FI110433B - alpha amidating enzyme-coding DNA sequence, host cells and a method for producing an amidated peptides - Google Patents

alpha amidating enzyme-coding DNA sequence, host cells and a method for producing an amidated peptides Download PDF

Info

Publication number
FI110433B
FI110433B FI935385A FI935385A FI110433B FI 110433 B FI110433 B FI 110433B FI 935385 A FI935385 A FI 935385A FI 935385 A FI935385 A FI 935385A FI 110433 B FI110433 B FI 110433B
Authority
FI
Finland
Prior art keywords
enzyme
alpha
peptidyl
gt
ph
Prior art date
Application number
FI935385A
Other languages
Finnish (fi)
Swedish (sv)
Other versions
FI935385A (en
FI935385A0 (en
Inventor
James P Gilligan
Barry N Jones
Arthur H Bertelsen
Nozer M Mehta
Original Assignee
Unigene Lab Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US06/655,366 priority Critical patent/US4708934A/en
Priority to US65536684 priority
Priority to US07/086,161 priority patent/US6319685B1/en
Priority to US8616187 priority
Application filed by Unigene Lab Inc filed Critical Unigene Lab Inc
Publication of FI935385A0 publication Critical patent/FI935385A0/en
Publication of FI935385A publication Critical patent/FI935385A/en
Application granted granted Critical
Publication of FI110433B publication Critical patent/FI110433B/en

Links

Abstract

An enzymatic compsn. is claimed comprising at least one alpha-amidating enzyme (AAE) capable of catalysing, in the presence of oxygen and a reducing agent, the conversion of a peptidyl cpd. having a glycine residue at least at the C-terminus of its peptide chain to a corresponding peptidyl amide cpd. having an amino gp. in place of the C-terminal glycine, the enzymatic compsn. being sufficiently pure in AAEs to exhibit a specific activity of at least 25 mll per mg of protein present and the enzymatic compsn. being sufficiently free of proteolytic activity capable of degrading at least one of the peptidyl cpd., the corresponding peptidyl amine and the AAEs to allow the compsn. to catalyse the conversion when the peptidyl cpd. comprises L-amino acids. Also claimed are immunoaffinity columnss for purifying the AAE and method for prodn. of AAE compsns. using DNA sequences coding for AAE.

Description

110433 110433

Alfa-amidointientsvvmiä koodaava DNA-sekvenssi. encoding the alpha-amidointientsvvmiä DNA sequence. isäntäsolu ia menetelmä amidoidun peptidin valmistamiseksi Tämä hakemus on jatko US-patenttihakemukseen n:o 655,366, joka on jätetty 27.9.1984 5 ja joka on kokonaisuudessaan tässä viitteenä. host cells and methods for producing an amidated peptide This application is a continuation of U.S. Patent Application No. 655.366, filed 27/09/1984 5, and which is incorporated herein by reference in its entirety.

Tämä keksintö liittyy alfa-amidointientsyymeihin, alfa-amidointientsyymien valmistukseen ja niiden käyttöön alfa-amidoitujen tuotteiden valmistuksessa entsyymien vaikuttaessa glysiinillä laajennettuihin substraatteihin. This invention relates to alpha-amidating enzyme, the production of alpha-amidating enzyme and to their use in the manufacture of alpha-amidated products action of enzymes glycine-extended substrates. Tietyissä edullisissa suoritusmuodoissa io keksinnön mukaisen DNA-sekvenssin koodamaa alfa-amidointientsyymiä voidaan käyttää valmistettaessa hyödyllisiä alfa-amidoituja hormoneja ja maanviljelys-ja lääketuot-teita, jotka sisältävät kalsitoniinia, kasvuhormonia vapauttavia tekijöitä, kalsitoniinigee-nin sukuisia peptidejä ja muita alfa-amidoituja tuotteita. In certain preferred embodiments according to the IO invention, the DNA sequence encoded by the alpha-amidating enzyme can be used in the preparation of useful alpha-amidated hormones and of agricultural and pharmaceutical products, compounds containing calcitonin, growth hormone releasing factors, calcitonin gene-nin-related peptide and other alpha-amidated product.

is Luonnollisten proteiinien esiastemuotojen intrasellulaarista käsittelyä (lohkaisua ja/tai funktionaalisen ryhmän muuntoa) sekä niiden translaatiota nukleiinihapon koodavista sekvensseistä on selitetty yksityiskohtaisesti. intracellular precursor forms of the proteins is by natural processing (cleavage and / or conversion of a functional group) and the translation of the nucleic acid coding sequence has been described in detail.

Yleensä nisäkkäiden solut ja muut eukaryootit voivat suorittaa määrättyjä translaation 20 jälkeen tapahtuvia käsittelyjä, kun taas prokaryootit eivät. In general, mammalian cells and other eukaryotes may be carried out after the prescribed 20-translational processes taking place, while prokaryotes can not. Määrättyjä prokaiyootteja, ,.: : kuten R colia käytetään laajalti isäntinä nisäkkäiden proteiinien valmistuksessa yhdis- * · •. Certain prokaiyootteja,.,:: As R coli is widely used as hosts for the production of mammalian proteins in combination · * •. '! '! * telmä-DNA- (rDNA) tekniikan avulla, koska niitä voidaan helposti kasvattaa kerta- * System of DNA (rDNA) techniques, because they can be easily grown single

• · I • · I

• · · * käymismenetelmissä ja koska ne ovat geneettisesti hyvin luonnehdittuja. • · · * fermentation methods and because they are genetically well characterized. Kuitenkin ge- • · : · ' ' neettisellä yhdistelmätekniikalla tuotetut nisäkkäiden proteiinit vaativat jonkintyyppistä 25 translaation jälkeistä käsittelyä ja tämä täytyy suorittaa usein käyttämällä monimutkai- • siä kemiallisia in vitro-toimenpiteitä. However, gelatin • · · '' produced by the genetic recombination technique mammalian proteins require some type of post-translational processing 25, and this must often carried out using complex chemical • tions in in vitro procedures. jotka ovat kalliita suurimittaisessa valmistuksessa. which are costly for large scale manufacture.

• · » · · • · · • · »· · • · ·

Eräs tapa aktiivisuuden käsittelemiseksi on käyttää proteiinin karboksyyli-terminaalisen ' · ' aminohapon spesifistä amidointia. One way to deal with the activity of the protein is the use of carboxyl-terminal '·' The specific amidation of the amino acid. Useat luonnossa esiintyvät hormonit ja peptidit sisäl- ';'; A number of naturally occurring hormones, and peptides containing ';'; * 30 tävät tällaisen muunnelman, joka on usein välttämätön, jos proteiinin on oltava biologi- • · * *. * 30 Methods such a variation, which is often necessary if the protein must be biologically • · * *. * sesti aktiivinen. * Active. Eräs esimerkki on kaisitoniini, jossa luonnollisen amidoidun proliinin : .' One example is kaisitoniini, wherein the natural amidated proline. " substituutio ei-amidoidulla proliinitähteellä saa aikaan biologisen aktiivisuuden 3.000- substitution of a non-amidated proline residue causes a biological activity of 3.000-

• II • II

kertaisen vähenemisen. fold decline.

2 110433 2 110433

Aine, joka vaikuttaa tähän C-terminaaliseen (alfa) amidointiin, tunnistaa glysiini-tähteen, joka seuraa välittömästi amidoitavaa aminohappoa (RX-gly, jossa R on proteiinin päärunko, X on tähde, joka on amidoitu, ja "gly" on glysiinitähde). A substance that affects this C-terminal (alpha) amidation recognizes a glycine residue which immediately follows the amidated amino acids (RX-gly, where R is the main body of the protein, X is the residue which is amidated, and "gly" is the glycine residue). Glysiini loh-5 kaistaan ja se itse asiassa luovuttaa amino-osan viimeistä edelliseen aminohappoon ja amidoi sen tällöin. Glycine dragon-band 5 and is, in fact, disclose the amino portion of the penultimate amino acid, and then the amidoi.

Ensimmäiset tutkijat, jotka ovat esittäneet alfa-amidointientsyymin likimääräisen mole-kyylipainon, olivat Bradbury AF et ai., Nature, Voi. The first investigators who submitted the alpha-amidating enzyme, an approximate molecular weights were Bradbury, AF, et al., Nature, Vol. 298, 1982, s. 686-88. 298, 1982, pp. 686-88. Käyttämällä 10 Sephadex G-100:a he ehdottivat ilmeiseksi minimimolekyylimassaksi n. 60.000 dalto-nia. 10 Use of Sephadex G-100 they suggested a minimum apparent molecular mass of about 60,000 dalto-ketone..

Seuraavissa tutkimuksissa on ehdotettu tällaisen entsyymin molekyylimassaksi 60.000 -70.000 daltonia (mitattuna geelisuodatuskromatografialla). In the following studies have suggested the molecular mass of such an enzyme -70.000 60.000 daltons (as measured by gel filtration chromatography). Ks. See. Husain, I. ja Tate, SS, 15 FEBS Letters, Voi. Husain, I., and Tate, SS, 15 FEBS Letters, Vol. 152 #2,1983, s. 277 - 281; 152 # 2.1983, p 277 - 281.; Eipper, et ai, PNAS Voi. Eipper, et al, PNAS, Vol. 80, 1983, s. 5144 - 5148; 80, 1983, pp 5144 - 5148.; Gomez et ai., FEBS Letters, Voi. Gomez et al., FEBS Letters, Vol. 167, #1, 1984, s. 160 -164 ja Kizer, J. 167, No. 1, 1984, pp. 160 -164, and Kizer, J.

S., et ai., PNAS, Voi. S., et al., PNAS, Vol. 81,1984, s. 3228 - 3232. 81.1984, p 3228 -. 3232.

Eipper et ai., PNAS, Voi. Eipper, et al., PNAS, Vol. 80,1983, s. 5144-48, ovat esittäneet, että molekyylihapen 20 lisäksi tarvitaan kaksi kofaktoria maksimaalista entsyymin amidointiaktiivisuutta var- | . 80.1983, p 5144-48, have suggested that in addition to molecular oxygen 20 requires two enzyme cofactor maximum VaR amidointiaktiivisuutta | : ten. : Ten. Nämä ovat askorbiinihappo ja kupari(II)ioni. These are ascorbic acid and copper (II) ion.

« · · • * • t · • '.: Kemiallinen reaktio, joka saa aikaan peptidin karboksyylipäätteen amidoinnin, tarvitsee •.: i aminoryhmän lähdettä. «* • · · · • • T '. The chemical reaction which has the carboxyl terminal amidation of a peptide, needs .: • i amino group source. Bradbury, AF, et ai.. Nature, Voi. Bradbury, AF, et al .. Nature, Vol. 298,1982, s. 686 - 688, • » * i . 298.1982, p 686 -. 688, • »* i. * 25 osoittivat, että glysiini lohkaistaan ja se luovuttaa aminoosan viimeistä edelliseen ami- • · · ' ' nohappoon, jolloin se amidoi tämän. * 25 demonstrated that glycine is cleaved and released before last amino aminoosan • · · '' acid, in which case it amidoi this. Muut tutkijat ovat vahvistaneet glysiinin tarpeen aminoryhmän donorina. Other researchers have confirmed the need for glycine amino group donor.

• · · • · * • · T Landymore, AEN, et ai·? • · · • · • · * T Landymore, AEN, et al ·? BBRC Voi. BBRC Oh. 117, #1,1983, s. 289 - 293 osoittivat, että D- • ♦ ' ·' · ' 30 alaniini voisi samoin toimia aminon donorina amidointireaktiossa. 117, # 1.1983, p 289 -. 293 showed that D • ♦ '·' · '30 alanine could act as the amino-donor amidation reaction. Tämän jälkeen Kizer * · · et ai., PNAS, Voi. After this, Kizer * · · et al., PNAS, Vol. 81,1984, s. 3228 - 3232, osoittivat kaksi erillistä entsyymiaktiivi- : 'suutta rotan aivoissa, jotka pystyvät katalysoimaan alfa-amidointireaktiota. 81.1984, p 3228 - 3232, showed two distinct enzyme activities. 'Suutta rat brain which are capable of catalysing the alpha-amidation reaction. Korkeani-• · :: man molekyylimassan omaavalla tyypillä (70.000 daltonia) on erikoisuus, joka on rajoi- 3 110433 tettu glysiiniin substraatin karboksyyli-päätteessä. own a Korkeani- • · :: Man molecular mass type (70,000 Daltons) is a specialty, which is limited to glycine been 3 110 433 of the substrate carboxyl-terminal. Alhaisemman molekyylimassan omaava entsyymi hyväksyy substraatin, jossa on β-alaniini karboksyyli-terminaalisessa aminohapossa. an enzyme with a lower molecular weight accepts a substrate with β-alanine carboxy terminal amino acid.

5 Bradbury, AF ja Smythe, DG, BBRC, Voi 112, #2,1983, s. 372 - 377, esittivät sian aivolisäkkeestä uutetun ja erityisesti puhdistetun alfa-amidointientsyymin pH-optimiksi n. 7,0. 5 Bradbury, AF, and Smythe, DG, BBRC, Vol 112, # 2.1983, pp 372 -. 377, made by the pituitary gland extracted from pig and in particular the purified alpha-amidating enzyme pH optimum of 7.0.. Eipper, BA, et ai., PNAS, Voi. Eipper BA, et al., PNAS, Vol. 80, 1983, s. 5144 - 5148, vahvistivat nämä tulokset ja esittivät, että rotan aivolisäkkeistä osittain puhdistetun alfa-amidointientsyymin pH-optimi on 7. He havaitsivat myös, että entsyymiaktiivisuus ale-10 ni nopeasti pH-arvoissa, jotka olivat alle 6,5 tai yli 7,5. 80, 1983, pages 5144 -. 5148, confirmed these results and suggested that the rat pituitary glands of partially purified alpha-amidating enzyme has a pH optimum 7. They also found that the enzyme activity of ale 10 ni rapidly at pH values ​​that were below 6; 5 or greater than 7.5.

Kaikissa edellä esitetyissä julkaisuissa (jotka ovat tässä viitteenä) esitetyt uutteet ja osittain puhdistetut entsyymiseokset sisältävät ylimääräisiä proteolyyttisiä entsyymejä, jotka voivat hajottaa mahdollisia substraatteja tai tuotteita samoin kuin itse alfani amidointientsyymejä, jolloin ne hidastavat peptidien ja polypeptidien amidointia tällaisilla entsyymeillä, jotka on puhdistettu luonnollisista lähteistä tai valmistettu yhdistel-mä-DNA-tekniikalla. In all the publications described above (which are incorporated herein by reference) extracts are shown and partially purified enzyme mixtures contain additional proteolytic enzymes which may degrade the potential substrate and products as well as self Alfani amidation enzyme to slow down the amidation of peptides and polypeptides such enzymes purified from natural sources or made of a combination-I DNA technology.

Yleisesti kaikki muiden aikaisemmin mittaamat amidointiaktiivisuudet perustuivat D-20 substraattien, kuten tripeptidin, DTyr-Val-Gly-COOH:n muuntoon D-Tyr-Val-i : CONH2:ksi. In general, all of the previously measured based on amidointiaktiivisuudet D-20 substrates such as a tripeptide DTyr-Val-Gly-COOH conversion DTyr-Val-i-CONH 2, respectively. Kahdesta mahdollisesta konfiguraatiosta ("D" tai "L") luonnossa esiintyvät # ' ': biologisesti tärkeät aminohapot esiintyvät "L"muodossa. Of the two possible configuration ( "D" or "L"), naturally-occurring # '' biologically important amino acids occur in the "L" form. Kuitenkin näiden muiden tut- • I · • '.: kijoiden käyttämää "D"-muotoa tarvittiin vaikuttamaan asiaankuulumattomien proteo- • · *,: i lyyttisten entsyymien läsnäoloa vastaan näiden tutkijoiden käyttämissä epäpuhtaissa • * · » · * : 25 amidointientsyymivalmisteissa. However, these other research · • I • '. Kijoiden using a "D" format is required to affect extraneous proteolytic • · i v * ,: presence of lytic enzymes used by the researchers in impure • * · »· * 25 amidointientsyymivalmisteissa. Näillä asiaankuulumattomilla entsyymeillä voi olla ko- · · * · * * rostettu proteolyyttinen vaikutus L-aminohappo-substraattiin samalla, kun ne vaikutta vat vain vähän D-substraattiin. These irrelevant enzymes may be interest · · · * * * sandwiched proteolytic effect of L-amino acid substrate while being active in minimal D-substrate. Tutkijat, joiden taakkana olivat proteolyyttiset ja muut epäpuhtaudet heidän entsyymissään, käyttivät epäluonnollista "D"-substraattia epäpuh- • t *; The researchers, which were saddled with proteolytic and other impurities in their enzyme, used unnatural "D" substrate impurities • t *; * tauksien joidenkin vaikutusten välttämiseksi. * In order to avoid some of the effects of impurities. Tähän mennessä ei ole pystytty osoitta- :* 30 maan, että heidän entsyymivalmisteensa voivat amidoida tehokkaasti mitään fysiologi- m ' · · · ' sesti merkityksellisiä substraatteja, so L-substraatteja niiden muuntamiseksi biologi- • · · '· ' · sesti aktiivisiksi alfa-amidoiduiksi L-tuotteiksi. Up to now, has not been shown: * 30 to their enzyme preparation can effectively amidated any physiologically m '· · ·' a relevant substrates, i.e., L-substrates for conversion of their biological • · · '·' · pharmaceutically active alpha amidated L-products.

• * • * > · • · < • · 4 110433 • * • *> • · · <• · 4 110433

Kuten tässä on osoitettu, tässä keksinnössä kuvatut valmisteet pystyvät tehokkaasti ami-doimaan L-substraatit ja niillä on D-substraateilla aktiivisuus, joka on 60 - jopa yli 1000 kertaa suurempi kuin hakijoiden tietämällä alan tasolla havaittu korkein aktiivisuus. As demonstrated herein, the preparations described in this invention are capable of effectively doimaan amino-L-substrates and having the activity of D-substrates, which is 60 - up to more than 1000 times greater than the highest activity was detected candidates by knowing the sector level.

5 5

Useissa lähteissä on esitetty entsyymivalmisteita, jotka pystyvät amidoimaan peptidien ja proteiinien karboksyylipäätteen. Several sources shown in enzyme preparations which are capable of amidation of the carboxyl-terminus of peptides and proteins. Esimerkiksi Bradbury. For example, Bradbury. AF, et ai., Nature, Voi. AF, et al., Nature, Vol. 298, 1982, s. 686 - 688 (kokonaisuudessaan tässä viitteenä) esittävät sian aivolisäkkeessä esiintyvän alfa-amidointientsyymiaktiivisuuden. 298, 1982, pp 686 -. 688 (incorporated herein by reference in its entirety) disclose a pig pituitary gland occurring alpha-amidointientsyymiaktiivisuuden. Entsyymiä sisältävä sian aivolisäkkeen 10 valmiste pystyy muuntamaan peptidit, jotka päättyvät glysiiniin vastaavaksi desglysii-nipeptidiamidiksi. 10 is made of porcine pituitary containing the enzyme is able to convert peptides that terminate with glycine to the corresponding desglysii-nipeptidiamidiksi. Bradbury et ai. Bradbury et al. myöntävät kuitenkin, että valmisteet eivät amidoi peptidejä tai polypeptidejä, jotka on puhdistettu luonnollisista lähteistä: "An assay system for detecting and estimating amidating activity in pituitary was obtained by examining the ability of enzyme preparations to convert the synthetic tripeptide Dtyrosylvalyl-15 glycine to the corresponding dipeptide amide Dtyrosylvaline amide...The D-tyrosine residue conferred stability against degradation by aminopeptidases present in tissue homogenates...Control experiments showed that when synthetic...D-tyrosylvaline amide was incubated in the same conditions it was slowly degraded. Thus the formation of the dipeptide amide by the pituitary enzyme is followed by its destruction by other enzymes 20 present in the pituitary extract." admit, however, that the products do not amidoi peptides or polypeptides that have been purified from natural sources: "An assay system for detecting and estimating an amidating activity in the pituitary was Obtained by examining the Ability of enzyme preparations to convert the synthetic tripeptide Dtyrosylvalyl-15 glycine to the Corresponding dipeptide amide amide Dtyrosylvaline ... The D-tyrosine residue conferred stability against degradation by aminopeptidases present in tissue homogenates Control experiments showed ... That when synthetic ... Dtyrosylvaline amide was incubated in the same conditions it was slowly degraded. tHUS the formation of the dipeptide amide by the pituitary enzyme is Followed by its destruction by enzymes other 20 present in the pituitary extract. " (s. 686). (P. 686). (Analyysijäqestelmä amidointiaktiivisuuden :: ilmaisemiseksi ja arvioimiseksi aivolisäkkeessä saatiin tutkimalla entsyymivalmisteiden •, ”: kykyä muuntaa synteettinen tripeptidi D-tyrosyylivalyyliglysiini vastaavaksi dipepti- • · · • 1diamidiksi, D-tyrosyylivaliiniamidiksi...D-tyrosiinitähde antoi stabiiliuden kudoshomo- ψ · :, ii genaateissa läsnäolevien aminopeptidaasien aiheuttamaa hajottamista vastaan. Kontrol- I · · : 25 litutkimukset osoittivat, että kun synteettistä...D-tyrosyylivaliiniamidia inkuboitiin sa- I t » ·' 1 moissa olosuhteissa se hajosi hitaasti. Siten dipeptidiamidin muodostumista aivolisäke- entsyymin avulla seuraa sen hajottaminen muilla aivolisäkeuutteessa läsnäolevilla ent- • · · syymeillä). (Analyysijäqestelmä amidointiaktiivisuuden :: detecting and evaluating the pituitary was obtained by examining the enzyme preparations • ": the ability to convert the synthetic tripeptide D-tyrosyylivalyyliglysiini the corresponding dipeptide • • 1diamidiksi · ·, D-tyrosyylivaliiniamidiksi ... D-tyrosine residue gave on tissue stability · ψ: ii homogenates in the presence of aminopeptidases induced degradation against a control, I · ·. 25 studies the indicated that the synthetic ... D tyrosyylivaliiniamidia were incubated with the same I t "·" one same conditions it broke slowly dipeptidiamidin Thus, the formation of the pituitary enzyme it. decomposition of other pituitary extract present in the enzyme • · · enzymes).

· ' · ' 30 Siten Bradbury et ai. · '·' 30 Thus, Bradbury et al. myöntävät, että esitetyt valmisteet sisältävät muita proteolyyttisiä acknowledge that the preparations shown contain other proteolytic

t « I t «I

' ' entsyymejä, jotka hajottavat peptidit tai polypeptidit ja että luonnossa esiintymätöntä D- • 1.: tyrosiinitähdettä oli käytettävä tällaisen hajottamisen minimoimiseksi. '' Enzymes that degrade peptides or polypeptides, and naturally-occurring D-1 • .: tyrosine residues was used to minimize such degradation.

