein and show that the 48 kDa NS1 glycoprotein of VFJ or newly synthesized Ac-E.NS1 virus can be converted into a thermolabile gp 72 oligomeric form that can be found associated with membranes.

 The 100 kDa polypeptide synthesized by Ac-E.NS1 is completely extracted in the detergent phase and reacts with rabbit immune sera directed against E or NS1 proteins. The result confirms that the polypeptide represents the uncleaved precursor of recombinant E and NS1 and indicates that it is strongly associated with intracellular membranes. Flush tagging assays show that cleavage to generate recombinant E and NS1 proteins occurs after the precursor has been completely transferred to the ER (endoplasmic reticulum) lumen. It was also found that the processing of the precursor was unaffected by tunicamycin, since the unglycosylated E and NS1 proteins were produced in the presence of this drug.

TransPort and Secretion of Authentic and Recombinant NS1 Proteins in Infected Cells
Since the NS1 proteins of different flaviviruses were described as the soluble complement-fixing antigens and later as a secreted protein in the cell culture medium, it was interesting to determine whether the authentic and recombinant NS1 proteins synthesized in infected Vero cells VFJ or baculovirus-infected Sf9 cells were also secreted into the medium.

 Vero cells infected with VFJ are radiolabeled with [355] methionine for 30 min. then chased with an excess of cold methionine for 0 to 5 hours. The authentic NS1 protein is present in the cell supernatant after 2 hours of flushing, after which a plateau is rapidly reached. The secreted form of NS1 migrates as a diffuse band with an apparent molecular weight slightly greater than its cellular counterpart.

Although the proportion of NS1 in the extra- and intracellular fractions has not been quantified, autoradiographic analyzes clearly indicate that a large portion remains in intracellular form.

From hunt tagging assays, it can be concluded that the secretion of NS1 is a rather slow process as it takes more than 5 hours for half of the radiolabelled NS1 proteins to be released into the cell culture medium. It is also shown that the extracellular form corresponds to oligomer gp 72 and that it migrates in the form of a band wider than the intracellular oligomer. It disappears after heating while the monomeric form of secreted NS1 appears.

A treatment with tunicamycin does not make the secretion of NS1 disappear as is apparent from the presence of the non glycosylated oligomer p62 of NS1, in the culture medium.

In contrast, Vero cells infected with VFJ, the recombinant NS1 protein obtained from Sf9 cells infected with Ac-E.NS1 is not secreted because none of the recombinant polypeptides could be detected in the extra fraction. -cellular after a 30 min mark. followed by a 3 hour hunt. The duration of the hunt did not exceed periods that were too long due to possible cell lysis due to baculovirus infection. Sf9 cells infected with non-permeabilized Ac-E.NS1 showed a clearly positive reaction when they were tested with the NS1-specific 8G4 antibody by immunofluorescence at 24 hours post-infection, suggesting that, although the recombinant NS1 oligomers are not secreted, they have entered the endoplasmic reticulum and in the apparatus of
Golgi and were transported to the plasma membrane with which they associated.

N-Alvcosvlation of Authentic and Recombinant NS1 Proteins
Endoglycosidase H is known to hydrolyze the high manganese oligosaccharide residues bound to the asparagine of the glycoprotein, but not the complex types of glycans, while the endo-F similarly cleaves the high-grade oligosaccharides. in mannose and complex oligosaccharides. The resistance to elimination of the hydrocarbon side chains by 11-Indo-H is acquired after the conversion of GlcNAc2-Man5 to GlcNAc2-Man3 -
GlcNAc, an event that takes place in the middle region of the Golgi apparatus.Thus the sensitivity or resistance to endoglycosidase H treatments, oligosaccharide groups linked to asparagines present on the NS1 protein expressed by the VFJ or by the Ac-E.NS1 virus should provide guidance on its transport in the intracellular secretory pathway and an indication as to the compartment in which the oligomerization takes place.