» 1 1 • · 5 110433 »1 5 1 • · 110433

Edelleen Bradbury et ai. Further, Bradbury et al. opettavat homogenoituiin tai subsellulaarisen fraktionnin käyttöä ja tämän jälkeen suoritettavaa geelisuodatuskromatografiaa amidointientsyymin puhdistamiseksi, joka eittämättä on edelleen epäpuhdas proteolyyttisten entsyymien johdosta. The homogenized or teach the use of the subcellular fraction, and subsequently by gel filtration chromatography to purify amidating enzyme, which is admittedly still impure due to proteolytic enzymes.

5 5

Husain, I. ja Ta te. Husain, I., and Ta te. SS, FEBS Letters, Voi. SS, FEBS Letters, Vol. 152, #2,1983, s. 277 - 281 esittävät alfa-amidointiaktiivisuuden, joka on läsnä naudan aivolisäkkeen neurosekretorisissa jyväsissä. 152, # 2.1983, pp 277 -. 281 show the alpha-amidointiaktiivisuuden that is present in bovine pituitary neurosecretory granules.

io Eipper et ai., PNAS Voi. io Eipper et al., PNAS, Vol. 80,1983, s. 5144 - 5148 esittävät alfa-amidointientsyymi-aktiivisuuden, joka on läsnä rotan aivolisäkkeen etu-, keski-ja takalohkossa ja naudan aivolisäkkeen keskilohkossa. 80.1983, p 5144 -. 5148 disclose alpha-amidating enzyme activity is present in the rat pituitary anterior, intermediate and posterior pituitary lobe and bovine middle block. Kuitenkin tässä viitejulkaisussa opetetaan ainoastaan synteettisen D-Tyr-Val-Gly-substraatin käyttöä valmistettujen tuotteiden epäpuhtauden tunnistamiseksi alfa-amidointiaktiivisuuden suhteen. However, this reference is taught merely to identify the impurity products use synthetic D-Tyr-Val-Gly substrate made of alpha-amidointiaktiivisuuden relationship.

15 15

Gomez et ai., FEBS Letters, Voi. Gomez et al., FEBS Letters, Vol. 167, #1,1984, s. 160 - 164, ovat määrittäneet, että rotan hypotalamus sisältää myös alfa-amidointiaktiivisuuden. 167, # 1.1984, pp 160 -. 164, have determined that rat hypothalamus also contains alpha-amidointiaktiivisuuden.

Bradbury, AF, Smythe, DG, julkaisussa Peptides Structure and Function: Procee-20 dings of the Eighth American Peptide Symposium, s. 249-52 (1983), julkaisijat Hruby, VJ ja Rich, DH, esittävät alfa-amidointientsyymiaktiivisuuden läsnäolon rotan kilpi- • · . Bradbury, AF, Smythe, DG, in Peptides Structure and Function: Procee-20 dings of the Eighth American Peptide Symposium, pp 249-52, (1983), published by Hruby, VJ and Rich, DH, disclose alpha-amidointientsyymiaktiivisuuden the presence of rat thyroid. - • ·. : rauhasessa. : Gland.

I · · > * • · * = ' ' Mains RE et al., Endocrinology, Voi. I · ·> * • · * = '' Mains RE, et al., Endocrinology, Vol. 114,1984, s. 1522- 1530, ovat esittäneet, että * · · : ·' 25 hiiren aivolisäkkeen etulohkosta johdettu solukanta (ATT-20) sisältää alfa- • · * * * ' ' amidointientsyymiaktiivisuuden, joka selvästi pienenee vähitellen viljelyssä. . 114.1984, p 1522 1530, have suggested that * · · · "25 derived from a mouse anterior pituitary cell strain (ATT-20) • · contains alpha * * * '' amidointientsyymiaktiivisuuden, which clearly decreases gradually growing.

• » · • * · ' Rauhaset tai elimet, joiden tiedetään sisältävän amidoituja peptidejä, voivat sisältää ent- t '! • »* • · · 'glands or organs, which are known to contain amidated peptides may contain the enzyme t'! ' syymin, joka pystyy katalysoimaan amidointireaktiota. 'Enzyme capable of catalyzing the amidation reaction. Esimerkiksi O'Donohue TL, et 30 ai., Peptides 3, 1982, s. 353 -395, ovat esittäneet, että alemmat elämän muodot, kuten • · * ·; For example, the TL O'Donohue et 30 al, Peptides 3, 1982, pp 353 -395, have suggested that the lower forms of life, such as: • · · *..; ' koirahai fSqualus acanthi as), sisältävät amidoituja peptidejä aivolisäkeuutteissa. 'Koirahai fSqualus ACANTHA AS), amidated peptides include pituitary extract. Schel- 1 '.· ler, RH et ai., Cell, Voi. Schel- 1 '. · Ler, RH et al., Cell, Vol. 32,1983, s. 7 - 22, ovat esittäneet amidointisignaalipeptidien 32.1983, p 7 -. 22, submitted amidointisignaalipeptidien

t II t II

' · * · läsnäolon merietanassa, Anlvsiassa. '· * · Presence of sea snail, Anlvsiassa. Huolimatta tämän aktiivisuuden ilmeisestä läsnä- 6 110433 olosta kaikkialla luonnossa entsyymin fysikaalis-kemiallisista ominaisuuksista on julkaistu vähän informaatiota. Despite the apparent activity in the presence of 6 110433 existence throughout nature of the enzyme physico-chemical properties of the publication bit of information. Tämä voi johtua entsyymin hyvin alhaisista tasoista näissä neuroendokriinisissä elimissä. This may be due to the very low levels of the enzyme in these neuroendocrine organs.

5 Amidoitujen peptidien läsnäolo erityisessä kudoksessa ei ole välttämättä samanmerki-tyksinen alfa-amidointientsyymin korkeiden tasojen kanssa. 5 The presence of amidated peptides in a specific tissue does not necessarily with samanmerki-TYKS alpha-amidating enzyme to high levels. Esimerkiksi rotan etuaivo-lisäkekudos sisältää korkean alfa-amidointiaktiivisuuden, mutta ei mitään tunnettuja substraatteja (Eipper et ai., PNAS 80, 5144 - 5148,1983). For example, in the forebrain of the rat-lisäkekudos contains a high alpha-amidointiaktiivisuuden, but no known substrates (Eipper et al, PNAS 80, 5144 -. 5148.1983). Rotan taka-aivolisäkekudos sisältää amidoituja peptidejä (oksitosiiniä ja vasopressiiniä), mutta sillä on hyvin pieni 10 alfa-amidointiaktiivisuus (Eipper et ai., Endo 116,2497 - 2504,1985). Rat rear aivolisäkekudos contains amidated peptides (oxytocin and vasopressin) but has very little alpha-amidointiaktiivisuus 10 (Eipper et al, Endo 116.2497 -. 2504.1985). Tästä syystä ennen kuin kudokset on testattu alfa-amidointiaktiivisuuden suhteen, entsyymin läsnäoloa tai mahdollisia tasoja ei voida ennustaa. For this reason, before the tissue is tested for alpha-amidointiaktiivisuuden respect to the presence of the enzyme or potential levels can not be predicted.

Tämän keksinnön tehtävänä on saada aikaan alfa-amidointientsyymikoostumuksia, jot-15 ka voivat tuottaa tehokkaasti alfa-amidoituja tuotteita jopa substraateista, jotka sisältävät L-aminohappoja, kuten peptidi- tai polypeptidisubstraateista, jotka on puhdistettu luonnollisista lähteistä tai valmistettu yhdistelmä-DNA-tekniikalla. The object of the invention is to provide an alpha-amidointientsyymikoostumuksia, jot ka-15 can efficiently produce the alpha-amidated products up to substrates that contain L-amino acids, such as peptide or polypeptide substrates, which are purified from natural sources or produced by recombinant DNA technology.

Edelleen tehtävänä on saada aikaan tehokkaat ja kustannuksiltaan halvat menetelmät 20 entsymaattisten koostumusten valmistamiseksi. A further object is to provide a cost-effective and cheap methods for the preparation of 20 enzymatic compositions.

• · • · · · .' • • · · · ·. ' *: Näistä saadaan edelleen aikaan monoklonaalisia vasta-aineita, jotka ovat alfa- M · • V amidointientsyymille spesifisiä, ja immobilisoituja vasta-aineita, puhdistushartseja, :. * These further provides monoclonal antibodies that are alpha · M • V amidation enzyme specific, immobilized antibodies puhdistushartseja,. ii immunoaffiniteetti-pylväitä ja vastaavia, joissa käytetään näitä vasta-aineita alfa- • · · • · · : 25 amidointientsyymin puhdistamiseksi tehokkaasti. ii immunoaffinity columns, and the like, using these antibodies to alpha • • · · · · 25 for cleaning the amidation enzyme effectively.

• · · • · · • · · • · · • · · • · ·

Edelleen tehtävänä on saada aikaan geneettisesti manipuloituja isäntäsoluja, jotka pys- tl» • * * ;,. A further object is to provide genetically engineered host cells which are capable ts »• *;. * tyvät alfa-amidointientsyymin ilmaisuun suurella saannolla. * Tyvät alpha-amidating enzyme in high yield expression.

» · tl» ' ·' · ' 30 Tämän keksinnön tehtävänä on edelleen valmistaa alfa-amidoituja tuotteita substraateis- • · * ; »· Ts" '·' · '30 task of this invention is prepared from an alpha-amidated products of substrates • · *; · * ta, jotka sisältävät C-terminaalisen glysiinitähteen, saattamalla substraatti reagoimaan » » · : '.· entsyymikoostumuksenläsnäollessa. · * O, which contain a C-terminal glycine residue, by reaction of the substrate "" · '· enzyme composition in the presence of..

• I · 7 110433 I Nämä ja muut tehtävät selviävät seuraavasta yksityiskohtaisesta selityksestä. • I · 7 110433 I. These and other objects will become apparent from the following detailed description. Keksinnön mukaisesti hakijat saavat aikaan riittävän puhtauden omaavia uusia alfa-amidointientsyymikoostumuksia, joiden spesifinen alfa-amidointiaktiivisuus on vähintään n. 25 mU/mg proteiinia ja etenkin yli 50 tai yli 150 mU/mg proteiinia. According to the invention the applicants provide a sufficient purity having new alpha-amidointientsyymikoostumuksia having a specific alpha-amidointiaktiivisuus of at least approx. 25 mU / mg protein and preferably more than 50 or more than 150 mU / mg protein. Kaikki tässä 5 esitetyt spesifisen aktiivisuuden yksiköt perustuvat dansyyli-D-Try-Val-GlyCOOH:n dansyyli-D-Tyr-Val-CONH2:ksi tapahtuvaan muuntoon. All specific activity units set in five of dansyl-D-Try-Val-GlyCOOH the dansyl-D-Tyr-Val-CONH 2 KSI conversion taking place. Yksi mU on määritelty aktiivisuuden määräksi, joka tarvitaan dansyyli-D-TyrVal-Gly-COOH:n yhden nanomoolin (nmooli) muuntamiseksi dansyyli-D-Tyr-Val-CONH2:n yhdeksi nmooliksi/min. One mU of activity is defined as the amount required for dansyl-D-TyrVal-Gly-COOH of one nanomole (nmole) into a dansyl-D-TyrVal-CONH2 one nmol / min.

37 °C:ssa ja pH-arvossa 7,0 askorbaatti-ionien läsnäollessa 3 mM konsentraatiossa (ροζ ö rustuen koko reaktioseokseen mukaanlukien entsyymi, substraatti, kofaktorit jne.), mo- lekyylihapen läsnäollessa mooliylimääränä substraatin suhteen ja kupari(II)-ionien konsentraatiossa, joka pystyy maksimoimaan aktiivisuuden (tavallisesti n. 2 μΜ riippuen entsyymin puhtaustilasta). 37 ° C and at pH 7.0 ascorbate ions in the presence of 3 mM concentration (ροζ o on total reaction mixture including enzyme, substrate, co-factors etc.), mono lekyylihapen the presence of a molar excess relative to a substrate, and copper (II) ions in a concentration which is able to maximize activity (usually approx. 2 μΜ depending on the state of purity of the enzyme).

is Keksinnön mukaisen DNA-sekvenssin koodaama alfa-amidointientsyymi, peptidyyli- glysiini-alfa-amidointimono-oksygenaasi, pystyy katalysoimaan peptidyyliyhdisteen muuntoa, jossa on glysiinitähde ainakin peptidiketjun C-päätteessä, vastaavaksi pepti- dyyliamidiyhdisteeksi, jossa on aminoryhmä C-terminaalisen glysiinin tilalla. The DNA sequence of the invention is encoded by the alpha-amidating enzyme, peptidyl glycine alpha-amidointimono-oxygenase is capable of catalyzing the conversion of peptidyl, wherein the peptide has a glycine residue at least at the C terminus, to the corresponding peptide dyyliamidiyhdisteeksi, wherein the amino group is the C-terminal glycine in the farm. Tässä käytettynä käsite "peptidiketju" tarkoittaa polypeptidiä, jossa on vähintään kaksi amino- 20 happoa, jotka on liitetty yhteen peptidisidoksella. As used herein, the term "peptide chain" means a polypeptide comprising at least two amino acid 20, which are joined together by a peptide bond. Käsite "peptidyyliyhdiste" tarkoittaa . The term "peptidyl" means. : yhdistettä, jossa on peptidiketju. The compound having a peptide chain. Käsite "vastaava peptidyyliamidi" tarkoittaa reak- • · •. The term "corresponding peptidyl amide" refers to a reaction • · •. ' : tiotuotetta, joka substituoi aminoryhmän peptidiketjun C-terminaalisen glysiinin tilalle. 'Reaction product, which substitutes in place of the C-terminal glycine amino group of the peptide chain.

• · · • · • ♦ tl* '«' ' Edullisesti alfa-amidointireaktio tapahtuu hapen ja pelkistysaineen läsnäollessa. • · · · • • ♦ * ts '' '' Preferably, the alpha-amidation reaction take place in the presence of oxygen and a reducing agent. Sopivia « * · « · * : ; Suitable «* ·« · *; * 25 pelkistysaineita ovat esim. askorbiinihappo, askorbiinihapposuolat, dihydroksifumaraat- • I · ·* ti, metallisyanidiyhdisteet ja tetrahydropteriini. * 25 reducing agents are e.g. ascorbic acid, askorbiinihapposuolat, dihydroksifumaraat- • * · I · t, metallisyanidiyhdisteet and tetrahydropterin. Määrättyjen kofaktoreiden on todettu . Of certain co-factors have been found. . . edistävän reaktion kulkua ja/tai hidastavan entsyymin hajoamista tai inaktivoitumista. promoting decomposition or inactivation of the course of the reaction and / or slow the enzyme.

!.. ' Näitä kofaktoreita ovat mm. ! .. 'These co-factors are mm. katalaasi, etanoli, kaliumj odidi ja kupari(II)-ionit. catalase, ethanol, kaliumj iodide and copper (II) ions. Keksin- ' · ' nön mukaisen menetelmän avulla saadut puhdistetut entsymaattiset koostumukset ovat » · · 30 etenkin riittävän vapaita proteolyyttisestä aktiivisuudesta, joka pystyy hajottamaan joko • · alfa-amidointientsyymin tai alfa-amidointireaktion tuotteet tai lähtöaineet, niin että ent- II » i *. In the invention '·' the method of the non-purified enzymatic compositions are obtained »· 30 · especially sufficiently free of proteolytic activity capable of degrading either • · alpha-amidating enzyme, or alpha-amidation reaction products or starting materials, so that the enzyme II» i *. ' symaattiset koostumukset voivat katalysoida alfa-amidointireaktiota, vaikka substraatti • · » · * ' · ' · ja tuote koostuvat L-aminohapoista. 'The enzymatic compositions can catalyze the alpha-amidation reaction, even if the substrate · • "· *' · '· and a product composed of L-amino acids. Amidointireaktioseoksen proteolyyttinen aktiivi- 8 110433 suus ei voi heijastaa suoraan proteaasin konsentraatiota. The proteolytic activity of Amidointireaktioseoksen 8 110433 content may not directly reflect the concentration of the protease. Aktiivisuutta, jopa korkeissa proteaasikonsentraatioissa, voidaan hillitä, esimerkiksi erilaisten inhibiittoreiden vaikutuksella. The activity, even at high proteaasikonsentraatioissa, may be contained, for example, the effect of different inhibitors. Proteolyyttisen aktiivisuuden puute, joka lisää entsymaattisen koostumuksen kaupallista ja käytännön toivottavuutta L-aminohapoista koostuvien substraattien kans-5 sa tapahtuvaa käyttöä varten, ei vähennä millään tavoin koostumuksen käyttökelpoisuutta substraattien kanssa, jotka eivät sisällä L-aminohappoja. lack of proteolytic activity which increases the enzymatic composition of the commercial and practical desirability of L-amino acids consisting of substrates with SA-5 for use in, does not reduce in any way the usefulness of the composition with the substrate, which do not contain L-amino acids.

Kuten yksityiskohtaisessa selityksessä on esitetty, hakijat ovat puhdistaneet useita spesifisiä proteiineja, joilla on olennainen alfa-amidointiaktiivisuus. As shown in the detailed description is, applicants have purified a number of specific proteins, which is an essential alpha-amidointiaktiivisuus. Tässä käytetty käsite 10 "alfa-amidointiaktiivisuus" tarkoittaa aktiivisuutta, joka pyrkii jättämään ainoastaan aminoryhmän asemaan, joka oli aikaisemmin varattu substraattipeptidyyliyhdisteen C-terminaalisella glysiinillä. As used herein, the term 10 "alpha-amidointiaktiivisuus" means an activity that tends to leave only the position of the amino group, which had previously been reserved for substraattipeptidyyliyhdisteen the C-terminal glycine. Tällainen substituutio voi vaatia glysiinin kaikkien paitsi aminoryhmän lohkaisua, niin että ainoastaan aminoryhmä jää asemaan, joka oli aikaisemmin varattu koko glysiiniosalla. Such substitution may be required for all but the amino group of glycine cleavage, so that only an amino group remains the position that was previously occupied the entire glysiiniosalla. Tässä käytettynä "alfa-amidointientsyymi" tarkoit-15 taa koostumusta tai yhdistettä, jolla on alfa-amidointiaktiivisuus, ja niiden aktiivisia homologeja ja fragmentteja. As used herein, "alpha-amidating enzyme" mean 15-TAA composition or compound which is an alpha-amidointiaktiivisuus, and their homologs and active fragments thereof.

Tämän keksinnön mukaisesti saadut entsymaattiset koostumukset voidaan puhdistaa homogeenisiksi. enzymatic compositions obtained in accordance with the present invention may be purified gay gene therefore. Tässä käytettynä "homogeeninen" tarkoittaa entsyymivalmisteita, joilla 20 on yksi ainoa, hyvin määritelty kaista elektroforeesin jälkeen, joka suoritetaan natrium- ,, | As used herein, a "homogeneous" refers to enzyme preparations with 20 of a single, well-defined band following electrophoresis, which is carried out with sodium ,, | · dodekyylisulfaatti/polyakryyliamidigeelillä, ja joilla on yhdet ainoat aminohappose- •.' · Dodecyl sulfate / polyacrylamide gel, and with one single amino acid •. ' ': kvenssitiedot yleisten sekvenssointimenetelmien mukaisesti. 'In accordance with the general kvenssitiedot the sequencing.

• » i.: Keksinnön mukaisen DNA-sekvenssin koodaamalla alfa-amidointientsyymillä, joka on t · · » · * : ·' 25 puhdistettu homogeeniseksi, on spesifisenä entsyymiaktiivisuutena yli n. 1500 mU/mg * · * proteiinia. • "I .: The DNA sequence of the invention encoding the alpha-amidating enzyme, which is a · T ·» · * · '25 gay purified homogeneous, has a specific enzyme activity of more than 1500 mU / mg protein * · *..

• * • · · ;.. * Tämän keksinnön mukaisen DNA-sekvenssin koodaaman entsyymin sisältäviä • ♦ 11 * valmistettuja entsymaattisia koostumuksia voidaan käyttää käyttökelpoisten alfa- • · i * * ' · * · * 30 amidoitujen tuotteiden valmistamiseksi käyttämällä entsymaattisia koostumuksia ia · • * ' ·; • * • · ·; .. * according to the present invention containing the DNA sequence of the enzyme encoded • ♦ 11 * enzymatic compositions prepared may be useful to use alpha · i • * * '* · · * 30 for the preparation of amidated products by using the enzymatic compositions ia · • * '·; ·' tällaisten tuotteiden alfa-amidoinnin katalysoimiseksi. · 'Of such products to catalyze the alpha-amidation. Saadaan aikaan substraatti, joka • '. Providing a substrate, which • '. · on peptidyyliyhdiste, jossa on glysiinitähde ainakin peptidinketjun Cpäätteessä, jolloin :. · Is peptidyl having a glycine residue at least peptidinketjun Cpäätteessä, wherein:. ' ·; '·; C-terminaalisen glysiinitähteen substituutio aminoryhmällä saa aikaan halutun tuotteen. C-terminal glycine residue substitution of an amino group provides the desired product.

Substraatti saatetaan reagoimaan, etenkin hapen ja pelkistysaineen läsnäollessa, tämän 9 110433 tetaan reagoimaan, etenkin hapen ja pelkistysaineen läsnäollessa, tämän keksinnön mukaisesti valmistetun entsymaattisen koostumuksen läsnäollessa riittävän pitkäksi ajaksi peptidyyliyhdisteen muuntamiseksi vastaavaksi peptidyyliamidiksi. The substrate is reacted, especially oxygen and a reducing agent in the presence of the 9 110433 is reacted, especially oxygen and a reducing agent in the presence of catalyst, prepared in accordance with the present invention in the presence of an enzymatic composition for a time sufficient to convert the peptidyl corresponding peptidyl amide. Muuntuminen alkaa olennaisesti substraatin ja entsyymin ensikosketuksessa, mutta reaktionopeus vaihtelee 5 huomattavasti pH-arvon, lämpötilan, substraatin identtisyyden, kofaktoreiden konsent-raation ja muiden parametrien mukaisesti, jotka voidaan säätää tunnetulla tavalla reaktion optimoimiseksi. The transformation begins with substantially the enzyme substrate and the first contact, but the reaction rate will vary greatly according to 5 in pH, temperature, identity of the substrate, a cofactor, a concentrated concentration and the other parameters that can be adjusted in a known manner to optimize the reaction. Reaktion annetaan edetä tavallisesti aikajakson ajan, joka on valittu halutun muuntoprosentin (substraatin mummon tuotteeksi) mukaisesti. The reaction is allowed to proceed normally a period of time which is selected according to the desired conversion rate set (granny substrate product). Edullisissa suoritusmuodoissa kofaktoreita, kuten edellä mainittuja, käytetään reaktion edistämiseksi ίο ja/tai entsyymin aktiivisuuden parantamiseksi tai vahvistamiseksi. In preferred embodiments, co-factors, as mentioned above, is used to promote the reaction ίο and / or to improve or strengthen the activity of the enzyme.