Intracellular and extracellular samples obtained from tagging experiments followed by 2 hours of flushing were analyzed for their endoglycosidase reactivity. The extracellular NS1 protein of VFJ appears to be almost completely resistant to Endo-H and shows the same heterogeneity as the untreated form; but as expected, is sensitive to Endo-F. This indicates that
NS1 must pass through the secretory compartment where the high mannose oligosaccharides are modified into complex endo-H resistant sugars.

The heterogeneity of the released NS1 protein is probably due to multiple modifications of the oligosaccharides linked to Asparagine residues. In contrast to the secreted form, the intracellular NS1 protein is fully endo-H sensitive, indicating that it does not migrate to the Golgi complex but remains in the endoplasmic reticulum. Since the majority of NS1 is present in the oligomeric form, these results strongly suggest that folding and oligomerization probably occur in the endoplasmic reticulum or in a compartment that precedes trans-Golgi.

To characterize the nature of the N-glycans on the recombinant protein NS1, the labeled proteins obtained from Sf9 cells infected with
Ac-E.NS1 and treated with Triton X 114 are partitioned between the aqueous and detergent phases and then the NS1 protein of each phase is immunoprecipitated.

Similar results are obtained with one or the other phase. When the NS1 recombinant protein composed of both gp 48 and gp 47 is treated with endoglycosidase H, two bands are observed which migrate with unglycosylated form 43 and gp form 47 respectively. Both bands are sensitive to Endo-F which reduces their size to 43 kDa.

These results suggest that gp 48 is the endo-H sensitive form while gp 47 is the endo-H resistant form. The existence of Endo-H-resistant gp protein 47 suggests that although the majority of NS1 proteins have high mannose glycans, some of the oligosaccharides are shortened without further elongation. This means that the protein was transported from endoplasmic reticulum to the Golgi apparatus where mannose-rich sequences were likely modified in
Man3GlcNAc2. This phenomenon is observed in insect cells. In addition, such glycans are known to be poor substrates for Endo-H.

Thus, it appears that the glycosylation of the protein
Recombinant NS1 expressed in insect cells is different from that of the authentic NS1 protein synthesized in mammalian cells.

B / Expression of recombinant baculoviruses
Ac-E I and Ac-NS1
The study of the expression of the recombinant proteins E and NS1 in Sf9 cells was carried out 30 h after infection with baculovirus Ac-E 1 or Ac-NS 1.

1) Expression of the truncated E protein
The recombinant baculovirus Ac-E 1 expresses the E envelope protein of the yellow fever virus deleted from its C terminal transmembrane anchoring domain. The recombinant protein E has a theoretical molecular weight of 52 kDa (96a of the 17D virus E protein).

* Antigenicity of the recombinant protein E
The E protein expressed by the Ac-E 1 virus has an electrophoretic migration profile very similar to those synthesized by the 17D virus or by the recombinant Baculovirus Ac-E.NS1. This recombinant protein reacts with an anti17D mouse antiserum as well as with the neutralizing monoclonal antibodies 4E8,2C9,2E10,2D12 and 5E3 (Schlesinger et al, (10)). The neutralizing mAb 864 (Gould et al, (9)), specific for the 17D-204 vaccine strains, recognizes the recombinant E protein.

* Production rate in Sf9 cells
Truncated E protein in insect cells infected with Ac-E 1 virus is visualized by staining with Coomassie blue from the total proteins of a lysate of 10 6 cells after analysis on an SDS-polyacrylamide gel ( SDS-PAGE).

The production of E is estimated at 10 μg per 106 cells.

* Physicochemical properties of the recombinant protein E
If the recombinant Baculovirus Ac-E synthesizes the protein E in large quantities, the purification tests show that it appears relatively insoluble;
* Secretion of the protein E
The recombinant protein E is not detected in the supernatant of Sf9 cells infected with the Ac-E1 virus. The absence of secretion, despite the deletion of its transmembrane anchoring domain, would be correlated with its insolubility property in the intracellular compartment.

* Cellular localization of protein E by immunofluorescence
By indirect immunofluorescence, protein E is found only in the intracellular compartment, it is not detected on the surface of the cell.