Voidaan valmistaa useita käyttökelpoisia tuotteita, mukaanlukien luonnollisia hormoneja ja vastaavia, joille alfa-amidointi on edullista tai välttämätöntä, saattamalla glysiinillä pidennetyt peptidyyliyhdisteet reagoimaan tämän keksinnön mukaisesti saatujen alfa-15 amidointientsyymikoostumusten läsnäollessa. It can be prepared by a number of useful products, including natural hormones and the like, to which the alpha-amidation is preferable or necessary, by reacting a glycine-extended peptidyl reacted in accordance with the present invention from the alpha-15 amidointientsyymikoostumusten acid. Näitä tuotteita, joita voidaan käyttää esimerkiksi maanviljelyksessä tai hoidettaessa sairauksia, joille on luonteenomaista hormonaaliset vajaukset, ovat mm. These products, which can be used for example in agriculture or in the treatment of diseases characterized by hormonal deficiencies in, include. erilaiset kalsitoniinit, kasvuhormonia vapauttavat tekijät, kalsitoniinigeenin sukuiset peptidit ja vastaavat. various calcitonins, growth hormone-releasing factors, calcitonin-gene-related peptides, and the like. Hormonit, joihin tässä viitataan, kuten edellä mainitut kalsitoniinit, kasvuhormonia vapauttavat tekijät ja kalsitoniinigee-20 nin sukuiset peptidit, sisältävät C-terminaalisia amidiproteiineja, jotka ilmaisevat maini-,, · · tun hormonin luonteenomaisen aktiivisuuden, kuten alan ammattihenkilölle on selvää. Hormones referred to herein such as the above-mentioned calcitonins, growth hormone releasing factors and calcitonin gene-related peptides 20 Nin, containing C-terminal amidiproteiineja indicative of said ,, · · tun characteristic hormone activity, such as the person skilled in the art.

Esimerkiksi kalsitoniini sisältää kaikki lajit, jotka ilmaisevat kalsiumin oton säädön * ' .* luuhun, mikä on luonteenomaista tunnetuille kalsitoniineille. For example, calcitonin includes all events that indicate the uptake of calcium regulation * '. * Bone that is characteristic of the known calcitonin. Tässä esitettyjen eri prote- i * different protein disclosed herein, R *

I t I I t |

! ! *! *! * iinilajien homologit sisältyvät lajien määritelmiin ja tässä esitetyt nukleotidisekvenssit I « I » * » • ' ' 25 tai aminohapposekvenssit sisältävät homologiset sekvenssit, joissa substituutiot, additiot > 1 9 ' ' ' tai deleetiot eivät vaikuta aineellisesti esitetyn sekvenssin tuottamaan toimintaan. * Iinilajien homologs included in the definitions of the species, and nucleotide sequences disclosed herein I "I" * "• '' or 25 include amino acid sequences homologous sequences with substitutions, additions of> 1 9 '' 'or deletions do not affect the substance of the sequence shown in producing activities. Edul- , , lisesti vähintään 40 % ja etenkin 50 % peptidin aminohapoista vastaavat esitettyjä. Preferably,, received at least a 40%, in particular 50% of the amino acids of the peptide corresponding section. Nuk- » I » » » » i..' leotidisekvenssien suhteen kodonit voi olla tietenkin substituoitu ekvivalenttisilla kodo- > · * I ' neilla, jotka koodaavat samoja aminohappoja. The nucleic »I» »» »i .. 'in terms of their nucleotide codons can of course be substituted with equivalent codons> · * I' recess, on that encode the same amino acids.

I · I * » II * * * 30 I 1 * t * ' ·; I · I * »* II * I 30 * 1 * v * '·; * ' Keksinnön mukaisen DNA-sekvenssin koodaaman entsyymin sisältävien entsyymikoos- i · · i '. * 'According to the invention, the DNA sequence containing the enzyme encoded entsyymikoos- · i · i'. · tumusten kyky katalysoida alfa-amidointireaktiota jopa L-aminohappoja sisältävillä * » I > I t '. · Compositions ability to catalyze the alpha-amidation reaction even-containing L-amino acids * »i> I t '. * ' substraateilla mahdollistaa näiden tuotteiden tehokkaan ja kustannuksiltaan edullisen 10 110433 valmistuksen käyttämällä substraatteja, jotka on puhdistettu luonnollisista lähteistä tai valmistettu yhdistelmä-DNA-tekniikalla. * 'Substrates allows for the efficient and cost effective 10 110433 manufacture of such products by using the substrates, which is purified from natural sources or produced by recombinant DNA technology.

Määrätyissä edullisissa suoritusmuodoissa alfa-amidointireaktiota voidaan helpottaa 5 immobilisoimalla entsyymi kiinteällä kantoaineella, joka ei liukene vesipitoisiin väliaineisiin ja vastustaa hajoamista reaktio-olosuhteissa, ja ohjaamalla substraatti immobili-soidun entsyymin kautta, etenkin sopivien kofaktoreiden läsnäollessa. In certain preferred embodiments, the alpha-amidation reaction may be facilitated by immobilizing the enzyme 5-solid support that is insoluble in aqueous media, and resist degradation under the reaction conditions, and controlling the substrate through the Immobiline the enzyme-catalyzed, especially appropriate in the presence of cofactors. Tässä "immobili-sointi" tarkoittaa entsyymin sitomista substraattiin. This "immobili-tone" refers to binding of the enzyme to the substrate. Tähän tarkoitukseen sopivia kanto-aineita ovat esim. säätöhuokoslasi tai aktivoitu absorbantti, kuten syaanibromidilla aktiko voitu sefaroosi. Suitable for this purpose the support materials are e.g. säätöhuokoslasi or an activated absorbant such as cyanogen bromide sepharose been aktiko. Tällä tavalla immobilisoituja entsyymejä voidaan käyttää uudelleen poistamalla reaktioseos kiinteästä kantoaineesta, joka säilyttää entsyymin tulevaa käyttöä varten. In this way immobilized enzymes can be used again by removing the reaction mixture from the solid support, which is stored for future use of the enzyme.

Hakijat ovat havainneet, että edellä mainitut entsymaattiset koostumukset voidaan saada 15 ja puhdistaa useilla menetelmillä. Applicants have found that the enzymatic compositions can be obtained by the above-mentioned 15 and purified by several methods. On todettu, että medullaarinen kilpirauhaskarsinoo-makudos, joka on johdettu rotasta, sen solulinjoista ja/tai näistä solulinjoista johdetuista soluviljelyalustoista ovat etenkin haluttuja raa'an alfa-amidointientsyymin lähteitä. It has been found that the medullary kilpirauhaskarsinoo-makudos, which is derived from rat, the cell lines and / or cell lines derived from these cell culture media are particularly desired crude alpha-amidating enzyme sources. Epäpuhdas alfa-amidointientsyymi voidaan puhdistaa alistamalla raaka koostumus sekä kokoekskluusiokromatografiaan että anioninvaihtokromatografiaan, etenkin vahvaan . The crude alpha-amidating enzyme can be purified by subjecting the raw composition, as well as size exclusion chromatography and anion exchange chromatography, especially strong. 20 anioninvaihtokromatografiaan. 20 anion exchange chromatography. Tässä "vahva" anioninvaihtokromatografia tarkoittaa • * • t anioninvaihtokromatografiaa, joka suoritetaan hartsilla, joka säilyttää vakion positiivi- • · sen kokonaisvarauksen pH-alueella 2 -12. Here, the "strong" anion exchange means • * • s, anion exchange chromatography is performed with resins that maintains a constant positive • · the total charge in the pH range 2 -12. Määrätyissä edullisissa keksinnön suoritus- : muodoissa kokoekskluusiokromatografia on ennen vahvaa anioninvaihtokromatografiaa • · · • » « · :·,·. In certain preferred embodiments of the invention: forms, size exclusion chromatography is strong anion exchange chromatography before • · • · »« · · ·. ja kokoekskluusiokromatografiavaihetta voi edeltää vielä toinen anioninvaihtokromato- • · • · . and size exclusion chromatography steps may be preceded by yet another anion exchange • · • ·. ·: ·. ·: ·. 25 grafiavaihe. 25 pornography phase. Voi olla toivottavaa suorittaa toinen anioninvaihtokromatografiavaihe en- • · · simmäisen vaiheen jälkeen ja eräässä edullisessa suoritusmuodossa joko ensimmäinen ; It may be desirable to perform a second anion exchange en-• · · after the first stage and in a preferred embodiment, either the first; | | vahva anioninvaihtokromatografia tai toinen vahva anioninvaihtokromatografia suorite- • · • * *': taan emäksisessä pH-arvossa, kun taas toinen suoritetaan happamassa pH-arvossa. strong anion exchange chromatography or strong anion exchange chromatography is performed second · • • * * 'to basic pH, while the second is carried out at acidic pH.

II t • t • · · • · · • · . II t t • • · · · • · • ·. · · ·. · · ·. 30 Käyttämällä entsyymilajeja, jotka on olennaisesti puhdistettu homogeenisiksi, on val- .. *. 30 Using enzyme species which have been substantially purified gay gene, therefore, is manufactured .. *. mistettu entsyymille spesifisiä monoklonaalisia ja polyklonaalisia vasta-aineita käyttä- • » \ '. made of the enzyme specific monoclonal and polyclonal antibodies using • »\ '. mällä puhdistettua entsyymiä antigeeninä immuunireaktion esiintuomiseksi hiirissä ja vast, kanoissa. by the purified enzyme as an antigen to elicit an immune reaction in mice and, respectively, the chickens. Tällä tavalla jostakin lajista johdetut vasta-aineet voidaan puhdistaa ja π 110433 immobilisoida kiinteälle kantoaineelle entsyymille spesifisen immunoaffiniteettipylvään valmistamiseksi. In this way, derived from one species, antibodies can be purified and π 110433 immobilized on a solid support for the enzyme preparation of the specific immunoaffinity. Tätä pylvästä voidaan käyttää raa'an entsymaattisen aineen puhdistamiseksi, jolloin tuloksena saadaan entsyymin lisääntynyt tehokkuus ja uudelleenkäytettävyys. This column can be used to purify the crude enzymatic agent, resulting in an increased enzyme efficiency and reusability.

5 5

Alfa-amidointientsyymiä yhdessä sen tryptisten fragmenttien kanssa on sekvenssoitu tunnetuilla menetelmillä ja sekvenssitietoja on käytetty oligo- nukleotidikoetinten valmistamiseksi. The alpha-amidating enzyme in combination with the tryptic fragments have been sequenced by known methods and the sequence used for the preparation of oligo- nukleotidikoetinten. Käyttämällä tällä tavalla valmistettuja leimattuja oligonukleotidikoettimia hakijat ovat eristäneet alfa-amidointientsyymin koodaavan geenin cDNA-kiqastosta, 10 joka on syntetisoitu polyA RNArsta, joka on johdettu rotan medullaarisesta kilpirauhas-karsinoomakudoksesta. Use of labeled oligonucleotide probes made in this way, Applicants have isolated the alpha amidating enzyme gene encoding the cDNA kiqastosta, 10 which have been synthesized poly-derived RNA, which is derived from rat medullary thyroid carcinoma. Geeni, jota luonnehditaan yksityiskohtaisemmin tämän hakemuksen yksityiskohtaisessa selitysosassa, voidaan yhdistää sopivaan ilmaisuvektoriin ja siirtää isäntäsoluun, joka pystyy ilmaisemaan geenin. The gene, which is described in more detail in the detailed description section of this application may be combined in a suitable host an expression and transfer to a cell that can express the gene. Sopivia isäntiä ovat mm. Suitable hosts include. E. coli. E. coli. hiivakannat, kuten S. cerevisiae tai korkeammat eukaroyyttiset solut, kuten solulinja, is josta entsyymi alunperin on puhdistettu. yeast, such as S. cerevisiae, or higher eukaroyyttiset cells, such as cell line, which is the enzyme was originally purified. Kaupallista massatuotantoa voidaan helpottaa mikro-organismilla, joka on geneettisesti muodostettu yllä esitetyllä tavalla alfa-amidointientsyymin suurten määrien ilmaisemiseksi. Commercial mass production can be facilitated by a microorganism that has been genetically formed as described above to detect large amounts of alpha-amidating enzyme.

Entsyymien kaupallista massatuotantoa luonnollisista lähteistä voidaan helpottaa puh- . Commercial mass production of enzymes from natural sources to facilitate cleaning. 20 distusmenetelmillä, jotka käsittävät sekä kokoekskluusiokromatografian että anionin- • · • · . 20 purification procedures, which encompasses both the size-exclusion chromatography on an anion • · • ·. ' vaihtokromatografian, j olioin anioninvaihtokromatografialla pidätetyt laj it eluoidaan • · . '-Exchange, anion-exchange chromatography j olioin arrested laj it is eluted with • ·. ' '·. '' ·. käyttämällä suolaliuosta, jonka konsentraatio on yli n. 250 mM ja etenkin 350 mM tai ; using a salt solution having a concentration of greater than about 250 mM, especially 350 mM, or.; , ·. ·. 500 mM. 500 mM. Korkeissa suolaliuoskonsentraatioissa eluoidaan useimmat pidätetyt entsyymi- • · · I · I · : ·. In high saline concentration is eluted with most of those arrested enzymes • · · I · I ·: ·. ·. ·. lajit. species. Kokoekskluusiokromatografia tulisi suunnitella siten, että eristetään lajit, joiden . Size exclusion chromatography should be designed to isolate species with. ':·. '·. 25 ilmeinen molekyylipaino on n. 58.000 - 67.000 daltonia ja etenkin n. 60.000 - 65.000 daltonia. 25 an apparent molecular weight of about 58,000 -. 67,000 daltons, and preferably about 60,000 -. 65,000 Daltons. Puhdistettu valmiste pystyy amidoimaan peptidyyliyhdisteen, joka on puhdis- : ' ·, · tettu luonnollisista lähteistä tai valmistettu yhdistelmä-DNA-tekniikalla, so L- • · • ' “: aminohapoista koostuvat peptidit. The purified preparation is capable of amidation of peptidyl compounds that have been purified, '· · from their natural sources or produced by recombinant DNA technology, i.e. L · • •' "consisting of the amino acids, peptides.

• · * * · * • · . • · * * * · • ·. · · ·. · · ·. 30 Kuvioissa • · * · · . 30 Figures * • · · ·. Λ kuv. Λ FIG. I - V koskevat esimerkkiä 1 ja niitä selitetään myöhemmin lähemmin, • · '. I - V, for example 1 and will be explained later in more detail, • · '. '. '. kuv. Fig. VI - XII koskevat esimerkkiä 2 ja niitä selitetään myöhemmin lähemmin, • · · kuv. VI - XII of the example 2 and subsequently described in more detail, • · in FIG. XIII - XVI koskevat esimerkkiä 2 ja niitä selitetään myöhemmin lähemmin, 12 110433 kuv. XIII - XVI for Example 2 and are explained in more detail later, 12 110433 FIG. XVII - XXI koskevat esimerkkiä 4 ja niitä selitetään myöhemmin lähemmin, kuv. XVII - XXI for Example 4 and are explained in more detail later, Fig. XXII koskee esimerkkiä 10 ja sitä selitetään tässä lähemmin, ja kuv. XXII relates to Example 10 and is explained in more detail, and Fig. XXIII koskee esimerkkiä 6 ja sitä selitetään tässä lähemmin. XXIII relates to Example 6 and is explained in more detail here.

5 Nyt on havaittu, että homogeeninen alfa-amidointientsyymi voidaan saada monivaihe-menetelmällä käyttämällä kokoekskluusio- ja ioninvaihtokromatografiaa kiinteistä tuu-morikudosuutteista, tuumorisolulinjoista ja tällaisista solulinjoista peräisin olevista ku-dosvilj elyväliaineesta. 5 It has now been discovered that homogeneous alpha-amidating enzyme can be obtained by a multi-step method using ion exchange chromatography, size exclusion and the standard TUU morikudosuutteista, such tumor cell lines and cell lines derived from Ku-dosvilj elyväliaineesta.

io Entsyymi on uutettu rotan medullaarisista kilpirauhaskarsinoomeista ("MTCs"), jotka on kehitetty WAG/Rij Wistar-rotissa, kuten ovat esittäneet Roos, BA, et ai., Endocrinology, 1979, Voi. io The enzyme has been extracted from rat medullary thyroid carcinoma ( "MTCS") which are developed in WAG / Rij Wistar rats as described by Roos, BA, et al., Endocrinology, 1979, Vol. 150, #1, s. 27 - 32. Tämä kudos on talletettu nimikkeellä IVI-10028 (sittemmin ATCC 75168). 150, No. 1, pp 27 -. 32. This tissue has been deposited under the name IVI-10028 (now ATCC 75 168). Entsyymi on uutettu myös muista lähteistä, etenkin ihmisen ja rotan medullaarisista kilpirauhaskarsinoomasolulinjoista. The enzyme is extracted from other sources, particularly in human and rat medullary kilpirauhaskarsinoomasolulinjoista. Rotan solulinja 15 ("CA-77") johdettiin rotan medullaarisista kilpirauhaskarsinoomatuumoreista sarjatuo tannossa, kuten ovat esittäneet Muszynski, M. et ai., JBC 1983, Voi. The rat cell line 15 ( "CA-77") was derived from rat medullary kilpirauhaskarsinoomatuumoreista sarjatuo rol, as disclosed by Muszynski, M., et al., JBC 1983, Vol. 258, s. 11678-83. 258, pp. 11678-83. Tämä solulinja on talletettu nimikkeellä IVI-10029 (sittemmin ATCC CRL 10919). This cell line has been deposited under the title IVI-10029 (now ATCC CRL 10919).

Ihmisen solulinjan ("HTT 54(34)") kehitti BA Roos, VA Medical Center, Cleveland, Ohio, käyttämällä ihmisen medullaarisia kilpirauhaskarsinoomasoluja primaarista vilje-20 lyä varten. The human cell line ( "HTT 54 (34)") was developed by BA Roos at the VA Medical Center in Cleveland, Ohio using human medullary kilpirauhaskarsinoomasoluja primary vilje-20 for shuffling. Ihmisen solulinja HTT 54(34) on talletettu nimikkeellä IVI-10031 (sittem- • « "V min ATCC CRL 10918). (ks. "Recognition of the Deposit of Micro-Organisms for the • ·. ·. Purpose of Patent Procedure", j osta ilmenee nämä talletukset, ja "Budapest Notificati- : .·, on" No. 34, 3.11.1983, jotka ovat kokonaisuudessaan tässä viitteenä). The human cell line HTT 54 (34) has been deposited under the name IVI-10031 (Later the • «" V min ATCC CRL 10918). (See., "Recognition of the Deposit of Micro-Organisms for the • ·. ·. Purpose of Patent Procedure" , j is evident from these deposits and "Budapest Notificati-:. ·, is" No. 34, 3/11/1983, which are incorporated herein by reference in its entirety).

• # · * · · • · ;': 25 Sekä ihmisen että rotan solulinjoista peräisin olevien määriteltyjen kudosviljelyväliai- neiden on todettu sisältävän huomattavia alfa-amidointientsyymiaktiivisuuden tasoja, : ' 1.! • # * · · · · •, '25, both the human and rat derived cell lines specified in tissue culture instruments is found to contain significant levels of alpha-amidointientsyymiaktiivisuuden,' 1! mikä osoittaa, että osa entsyymistä eritetään soluista. which shows that the fraction of the enzyme is secreted from the cells. Entsyymi voidaan valmistaa ja • 1 ' ' I puhdistaa etenkin alistamalla ensin raaka materiaali (joka sisältää kulutettuja viljelyvä- .'. 1. liaineita, entsyymiä ja epäpuhtauksia) anioninvaihtokromatografiaan. The enzyme may be prepared and • 1 '' I, especially purified by subjecting the first raw material (containing the consumed in culture. '. 1 medium with the enzyme and impurities) anion-exchange chromatography. Näyte voidaan : “ '; The sample may be: ''; 30 esimerkiksi irtolastata preparatiiviseen anioninvaihtimeen, kuten dietyyliaminoetyyli- : · 1 >. 30 cargoes in bulk, for example, preparative anion exchanger, such as diethylaminoethyl: 1 ·>. ("DEAE") patruunaan, kuten CUNO 250, jota valmistaa CUNO Corp. ( "DEAE") cartridge such as CUNO 250, manufactured by CUNO Corp.

· · 13 110433 · · 13 110433

Patruunasta eluoitu alfa-amidointiaktiivisuuden sisältävä koostumus alistetaan sitten kokoekskluusiokromatografiaan hartsilla, jolla on sopiva erotuskyky, esimerkiksi erittäin hieno Sephacryl S-200, jota valmistaa Pharmacia Fine Chemicals. A composition comprising an alpha-amidointiaktiivisuuden eluted from the cartridge is then subjected to size exclusion chromatography on a resin having a suitable resolution such as very fine Sephacryl S-200, manufactured by Pharmacia Fine Chemicals.

5 Aktiivisuuden sisältävä eluenttifraktio alistetaan sitten ioninvaihtokromatografiaan käyttämällä vahvaa anioninvaihtomatriisia. Eluant fractions containing the 5 activity is then subjected to ion exchange chromatography using a strong anioninvaihtomatriisia. Hartsi, jota voidaan käyttää, on vahva Mono Q HR5/5-anioninvaihtohartsi, jota valmistaa Pharmacia Fine Chemicals, ja voidaan tarvita yksi tai useampi läpikulku pylväällä entsyymin puhdistamiseksi homogeeniseksi. The resin which can be used are strong Mono Q HR5 / 5 anion exchange resin, prepared by Pharmacia Fine Chemicals, and may require one or more through-flow column purification of the enzyme gene gay sex. Mono Q HR5/5-pylvään hiukkaskoko on 10 pm, sen ontelotilavuus on 40 % ja siinä on ίο geeli, jonka varattu ryhmä on CH2-N*-(0¾^ ja jonka ionikapasiteetti on 0,28 - 0,36 mmoles/ml. Mono Q HR5 / 5 column particle size of 10 microns, a void volume of 40%, and there is ίο gel whose charged group is -CH 2 -N * - (^ 0¾ and having an ionic capacity of 0.28 - 0.36 mmoles / ml.

Jokaista puhdistusvaihetta voidaan valvoa sekä proteiinipitoisuuden että alfa-amidointiaktiivisuuden tason suhteen. Each purification step can be monitored with respect to both the protein content of the alpha-amidointiaktiivisuuden level. Tätä informaatiota käytetään entsyymin spesifi-15 sen aktiivisuuden laskemiseksi, joka toimii entsyymin suhteellisen puhtauden indikaattorina. This information is used to calculate the activity specific for the enzyme-15, which is an indicator of the relative purity of the enzyme.

Tämän keksinnön mukaisesti puhdistetun peptidyyli-glysiinialfa-amidointimono- oksygenaasin (talletettu rotasta johdettu entsyymi, IVI-10032, sittemmin ATCC 75145; . 20 talletettu ihmisestä johdettu entsyymi, IVI-10033, sittemmin ATCC 75146) ilmeinen • · ' V. * molekyylimassa on n. 60.000 - 65.000 daltonia geelisuodatuksella määritettynä. According to the present invention, the purified peptidyl-glysiinialfa amidointimono--oxygenase (deposited rat derived enzyme, IVI-10032 and subsequently ATCC 75 145,. human enzyme derived from the deposit 20, IVI-10033 and subsequently ATCC 75146) · apparent • "V * the molecular mass of the . 60,000 - 65,000 daltons as determined by gel filtration.

• · • · · • · ; • · • · • · ·; . . ·, Entsyymi on puhdistettu siten, että sen spesifinen entsyymiaktiivisuus on vähintään n. ·, The enzyme is purified to a specific enzyme activity of at least about.

• · · • · · · : ·. • • · · · · · ·. ·. ·. 25 mU/mg proteiinia ja etenkin vähintään n. 50 mU/mg proteiinia. 25 mU / mg protein and preferably at least approx. 50 mU / mg protein. Etenkin spesifinen . In particular, specific. ·:'. · '. 25 aktiivisuus on yli n. 150 mU/mg proteiinia. 25 activity of more than approx. 150 mU / mg protein. Alfa-amidointientsyymi on puhdistettu myös siten, että sillä on yksi ainoa homogeeninen hyvin määritelty kaista elektroforee-: * ·.: sin jälkeen, joka suoritetaan natriumdodekyylisulfaatti/polyakryyliamidigeeleillä (SDS- PAGE). Alpha-amidating enzyme is purified in such a way that it has a single homogeneous well-defined band by electrophoresis: * · sin .: After that runs sodium dodecyl sulfate / polyacrylamide gels (SDS-PAGE).

. . ·". 30 Puhdistettua peptidyyli-glysiini-alfa-amidointimono-oksygenaasia käytetään terminaali- ,. '. sen glysiinitähteen sisältävän polypeptidin alfa-karboksyyliryhmän amidoimiseksi, joi- | · * /; loin glysiini toimii aminoryhmä-donorina. Substraattipeptidi tai -polypeptidi voidaan • · » • · puhdistaa luonnollisista lähteistä, syntetisoida sen aminohappokomponenteista tai vai- 14 110433 mistaa yhdistelmä-DNA-tekniikalla. Glysiiniin päättyvä polypeptidi yhdistetään hapen kanssa entsyymin tehokkaan määrän läsnäollessa. Vaadittava entsyymin määrä riippuu useista tällä alalla hyvin tunnetuista muuttujista, mukaanlukien etenkin mm. seuraavat: määrätyn entsyymivalmisteen spesifinen aktiivisuus, muunnettavan substraatin määrä ja 5 kemiallinen luonne, aika, jona muunto tapahtuu, ja reaktioseoksen lämpötila ja pH. . · "30 The purified peptidyl-glycine-alpha-monooxygenase amidointimono used in a terminal," a polypeptide having a glycine alpha-amidating a carboxyl group, Synergies | · * /,... I created glycine is an amino-donor substrate peptide or polypeptide can be • · "• · purified from natural sources, synthesized from the amino acid components or phase 14 110433 mistaa recombinant DNA technology. ending with glycine polypeptide is combined with oxygen an effective amount of an enzyme catalyst. the amount of enzyme required depends on the several well-known variables, including the particular example. the following Defined specific activity of the enzyme preparation, the number of converting the substrate 5 and the chemical nature, the time in which the conversion takes place, and the reaction temperature and pH.

Alan ammattihenkilöt tuntevat muita muuttujia, jotka voivat vaikuttaa entsyymin määrätyssä tilanteessa tarvittavaan tarkkaan määrään. The skilled person is familiar with other variables that may affect a given situation enzyme required for the exact amount. Happi on tavallisesti läsnä mooliylimääränä reaktiossa substraatin konsentraation suhteen. Oxygen is usually present in molar excess in the reaction relative to the substrate concentration. Kupari(II)-ionien haluttu konsentraatio voidaan järjestää jollakin kuparisuolalla, jonka anioni ei vaikuta jo haitallisesti reaktioon. The copper (II) ions in the desired concentration can be arranged in one of the copper salt whose anion does not already have an adverse effect on the reaction. Entsyymillä, jonka spesifinen entsymaattinen aktiivisuus on ainoastaan n. 1 mU/mg proteiinia, maksimaalinen alfa-amidointi tapahtuu kupari(II)-ionien suhteellisen korkealla konsentraatiolla, joka on n. 4 μΜ. The enzyme having a specific enzymatic activity of only approx. 1 mU / mg protein, maximum alpha-amidation occurs with copper (II) ions in a relatively high concentration, which is approx. 4 μΜ. Koska entsyymin puhtaus kasvaa, eksogeenisen kupari(II)-ionin konsentraatiovaatimukset pienenevät. Since the purity of the enzyme increases, the exogenous copper (II) ion concentration requirements are reduced. Entsymaattista aktiivisuutta voidaan lisätä myös askorbaatti-ionien läsnäololla, jotka is voidaan järjestää jollakin askorbiinihapposuolalla, niin kauan kuin suolan kationi ei vaikuta haitallisesti reaktioon. The enzymatic activity can also be increased by the presence of ascorbate ions which can be provided is one askorbiinihapposuolalla, as long as the cation of the salt does not adversely affect the reaction. Puhdistetun entsyymin kohdalla, jonka spesifinen entsymaattinen aktiivisuus on n. 50 mU/mg proteiinia, maksimaalinen alfa-amidointiaktiivisuus tapahtuu n. 5 mM askorbaatissa. The purified enzyme into a specific enzymatic activity of approx. 50 mU / mg protein, maximum alpha-amidointiaktiivisuus occurs approx. 5 mM ascorbate. Alfa-amidointiaktiivisuutta voidaan lisätä lisäämällä katalaasia. Alfa-amidointiaktiivisuutta can be increased by adding catalase. Optimaalinen pH biologisesti relevantin substraatin 20 muuntamiseksi amidoiduiksi tuotteiksi on 6,5 - 7,5. The optimum pH of biologically relevant substrate to amidated products 20 for conversion of 6.5 - 7.5.

.Entsyymiä vastaan suunnattuja monoklonaalisia ja polyklonaalisia vasta-aineita on saa-. monoclonal and polyclonal, directed against .Entsyymiä antibodies have been obtained. '•t tu käyttämällä homogeenista entsyymiä antigeeninä immuunireaktion tuottamiseksi '• s by employing a homogeneous enzyme as an antigen to produce an immune reaction,

I « I I «I

• · ' · hiirissä ja vast, kanoissa. • · '· and response in mice, chickens. Hakij at ovat valmistaneet sekä monoklonaalisia että polyklo- . Hakij have produced at both monoclonal and polyclonal. ·: \ 25 naalisia vasta-aineita esimerkissä 8 esitetyllä tavalla. ·: \ 25-functional antibodies as described in Example 8 manner. Alfa-amidointientsyymille spesi fisten vastaaineiden varastoja säilytetään hakijoiden laboratorioissa. The alpha-amidation enzyme speci fisten antibodies stocks stored laboratory of the applicants.

ia • · •' '1: Vasta-aineet voidaan immobilisoida kiinteälle matriisille, joka ei liukene väliaineisiin, • » a jossa sitä käytetään. IA · • • '' 1: Antibodies may be immobilized on a solid matrix which is insoluble in media • »a where it is used. Etenkin matriisi on sellainen, joka on kestävä hajoamisen suhteen. In particular, the matrix is ​​one which is resistant to breakdown relationship.

. . · ·. · ·. 30 Matriisi varustetaan funktionaalisella ryhmällä, joka pystyy sitomaan proteiinit, jolloin ,. The matrix 30 is provided with a functional group capable of binding proteins, wherein the. '. '. funktionaaliset ryhmät sidotaan sitten kovalenttisesti vasta-aineisiin. The functional groups are then covalently bound to the antibodies. Tällainen vasta- ' · t ': aineiden immobilisointi helpottaa α-amidointientsyymin eristämistä luonnollisista ja/tai rekombinanttilähteistä. Such antibodies '· t' to facilitate the immobilization of substances α-amidating enzyme isolation from natural and / or recombinant sources. Tämä suoritetaan sekoittamalla immobilisoidut vasta-aineet ent- 15 110433 syymin raakojen valmisteiden kanssa. This is accomplished by mixing the immobilized antibodies with the enzyme preparations of the crude enzyme 15 110433. Vasta-aineet sitovat spesifisesti a-amidointi-entsyymimolekyylit. The antibodies specifically bind to alpha-amidation enzyme molecules. Saastuttavat proteiinit eivät sitoudu vasta-aineisiin ja ne poistetaan helposti eluoimalla tai linkoamalla kevyesti. Contaminating proteins do not bind to antibodies and are readily removed by elution or by spinning lightly. Epäpuhtauksien poistamisen jälkeen a-amidointientsyymi voidaan poistaa immobilisoiduista vasta-aineista ionisen vahvuuden 5 tai pH:n muutoksilla tai lisäämällä kaotrooppisia ioneja ("Affinity Chromatography: Principles and Methods, Manual, Pharmacia Fine Chemicals, Uppsala, Ruotsi) ja ottaa talteen erittäin puhtaassa muodossa. After removal of impurities alpha-amidating enzyme can be removed by the immobilized antibody-5 or pH the ionic strength of the modifications or the addition of chaotropic ions ( "Affinity Chromatography: Principles and Methods, Manual, Pharmacia Fine Chemicals, Uppsala, Sweden) and recovered in a highly pure form.

Entsyymi on myös puhdistettu riittävästi sen aminohapposekvenssin määrittämiseksi. The enzyme is also cleaned sufficiently to determine its amino acid sequence. io Tätä informaatiota käytettiin entsyymin nukleiinihappokoodauksen eristämiseksi. io This information was used to isolate the enzyme nukleiinihappokoodauksen.

Tämän jälkeen liittäminen sopivaan yksisoluiseen organismiin tai isäntäsoluun, joka oli eristetty monisoluisesta organismista, suoritetaan vakioilla yhdistelmä-DNA-menetelmillä (ks. Maniatis, et ai., Molecular Cloning: A Laboratory Manual, Cold 15 Spring Harbor, 1982, tai Wu, R., julk., Methods in Enzymology, Vol. 68, Academic Press, 1979, jotka ovat tässä viitteenä). Then, connect the appropriate unicellular organism or host cell isolated from a multicellular organism, the constant in the recombinant DNA methods (see Maniatis et al, Molecular Cloning. A Laboratory Manual., Cold 15 Spring Harbor, 1982; or Wu, R., , ed., Methods in Enzymology, Vol. 68, Academic Press, 1979, which are incorporated herein by reference). Saatavat solut, jotka sisältävät alfa-amidointientsyymin heterologisen DNA-koodauksen, mahdollistavat entsyymin riittävän määrän valmistuksen in vitro translaation jälkeisen alfa-amidoinnin suorittamiseksi ja teoreettisesti nämä solut mahdollistavat peptidin tai polypeptidin tämän muunnon 20 suorittamisen in vivo. Available cells that contain alpha-amidating enzyme of the heterologous DNA coding allow to carry out a sufficient amount of enzymes for in vitro post-translational alpha-amidation and theoretically, these cells allow 20 the in vivo performance of a peptide or polypeptide of the conversion.

• ·. • ·. ·. ·. Vaikkakin tätä keksintöä on selitetty sen edullisten suoritusmuotojen yhteydessä, alan : . Although this invention has been described in connection with its preferred embodiments, those. *. *. ammattihenkilölle selviää useita muunnelmia ja modifikaatioita. the skilled person will survive several variations and modifications. Keksinnön edullisia • M t suoritusmuotoja selitetään edelleen seuraavien esimerkkien avulla. • M s preferred embodiment of the invention is further explained by the following examples.

• · :T: 25 • · T: 25

Esimerkki 1 • t • · • il MTC-tuumoreista valmistetun alfa-amidomtientsvvmivalmisteen puhdistusmenetelmä • · · ;''': 30 Jäädytetyt rotan MTC-tuumorit jauhettiin hyvin pieniksi fragmenteiksi ja homogenoitiin 150 mM Tris:ssä pH 7,5, joka sisälsi 250 mM sakkaroosia, 0,25 % N-asetyyli- • · : glukopyranosidiä, 0,1 mM PMSF:ä, 20 pg/ml pepstatiinia ja 100 pg/ml soijapaputryp- • · siini-inhibiittoria. Example 1 • T • • · IL produced MTC tumors alpha amidomtientsvvmivalmisteen purification process • · ·; '' ': 30 Frozen rat MTC tumors were ground into very small fragments and homogenized in 150 mM Tris pH 7.5, containing 250 mM sucrose, 0.25% n-acetyl • ·: glucopyranoside, 0.1 mM PMSF, 20 pg / ml pepstatin, and 100 pg / ml soijapaputryp- • · toxin inhibitor. Tavanomaisesti 25 g tuumorikudosta homogenoitiin 200 mkaan yllä 16 110433 esitettyä puskuria jäässä. Normally, 25 g of tumor tissue were homogenized in 200 ml of buffer described above 16 110433 ice. Homogenointi saatiin aikaan neljällä 20 sekunnin murskauksella, joissa käytettiin kulloinkin Polytron-homogenointilaitetta (Brinkman) säädössä 7. Homogenaattia lingottiin 15 minuutin ajan 9.000 g:ssä JA-20-roottorissa (Beckman) ja supematantti (Sup. 1) dekantoitiin. Homogenization was achieved by four 20-second crushing, using in each case a Polytron homogenizer (Brinkman) regulation of 7. The homogenate was centrifuged for 15 minutes at 9000 g and-20 rotor (Beckman) and the supernatant (Sup. 1) decanted. Pelletti homogenoitiin uudestaan 60 ml:ssa homo-5 genointipuskuria kolmen 20 sekuntia kestävän murskauksen ajan kulloinkin säädöllä 7. Tätä toista homogenaattia lingottiin samoin 15 minuutin ajan 9.000 g:ssä. The pellet was homogenized again in 60 ml of gay-5 genointipuskuria three 20-second crushing at each control 7. This second homogenate was similarly centrifuged for 15 minutes at 9000 g. Tämän linko-uksen supematantti (Sup.2) yhdistettiin Sup.l:n kanssa. This centrifuge blood flow supernatant (Sup.2) were combined Sup.l with. Yhdistettyjä Sup.l:täja Sup.2:ta lingottiin sitten 30 minuutin ajan 100.000 g:ssä SW28-roottorissa (Beckman) 4 °C:ssa. The combined Sup.l and antibodies Sup.2 was then centrifuged for 30 minutes at 100,000 g at SW28 rotor (Beckman) at 4 ° C. Selkeytettyyn homogenaattiin (Sup.3) lisättiin riittävä määrä ammoniumsul-10 faattikiteitä 25 %:isen liuoksen muodostamiseksi ammoniumsulfaatissa. The clarified homogenate (Sup.3) was added sufficient 10 ammoniumsul-sulfate crystals in 25% ammonium sulfate to form a solution. Kiteitä lisättiin asteittain 15 minuutin ajan sekoittaen tasaisesti homogenaattia 4 °C:ssa. The crystals were added gradually for 15 minutes, stirring steadily the homogenate at 4 ° C. Sekoitettiin edelleen 30 minuutin ajan 4 °C:ssa, sitten seosta lingottiin 15 minuutin ajan 27.000 g:ssä JA-20-roottorissa (Beckman) 4 °C:ssa. The mixture was stirred for a further 30 minutes at 4 ° C, then the mixture was centrifuged for 15 minutes at 27,000 g and-20 rotor (Beckman) at 4 ° C. Supematantti dekantoitiin ja supematant-tiin lisättiin lisää ammoniumsulfaattia liuoksen tekemiseksi 40%:iseksi ammoniumsul-15 faatissa. The supernatant was decanted and the supernatant added, the more ammonium sulfate was added to make the solution 40% ramp up ammoniumsul-15 faatissa. Sekoitettiin edelleen 30 minuutin ajan, sitten seosta lingottiin edelleen 15 minuutin ajan 27.000 g:ssä yllä esitetyllä tavalla. The mixture was stirred for a further 30 minutes, then the mixture was further centrifuged for 15 minutes at 27,000 g as described above. Tämän linkouksen supematantti heitettiin pois ja pelletti, joka sisälsi vähintään 50 % homogenaatin koko entsyymiaktiivisuudesta, suspendoitiin uudelleen 50 mM Tris HCltään, pH 7,0, näytteen muodostamiseksi. This centrifugation the supernatant was discarded and the pellet, which contained at least 50% of the total enzyme activity in the homogenate, was resuspended in 50 mM Tris HCltään, pH 7.0, to form a sample. Aktiivisuus oli 8,2 mU/mg proteiinia. The activity was 8.2 mU / mg protein.

20 '". ' Seohacrvl S-300-geelisuodatusekskluusiokromatografia « « · · • _ ; , ·. Sephacryl S-300 (Pharmacia) tasapainotettiin 50 mM Tris HCliään pH 7,0 ja kaadettiin < i · f * · t : *. ·. K 50/100-pylvääseen (Pharmacia) valmistajan ohjeiden mukaisesti. Pylvään kerrostila- » · . * ]'; 25 vuus oli n. 1,3 litraa. Näyte kuormattiin pylväälle määränä, joka oli n. 3 % pylvään ker- rostilavuudesta. Proteiinit eluoitiin pylväästä 50 mM Tris HCl:ssä pH 7,0 virtausnopeu-: * *.: den ollessa n. 2 ml/min. Kerättiin 10 ml:n fraktioita ja ne analysoitiin alfa- ' : amidointientsyymiaktiivisuuden suhteen käyttämällä dansyyli-D-Tyr-Val-Gly- . y. substraattia. Entsyymi eluoitui pylväästä aktiivisuuden yhtenä ainoana huippuna, kuten .'": 30 on esitetty kuviossa I molekyylimassan ollessa 60.000 - 65.000 daltonia. . 20 ''. 'Seohacrvl S-300 geelisuodatusekskluusiokromatografia «« _ • · ·, · a Sephacryl S-300 (Pharmacia) equilibrated with 50 mM Tris pH 7.0 HCliään and poured into <i * · f · t · *. .. K 50/100 column (Pharmacia) according to the manufacturer's instructions column kerrostila- "* ·] ',... 25 volume was about 1.3 liters of sample were loaded onto the column in an amount of about 3% of the column rostilavuudesta times.. the proteins were eluted from the column with 50 mM Tris HCl, pH 7.0, flow rate: * .: * being the 2 mL / min, 10 ml were collected.. fractions were analyzed and alpha 'relative to amidointientsyymiaktiivisuuden using dansyl-D-Tyr ... -Val-Gly-y substrate of the enzyme was eluted from the column as a single activity peak such as "": 30 is shown in Figure I a molecular weight of 60,000 - 65,000 daltons.. Aktiivisuus oli ; The activity was; · ' · t vähintään 50 mU/mg proteiinia. · '· T for at least 50 mU / mg protein.

» * I »* I

ik I I ik

• · 17 110433 • · 17 110433

Mono O-kromatografia pH-arvossa 6.0 - vahva anioninvaihtokromatografia Mono O-chromatography at pH 6.0 - strong anion-exchange chromatography

Sephacryl S-300-pylvään fraktiot Jotka sisälsivät maksimaalisen entsyymiaktiivisuuden, yhdistettiin ja dialysoitiin 20 mM bis-Tris-puskuria, pH 6,0,4 litraa vastaan. Sephacryl S-300 column fractions containing the maximum enzyme activity were pooled and dialyzed against 20 mM Bis-Tris buffer, the pH of the 6,0,4 liters. Neste 5 lastattiin sitten Mono Q HR 5/5-pylväälle (Pharmacia), joka oli esikäsitelty valmistajan ohjeiden mukaisesti ja tasapainotettu 20 mM bis-Tris:ssä pH 6,0. Liquid 5 was loaded onto a Mono Q HR 5/5 column (Pharmacia) which had been pretreated according to the manufacturer's instructions and equilibrated in 20 mM bis-Tris pH 6.0. Proteiinit, jotka eivät sitoutuneet pylvääseen, kerättiin pylväseluenttiin (läpivirtaus), ja sitten sitoutuneet proteiinit eluoitiin lineaarisella suolagradientilla 0 - 300 mM NaClrä 20 mM bisTris.ssä, pH 6,0. Proteins that are not bound to the column were collected as the column (flow through), and then bound proteins were eluted with a linear salt gradient from 0 - 300 mM NaCl in 20 mM bisTris.ssä, pH 6.0. Pylväs ajettiin virtausnopeudella 0,5 ml/ min. The column was run at a flow rate of 0.5 ml / min. ja kulloinkin 2 ml:n fraktiot kerätyt? and in each case 2 ml fractions were collected? tiin. added. Proteiinien liuos, joka eluoitiin Mono Q-pylväästä pH-arvossa 6,0, neutraloitiin välittömästi keräämällä putkiin, jotka sisälsivät kukin 200 μΐ 1,0 M Tris:iä, pH 7,0. Protein solution was eluted on a Mono Q column at pH 6.0, immediately neutralized by collecting tubes, each containing 200 μΐ 1.0 M Tris, pH 7.0. Fraktiot analysoitiin alfa-amidointientsyymiaktiivisuuden suhteen kuten edellä ja havaittiin aktiivisuuden huippu, joka eluoitiin pylväästä n. 160 mM NaCkssä (kuv. II). The fractions were analyzed with respect to the alpha-amidointientsyymiaktiivisuuden as above and was found to peak activity eluted from the column with approx. 160 mM, NaCl (Fig. II). Aktiivisuus oli 161 mU/mg proteiinia. The activity was 161 mU / mg protein.