 The recombinant baculovirus Ac-E1 expresses the E protein of the yellow fever virus, vaccine strain 17D-204 France, which correctly presents the neutralization epitopes.

2) Expression of the NSI Protein
Recombinant baculovirus Ac-NS1 expresses the non-structural NS1 (aa 779 to 1129) yellow fever virus glycoprotein in the presence of amino acids
MSMSMILVGVIMMFLSLGVGA (aa 758 to 778) which would compose its internal signal peptide.

* Antigenicity of the recombinant protein
NS1
The recombinant NS1 protein synthesized by the Ac-NS1 virus migrates in the form of a doublet (apparent PM of 48 and 47 kDa) with an electrophoretic migration profile very similar to that of the protein expressed by the 17D virus or by the recombinant baculovirus ac-E.NS1. The NS1 doublet reacts with anti-17D mouse antiserum and with mAb 1A5,4E3,2D10,2G2 and 8G4 (Schlesinger et al, 10).

 The 1A5 and 8G4 mAbs have complement-mediated cytolytic activity and can passively protect the mouse and primate against intracerebral injected 17D virus.

* Glycosylation
In the presence of tunicamycin, an inhibitor of N-glycosylation of glycoproteins or after treatment with endoglycosidase F, the doublet of NS1 of 48 and 47 kDa disappears while appears a polypeptide of 43 kDa which has a very electrophoretic migration profile comparable to the non-glycosylated form of the NS1 protein of yellow fever virus. This result indicates that the 48-47 kDa doublet corresponds to two major forms of the recombinant NS1 protein that differ in the nature of their oligosaccharides.

* Production rate in Sf9 cells
NS1 protein in insect cells infected with Ac-NS1 virus is visualized by staining with Coomassie blue from a lysate of 106 cells after analysis on SDS-PAGE. It is estimated that about 10 μg of NS1 protein is produced per 10 6 cells.

* Oligomerization and membrane association of NS1 protein
The oligomeric form of the NS1 protein (gp 72 kDa), previously described for the 17D virus and for the recombinant baculovirus Ac-E.NS1, is observed in the insect cells infected by the virus.
Ac-NS1 after staining with Coomassie blue of the total proteins of an undenatured cell lysate analyzed on SDS-PAGE. The existence of the gp 72 kDa oligomeric form of the NS1 protein expressed by the Ac-NS1 virus was confirmed by Western blotting with anti-NS1 rabbit antiserum. The oligomeric form of the NS1 protein is found membrane associated with Triton X 114 nonionic detergent fractionation experiments.

* Secretion of NS1 protein
The recombinant NS1 protein is not detected in the supernatant of Sf9 cells infected with Ac-NS1 virus. The absence of excretion of the NS1 protein by lepidopteran cells was previously observed in cells infected with the recombinant baculovirus Ac-E.NS1.

Cellular localization of the NS1 protein by immunofluorescence
By indirect immunofluorescence with 8C4 mAb, the recombinant NS1 protein is found on the surface of the infected Sf9 cell.

III - Protective immunity against induced VFJ
Recombinant proteins E and NS1 in mice
The immunogenicity and the protective capacity of recombinant E and NS1 proteins expressed in Sf9 insect cells infected with different baculoviruses were tested in mice, which is the reference animal model for studying the pathogenesis of VFJ. Indeed, if wild strains kill the adult rodent after intracerebral or intraperitoneal injection, the 17D vaccine strains are lethal only when the virus is injected intracerebrally. The young mice are susceptible to wild or vaccinal virus whatever the route of inoculation. Thus, to test the immunogenic capacity of recombinant proteins E and / or NS1, cell lysates were inoculated into Swiss mice for three weeks. The challenge with the virulent virus is by injecting the virus intracerebrally.

 The detection of antibodies directed against E and NS1 proteins in the sera of immunized mice was carried out before the animals received an intracerebral injection of the infectious virus 17D (challenge or challenge with VFJ).

a) preparation of cell lysates
Sf9 cells infected with wild-type baculovirus (AcNPV) were used as a negative control and two types of positive control were selected: the 17D virus inoculated intraperitoneally and the 17D-infected Vero cells.