15 15

Mono O-kromatografia pH-arvossa 8.0 Mono O chromatography at pH 8.0

Fraktiot, jotka sisälsivät alfa-amidointientsyymiaktiivisuuden huipun Mono Q- kromatografiasta pH-arvossa 6,0, dialysoitiin kahta 4 litran vaihtoa vastaan, joista kum- . Fractions containing alpha-amidointientsyymiaktiivisuuden the peak of the Mono Q chromatography at pH 6.0 were dialyzed against two 4-liter exchanges are utilized with each. 20 pikin sisälsi 50 mM Tris HCl:ä pH 8,0. Insert support 20 containing 50 mM Tris HCl pH 8.0 days. Entsyymi laitettiin sitten Mono Q HR 5/5- • · " '. * pylväälle (Pharmacia), joka oli tasapainotettu 50 mM Tris HCkllä pH 8,0. Proteiinit . 1 /. t eluoitiin suolagradientilla 0 - 300 mM HCl:ä 50 mM Tris HCkssä pH 8,0. Virtausno- • · : . ·, peutena käytettiin 0,5 ml/min. ja kerättiin 2 ml:n fraktioita. Jokainen fraktio neutraloi- « · • · · · : v, tiin lisäämällä 200 μΐ 1,0 M Tris:iä pH 7,0 jokaiseen koontiputkeen. Nähtiin kaksi eril- • · The enzyme was then applied to a Mono Q HR 5/5 · • "" * column (Pharmacia) which had been equilibrated with 50 mM Tris HCl pH 8.0 Proteins 1 / h was eluted with a salt gradient 0 - 300 mM HCl... A. 50 mM Tris pH 8.0 the flow HCkssä • ·:.. · used as peutena 0.5 ml / min and 2 mL were collected.. fractions of each fraction was neutralized «• · · · ·: v, by adding 200 μΐ 1 0 M Tris. pH 7.0 IA in each collection line was seen two separate • ·

. . ·: ·; · ·; 25 listä entsyymiaktiivisuuden huippua eluoimalla 190 mM NaCkssä ja vast. 25 a list of the enzyme activity of the peak eluting at 190 mM, NaCl and response. 220 mM 220 mM

NaCkssä (kuv. III). Phosphate, NaCl (Fig. III). Aktiivisuudet olivat vähintään 80 mU/mg proteiinia ja vast. The activities were at least 80 mU / mg protein, and the response. 400 : ' ·.: mU/mg proteiinia. 400: '· .: mU / mg protein.

• · tt » • · · • · tt »• · ·

Mono O-kromatografian. Mono O-chromatography. pH 8.0. pH 8.0. entsyymin huippufraktion geelielektroforeesi .'· 30 % · « k The peak of the enzyme gel electrophoresis. '· 30% · «k

Entsyymin huippufraktion määräosa, joka eluoitiin 220 mM NaCkssä ja jonka aktiivi- I · suus oli 408 mU/mg proteiinia, laitettiin 10%:iselle SDS-polyakryyliamidigeelille sen • · · • · jälkeen, kun se oli lämpödenaturoitu puskurissa, joka sisälsi SDS:ä ja B- 18 110433 merkaptoetanolia (kuv. IV). An aliquot of the enzyme peak fraction eluted with 220 mM, NaCl, and a · I, the active content was 408 mU / mg protein was applied to a 10% agarose in SDS-polyacrylamide gel it, • • · · ·, after it was heat denatured in a buffer containing SDS and B-18 110433 mercaptoethanol (Fig. IV). Yksi ainoa kaista havaittiin fraktiosta, joka eluoitiin 220 mM NaClrssä. A single band was observed from the fraction eluted with 220 mM NaCl. Tämän kaistan ilmeinen molekyylimassa on n. 73.000 - 75.000 daltonia. This band of apparent molecular mass of about 73,000 -. 75,000 Daltons.

73.000 - 75.000 daltonin kaistan identiteetin vahvistaminen alfa-amidointientsvvminä 5 fixing of the identity of 75,000 dalton band-alpha-amidointientsvvminä 5 - 73.000

Ylimääräisestä alfa-amidointientsyymivalmisteesta, joka oli puhdistettu käyttämällä yllä esitettyjä kriteerejä, käytetiin määräosia elektroforeesia varten ei-denaturoidulla 10%:isella akryyliamidigeelillä. For an extra alpha-amidointientsyymivalmisteesta, which was purified using the criteria outlined above, the number of parts was used for electrophoresis in a non-denatured 10% acrylamide gel. 50 μ!:η määräosia laitettiin kummallekin kaistalle. 50 μ: η the number of parts placed in each band. Elektroforeesin jälkeen toisen kaistan proteiini visualisoitiin käyttämällä hopeavärjäys-10 menetelmää. After electrophoresis, the second band of protein was visualized using a silver staining method 10. Toisesta kaistasta leikattiin 3 mm:n suikaleita ja jokaista suikaletta inku-boitiin mikrotiitterilevyn yhdessä syvennyksessä. The second band was cut into 3 mm strips and each strip was incubated at inku-microtiter plate in a single recess. Jokaiseen syvennykseen lisättiin 100 μΐ seosta, joka sisälsi dansyylisubstraattia, katalaasia, askorbiinihappoa ja 150 mM Trisiä pH 7,0. To each well was added 100 μΐ mixture containing dansyylisubstraattia, catalase, ascorbic acid and 150 mM Tris pH 7.0. Inkuboitiin 16 tunnin ajan 37 °C:ssa ravistellen jatkuvasti. After incubation for 16 hours at 37 ° C with constant shaking. Määräosat jokaisesta syvennyksestä analysoitiin sitten substraatin amidoiduksi tuotteeksi tapahtu-15 neen muunnon suhteen. The parts count each well is then analyzed for the amidated product of events substrate 15 Neen conversion relationship. Entsymaattista aktiivisuutta todettiin kahdessa geeliviipaleessa. The enzymatic activity was found in two gel slices. Aktiivisuus vaelsi voimakkaasti värjäytyvän proteiinikaistan mukana vastaavassa värjätyssä geelikaistassa (kuv. V). The activity went strongly staining protein band in the gel stained with respectively (Fig. V).

Esimerkki 2 20 "V Menetelmät ihmisperäisen rekombinoidun kalsitoniinin valmistamiseksi • · · • ♦ · ; t · t Ihmisen kalsitoniini on 32-aminohappopeptidihormoni, jossa on amidoitu prolyylitähde • · · • · · · : ·. ·. sen karboksyylipäätteessä. Mikroorganismi manipuloitiin geneettisesti rekombinantti- • · « · ,··.·. 25 fuusioproteiinin muodostamiseksi, joka sisälsi aminohapposekvenssin, joka vastasi ih misen kalsitoniiniä. Fuusioproteiinigeeni suunniteltiin siten, että ihmisen kalsitoniinise- : 1 ·,: kvenssi tuettiin arginyylitähteellä sen aminopäätteessä ja sen karboksyylipäätteessä gly- • 1 '' ': syylitähteellä, joka myös päätti rekombinanttifuusioproteiinin (ks. kuv. VII). Ihmisen t«» . ·, ·, kalsitoniinigeenin yhdistämisen jälkeen plasmidiin sopivan fuusioplasmidin muodosta- . 1 1. 30 miseksi mikro-organismi transformoitiin tämän plasmidin kanssa ja saatiin fuusion il- .. 1. maisu (ks. kuv. VI). Tämä ihmisen kalsitoniinia Example 2 A 20 "A Methodology for the preparation of human recombined calcitonin • · · • ♦ ·; s · t Human calcitonin is a 32-aminohappopeptidihormoni, which is amidated prolyylitähde • · · • · · ·... · · The carboxyl-terminus of the microorganism were genetically engineered recombinant - • · «·, ·· · 25 to form a fusion protein containing an amino acid sequence corresponding to misen of calcitonin iH fusion protein gene was designed so that the human kalsitoniinise-: 1 · ,: sequence supported arginyl residues of the amino terminus and the carboxyl-terminus glycine • 1... '' 'syylitähteellä, which also decided Recombinant human t «» ·, ·, after combining calcitonin gene into a plasmid to form the appropriate fuusioplasmidin 1 1 30 order of micro-organism was transformed with this plasmid and was obtained (see FIG VII.).... fusion expression .. 1. The term not (see. Fig. VI). This human calcitonin sisältävä proteiini eristettiin rekombi- containing protein was isolated from the recombinant

» I »I

'. '. t 1; T 1; nanttimikro-organismien lysaateista saostamalla. lysates of nanttimikro-organisms precipitation. Kysteinyylitähteet muunnettiin S- • · sulfonaateiksi ja lysyylitähteet lukittiin palautuvasti reaktiolla sitrakonihappoanhydridin 19 110433 kanssa. Cysteinyl converted into the S • · sulphonates and lysyl locked reversibly by reaction with citraconic 19 110433. Koska ihmisen kalsitoniini ei sisällä arginiinia, rekombinanttifuusioproteiinin tryptinen hajottaminen tuotti peptidin, joka sisälsi ihmisen kalsitoniinisekvenssin, jossa oli karboksyyliterminaalinen glysiinipidennys. Since human calcitonin does not include arginine, recombinant fusion protein tryptic cleavage produced a peptide containing the human kalsitoniinisekvenssin of carboxyl glysiinipidennys. Tämä peptidi eristettiin joko käänteis-faasi-HPLC:llä (ks. kuv. VIII) tai ioninvaihtokromatografialla ja sen rakenne vahvistet-5 tiin aminohappo- ja mikrosekvenssianalyy sillä. This peptide was isolated by either reverse-phase HPLC (see Fig VIII..) Or ion-exchange chromatography, and its structure was confirmed the 5-amino acid and the mikrosekvenssianalyy.

Peptidin glysyylitähde poistettiin ja viimeistä edellinen prolyyli muunnettiin prolii-niamidiksi tämän keksinnön mukaisella alfa-amidointientsyymillä. Peptide glysyylitähde removed and the penultimate prolyl was converted prolii-niamidiksi according to the present invention, the alpha-amidation enzyme. Tämän peptidin puo-lipreparatiivisen alfa-amidoinnin olosuhteiden esimerkki on seuraava: Lyofilisoitu pep-10 tidi (200 - 300 nanomoolia) (substraatti) liuotettiin 200 pl:aan 150 mM Tris-HCl- puskuria, pH 7, joka sisälsi n. 750 uU alfa-amidointientsyymivalmistetta. An example of this peptide Def-lipreparatiivisen alpha-amidation conditions is as follows: Lyophilized pep sequence, for example 10 (200 - 300 nanomoles) (substrate) was dissolved in 200 ul of 150 mM Tris-HCl buffer, pH 7, containing approximately 750 uU alpha. -amidointientsyymivalmistetta. Entsyymi johdettiin joko rotan MTC-kudoksesta tai rotan MTC CA-77-solulinjasta peräisin olevasta käytetystä kudosviljelyväliaineesta. The enzyme is derived from either rat MTC MTC tissue and rat CA-77 cell line derived from the tissue culture medium used. Entsyymi puhdistettiin siinä määrin, että koko pro-teolyyttinen aktiivisuus oli poistettu. The enzyme is purified to such an extent that the size of the pro-teolyyttinen activity was removed. Tämä suoritettiin ioninvaihto-ja ekskluusiokroma-15 tografian yhdistelmällä (ks. edellä esitettyä menetelmää). This was accomplished by ion-exchange and a combination of ekskluusiokroma-15 chromatography (see method. Above). Puhdas, homogeeninen entsyymi ei ollut vaatimuksena. Pure, homogeneous enzyme was not a requirement. Sitten tähän seokseen lisättiin askorbiinihappoa ja kupari-sulfaattia riittävinä määrinä, niin että lopullisiksi konsentraatioiksi saatiin n. 3 mM ja vast. Then, to this mixture was added ascorbic acid and copper sulfate in amounts sufficient so that the final concentrations were approx. 3 mm, respectively. 2 uM. 2 uM. Saatua liuosta sekoitettiin ja inkuboitiin 37 °C:ssa 5-6 tunnin ajan. The resulting solution was stirred and incubated at 37 ° C for 5-6 hours. Tavanomaisesti substraatin tuotteeksi tapahtuvan muunnon prosenttimäärä on 70 - 90 %. Conventionally, the product of the conversion of the substrate to occur percentage is 70-90%. S- . S. 20 sulfonaattiryhmien poistamisen jälkeen ihmisperäinen rekombinoitu kalsitoniini (rhCT) « · " V puhdistettiin käänteisfaasiHPLC:llä (ks. kuv. IX). Lopullinen tuote luonnehdittiin sen . I 1. retentiolla käänteisfaasi-HPLC:llä (ks. kuv. X), kvantitatiivisellä tryptisellä kartoituk- ; , ·, sella (ks. kuv. XI), aminohappoanalyysillä (ks. taulukko I) ja sen biologisella aktiivi- • 1 » • i · 1 : ·. ·. suudella (ks. kuv. XII). Kaikissa tapauksissa ihmisperäistä rekombinoitua kalsitoniiniä • · . 1: ·; 25 ei voitu erottaa ihmisen synteettisestä kalsitoniinistä. 20 after removal of the sulfonate-derived recombinant human calcitonin (RHCT) "·" V was purified by reverse phase HPLC (see Fig IX.). The final product was characterized by its retention on reverse phase I 1... O (.. See Fig X), quantitative tryptic surveying;, ·, the public (see FIG XI..), amino acid analysis (see table I). and biological activity of 1 • »• i · 1... kiss · · (.. see Fig XII) In all cases, recombined human-derived calcitonin 1 • ·. ·; 25 could not be separated from the synthetic human calcitonin.

: 1 ·, I Edellä esitetty osoittaa, että tämän keksinnön mukaisesti saadut valmisteet pystyvät • · • ' “: amidoimaan fysiologisesti relevantin substraatin, esim. ihmisen kalsitoniinin, joka on • · · , ·. 1 · I above shows that the products obtained in accordance with the present invention are capable · • • ' ". Amidation of a physiologically relevant substrate, e.g., human calcitonin, a • · · ·. ·, valmistettu yhdistelmä-DNA-tekniikalla, so sisältää ainoastaan L-aminohappoja. ·, Produced by recombinant DNA technology, i.e. contains only L-amino acids.

• · .''1. • ·. '' 1. 30 > · • » a I > · 30> · • »a I> ·

> » I > »I

• · · t > I • »I • 4 20 110433 • · · T> I • »I • 4 20 110433

Vertailuesimerkit Reference Examples

Esitetyn valmisteen aktiivisuuden vertailu tunnettuun alan tasoon Analvvsiiäriestelmien vertailu esitettyjen valmisteiden spesifisen aktiivisuuden määrit-5 tämiseksi the level of activity of the known reference field further to the preparation of specific preparations described in Control Analvvsiiäriestelmien-5 activity is determined by tämiseksi

Tunnetulla alan tasolla on käytetty useita aktiivisuuden analysointijärjestelmiä. The known area at a plurality of analysis systems for activity is used. Useimmat tunnettuna alan tasona esitetyt työt ovat käyttäneet analyysiä, joka perustuu DTyr-Val-Gly:n muuntoon D-Tyr-Val-amidiksi. Most of the work described in the known level of the industry have used the analysis based on the DTyr-Val-Gly conversion DTyr-Val-amide. Tässä analyysissä käytetään radioaktiivisesti ίο leimattua merkkiainetta ( I-DTyr-Val-Gly), joka sekoitetaan ei-leimatun materiaalin (DTyr-Val-Gly) ylimäärän kanssa. In this assay radioactively labeled tracer ίο (I-DTyr-Val-Gly) is mixed with unlabeled material (DTyr-Val-Gly) with an excess. Leimatun merkkiaineen muunnon mittaus mahdollistaa ekstrapoloinnin leimaamattomaan materiaaliin ja tämä puolestaan mahdollistaa aktiivisuuden laskemisen. Labeled tracer measurement conversion allows extrapolation of the unlabelled material, and this in turn allows calculation of the activity.

15 Vaikka hakijat ovat käyttäneet tätä analyysiä, esitettyjen valmisteiden aktiivisuuden määritykset perustuvat siihen, että mitataan suoraan dansyyli-Tyr-Val-Gly:n muunto dansyyli-T yr-Vai-amidiksi. 15 Although applicants have used this analysis, the determination of the activity of preparations described are based on measuring directly the dansyl-Tyr-Val-Gly conversion dansyl-T yr-Val-amide.

Tunnettujen valmisteiden spesifisen aktiivisuuden mielekkään vertailun mahdollistami- . a meaningful comparison of the specific activity to allow the known preparations. 20 seksi tämän keksinnön mukaisiin valmisteisiin on suoritettu kokeita analyysijäqestelmi- • · • · ” V en vertaamiseksi. 20 into the preparations according to the present invention has conducted experiments analyysijäqestelmi- • • · · "V For comparison.

• · · • · * I · • · ♦ · ; • · · • · * · • · I · ♦; Koekäytännöt olivat seuraavat: » · · »«« · • · · t · · • · .*.·. Experimental practice, were as follows: »· · ·» «« · • · · T · · • · · *... 25 I. Monodanswli-L-Tvr-Val-Glv • · · - -• ;| 25 I. Monodanswli-L-Tyr-Val-Gly • · · - - •; | Näissä kokeissa käytettiin entsyymilähteenä alfa-amidointientsyymivalmistetta, joka oli • ” ': eristetty rotan medullaarisista kilpirauhaskarsinoomatuumoreista ja kudosvilj elyväliai- . In these experiments, the enzyme was used as a source of alpha-amidointientsyymivalmistetta, which • " 'isolated from rat medullary kilpirauhaskarsinoomatuumoreista and tissue culture elyväliai-. v, neista, jotka oli kerätty CA-77-soluista. v, media, which had been collected from CA-77 cells. Käytetyn entsyymin konsentraatio oli kaikissa . The concentration of enzyme was all. · · ·. · · ·. 30 kokeissa vakio, mikäli toisin ei ole mainittu. 30 standard tests, unless otherwise stated.

» · » *» » » » t • * » * · 21 110433 »·» * »» »» T • * »* · 21 110433

Reaktioseos monodansyylisubstituutin muuntamiseksi sisälsi: 5 μΐ entsyymiä 5 μΐ 30 mM askorbaattia 5 5 μΐ 20 μΜ CuS04:ä 5 μΐ 100 pg/ml naudan haimakatalaasia 5 μΐ sisältäen 2 nmoolia substraattia 25 μΐ 150 mM TEStiä pH 7,0 10 Näytteet valmistettiin kahtena kappaleena ja niitä inkuboitiin 37 °C:ssa 10,20 ja 30 minuutin ajan. The reaction mixture was monodansyylisubstituutin converting containing 5 μΐ enzyme 5 μΐ of 30 mM ascorbate 5 5 μΐ 20 μΜ CuS04 5 days μΐ 100 pg / ml bovine haimakatalaasia 5 μΐ containing 2 nmoles of substrate 25 μΐ 150 mM pH 7.0 The test of 10 samples were prepared in duplicate and incubated at 37 ° C for 10,20 and 30 minutes. Entsymaattinen reaktio pysäytettiin lisäämällä 10 μΐ 500 mM EDTAtta. The enzymatic reaction was stopped by adding 10 of 500 mM μΐ EDTAtta. Substraatti ja tuote erotettiin käänteisfaasi-HPLCrllä käyttämällä Hewlett Packard-1090-nestekromatografiajäqestelmää ja määritys saatiin aikaan käyttämällä HP-3392-integraattoria. Substrate and product were separated by reverse-phase HPLC using a Hewlett-Packard 1090 nestekromatografiajäqestelmää and the assay was achieved using a HP-3392 integrator. Monodansyyli-L-Tyr-Val-Gly:n muunnon alfa-amidoiduksi tuotteeksi is osoitettiin olevan lineaarinen ajan suhteen. Monodansyyli-L-Tyr-Val-Gly conversion of alpha-amidated product is shown to be linear with respect to time.

II. II. 125I-D-Tvr-Val-Glv D-Tyr-Val-Gly ja D-Tyr-Val-NH2 jodattiin Pierce Chemical Companyn jodipalloilla. 125 I-D-Tyr-Gly-Val-D-Tyr-Val-Gly and D-Tyr-Val-NH 2 was iodinated from Pierce Chemical Company jodipalloilla.

. . 20 Radioaktiivisesti leimattua substraattia ja tuotetta käytettiin sulfyyli-propyyli- *!V kationinvaihtopylväänkalibroimiseksi. 20 of radioactively labeled substrate and the product was used sulfyyli-propyl *! V kationinvaihtopylväänkalibroimiseksi. 125I-D-Tyr-Val-Gly:tä lisättiin 650 pMD-Tyr- .! 125 I-D-Tyr-Val-Gly was added to 650 PMD-Tyr.! _ it Val-Gly:hyn ja käytettiin substraattina. _ It Val-Gly and used as the substrate. Reaktioseos monodansyylisubstraatin muunta- k · ; The reaction mixture was monodansyylisubstraatin · D conversion; miseksi sisälsi: • · · 14· · » * · I · • · ,' j1. order containing: • 14 · · · · »* • · I · ·," j1. 25 5 μΐ entsyymiä 5 μΐ askorbaattia (30 mM) : ' ·,: 5 μΐ 100 pg/ml katalaasia 5 μΐ20 pMCuSO^ä , ·, *, 5 μΐ substraattia, 650 μΜ lopullinen kons. May 25 μΐ enzyme 5 μΐ ascorbate (30 mM): ',: · 5 μΐ 100 pg / mL catalase 5 μΐ20 pMCuSO s ^, ·, *, 5 μΐ substrate 650 μΜ final conc.

."1. 30 25 μΐ 150 mM TES:iä pH 7,0 »*ki » · » k Näytteitä inkuboitiin 10,20 ja 30 minuutin ajan 37 °C:ssa. Reaktio pysäytettiin lisää- • k » • k mällä 500 mM EDTA:ta. Koko näyte laimennettiin 10 mM natriumfosfaattipuskurilla, 22 110433 pH 5,2, ja laitettiin sulfyyli-propyyli-kationinvaihtopylvääseen. Substraatti ei sitoudu pylvääseen. Amidoitu tuote eluoitiin 500 mM NaCl:llä. Radioaktiivisesti leimatun substraatin muunto tuotteeksi oli lineaarinen ajan suhteen. . '1 30 25 μΐ 150 mM TES. IA pH of 7.0 »* k" · "k samples were incubated for 10,20 or 30 minutes at 37 ° C. The reaction was quenched by the addition k •» • k by 500 mM EDTA. the entire sample was diluted with 10 mM sodium phosphate buffer, pH 5.2 22 110 433, and placed sulfyyli-propyl cation exchange column, the substrate does not bind to the column Amidated product was eluted with 500 mM NaCl.. with the radiolabeled substrate conversion to product was linear with respect to time..