All Sf9 or Vero cells were removed at the 30th hour after the onset of infection. They were suspended in PBS and the cell extract was obtained by a simple freeze-thaw step.

Each Swiss mouse receives an intraperitoneal (ip) injection of 5 x 105 cells (except 2.5 x 10 6 cells infected with Ac-E.NS1) contained in 0.3 ml, without adjuvant, or from 106 pfu of 17D virus, to time OJ and J 15. Three weeks after the start of the inoculation, on day 19, the sera of the immunized mice are removed and at 21 the animals receive a dose of 100 LD50 of 17D virus contained in a volume of 30 μl per intracerebral route (ic). Mortality
mice is counted until the 21st day
following the test, ie 6 weeks after the start of
immunization.

b) Protection of immunized mice
The results are shown in the table
1.

TABLE I *
Virus or lysate Number of protected mice Tit Ac NI cell on total number of mice immunized injected sera (% protection) before 17D test ip e 16/19 (85%) 40-80 Vero / 17D 20/20 (100%) 10
AcNPV≈1 / 19 (5%) <10
Ac-E.NS1 25/25 (100%)
Ac-E 1 17/19 (90%)
Ac-NS 1 5/25 (20%) <10 *
(*: dilution of the serum to obtain 50% reduction
viral title) (16 ftf of VFJ)
(#: 0.5 x 106 infected cells)
(+: 2.5 x 106 infected cells)
Swiss mice inoculated with the 17D virus
intraperitoneally or those who have received lysate
Vero cells infected with the 17D virus are prote
while the mice immunized with lysate
Sf9 cells infected with AcNPV baculovirus are
died 15 days after the start of the test with the infectious virus (Figure 6). When the Swiss mice are inoculated with the Ac-E.NS1 cell lysate, the protection is total.

 To establish the respective roles of E and NS1 in inducing an antiviral protective immune response, the Swiss mice received either a lysate of cells infected with the recombinant baculovirus Ac-E1 or a lysate of cells infected with HIV. Recombinant baculovirus Ac-NS1. The mice immunized against the truncated E protein at its C-terminal end (Ac-E1 virus) are protected against the infectious virus (FIG. 7), those immunized against the NS1 protein (Ac-NS1 virus) remaining sensitive to VFJ at 80% despite a delay of 2 days in the appearance of clinical signs compared to mice that received only baculovirus proteins (AcNPV virus) (Figure 7). This weak (20%) but real protection suggests that the NS1 protein alone plays a significant role in anti-viral immunity.

c) Presence of antibodies against E and NS1 proteins
The sera taken from the mice immunized before the injection of the 17D virus into the intracerebral (J21) are tested for the presence of antibodies directed against the proteins E or NS1. By radioimmunoprecipitation of a lysate of Vero cells infected with
35
VFJ and labeled with methionine [S, it is confirmed that the sera of mice immunized with baculovirus
AcNPV does not react with any of the VFJ proteins.

The sera of mice that received the 17D virus at i.p.

or Vero cell proteins infected with the
VFJ immunoprecipitate with varying intensities the E and NS1 proteins (Figure 8).

 The sera of the mice immunized with the lysate of Sf9 cells infected with the AC.E-NS1 virus immunoprecipitate the NS1 protein and, to a lesser extent, the VFJ protein E (FIG. 8).

The sera of the mice immunized with the lysate of Sf9 cells infected with the Ac-E1 or Ac-NS1 viruses immunoprecipitate very weakly or not with the E or NS1 proteins respectively (FIG. 8). Two hypotheses can be proposed to respond to this phenomenon; either the E and NSi recombinant proteins expressed by the Ac-E.NS1 virus are more immunostimulatory than those synthesized respectively by the Ac-E1 and Ac-NS1 viruses, or the antibodies directed against the individualized E and NS1 proteins belong to classes d isotypes that react very poorly with protein A which is specific for Ig2a.

The second explanation can be argued by the fact that the Ac N1 titre against the E protein expressed by the Ac-E1 virus is higher than that of the E protein expressed by the Ac-E.NS1 virus, although nothing is detected by immunoprecipitation; finally, we can imagine that the E and NS1 proteins synthesized by the Ac-E1 and Ac-NS1 viruses respectively preferentially stimulate certain classes of immunoglobulins not recognized by protein A, a phenomenon that would not occur when the recombinant proteins are expressed by the Ac-E.NS1 virus. the antigenic response seems different for the same proteins according to their mode of presentation to the immune system of the animal.

 By the in vitro seroneutralization test, the neutralizing antibody titer (AcNI) present in the sera was used. The in vitro seroneutralization test is carried out as follows; One hundred plaque-forming units (ufp) of VFJ, vaccine strain 17D-204 France, are incubated for 2 hours with successive serial dilutions and then placed in contact with porcine kidney (PS) cells in the presence of carboxymethylcellulose (CMC). After 5 days, the cells are stained and the dilution of the serum is determined which makes it possible to obtain about 50 plaques, ie a 50% reduction in the viral titre (serum neutralization titre). The titre obtained is 40-80 for the sera of mice which have received the 17D virus in i.p. and 10 for those animals immunized against the VFJ-infected Vero cell lysate (Table 1). As expected, no Ac-NI was detected in the sera of mice immunized against Baculovirus AcNPV proteins or against the protein. recombinant NS1 expressed by the recombinant Baculovirus Ac-NS1 (titre <10). The sera of mice immunized with Baculovirus Ac-E.NS1 or Ac-E 1 have neutralizing antibody titers of 10 and 20 respectively (Table 1).

d) conclusion
The yellow fever virus E and NS1 proteins, vaccine strain 17D-204 France, expressed by the recombinant Baculovirus Ac-E.NS1 induce a complete protective immune response (100%) against the infectious agent with a neutralizing antibody titer of 10. The envelope protein (E) deleted from its transmembrane carboxylic anchoring domain expressed by the Ac-E1 virus, effectively immunized against VFJ (90% protection) with a titre of Ac
NI 20.If the recombinant NS1 protein synthesized by the Ac-NS1 virus does not induce an effective protective immunity against VFJ (20% protection), the humoral and / or thymus-dependent cellular immune response induced by it appears to delay the appearance of clinical signs, (usually lower limb paralysis) and may protect some individuals probably in relation to the haplotype of the major histocomptability complex (MHC) of the immunized Swiss mice.

From all these results, it appears that the envelope protein has a primordial role in the anti-viral protective immune response, certainly by the induction of neutralizing antibodies. However, it seems that the immune response against the E and NS1 proteins expressed by the Ac-E.NS1 virus is even more efficient for the following reasons.
- the existence of total protection against VFJ after only two injections 15 days apart from a single cell lysate;
the level of neutralizing antibodies (titre 10) is sufficient for complete antiviral protection (a titre comparable to that obtained for the mice protected with the lysate of Vero cells infected with the 17D virus);
observation of a high immunogenic capacity of the NS1 protein produced by Ac-E.NS1.

 - intervention of the two compartments of the protective anti-viral immunity, the seroneutralization of the virus and the cytotoxicity directed against the infected cells, the whole allowing a double protection against the diffusion of the pathogen in the organism (by the AcNI ) as well as to prevent the appearance of neutralizing antibody escape mutants by early blocking viral replication by precisely blocking viral replication by the intervention of a humoral and / or thymus dependent immune response directed against the NS1 protein.

 This double antigenic response could, in the case of dengue, prevent the occurrence of severe complications such as haemorrhagic fevers which have been described as being related to the presence of pre-existing immunity to a heterologous serotype of dengue virus.

 The use of a subunit vaccine composed of recombinant E and NSI proteins appears as an effective and original response for the development of anti-flavivirus or anti-flavilike prophylaxis. In the case of yellow fever, children younger than 6 months of age could be effectively immunized, which is not possible with the current 17D live vaccine because of its significant level of neurovirulence (O.M.S. recommendation).