5 III. 5 III. D-Tvr-Val-Glv D-Tyr-Val-Gly:n amidointiin käytetyt reaktio-olosuhteet olivat samat kuin dansyylin ja jodattujen substraattien kohdalla. D-Tyr-Gly-Val-D-Tyr-Val-Gly employed in the amidation reaction conditions were the same as dansyl and iodinated substrates into. Reaktioseoksen substraattikonsentraatio oli 650 uM. The reaction mixture was the substrate concentration was 650 uM. Substaatin ja tuotteen erotus saadaan aikaan gradienttieluoinnilla käänteisfaasi-HPLC:llä käyttämällä HP-1090-nestekromatografiajärjestelmää. The substrates and separation of the product is achieved by gradient elution reversed-phase HPLC using a HP-1090 liquid chromatography system. Pylvään effluentteja io valvottiin 280 nm.ssä. Column effluents were monitored at 280 nm io. Tämän analyysin herkkyystaso on paljon alhaisempi kuin dansyylin tai jodattujen substraattien. This analysis, the sensitivity level is much lower than the dansyl and iodinated substrates. Tämän alhaisemman herkkyystason sovittamiseksi alfa-amidointireaktiot suoritettiin pitempinä aikajaksoina ja/tai alfa-amidointientsyymin suuremmilla määrillä. This lower level of sensitivity to adapt the alpha-amidation reaction was carried out longer periods of time and / or alpha-amidating enzyme for larger quantities.

is 125I-D-Tyr-Val-Gly:n 125I-D-Tyr-Val-amidiksi ja dansyyliTyr-Val-Gly:n dansyyli-Tyr-Val-amidiksi tapahtuvan jakomuunnon arvojen analyysi osoittaa, että jokaisena ajankohtana muunnetaan n. 1,55 kertaa enemmän jodattua substraattia kuin dansyylisubst-raattia. is 125I-D-Tyr-Val-Gly-125I D-Tyr-Val-amide and dansyyliTyr-Val-Gly. Analysis of dansyyliTyr-Val amide place jakomuunnon values ​​shows that, each time, is converted into 1, 55 times more iodinated substrate than dansyylisubst-hydrate. Siten verrattaessa tunnetun alan tason analyysijäqestelmää hakijoiden käyttämään analyysijärjestelmään on käytettävä muuntotekijää, joka on 1,5 kertaa dansyy-, 20 lisubstraattimenetelmällä (hakijoiden) määritetty aktiivisuus. Thus, in comparison with the prior art in the field analyysijäqestelmää candidates to the analysis system is used for conversion factor, which is 1.5 times dansyy-, 20 lisubstraattimenetelmällä (candidates) determined activity.

• i • i I » · · • · ι i · ,! • i • i I »· · • · · ι i,! * Edelleen jonkin verran ankarampaa kineettistä analyysiä on myös käytetty (hakijoiden) » » . * Further, some more severe kinetic analysis has also been used (candidates) "". dansyyli-Tyr-Val-Gly-analyysin vertaamiseksi (tunnetun alan tason) D-Tyr-Val-Gly- • » · ; dansyl-Tyr-Val-Gly-analysis comparing (the known prior art) D-Tyr-Val-Gly • »·; ·. ·. ·, analyysiin. ·, Analysis. Tämä analyysi osoittaa: » · • · • ·» jc * · · III i This analysis indicates: "• · · · •» jc * · i · III

Substraatti Km Vmax D-Tyr-Val-Gly 37 31 • * (tekniikan taso) i · » dansyyli-Tyr-Val-Gly 1,7 21 • 1 I • · ,·**, 30 (hakijoiden) • · II» I > » * * * Substrate Km Vmax D-Tyr-Val-Gly • * 37 31 (prior art) · i »dansyl-Tyr-Val-Gly 1.7 1 21 • I • · · ** 30 (candidates) • · II" I> »* * *

II II

\ \ Kuten voidaan nähdä vertaamalla näiden kahden substraatin maksimaalista nopeutta • i * (Vmax = pmol tuotetta/min/μΐ) D-TyrVal-Gly (tekniikan taso) tuottaa n. 1,48 niin pal- 23 110433 jon aktiivisuutta kuin dansyyli-Tyr-Val-Gly (hakijat). \ \ As can be seen by comparing the maximum speed of these two substrates • i * (Vmax = pmol product / min / μΐ) TyrVal-D-Gly (prior art) to produce approx. 1.48 to service 23 110433 Jon activity as the dansyl-Tyr -Val-Gly (applicants). Tämä on yhtäpitävä yllä esitettyjen havaintojen kanssa ja vahvistaa ne. This is consistent with the findings of the above, and to strengthen them.

Aktiivisuuden vertailu 5 comparison of the activity of 5

Eipper et ai. Eipper, et al. (PNAS) esittävät sivulla 5147, kuv. (PNAS) discloses on page 5147, Fig. 4, että Vmax on 39 pikomoo-lia/mikrogramma/tunti. 4, the Vmax is 39 pikomoo-signal / microgram / hour. Tämä vastaa spesifistä aktiivisuutta, joka on 0,65 mU/mg prote-iinia/min. This corresponds to a specific activity of 0.65 mU / mg, the protein-ine / min. Tämä on korkein aktiivisuus, mitä on tähän asti alalla esitetty. This is the highest activity, what has hitherto been described in the art. Jakamalla tämä edellä mainitulla muuntotekijällä 1,5 johdetaan spesifinen aktiivisuus, joka on 0,4 10 mU/mg proteiinia/ min. Dividing this by the above-mentioned conversion factor of 1.5 is passed specific activity of 0.4 to 10 mU / mg protein / min. Tätä arvoa voidaan nyt verrata suoraan hakijoiden saavuttamiin edellä mainittuihin spesifisiin aktiivisuuksiin. This value can now be compared directly with applicants achieved by the above-mentioned specific activities. Hakijat, kuten edellä esitettiin, ovat saavuttaneet aktiivisuuksia, jotka ovat vähintään 25 mU/mg proteiinia ja suurempia kuin 1500 mU/mg proteiinia. Applicants, as indicated above, have achieved activities of at least 25 mU / mg protein and greater than 1500 mU / mg protein. Hakijat ovat siten saavuttaneet aktiivisuuden, joka on 60 - yli 3.750 kertaa Eipperin (PNAS) esittämä aktiivisuus. Applicants have thus achieved activity from 60 - more than 3,750 times Eipper (PNAS) of an activity.

15 15

Esimerkki 3 Example 3

Rotan MTC-tuumorista peräisin olevien alfa-amidointientsvvmien puhdistus ia karakterisointi 20 . from rat MTC tumor alpha-amidointientsvvmien Purification and characterization of 20. ' * *: Jäädytetty rotan MTC-kudos jauhettiin hyvin pieniksi fragmenteiksi ja homogenoitiin . '* *: Frozen rat MTC tissue was ground into very small fragments and homogenized. ' · vesipitoisessa puskurissa käyttämällä Polytron-homogenisaattoria. '· An aqueous buffer using a Polytron homogenizer. Alhaisella nopeudel- •. • At low a rate. · ; ·; la suoritetun linkoamisen jälkeen supematantti säästettiin ja pelletti uutettiin uudelleen : *. After centrifugation, the supernatant was carried out Ia was saved and the pellet re-extracted:. · tuoreella puskurilla. · Fresh buffer. Tämä toinen homogenaatti alistettiin jälleen alhaisella nopeudella :.: * 25 tapahtuvaan linkoukseen ja tämä supematantti yhdistettiin ensimmäisen kanssa. This second homogenate was again subjected to low speed. * 25 spin taking place, and this supernatant combined with the first. Nämä kaksi yhdistettyä supematanttia selkeytettiin sitten linkoamalla suurella nopeudella ja • # · tämän linkouksen supematanttia käytettiin lähtöaineena entsyymin puhdistamiseksi. These two combined supernatant was then clarified by centrifugation at a high speed, and • # · the spin supernatant was used as the starting material for the purification of the enzyme.

• » • · · :;: Suoritettiin korkealla nopeudella lingotun supematantin ammoniumsulfaattijakotislaus. • »• · ·:;: performed spun at high speed supernatant ammoniumsulfaattijakotislaus.

' ·. '·. · * 30 Suurimman osan entsyymiaktiivisuudesta todettiin saostuvan 26 - 40 %:n ammonium- | · * 30 Most of the enzyme activity was found to precipitate 26-40% of the ammonium | sulfaattifraktiossa ja tämän fraktion pelletti puhdistettiin edelleen alla esitetyllä tavalla. sulfaattifraktiossa and the pellet of this fraction was further purified as described below.

• · · » · 24 110433 • · · »· 24 110433

Ekskluusiokromatografia suoritetiin Sephacryl S-300-pylväällä. Exclusion chromatography was performed on Sephacryl S-300 column. Esimerkissä 1 koko entsyymi eluoitiin pois tästä pylväästä aktiivisuuden yhdessä ainoassa huipussa. In Example 1 the total enzyme eluted from this column with a single peak of activity in combination. Tässä esimerkissä pylvään pituutta lisättiin ja pylvään virtausnopeutta vähennettiin. In this example, the length of the column was added to the column and the flow rate was reduced. Näissä uusissa eluointiolosuhteissa nähtiin aktiivisuuden suurehko huippu (kuten esimerkissä 5 1), jota seurasi pienempi jäljessä tuleva huippu, joka voi vastata entsyymin alhaisem man molekyylipainon omaavaa muotoa. These new major elution peak was seen in the activity (as in Example 5 1), followed by the lower trailing peak, which may correspond to the enzyme alhaisem man molecular weight form. Tässä kohdassa on epäselvää, esiintyykö entsyymin alhaisen molekyylipainon omaava muoto in vivo vai tuotetaanko se osittaisella proteolyyttisellä sulatuksella uuttamisen ja puhdistuksen aikana. This point is not clear whether there is a low molecular weight form of the enzyme in vivo, or it is produced by partial proteolytic digestion during extraction and purification.

ίο S-300-pylvään aktiivisuuden suurempi huippu yhdistettiin ja kromatografoitiin Mono Q-pylväällä pH-arvossa 6,0. higher peak ίο S-300 column activity were pooled and chromatographed on a Mono Q column at pH 6.0. Tässä esimerkissä käytettiin suurempaa, preparatiivista pylvästä kuin esimerkissä 1 (Mono Q HR 10/10), joka eluoitiin käyttämällä vähemmän jyrkkää lineaarista suolagradienttia. greater preparative column as in Example 1 (the Mono Q HR 10/10), which was eluted using a less steep linear salt gradient used in this example. Näiden muutosten tuloksena tässä vaiheessa havaittiin neljä alfa-amidointientsyymiaktiivisuuden huippua, jotka eluoitiin 160 mM, 200 15 mM, 220 mM ja 240 mM NaClrssä (kuvion XIII huiput I, H, III ja vast. IV). The result of these changes at this stage, four peaks of alpha-amidointientsyymiaktiivisuuden, which was eluted with 160 mM, 200 of 15 mM, 220 mM and 240 mM NaCl (Figure XIII of peaks I, II, III and respectively IV.) was observed. Tämä osoittaa, että on olemassa entsyymin monenlaisia muotoja ja että näillä muodoilla on varausheterogeenisyys. This shows that there is a wide variety of forms of the enzyme, and that these forms have been booking heterogeneity. Edelleen proteiinien polyakryyliamidigeelianalyysi entsyymiak-tiivisuushuipuissa osoittaa, että huiput II, III ja IV sisältävät suunnilleen saman molekyylipainon omaavan alfa-amidointientsyymin (so 73.000 75.000), kun taas huippu I : *: 20 sisältää erilaisen, mahdollisesti pienemmän molekyylipainon omaavan entsyymin. Further, the proteins in polyacrylamide gel entsyymiak-tiivisuushuipuissa indicates that peaks II, III and IV contain approximately the same molecular weight having an alpha-amidating enzyme (i.e. 73,000 to 75,000), whereas peak I *: 20 includes a differential, possibly a smaller molecular weight enzyme. Hui- IM · . · IM climax. * · ·: pun III aktiivisuus puhdistettiin homogeeniseksi seuraavasti: • · »· · • · t · • · __ • t · · Huipun III entsyymi yhdistettiin ja kromatografoitiin Mono Q HR 10/10-pylväällä pH- • *. * · ·: Red III activity is purified by gay gene order: • · »· · · T · • • • __ · s · · The peak III enzyme were combined and chromatographed on a Mono Q HR 10/10 column • * pH. ' arvossa 8,0 (kuv. XIV). 'Value of 8.0 (Fig. XIV). Entsyymi eluoitiin tästä pylväästä yhtenä ainoana huippuna 250 • · · •.· * 25 mM NaCl:ssä ja geelianalyysi vahvisti, että entsyymi oli puhdistettu homogeeniseksi (kuv. XVa, kaista 6). The enzyme was eluted from this column as a single peak at 250 • • · · · * 25 mM NaCl. Journal gel analysis and confirmed that the enzyme was purified gay sex gene (Fig. XVa, lane 6). Seuraavat karakterisointikokeet suoritettiin huipun III puhdistetul- « · The following karakterisointikokeet peak III was carried out with the purified «·

• II • II

' · * · la entsyymillä: • · · • · · • · :: 1. Huipun III entsyymin molekyylipaino määritettiin 7 %:n polyakryyliamidigeeli- •...: 30 analyysillä n. 75.000 daltoniksi (kuv. XVb). '* · Ia · Enzyme: • • · · · · · • :: 1. The peak III enzyme molecular weight was determined by 7% polyacrylamide gel • .... 30 analysis of 75,000 Daltons (Figure XVb.).

: *. : *. 2. Entsyymin aktiivisuuden pH-optimi määritettiin arvoksi 5,0-5,5 käyttämällä sub straattina N-dansyyli-Tyr-ValGly:tä (kuv. XVI). 2. The enzyme activity pH optimum of 5.0-5.5 was determined using the value of the sub-N as substrate dansyl-Tyr-ValGly: s (Figure XVI.). Kuitenkin entsyymin lisääntyneen sta- 25 110433 biiliuden johdosta neutraalissa pH-arvossa voi olla edullista suorittaa amidointireaktio tällaisessa pH-arvossa. However, the increased enzyme stabilizers 25 110433 biiliuden the neutral pH may be advantageous to carry out the amidation reaction in such a pH.

3. Määritettiin, että entsyymiaktiivisuuden kofaktoriksi vaaditun kuparin määrä oli 5 kääntäen verrannollinen entsyymin puhtauden suhteen. 3. It was determined that the enzyme activity a cofactor required amount of copper was 5 inversely proportional to the enzyme purity. Homogeeniseksi puhdistettu entsyymi vaati 0,1 μΜ tai vähemmän Cu^-ioneja maksimaalista aktiivisuutta varten, kun taas entsyymin raa'at valmisteet tarvitsivat 2 μΜ Cu^-ioneja. Gay Genetic Sex purified enzyme to 0.1 μΜ or less of Cu ^ ions for maximal activity, whereas crude preparations of the enzyme needed μΜ 2 ^ Cu ions.

4. Entsyymin isoelektrinen piste (pl) oli 4,8. 4. Enzyme The isoelectric point (pI) was 4.8.

10 5. Huipun III homogeenisen entsyymin spesifinen aktiivisuus oli 2.100 mU/mg proteiinia. 10 5. The specific activity of the peak III enzyme was homogenous 2.100 mU / mg protein.

Huipun II entsyymi puhdistettiin myös homogeeniseksi. The peak of enzyme II gene was also purified gay sex. Kuitenkin tämän entsyymin is kanssa todettiin, että Mono Q-kromatografia pH-arvossa 8,0 oli riittämätön homogeenisen valmisteen valmistamiseksi. However, with this enzyme is found that Mono Q chromatography at pH 8.0 was insufficient to produce a homogeneous product. Tästä syystä Mono Q-pylvään, pH 6,0, huipun II koko entsyymi (kuv. XIII) dialysoitiin 1 M Trisiä, pH 7,0, vastaan ja täytettiin fenyylisefa-roosipylvääseen, joka oli tasapainotettu samalla puskurilla. For this reason, the Mono Q column, pH 6.0, peak II the total enzyme (Fig. XIII) was dialyzed against 1 M Tris, pH 7.0, and filled fenyylisefa-roosipylvääseen which had been equilibrated with the same buffer. Suvuin osa saastuttavista proteiinilajeista otettiin talteen pylvään läpivirtauksessa ja amidointientsyymi, joka elu-: : 20 oitiin myöhemmässä vaiheessa, oli olennaisesti puhdistettu. Suvuin part of the contaminating protein species were recovered in the column flow-through and the amidating enzyme which eluted: 20 oitiin a later stage, was substantially purified. Fenyylisefaroosipylvään •, '" yhdistetyn entsyymin edelleenpuhdistus Mono Q HR 10/10-pylväällä, pH 8,0, tuotti * « ♦ • Fenyylisefaroosipylvään, "a" composite enzyme to further purification on a Mono Q HR 10/10 column at pH 8.0, to afford * «♦

• *.: huipun II entsyymin homogeenisen valmisteen, joka eluoitiin pylväästä 220 mM • * II .: the peak of homogeneous enzyme preparation, which was eluted from the column with 220 mM

• · :.: : NaClissä tai sen yli. • ·:.:: NaClissä or more.

• » · • · • · · "·' ' 25 Huipun II entsyymin karakterisointi vahvisti, että *; * · 1. Huipun II entsyymin molekyylipaino 7 %:n polyakryyliamidigeelielektroforeesilla oli n. 73.000 - 75.000 daltonia. Siten huipun Ilja huipun III entsyymejä ei voitu erottaa • » v. * vertaamalla niiden molekyylimassaa. • "· • · • · ·" · "" 25 peak II enzyme characterization confirmed that the *; * · 1. The peak II enzyme has a molecular weight of 7%.. The polyacrylamide gel was approximately 73,000 - 75,000 daltons, thus III enzymes peak II and a peak is not could distinguish • »v. * by comparing their molecular mass.

'···* 30 "· · · * 30

| | ' m'· 2. Huipun II entsyymin aktiivisuuden pH-optimi oli 5,0-5,5. 'M' · 2. Peak II enzyme activity pH optimum of 5.0-5.5. Jälleen tämä huipun II Again, this peak II

:: entsyymin ominaisuus on sama kuin huipun III entsyymin. :: enzyme property is the same as the peak III enzyme.

26 110433 f ! 26 110433 f! 3. Huipun II entsyymin isoelektrinen piste (pi) oli n. 5,8. 3. The peak II enzyme isoelectric point (pi) of about. 5.8.

Esimerkki 4 5 CA-77-solukudosvilielwäliaineista johdetun alfa-amidointientswmin puhdistus ia karakterisointi Example 4 derived from the 5 CA-77-alpha-solukudosvilielwäliaineista amidointientswmin Purification and Characterization

Rotan medullaarista kilpirauhaskarsinoomasolulinjaa, CA-77, kasvatettiin yksikerroksisena viljelynä 150 cm3:n T-pulloissa (Corning) 8 %:ssa C02.'a. The rat medullary kilpirauhaskarsinoomasolulinjaa, CA-77, was grown in monolayer culture on the 150 cm 3 of the T-flasks (Corning) 8% for C02.'a. Viljely pidettiin määrä-10 tyssä väliaineessa, joka sisälsi Dulbecco's Modified Eagle Mediumia: F-10 (1:1), 3,7 g!\ NaHCC^.a, 5 pg/ml transferriiniä, 10 pg/ml insuliinia, 30 nM seleeniä ja 4 pg/ml gen-tamysiinisulfaattia. Cultivation was held in the amount of 10-tyssä in a medium containing Dulbecco's Modified Eagle Medium: F-10! (1: 1), 3.7 g of \ NaHCO ^ .a, 5 pg / ml transferrin, 10 ug / ml insulin, 30 nM selenium and 4 ug / ml of gen-tamysiinisulfaattia. Tällä tavalla kasvatettuja viljelyjä voitiin säilyttää loputtomiin, jos väliaine vaihdettiin joka 48. tunti. cultures grown in this manner could be stored indefinitely if the medium was changed every 48 hours. Solujen kannan lisäämiseksi niitä aliviljeltiin ja kasvatettiin kolmen päivän ajan väliaineessa, joka sisälsi seerumia (5 % hevosen ja 2,5 % 15 fetaalisen vasikan seerumia). in order to increase the position of the cells were subcultured and grown for three days in medium containing serum (5% horse and 2.5% fetal calf 15 serum). Solut pestiin sitten kaksi kertaa fosfaattipuskuroidulla suolaliuoksella ja täydennettiin määrätyllä väliaineella. The cells were then washed twice with phosphate-buffered saline, and was supplemented with a defined medium.

Kudosviljelyväliaineet kerättiin aseptisesti 48 tunnin aikataululla ja varastoitiin -20 °C:ssa siihen asti, kun ne puhdistettiin. Tissue culture media was aseptically harvested 48 hour schedule and stored at -20 ° C until purified. Kudosviljelyväliaineet (tavanomaisesti 6 :*: 20 litraa) laimennettiin 2 litralla deionoitua vettä (3:1) ja laitettiin 50 ml/min.:n virtausno- • '" peudessa heikkoon DEAE-anioninvaihtopatruunaan (Cuno =f=250), joka oli edellä tasa- • painotettu 1,0 litralla 20 mM bis Tris:HCl:ä, pH 6,0,4 °C. Alfa-amidointientsyymi ("al- The tissue culture media (normally between 6 * 20 liters) was diluted with deionized 2 liters of water (3: 1) and applied to 50 ml / min. The flow • ' "in the rate of weak DEAE-anioninvaihtopatruunaan (Cuno = f = 250) was the • balance weighted with 1.0 liter of 20mM bis Tris: HCl., pH 6,0,4 C alpha-amidating enzyme ( "alkyl

:.· : fa-AE") eluoitiin patruunasta asteittain virtausnopeuden ollessa n. 50 ml/min. 50 mM :. ·: Fa-AE ") was eluted from the cartridge gradually flow rate of 50 ml / min. 50 mm.

: . :. ' Tris HCkllä, pH 7,0, joka sisälsi 500 mM NaCl:ä. "Tris HCl, pH 7.0, containing 500 mM NaCl. Kahden anioninvaihtovalmisteen * · · *·' 25 fraktiot, jotka sisälsivät alfa-AE-aktiivisuuden (spesifinen aktiivisuus 10-15 mU/mg), yhdistettiin ja konsentroitiin 4-...5-kertaiseksi alennetussa paineessa käyttämällä Savant t · * RH-100 prep. Two anion exchange * * · · · "25 fractions containing alpha-AE activity (specific activity 10-15 mU / mg), were combined and concentrated to give 4 -... 5-fold under reduced pressure using the Savant RH * · T-100 prep. roottoria. rotor.

« · *. «· *. v Tämä materiaali laitettiin suoraan 5 x 50 cm:n pylvääseen, joka sisälsi Sephacryl 300- » · ' · · · * 30 SF.ä (Pharmacia). v This material was applied directly to a 5 x 50 cm column containing Sephacryl 300 »· '· · · * 30 SF.ä (Pharmacia). Liikkuva faasi oli 100 mM Tris:HCl, pH 7,0,1,0 ml/min. The mobile phase was 100 mM Tris HCl, pH 7,0,1,0 mL / min. :n virtaus- j 'nopeudessa. The flow j 'speed. Koko geelisuodatuskromatografia suoritettiin myös 4 °C:ssa (kuv. XVII). The entire gel filtration chromatography was also performed at 4 ° C (XVII of Fig.).

• · 27 110433 • · 27 110433

Amidointientsyymivalmiste on tässä puhdistusvaiheessa vapaa ei-spesifisestä proteo-lyyttisestä aktiivisuudesta ja sen aktiivisuus on vähintään 50 mU/mg proteiinia. Amidointientsyymivalmiste this purification step is free of non-specific proteo-lytic activity and the activity of at least 50 mU / mg protein. Tämän vaiheen amidointientsyymivalmistetta on käytetty onnistuneesti rekombinoidun gly-laajennetun ihmisen kalsitoniinin ja kasvuhormonia vapauttavan tekijän amidoimiseksi. This step amidointientsyymivalmistetta has been used successfully recombined gly-extended human calcitonin and growth hormone releasing factor amidate.