Svmboles of Amnied Acids
Ala alanine
Cysteine Cysteine
D Asp aspartic acid
E Glu glutamic acid
F Phenylalanine
Gly glycine
H his histidine
I Isoleucine Island
K Lily lysine
Leucine leucine
M Met methionine
N Asn asparagine
P Pro proline
Gln glutamine
R Arg arginine
Serin serine
T Threonine
Valine Valley
W Trptophan Trp
Tyr Tyrosine Y
REFERENCES 1. Schlesinger, JJ Brandriss, MW and Walsh,
EE (1985). Protection against 17D yellow fever encephalitis in mice by passive transfer of monoclonal antibodies to the non-structural glycoprotein 48 and by active immunization 48 J. Immunol.

135-2805-2809 2. Gould, EA Buckley, A. Barrett, ADT and
Cammack., N (1986). Neutralizing (54K) and non-neutralizing (54K and 48K) monoclonal antibodies against structural and non-structural yellow fever virus proteins confer immunity in mice. J. Gen. Virol.

67.591-595 3. Maniatis, T., Fritsch, E. F. and Sambrook, J.

(1982). Molecular Cloning: A laboratory manual. Cold
Spring Harbor Laboratory, New York 4. Despres, P., Ruiz-Linares, A., Cahour, A., Girard, Mt C. Wychowski, and Bouloy, M. (1990). The amino acid residues preceding the amino terminus of the envelope protein in the yellow fever virus polyprotein precursor acts as a signal peptide. Virus
Res. 16, 59-76. 5. Luckow, VA and Summers, MD (1989). High level expression of non fused foreign genes with Autographa californica nuclear polyhedrosis virus expression vectors. Virology. 170, 31-39 6. Summers, MD and Smith, GE (1987). A manual of methods for baculovirus vectors and an insect cell culture procedure. In: "Texas Agricultural Experiment
Station Bulletin "College Station TX, No. 1555 7.Ruiz-Linares, A., Cahour, A., Despres, P., Girard,
M. and Boloy, M. (1989). Treatment of yellow fever virus polyprotein: role of cellular proteases in the processing of structural proteins. J. Virol. 63, 4199-4209 8. Despres, P., Cahour, A., Wychowski, C., Girard, M.

and Bouloy, M. (1988). Expression of yellow fever virus envelope protein using hydrid SV40 / yellow fever viruses. Ann.Inst.Pasteur / Virol.139,59-67 9. Gould, EA, Buckley, A., Cammack, N. Barrett,
ADT, Clegg, JCS, Ishak, R. and Varma, MGR

(1985). Examination of the immunological relationships between flaviviruses using yellow fever virus monoclonal antibodies. J.Gen.Viro 1.66: 1369-1382. 10. Schlesinger, J. J. Brandriss, M.W. and Monath, T.P.

(1983). Monoclonal antibodies between viruses and strains of yellow fever virus by neutralization, haemagglutination inhibition and immune precipitation of the virus envelope. Virology.125.8-17 11. Schlesinger, JJ Brandriss, MW, Walsh, EE,
Eckels, K. Zhang, YM and Lai, CJ (1988). Development of candidate subunit flavivirus vaccines: immunogenic characterization of yellow fever and dengue virus structural and non structural proteins. In "Technological Advances in Vaccine Development" (Alan
R. Less, Inc.). pp 11-20 12. Cane, PA and Gould, EA (1989). Immunobloting reveals differences in the accumulation of envelopes by wild-type and vaccine strains of yellow fever virus. J.Gen.Virol. 70.557-564 13. Winkler, G. Randolph, VB, Cleaves, GR, Ryan,
TE and Stollar, V. (1988). Evidence that the mature form of the flavivirus nonstructural protein is important. Virology. 162, 187-196 14. Winkler, G., Maxwell, SE, Ruemmler, C., and
Stollar, V (1989). Newly synthesized dengue-2 nonstructural protein NS1 is a soluble protein that becomes partially hydrophobic and membrane-associated after dimerization. Virology. 171, 302-305 15. FAN, W. and MASON, PW (1990). Membrane association and secretion of the japanese encephalitis NS1 protein from cells expressing NS1 c DNA,
Virology 177, 470-476 16. Schlesinger, JJ Brandriss, MW, Putnak, JR

and Walsh E.E. (1990). Cell surface expression of yellow fever non-structural virus glycoprotein NS1: consequences of interaction with J.Gen.Virol antibody.

71,593-599 17. Despres, P., Deubel, V., Bouloy, M. and Girard, M.

(1986). Identification and characterization of intracellular yellow fever virus-specific RNA: absence of subgenomic RNA. Ann.Inst. Pastor / Virol.137E, 193-204 18. Rice, CM, Lenches, EM, Eddy, SR, Shin, SH,
Sheet R. and Strauss, JH (1985) Nucleotide sequence of yellow fever virus: implications for flavivirus gene expression and evolution. Science. 229, 726-733 19. Despres, P., Cahour, A., Dupuy, A., Deubelt V.,
Bouloy, M. Digoutte, JP and Girard, M. (1987). High genetic stability of the region coding for the structural proteins of yellow fever virus strain 17D;

Gen.virol. 68, 2245-2247 20. Hahn, YS, Dalrymple, JM, Strauss, JH and
Rice, CM (1987). Comparison of the virulent Asibi strain of yellow fever virus with the 17D vaccine strain derived from it. Proc.Natl.Acad.Sci (USA) 84, 2019-2023 21. Dupuy, A., Despres, P., Cahour, A., Girard, M and
Bouloy, M. (1989). Nucleotide sequence comparison of the genome of two 17D-204 yellow fever vaccines.

 Nucleic.Acids.Res. Jarvis, D.L. and Summers, M.D. (1989).

Glycosylation and secretion of human tissue plasminogen activator in recombinant baculovirus-infected insect cells.Mol.Cell. Biol.9, 214-223

Claims (13)