5 Lähtemällä solutiheydestä 1 -1,5 x 106 solua/ml (T-pulloista) olemme tavanomaisesti saaneet saantona 200 - 350 mU amidointientsyymiaktiivisuutta/1 käytettyä väliainetta näiden kahden puhdistusvaiheen jälkeen. Starting with a cell density of 5 1 1.5 X 106 cells / ml (T-flasks) we have conventionally obtained in a yield of 200 - 350 mU medium amidointientsyymiaktiivisuutta / 1 used in the following these two purification steps. Entsyymi on stabiili ja sopiva käytettäväksi liuoksena tai kiinteään kantoaineeseen suoritetun immobilisoinnin jälkeen. The enzyme is stable and suitable for use in solution or after immobilization carried out in the solid carrier.

io Pylväsfraktiot, jotka sisältävät alfa-AE-aktiivisuuden, yhdistettiin ja dialysoitiin sitten 20 mM bis Tris:HCl:n, pH 6,0,6 litraa vastaan. io Column fractions containing alpha-AE activity were pooled and then dialyzed against 20 mM bis Tris: HCl, pH receiving 6,0,6 liters. Entsyymi laitettiin Mono Q HR 10/10 vahvaan anioninvaihtopylvääseen (Pharmacia), joka oli edellä tasapainotettu 20 mM bis Tris:HCl:llä, pH 6,0. The enzyme was applied to a Mono Q HR 10/10 strong anion exchange column (Pharmacia) which had been equilibrated with the 20 mM bis Tris: HCl, pH 6.0. Entsyymi eluoitiin pylväästä käyttämällä lineaarista 0 - 300 mM NaCl:n gradienttia kolmen tunnin kuluessa virtausnopeuden ollessa 2,5 ml/min. The enzyme was eluted from the column using a linear 0 - 300 mM NaCl gradient over a three-hour flow rate of 2.5 ml / min. Neljä 15 alfa-amidointientsyymiaktiivisuuden kromatografisesti erilaista muotoa erotettiin tässä puhdistusvaiheessa. Four 15-alpha amidointientsyymiaktiivisuuden were separated by chromatography on a different shape in this purification step. Huiput numeroitiin pylvään eluointijäqestyksessä (kuv. XVIII). The peaks numbered eluointijäqestyksessä column (Fig. XVIII). Huiput III ja IV merkitsevät entsyymin korkeamman molekyylipainon omaavia muotoja ja vastaavat MTC-tuumorista johdettuja huippuja Ilja III. Peaks III and IV indicate a higher molecular weight of the enzyme having shapes and the like derived from the MTC tumor peaks II and III. Huiput I ja II merkitsevät entsyymin alhaisemman molekyylipainon omaavia muotoja, jotka voivat olla huipun III : ': 20 ja IV proteolyyttisiä fragmenttej a. The peaks I and II represent a lower molecular weight of the enzyme having shapes that can be the peak III 'and IV 20 a proteolytic fragmenttej.

• '.: Laboratoriossamme tunnistetut neljä erilaista alfa-amidointientsyymin muotoa poikkea- • · :. • '. In our laboratory identified four different types of alpha-amidating enzyme deviation • ·:. · : vat toisistaan kokonaispintavarauksensa suhteen, kuten osoitetaan erilaisilla retentio- i '.: ajoilla vahvan anioninvaihtokromatografian aikana (kuv. XVIII). ·: From one another relative to the total surface charges, as indicated by a different retention i '. During the times of a strong anion exchange chromatography (FIG XVIII.). Näiden entsyymin • · t These enzymes • · t

V * 25 nelj än kromatografisesti erilaisen muodon pH-optimi on myös erilainen. A * 25 than the four different chromatography has a pH optimum is also different. Kuvion XIX Figure XIX

tulokset osoittavat, että huipuilla lilja IV on samanlainen pH-optimi 5,0 - 5,5. The results show that peaks III and IV is similar to the pH optimum of 5.0 - 5.5. Nämä • · · ' · tulokset ovat yhtäpitäviä pH-optimin kanssa, joka määritettiin MTC-tuumorista puhdis- • · tetuille huipuille II ja III. These • · · '· results are consistent with the pH optimum, determined by the MTC tumor purification • · tetuille peaks II and III. Huipuilla I ja II on paljon laajempi pH-aktiivisuusalue, joka :.:. Periods of peak I and II have a much broader pH activity range for a:.:. * on 5 - 8,5 (kuv. XIX). * 5 - 8.5 (XIX of Fig.). Nämä tulokset ovat tarkoin yhtäpitäviä pH-optimien kanssa, joita ' · · · * 30 ovat esittäneet Eipper et ai., Peptides, Voi. These results are closely consistent with the pH optima that are '· · · * 30 are expressed Eipper et al., Peptides, Vol. 4, s. 921 -28 (1983) ja Murthy et ai., J. Biol. 4, pp. 921 -28 (1983) and Murthy et al., J. Biol.

Chem., Voi. Chem., Vol. 261, s. 1815-22 (1986). 261, pp. 1815-22 (1986).

• » , » · • · · • · 28 110433 ΙΛί • »,» • · · · • · 28 110433 ΙΛί

Huipuista II ja IV peräisin olevan entsyymin radioaktiivinen merkintä Na I:llä ja SDS-PAGE:lla vahvistivat, että huipun IV entsyymiaktiivisuuden likimääräinen mole-kyylimassa oli 73 - 75 kDal, kun taas huipun II entsyymiaktiivisuus oli alle 55 kD. from peaks II and IV enzyme radioactive labeling Na I and SDS-PAGE confirmed that the peak IV enzyme activity an approximate molecular-weight ranging of 73-75 kDal, whereas the peak II enzyme activity was below 55kD. Tarkka molekyylipaino on tuntematon huipun II entsyymille, koska sitä ei puhdistettu 5 homogeeniseksi (useat proteiinikaistat ovat ilmeisiä 45 - 55 kDal:n alueella). The exact molecular weight is unknown peak II enzyme because it was not purified 5 gay gene order (several protein bands are evident 45-55 kDal in the area).

Huipun III ja IV entsyymi voidaan puhdistaa homogeeniseksi käyttämällä hydrofobisen vuorovaikutuskromatografian ja vahvan anioninvaihtokromatografian yhdistelmää pH-arvossa 8,0. The peak III and IV, the enzyme can be purified gay gene by the use of hydrophobic interaction and anion exchange chromatography, a combination of a strong at pH 8.0. Huipun IV entsyymin (kuv. XVIII) aktiivisuus yhdistettiin, konsentroitiin 10 n. 2 ml:aan tyhjiössä ja laitettiin suoraan 1,3 x 8 cm:n pylvääseen, jossa oli fenyylisefa-roosia (Pharmacia), joka oli tasapainotettu 500 mM Tris:HCl:llä, pH 7,0. Peak IV enzyme (Fig. XVIII) activity was pooled, concentrated in 10 of 2 ml. of a vacuum and applied to 1.3 x 8 cm column of fenyylisefa-sclerosis (Pharmacia) which had been equilibrated with 500 mM Tris HCl , pH 7.0. Alfa-AE-aktiivisuuden sisältävät fraktiot eluoitiin tasapainotuspuskurilla virtausnopeudella 0,5 ml/min. Fractions containing alpha-AE activity were eluted with equilibration buffer at a flow rate of 0.5 ml / min. (kuv. XX). (Fig. XX). Alfa-amidointiaktiivisuuden sisältävät huippufraktiot yhdistettiin, dialysoitiin 50 mM Tris:HCl:ä, pH 8,0, vastaan, minkä jälkeen ne laitettiin Mono Q HR is 10/10-pylvääseen, joka oli tasapainotettu 50 mM Tris:HCl:llä, pH 8,0. Alpha-amidointiaktiivisuuden containing peak fractions were pooled, dialyzed against 50 mM Tris HCl, v, pH 8.0, and then applied to a Mono Q HR is 10/10 column equilibrated with 50 mM Tris HCl, pH 8 , 0. Entsyymi eluoitiin pylväästä käyttämällä lineaarista 0 - 300 mM NaCl:n gradienttia kolmen tunnin kuluessa virtausnopeuden ollessa 2,0 ml/min. The enzyme was eluted from the column using a linear 0 - 300 mM NaCl gradient over a three-hour flow rate of 2.0 ml / min. (kuv. XXI). (Fig. XXI). Alfa-AE-aktiivisuuden sisältävät fraktiot, jotka oli eluoitu 240 mM:ssä tai yli n. 240 mM:ssä, yhdistettiin, säädettiin 0,001 %:iin (v/v) Triton X-100:ssa ja varastoiotiin 4 °C:ssa. The fractions containing alpha-AE activity were eluted with 240 mM or above 240 mM. Journal pooled, adjusted to 0.001% of (v / v) Triton X-100 and varastoiotiin 4 ° C. Puhdistetun entsyymin : ': 20 spesifiseksi aktiivisuudeksi määritettiin n. 1500 mU/mg proteiinia pH-arvossa 7,0. The purified enzyme '. 20 determined by specific activity of 1500 mU / mg protein at pH 7.0. Hui- .' The fraud. ' · ·: pun III alfa-AE-aktiivisuus puhdistettiin homogeeniseksi käyttämällä huipun IV yhtey- . · III alpha-AE activity of the purified red gay gene by the use in connection peak IV. "/· dessä esitettyjä menetelmiä. "/ · The methods described in conjunction.

• I • I

• · · • · · * • · · : *. • · · • · · • · · *: *. · Tuumorin huipun (esim. 3) ja kudosviljelyn huipun (esim. 4) fysikaalis-kemialliset omi- • t · :* 25 naisuudet mukaanlukien molekyylimassa (73.000 - 75.000 daltonia), pH-optimi (5,0 - 5,5), aminoterminaalisekvenssi ja eluointiasema (suurempi kuin n. 240 mM natrium- • · · Tumor peak (. 3, for example) and tissue culture peak (eg. 4) physico-chemical properties • T · * 25 characteristics including molecular weight (73,000 - 75,000 daltons), pH optimum (5.0 - 5.5) the amino-terminal and elution position (greater than approx. 240 mM sodium • ·

tt I I tt

' · ' · kloridi vahvasta anioninvaihtokromatografiasta, joka suoritettiin pH-arvossa 8,0) osoit- • · ;* tavat, että nämä kaksi huippua voivat merkitä samaa entsyymiä. '·' · Chloride from strong anion exchange chromatography performed at pH 8.0) demonstrate • ·; * Methods that these two peaks may constitute the same enzyme.

• · • ·

• « I • «I

• · · • · * • t * I * I » · • · · · • • * T * I ​​* I "·

Esimerkki 5 29 110433 Example 5 29 110433

Biologisesti relevanttien peptidihormonien alfa-amidointi käyttämällä alfa-amidointientsvvmiä 5 The biologically relevant peptide hormones alpha-amidation using alpha-amidointientsvvmiä 5

Useita rekombinoituja peptidihormonisubstraatteja, mukaanlukien lohen ja ihmisen kalsitoniinin, ihmisen kasvuhormonia vapauttavan tekijän ja ihmisen kalsitoniini-geenin sukuisen peptidin substraatit, on valmistettuja alfa-amidoitu onnistuneesti tämän keksinnön mukaisella alfa-amidointientsyymivalmisteella. Several recombined peptidihormonisubstraatteja, including the substrate-related salmon and human calcitonin, human growth hormone releasing factor and human calcitonin gene-peptide is produced from alpha-amidated successfully according to the present invention, the alpha-amidointientsyymivalmisteella. Alla on esitetty esimerkkinä ίο menetelmät, joita käytettiin rekombinoidun lohen kalsitoniinin, ihmisen kalsitoniini-geenin sukuisen peptidin ja ihmisen kasvuhormonia vapauttavan tekijän valmistamiseksi. Below is shown an example of ίο methods used in the recombined salmon calcitonin, human calcitonin-related gene peptide and human growth hormone-releasing factor. Samantyyppisiä menetelmiä voidaan käyttää muiden rekombinoitujen peptidien kohdalla. Similar methods may be used for other peptides, recombined.

15 Lohen kalsitoniini on 32-jäseninen peptidihormoni, jolla on alfa-amidoitu prolyylitähde sen karboksyylipäätteessä. 15 Salmon calcitonin is a 32-membered peptide hormone having an alpha-amidated prolyylitähde the carboxyl-terminus. Mikro-organismia manipuloitiin geneettisesti rekombinoidun fuusioproteiinin valmistamiseksi, joka sisälsi lohen kalsitoniinia vastaavan aminohapposekvenssin. The micro-organism was manipulated genetically recombined preparing a fusion protein containing the corresponding amino acid sequence of salmon calcitonin. Fuusioproteiinigeeni muodostettiin siten, että lohen kalsitoniinisekvenssi yhdistettiin metionyylitähteellä sen aminopäätteessä ja sen karboksyylipäätteessä gly- : : 20 syylitähteellä, joka myös päätti rekombinoidun fuusioproteiinin. The fusion protein gene was constructed so that salmon kalsitoniinisekvenssi combined methionyl residue of the amino terminus and the carboxyl-terminus glycine: 20 syylitähteellä, which also decided recombined fusion protein. Kun lohen kalsitoniini- • · /' ·* geeni oli liitetty plasmidiin, mikro-organismi transformoitiin tällä plasmidilla ja saatiin • *.: aikaan fuusioproteiinin ilmaisu. When salmon calcitonin · • / '* · gene was linked to a plasmid, a microorganism was transformed with this plasmid, and • * .: provides a fusion protein expression was obtained. Tämä kalsitoniiniä sisältävä proteiini eristettiin rekom- *.: i binoidun mikro-organismin lysaateista saostamalla ja sen kysteinyylitähteet muunnettiin i .: S-sulfonaateiksi. The protein-containing calcitonins isolated from lysates of the recombinant .: * i cholera micro-organism of the cysteinyl residues by precipitation and was converted to i. S-sulfonate. Koska lohen kalsitoniini ei sisällä metioniiniä, rekombinoidun fuusio- • · · » ♦ · ' ' 25 proteiinin syaanibromidi-lohkaisu tuotti peptidin, joka sisälsi lohen kalsitoniini- sekvenssin, joka oli laajennettu karboksyyli-terminaalisella glysiinillä. Since the salmon calcitonin does not contain methionine, fusion recombined • · · »· ♦ '' 25, cyanogen bromide cleavage of the protein yielded a peptide containing salmon calcitonin sequence was extended carboxyl-terminal glycine. Tämä peptidi • » · '·.,*· eristettiin joko käänteisfaasi-HPLC:llä tai ioninvaihtokromatografialla ja sen rakenne • · '; This peptide • "·" · * · isolated as either the reverse. HPLC or ion exchange chromatography, and its structure • · '; ' vahvistettiin aminohappokoostumuksella ja mikrosekvenssianalyysillä. 'Confirmed by amino acid composition and micro-sequence analysis.

• · ' · * ·' 30 Viimeistä edellinen prolyylitähde muunnettiin proliiniamidiksi alfa-amidointientsyymin • '.: vaikutuksella. • · '· · * "30 prolyylitähde penultimate proline amide was converted to alpha-amidating enzyme •'. Effect. Tämän peptidin alfa-amidoinnissa käytettyjen olosuhteiden esimerkki on \ ' · i seuraava: Lyofilisoitu peptidisubstraatti (glysiinillä laajennettu lohen kalsitoniinin esi aste, 200 - 300 nanomoolia) liuotettiin 200 pl:aan 150 mM Tris-HCl-puskuria, pH 7,0, 30 110433 joka sisälsi n. 750 uU alfa-amidointientsyymiä. As an example of the conditions used in peptide alpha is amidization \ '· i as follows: The lyophilized peptide substrate (glycine-extended salmon calcitonin, pre degree of 200 - 300 nanomoles) was dissolved in 200 ul of 150 mM Tris-HCl buffer, pH 7.0, 30 110433 containing approx. 750 uU of alpha-amidating enzyme. Entsyymi voidaan johtaa joko MTC-tuumorista tai rotan MTC CA-77-solulinjasta peräisin olevista kudosviljelyväliaineista. The enzyme may be derived from either the MTC MTC tumor or rat CA-77 cell line in tissue culture media. Entsyymi on puhdistettava sellaisessa määrin, että koko vieras proteolyyttinen entsyymiaktiivisuus on poistettu. The enzyme is purified to such an extent that the size of the guest proteolytic enzyme activity has been removed. Tämä suoritetaan tavallisesti ioninvaihto- ja 5 ekskluusiokromatografian yhdistelmällä (ks. esimerkki 4). This is usually accomplished by ion exchange in combination with 5-exclusion chromatography (see. Example 4). Puhdas, homogeeninen entsyymi ei ole vaatimuksena. Pure, homogeneous enzyme is not a requirement. Sitten tähän seokseen lisättiin askorbiinihappoa ja kuparisulfaattia riittävinä määrinä, niin että lopullisiksi konsentraatioiksi tuli n. 3 mM ja vast. Then, to this mixture was added ascorbic acid and copper sulfate in amounts sufficient so that the final concentrations of approx. 3 mm, respectively. 2 μΜ. 2 μΜ. Katalaasia (7,5 pg/ml), etanolia (1 %, v/v) ja kaliumjodidia (50 mM) voidaan myös lisätä reaktioseokseen alfa-amidoidun lohen kalsitoniinin saannon ίο parantamiseksi. Catalase (7.5 pg / ml), ethanol (1%, v / v) and potassium iodide (50mM) may also be added to the reaction mixture of alpha-amidated salmon calcitonin to improve the yield ίο. Saatua liuosta sekoitettiin ja inkuboitiin 37 °C:ssa 5-6 tunnin ajan. The resulting solution was stirred and incubated at 37 ° C for 5-6 hours.

Sitten poistettiin S-sulfonaatti-ryhmät beta-merkaptoetanoli-käsittelyllä, minkä jälkeen rekombinoitu lohen kalsitoniini puhdistettiin käänteisfaasi-HPLC:llä. Was then removed from the S-sulfonate groups of beta-mercaptoethanol treatment, after which the recombinant salmon calcitonin was purified by reverse-phase HPLC. Lopullinen tuote luonnehdittiin sen retentiolla käänteisfaasi-HPLC:llä, kvantitatiivisellä tryptisellä kar-15 toituksella ja aminohappoanalyysillä. The final product was characterized by its retention on reverse-phase HPLC, quant-15 carboxylic tryptic mapping and amino acid analysis. Kaikissa tapauksissa rekombinoitua lohen kalsito-niiniä ei voitu erottaa synteettisestä lohen kalsitoniinistä. In all cases, recombinant salmon calcitonin-adenine could not be distinguished from synthetic salmon calcitonin.

Ihmisen kalsitoniini-geenin sukuinen peptidi on 37-jäseninen peptidihormoni, jonka karboksyylipäätteessä on alfa-amidoitu fenyylialanyyli-tähde. The human calcitonin-related peptide gene, a 37-membered peptide hormone which is the carboxyl-terminus of alpha-amidated phenylalanyl residue. Fuusioproteiinigeeni :': 20 muodostettiin samalla tavalla kuin lohen kalsitoniini (ks. yllä) siten, että ihmisen kalsi- . The fusion protein gene: A '20 formed in the same manner as the salmon calcitonin to the human calcium (see supra.). toniini-geenin sukuinen peptidisekvenssi yhdistettiin metionyylitähteellä sen amino- > · · • "/· päätteessä ja sen karboksyylipäätteessä glysyyli-tähteellä, joka myös päätti rekom- • · •. · · binoidun fuusioproteiinin. Rekombinoidun ihmisen kalsitoniini-geenin sukuisen pepti- • t · i *.: diesiasteen vapautus, puhdistus, alfa-amidointi ja karakterisointi suoritettiin myös edellä t · · :* 25 rekombinoidun lohen kalsitoniinin yhteydessä esitetyllä tavalla. tonin-related peptide gene methionyl residue was combined with the amino-> · · • "/ · terminus and the carboxyl-terminus of the glycyl residue which also decided recombinant • • ·. · · cholera fusion protein. recombined human calcitonin-related gene peptide • T · i * .: diesiasteen liberation, purification, alpha-amidation, and characterization was performed in the t · * 25 connected recombined salmon calcitonin as shown.

• · • ·

I i I I i i

* · '' Ihmisen kasvuhormonia vapauttava tekijä (hGHRF) on 44-jäseninen peptidihormoni, · *; * · '' Human growth hormone releasing factor (hGHRF) is a 44-membered peptide hormone · *; * * jonka karboksyylipäätteessä on alfa-amidoitu leusyylitähde. * * Which is the carboxyl-terminus of alpha-amidated leucyl residues. hGHRF:n fuusioprote- :: iinigeeni muodostettiin siten, että peptidihormonin aminohapposekvenssi yhdistettiin ' · · · ' 30 tryptofanyyli-tähteellä sen amino-päättessä ja sen karboksyyli-päätteessä glysyyli- » \> tähteellä, joka myös päätti rekombinoidun fuusioproteiinin. hGHRF the fusion :: nucleoprotein gene was constructed so that the amino acid sequence of the peptide were combined "· · ·" 30 tryptophanyl residue at the amino terminus and a carboxyl-terminal glycyl "\> radicals, which is also decided recombined fusion protein. hGHRF:n sisältävä fuusio- » » :. fusion containing »»: hGHRF:. ' · j proteiini eristettiin rekombinoidun mikro-organismin lysaateista saostamalla. '· J recombined protein was isolated from lysates of microorganism by precipitation. Fuusio- proteiinin ei-hGHRF-osa denaturoitiin muuntamalla kysteinyyli-tähteet S-sulfonaatti- 31 110433 johdannaisiksi. The fusion protein of non-hGHRF portion denatured by converting the cysteinyl residues of the S-31 110433 sulfonate derivatives. Koska hGHRF ei sisällä tryptofaania, rekombinoidun fuusioproteiinin kemiallinen sulatus BNPS-skatolireagenssilla lohkaisi oksidatiivisesti fuusioproteiinin, jolloin muodostui amidoimaton hGHRF, joka oli laajennettu karboksyyli-terminaalisella glysiinillä. Since hGHRF does not contain tryptophan, chemical recombined fusion protein BNPS-melting skatolireagenssilla oxidatively cleaved the fusion protein, to form a amidoimaton hGHRF, which was extended carboxyl-terminal glycine. Samanaikaisesti hGHRF-molekyylin aseman 27 metionyyli-tähde hapetettiin 5 metioniinisulfoksidiksi. At the same time the position 27 hGHRF molecule was oxidized methionyl residue of 5 to methionine-sulfoxide. Tämä glysiinillä laajennettu peptidi eristettiin käyttämällä gee-lisuodatusta ja käänteisfaasiHPLC:tä. The glycine-extended peptide was isolated using a gel and reverse phase lisuodatusta's. Sen rakenne vahvistettiin trypsiini-sulatuksella tuotettujen fragmenttipeptidien aminohappoanalyysillä. The structure was confirmed fragment peptides produced by trypsin digestion by amino acid analysis.