Flaviviridae or a Flaviviridae-related virus inserted into the polyhedrin gene between nucleotide +35 and the nucleotide of +170, the A of the modified initiation codon of polyhedrin being numbered + 1.  1 - recombinant baculovirus, characterized in that it comprises a cDNA encoding all or part of the envelope antigenic protein E and / or a cDNA encoding all or part of the NS1 non-structural antigenic protein of a virus belonging to the  2 - recombinant baculovirus according to claim 1, characterized in that it comprises as insertion segment a cDNA coding for all or part of E or a cDNA coding for all or part of E and NS1, and in that it furthermore comprises, upstream of the cDNA, a leader sequence which corresponds to the 3 'end of the 5' non-coding region of the VP1 protein gene of the SV40 virus comprising the 3 'nucleotides at the Hind III site and the ATG initiation codon of the VP1 protein.  3 - recombinant baculovirus according to claim 1, characterized in that it comprises as an insertion segment a cDNA coding for all or part of E, in that it further comprises at the end 3 'a termination codon introduced prior to insertion into the baculovirus.  4 - recombinant baculovirus according to any one of claims 1 to 3, characterized in that it is obtained from Autoaranha California Nuclear Polyhedrosis Virus.  5 - recombinant plasmid for obtaining a baculovirus according to claim 1, called pAc-E.NS1 comprising the cDNA encoding E and NS1 deleted its potential amino acid C terminal, characterized in that it is obtained by the next steps  a) digestion of a recombinant plasmid SV40-VFJ comprising the cDNA encoding E and NS1, to introduce a termination codon at the carboxyl terminus of NS1. As a result, the expressed protein is deleted from its C-terminal amino acid;  b) digestion of this plasmid with Hind III and Bgl II;  c) treating the ends with the Klenow fragment in the presence of the 4 deoxynucleotides triphosphate, so as to make the ends blunt;  d) digestion of the DNAs obtained by Apa I;  e) isolation and ligation of the DNA fragments obtained with the plasmid pVL-941 poly previously linearized with Bam H1 and treated with the fragment of Klenow in the presence of the 4 deoxynucleotides triphosphate, then by the alkaline phosphatase to generate a plasmid comprising the ATG initiator of the VP1 protein of the SV40 virus preceded by the 11 adjacent nucleotides in 5 'delimited by a Hind III site.  6 - recombinant plasmid for obtaining a baculovirus according to claim 1, called pAC-NS1 comprising the cDNA encoding the protein NS1 deleted its potential amino acid C terminal, characterized in that it is obtained by the following steps  a) digestion of a recombinant plasmid SV40-VFJ comprising the cDNA coding for E and NSI deleted from its terminal amino acid C with Xba I;  b) filling with the Klenow fragment in the presence of the 4 deoxynucleotide triphosphates and ligating the fragments obtained to generate a plasmid comprising a leader sequence corresponding to the 3 'end of the 5' non-coding region of the VP1 protein gene of the SV virus 40 comprising the 11 nucleotides 3 'of the Hind III site and the ATG initiation codon of the VP1 protein as well as the exogenous GGG GGA TCC TCT AGC TAG sequence downstream of the cDNA coding for E and NS1 deleted from its amino acid C terminal;;  c) digestion of the plasmid obtained in step b) with Tth III, MluI and Pst I,  d) ligation of the fragments obtained in step c) after filling the Tth 1111 site with the Klenow fragment in the presence of the 4 deoxynucleotide triphosphates with a pVL-941 poly transfer vector obtained from pVL 941 by insertion of a multilinker at the 3 'end of the Bam HI site, digested with Bam HI and filling of the Bam HI site with the Klenow fragment in the presence of the 4 deoxynucleotides triphosphate.  7 - A recombinant plasmid for obtaining a baculovirus according to claim 1, called pAC-E1 comprising the cDNA coding for the signal peptide of the E protein followed by the truncated E protein, deleted from its C terminal end (amino acids 286 at 720), characterized in that it is obtained by the following steps  a) digestion of the plasmid of pAC-E.NS1 previously described by Xho I and Apa I and a SV40-VFJ recombinant plasmid comprising the cDNA coding for protein E with Apa I and Bgl II, and  b) ligation of the fragments [Xho I-Apa IJ of the plasmid pAC-E.NS1 obtained previously and [Apa I-Bgl II of the recombinant plasmid SV40-VFJ comprising the cDNA coding for the truncated protein E with a transfer vector PVL- 941 poly obtained from pVL 941 by insertion of a multilinker at the 3 'end of the site Bam HI and digested with Xho I and Bam H I.  8 - Polypeptides comprising all or part of the E and / or NS1 proteins, characterized in that they are obtained by a recombinant baculovirus according to any one of claims 1 to 4.  9 - Polypeptides comprising all or part of the E and / or NS1 proteins, characterized in that they are obtained by propagation of a recombinant baculovirus according to one of claims 1 to 4 in SnodoPtera frusiPerda cells.  10 - Method for in vitro diagnosis in humans or animals, by demonstrating antibodies directed against all or part of the protein E and / or the immunogenic NS1 protein as obtained by a recombinant baculovirus according to one of claims 1 to 4, in a biological sample of the human or animal in which the immunogenic protein or proteins is put in contact with one another E and NS1 with the biological sample of the man or the animal that may contain said antibodies and the presence of the bound antibodies is revealed.  11 - In vitro diagnostic kit for infections caused by Flaviviridae or Flaviviridae-related viruses for carrying out the method according to Claim 10 comprising all or part of the protein NS1 and / or the immunogenic protein E as obtained by a recombinant baculovirus according to any one of claims 1 to 4 and additionally containing an antibody specific for an immunoglobulin isotype.  12 - Vaccine for the treatment and prevention of infections caused by Flaviviridae or Flaviviridae-related viruses in humans or animals, wherein the vaccinating agent consists of all or part of protein E and / or of the NS1 protein, obtained by a recombinant baculovirus according to any one of claims 1 to 4.  Monoclonal antibody directed against all or part of a protein E and / or NS1, obtained by a recombinant baculovirus according to any one of claims 1 to 4.