Viimeistä edellinen leusyylitähde muunnettiin leusiiniamidiksi tämän keksinnön mukai-10 sella alfa-amidointientsyymillä. The penultimate leucyl residues were converted into 10-leucinamide in accordance with the public alpha-amidating enzyme of the present invention. Esimerkki alfa-amidoidun hGHRF:n valmistusolosuh-teista on seuraava: Lyofilisoitu peptidisubstraatti (20 - 40 nanomoolia) liuotettiin 150 pliaan deionoitua vettä ja siihen sekoitettiin 90 pl (500 pU) (pH 7,0) alfa-amidointientsyymivalmistetta, joka oli johdettu joko rotan MTC-tuumorista tai rotan CA-77-solulinjasta peräisin olevista kudosviljelyväliaineista. An example of an alpha-amidated hGHRF the valmistusolosuh-roads is as follows: The lyophilized peptide substrate (20-40 nanomoles) was dissolved in 150 pliaan of deionized water and mixed with 90 pl (500 PU) (pH 7.0) of alpha-amidointientsyymivalmistetta derived from either rat from MTC tumor or rat CA-77 cell line in tissue culture media. Entsyymi oli puhdistettava 15 koko vieraan proteolyyttisen entsyymiaktiivisuuden poistamiseksi kokoekskluusio- ja ioninvaihtokromatografian yhdistelmällä. The enzyme was purified to remove the entire 15 guest proteolytic enzyme activity by size-exclusion, and a combination of ion exchange chromatography. Sitten entsyymin ja substraatin seokseen lisättiin askorbiinihappoa ja kuparisulfaattia riittävinä määrinä, niin että konsentraatioiksi tuli 3 mM ja vast. Then, a mixture of the enzyme and the substrate was added to the ascorbic acid and copper sulfate in amounts sufficient so that the concentration of 3 mM and. 2 pM. 2 pM. Saatua liuosta sekoitettiin ja inkuboitiin 37 °C:ssa 4-6 tunnin ajan. The resulting solution was stirred and incubated at 37 ° C for 4-6 hours. Substraatin tavallinen muuntoprosentti tuotteeksi on 95 % perustuen trypsiini-: 20 sulatuksella vapautuneiden fragmenttien aminohappoanalyysiin. The standard product the conversion rate of the substrate is 95% based on trypsin: 20 released by digestion fragments of amino acid analysis. Lopuksi metioniini- • / ” sulfoksidi-tähde pelkistettiin metioniiniksi 4 M beta-merkaptoetanolilla, joka oli pusku- • '.: roitu pH-arvossa 4 10 mM natriumasetaatilla, 80 °C:ssa tunnin kuluessa. Finally, the methionine • / "sulfoxide residue was reduced to methionine 4M beta-mercaptoethanol, which was buffered • '. Buffered at pH 4 with 10 mM sodium acetate, 80 ° C for one hour. Lopullinen • · i.: : tuote puhdistettiin käänteisfaasiHPLC:llä ja luonnehdittiin sen retentioajalla, tryptisellä • · * : . The final .: • · i: the product was purified by reverse phase HPLC and characterized by its retention time of tryptic • · *. * sulatusanalyysillä ja aminohappoanalyysillä. * Sulatusanalyysillä and amino acid analysis. Rekombinoitua alfa-amidoitua tuotetta • » · ' · ' ' 25 testattiin myös biologisen aktiivisuuden suhteen. Recombined alpha-amidated product • "· '·' 'at 25 was also tested for biological activity. Kaikissa tapauksissa rekombinoitua hGHRF :ä ei voitu erottaa synteettisestä hGHRF :stä. In all cases, the recombinant hGHRF O were indistinguishable from synthetic hGHRF through.

» * · I · · • · • I k »* · I · · · • • I k

Yllä olevien tutkimusten lisäksi kahta kaupallisesti saatavaa glysiinillä laajennettua ' · * · * peptidihormonia arvioitiin niiden kyvyn suhteen toimia substraatteina alfa- ' *; In addition to the above studies, two commercially available glycine-extended '· · * * peptide hormone were evaluated for their ability to act as substrates for alpha' *; · * 30 amidointientsyymille. · * 30 amidation enzyme. Nämä ovat alfa-melanosyyttiä stimuloivan hormonin esiasteet ja '.: substanssi P. Molemmissa tapauksissa tulokset osoittavat, että molemmat peptidit ovat » · *. These are the alpha-melanocyte stimulating hormone precursors and '. In both cases, the substance P. The results show that both peptides are »· *. ' ': sopivia substraattej a alfa-amidointientsyymille. '' Substraattej a suitable alpha-amidation enzyme.

32 1 10433 32 1 10433

Esimerkki 6 Example 6

Rotan puhdistetun alfa-amidointientsvvmin sekvenssianalyysi 5 Puhdistettua alfa-amidointientsyymiä sisältävät fraktiot yhdistettiin joko rotan MTC- tuumorikudoksesta tai CA-77-soluviljelyn supematanteista ja entsyymin sulfhydryyli- ryhmät alistettiin pelkistykseen ja tämän jälkeen karboksimetylointiin. Fractions containing purified rat purified alpha-amidointientsvvmin Sequence analysis of the 5 alpha-amidating enzyme combined with either rat MTC tumor tissue or CA-77 cell culture supernatants and the sulfhydryl groups of the enzyme were subjected to reduction and subsequent carboxymethylation. Saadut reak- tioseokset laitettiin sitten Vydac C4-käänteisfaasi-HPLC-pylvääseen (5 μΜ hiukkasko- ko, 33 nm huokoskoko), joka oli tasapainotettu 0,l%:sella vesipitoisella trifluorietikka- 10 hapolla. The resulting reaction mixtures were then applied to a Vydac C4 reverse phase HPLC column (5 μΜ particle size, 33 nm pore size) which had been equilibrated 0, l% aqueous trifluoroacetic acid, 10. Pylväs pestiin tällä liuoksella ylimääräisten puskurisuolojen poistamiseksi. The column was washed with this solution to remove excess buffer salts.

Suolasta vapautettu entsyymi poistettiin HPLC-pylväästä eluoimalla 80%:sella asetonit- riilillä, joka sisälsi 0,08 % trifluorietikkahappoa. The salt released from the enzyme was removed from the HPLC column eluting with 80% solution with acetonitrile containing 0.08% trifluoroacetic acid. Pylväseffluenttia valvottiin UV:llä 220 nm:ssä. Of column monitored by UV at 220 nm. Saadut proteiinifraktiot koottiin, yhdistettiin ja lyofilisoitiin. The resulting protein fractions were collected, combined and lyophilized. Tämä materiaali liuotettiin sitten uudelleen 100 phään 0,l%:ista SDS:ä ja laitettiin sitten Applied Bio- 15 systems'in mallin 470 A proteiinisekvenssointilaitteeseen. This material was then dissolved in 100 phään 0, l% SDS and then placed on an Applied Bio Systems' Model proteiinisekvenssointilaitteeseen 15 470 A. Mikrosekvenssianalyysissä käytetyt menetelmät olivat Applied Biosystems'in antamien ohjeiden mukaiset. the methods used for micro-sequence analysis was in accordance with the instructions provided by Applied Biosystems. Saadut fenyylitiohydantoiiniaminohapot analysoitiin HPLCrllä Hypersil C18-pylväällä (hiuk- kaskoko 5 M, huokoskoko 10 nm) absorbanssilla, jota valvottiin 269 ja 313 nm:ssä Phenylthiohydantoin were analyzed by HPLC on a Hypersil C18 column (particle size 5 M, pore size of 10 nm) is the absorbance, which is monitored 269 and 313 nm

Hewlett-Packard 1090-nestekromatografiajäijestelmällä. Hewlett-Packard 1090-nestekromatografiajäijestelmällä. Tuumorikudoksesta peräisin : 20 olevan pääentsyymikomponentin huipun (huippu III) amino-terminaalinen sekvenssi oli • · ·/" seuraava: »· · • · 1 2 3 4 5 6 7 8 9 10 11 12 ·,· · NI^-Ser-Phe-Ser-Asn-Glu-Cys-Leu-Gly-Thr-Ile-Gly-Pro- \\i 13 14 IS 16 17 18 19 20 21 22 23 24 25 Tumor tissue derived from 20 to pääentsyymikomponentin peak (peak III), amino-terminal sequence was: • · · / "as follows:" · · · • 1 2 3 4 5 6 7 8 9 10 11 12 · · · NI ^ -Ser-Phe -Ser-Asn-Glu-Cys-Leu-Gly-Ile-Thr-Gly-Pro-\\ i 13 14 16 IS 17 18 19 20 21 22 23 24 25

Val-Thr-Pro-Leu-Asp-Ala-Ser-Asp-Phe-Ala-Leu-Asp-Ile- 25 26 27 28 Val-Thr-Pro-Leu-Asp-Ala-Ser-Asp-Phe-Ala-Leu-Asp-Ile 25 26 27 28

Arg-Met-Pro • · • · · • · · • · •»· • · CA-77-solukudosviljelyn supematanteista peräisin olevan entsyymin (huippu IV) pää-:.:. Arg-Met-Pro • · • · · · • · • · • »• · derived · CA-77 cell tissue culture supernatants of the head of the enzyme (peak IV) -::.. * komponentin amino-terminaalisen sekvenssin tiedot osoittavat, että se on identtinen * · * *' 30 tuumorikudosentsyymin (huippu III) kanssa. * The data for the component amino-terminal sequence indicates that it is identical · * * * '30 tuumorikudosentsyymin (peak III). Kuitenkin pienempi komponentti havaittiin »· * • ' / myös tämän entsyymin mikrosekvenssianalyysissä, joka näyttää sisältävän amino- • · :. However, a smaller component was detected »· * • '/ the micro-sequence analysis of this enzyme which appears to contain an amino • ·. * · · terminaalisen laaj ennuksen verrattuna alfa-amidointientsyymin päämuotoon. * · Expand terminal ennuksen compared to alpha-amidating enzyme from the main form. Tämän komponentin läsnäolo johtuu luultavasti entsyymin erilaisesta post-translationaalisesta 33 110433 käsittelystä. The presence of this component is probably due to the enzyme different post-translational processing 33 110433. Tämän komponentin amino-terminaalinen aminohapposekvenssi oli seu-raava: 123 4 56789 10 11 12 NH^-Phe-Lys-Glu-Thr-Thr-Arg-Ser-Phe-Ser-Asn-Glu-Cys 5 13 14 As a component of amino-terminal amino acid sequence was worded-ruled: 123 4 56789 10 11 12 NH ^ -Phe-Lys-Glu-Thr-Thr-Arg-Ser-Phe-Ser-Asn-Glu-Cys May 13 14

Leu-Gly- Leu-Gly

Ylimääräisen aminohapposekvenssin arvot saatiin rotan MTC-tuumorikudoksesta peräisin olevalle α-amidointientsyymille seuraavalla menetelmällä: N. 400 pg puhdistettua entsyymiä pelkistettiin ja karboksimetyloitiin. The additional amino acid values ​​were obtained from rat MTC tumor tissue to a α-amidation enzyme by the following procedure N. 400 pg of purified enzyme was reduced and carboxymethylated. Tämän jälkeen entsyymiliuos siirrettiin ίο dialyysiputkistoon ja sitä dialysoitiin 18 tunnin ajan 25 mM Tris-HCl:ä pH 8,0/0,5 M ureaa vasten. Thereafter, the enzyme solution was transferred to ίο dialyysiputkistoon and dialyzed for 18 hours in 25 mM Tris-HCl pH 8.0 s / 0.5 M against urea. Retentaatti siirrettiin sitten 1,5 ml:n linkoputkeen ja konsentroitiin 600 pl:n tilavuuteen alennetussa paineessa. The retentate was then transferred to a 1.5 mL centrifuge tube and concentrated to 600 ul volume under reduced pressure. Entsyymiliuokseen lisättiin 2 μΐ (2 pg) trypsiiniä ja seosta inkuboitiin tunnin ajan 37 °C:ssa. Enzyme solution was added 2 μΐ (2 pg) trypsin and incubated at 37 ° C. Tässä kohdassa lisättiin toinen määräosa trypsiiniä (2 pg) ja inkubointia jatkettiin 2 tunnin ajan 37 °C:ssa. This paragraph was added to another aliquot of trypsin (2 ug), and incubation was continued for 2 hours at 37 ° C. Digerointi is päätettiin lisäämällä 200 pl 4 M ureaa/10 % etikkahappoa. Digestion is terminated by adding 200 ul 4 M urea / 10% acetic acid. Uute laitettiin Vydac C18käänteisfaasi-HPLC-pylvääseen (hiukkaskoko 5 pm, huokoskoko 33 nm), joka oli tasapainotettu 0,l%:sella vesipitoisella trifluorietikkahapolla. The extract was charged with C18käänteisfaasi Vydac HPLC column (particle size 5 pm, 33 nm pore size) which had been equilibrated 0, l% aqueous trifluoroacetic acid. Pylväs eluoitiin sitten lineaarisella asetonitriilin gradientilla 50 %:n konsentraatioon 4 tunnin kuluessa ja fraktioita kerättiin kahden minuutin jaksoissa. The column was then eluted with a linear gradient of 50% acetonitrile to a concentration within 4 hours and fractions were collected for two minute periods. Entsyymin tryptisen uutteen saadut luonteen- : : 20 omaiset käänteisfaasi-HPLC-eluointihuiput on esitetty kuviossa XXIII. characteristic obtained from tryptic enzyme extract: 20 characteristic reverse phase HPLC elution is shown in Figure XXIII. Kolme saatua • · • * ” tryptistä peptidiä alistettiin automatisoituun sekvenssianalyysiin, kuten yllä on esitetty, • ': ja tulokset on esitetty seuraavassa. Three of the resulting · • • * 'tryptic peptides were subjected to automated sequence analysis as described above, •' and the results are shown below. (Peptidit on merkitty niiden fraktionumerolla.) • > · t « t : .* Trvptinen peptidi n:o 65 * « · '·* * 25 -Ser-Met-Gln-Pro-Gly-Ser-Asp-Gln-Asn-His-Phe-Ser-Gln-Pro- (The peptides are marked with their fraction number.) •> · T 't. * Trvptinen peptide No. 65 *' · '· * 25 -Ser-Met-Gln-Pro-Gly-Asp-Ser-Gln-Asn His-Phe-Ser-Gln-Pro

Thr- I « « I thr ««

* II * II

• · · t · '!* Trvptinen peptidi n:o 58 » * :' - Asn-Gly-Gln-Trp-Thr-Leu-Ile-Gly-Arg- * · '···' 30 t • Trvptinen peptidi n:o 86 :: -Phe-Val-Thr-Gln-Trp-Gly-Glu- • · · T · '* Trvptinen peptide No. 58 "*!' - Asn-Gly-Gln-Trp-Thr-Leu-Ile-Gly-Arg-* · '···' 30 t • Trvptinen peptide's No. 86 ::-Phe-Val-Thr-Gln-Trp-Gly-Glu

Esimerkki 7 34 110433 Example 7 34 110433

Geenin tai DNA-sekvenssien molekvvlikloonaus. The gene or DNA sequences molekvvlikloonaus. jotka koodaavat rotan MTC.n tai CA-77-solulinian alfa-amidointientsvvmin 5 encoding the rat MTC.n or CA-77 Cell Lines alpha-amidointientsvvmin 5

Kyky kloonata alfa-amidointientsyymin koodaava geeni tai DNA-sekvenssi johtuu useista kriittisistä informaatio-osista ja reagensseistä. The ability to clone alpha-amidating enzyme-encoding gene or DNA sequence is due to a number of critical data parts and reagents. On löydettävä entsyymiproteiinin luotettava lähde, joka puolestaan toimii entsyymin lähetti-RNA:n (mRNA) lähteenä ja lopuksi sen komplementaarisena DNA.na (cDNA). (mRNA) and, finally, a source DNA.na a complementary (cDNA) reliable source of enzyme protein, the enzyme which in turn acts as a messenger RNA has been found. Entsyymin geenin tai cDNArn eris-10 tys vaatii myös kyseessä olevan entsyymin molekyylikoetinta. The enzyme gene or cDNA as isolating TYS 10 also requires molekyylikoetinta of the enzyme in question. Yleensä tämä molekyyli-koetin omaa toisen kahdesta muodosta. In general, this molecular probe having a second of the two forms. Se on joko oligonukleotidi, jonka sekvenssi on komplementaarinen entsyymigeenin osan suhteen, tai se on vasta-ainemolekyyli (tai vasta-ainemolekyylien kokoelma), joka tunnistaa spesifisesti entsyymiproteiinin. It is either an oligonucleotide having a sequence complementary to a portion of the enzyme gene, or it is an antibody molecule (or antibody molecules Collection), which specifically recognizes the enzyme protein. Näiden molekyylikoetinten johtaminen tarvitsee menetelmää entsyymin puhdistamiseksi 15 siten, että voidaan valmistaa joko entsyymille spesifisiä vasta-aineita tai voidaan määrittää entsyymin aminohapposekvenssit oligonukleotidikoetinten muodostamiseksi. These molekyylikoetinten management needs a process for the purification of the enzyme 15 so that the enzyme can be prepared either by specific antibodies, or amino acid sequences can be determined by the enzyme to form the oligonucleotide probes. Nämä edellytykset on tyydytetty tämän hakemuksen mukaiselle alfa-amidointientsyymille. These conditions have been met according to the present application, the alpha-amidation enzyme.

Alfa-amidointientsyymi puhdistettiin rotan MTC-kudoksesta ja rotan CA-77-soluilla 20 käsitellyistä väliaineista. The alpha-amidating enzyme was purified from rat MTC tissue and rat CA-treated cells 77 20 media. Tämä vahvisti, että nämä solulähteet sisältäisivät entsyymipro- ' · *: teiinin koodaavan mRNA:n. This confirmed that these cell sources contain entsyymipro- '· * protein-encoding mRNA. Menetelmät, joita olemme käyttäneet alfa- »· * • amidointientsyymin cDNA:n valmistamiseksi, ovat molekyylibiologian alalla hyvin i,: i tunnettuja. The methods that we used alpha »* • · cDNA amidation enzyme for the production of the field of molecular biology well known in the i ,: i.

• * » t * • » f I < • tf '. • * »* • t» f I <• tf '. ' 25 Näiden menetelmien erityisiä selityksiä voidaan löytää laboratoriokäsikiq öistä, kuten '25 specific explanations of these methods can be found in laboratoriokäsikiq-works, such as

Molecular Cloning (1982), DNA Cloning, (osa 1) a Practical Approach (1985) tai pri- '; Molecular Cloning (1982), DNA Cloning, (Volume 1) a Practical Approach, (1985), or primary '; * · maarisesta viitekiqallisuudesta, kuten Gubler, V. & Hoffman, BJ, Gene, Voi. * · Maaris viitekiqallisuudesta, such as Gubler, V. and Hoffman, BJ, Gene, Vol. 25, s. 25, p.

» » 262-69 (1983), tai Young, RA ja Davis, RW, PNAS, Voi. »» 262-69 (1983), and Young, RA and Davis, RW, PNAS, Vol. 80, s. 1194-98 (1983). 80, pp. 1194-98 (1983).

•. •. *. *. * Nämä menetelmät ovat yleisesti sovellettavissa, jolloin kriittinen muuttuja on ainoas- « «· '* 30 taan käytetty mRNAtn lähde. * These methods are generally applicable when the critical variable is the only «« · '* 30 mRNAtn be used as a source. cDNA:lle spesifisen alfa-amidointientsyymin valmistami- : ' (· seksi olemme käyttäneet sekä rotan MTC-kudoksen mRNA:ta että CA-77-solun :, ' · · mRNA:ta. Kaksisäikeisiä cDNA-näytteitä, jotka syntetisoitiin, käytettiin puolestaan erillisten geenikirjastojen valmistamiseksi hyvin tunnetuilla menetelmillä. cDNA specific for alpha-amidating enzyme preparation of: "(· Sex we have used both rat MTC tissue mRNA and CA-77 cell:, '· · mRNA. to double stranded cDNA samples that were synthesized, used as part of separate for the preparation of gene libraries by methods well known in the art.

35 110433 35 110433

Kuten yllä esitettiin, alfa-amidointientsyymin mRNA:n erityisten cDNA:n tunnistaminen vaatii molekyylikoettimia, jotka voivat erottaa nämä yhdistelmät muista yhdistelmistä erityisessä kirjastossa. As discussed above, the mRNAs alpha-amidation enzyme specific cDNA requires identification of molecular probes that can distinguish these combinations other combinations of the particular library. Esimerkit 3 ja 4 esittävät yksityiskohtaisesti puhdistusme-5 netelmiä, joita käytettiin molekyylikoetinten johtamiseksi tarvittavan entsyymin valmistamiseksi. Examples 3 and 4 show in detail puhdistusme-five methods used to derive the molekyylikoetinten the preparation of the required enzyme. Esimerkki 6 selittää tämän proteiinin käyttöä aminohapposekvenssien määrittämiseksi, kun taas esimerkki 8 selittää puhdistetun proteiinin käyttöä entsyymille spesifisten vasta-aineiden valmistamiseksi. Example 6 explains the use of this protein to determine amino acid sequences, whereas Example 8 to explain the use of the purified enzyme preparation of the protein-specific antibodies.

ίο Esimerkin 6 aminohapposekvenssit ovat riittäviä spesifisten selektiivisten oligonukle-otidikoetinten valmistamiseksi. ίο 6 amino acid sequences are sufficient to produce specific selective oligonukle-otidikoetinten example. Oligonukleotidikoetinten valmistuksessa useat tekijät ovat tärkeitä koettimien tekemiseksi selektiiviseksi. Oligonucleotide Probes for the manufacture of a number of factors are important in making the probes selectively. Näiden täydellinen esitys voidaan löytää julkaisusta Lathe, RJ, J. Mol. These complete disclosure can be found in Lathe, RJ, J. Mol. Biol., Voi. Biol., Vol. 183, s. 1 - 12 (1985). 183, pp. 1 - 12 (1985). Koska yleensä useampi kuin yksi nukleotidisekvenssi voi koodata saman aminohapposekvenssin (tämä is periaate tunnetaan geneettisen koodin degeneraatioasteena), yksittäinen nukleotidisekvenssi merkitsee ainoastaan yhtä useista mahdollisista geenisekvensseistä. Because usually more than one nucleotide sequence may encode the same amino acid sequence (this is known as the principle of the degeneracy of the genetic code), single nucleotide sequence represents only one of several possible genetic sequences. Sen takaamiseksi, että oligonukleotidikoetin tunnistaa kyseessä olevan geenin, voidaan valmistaa ekvimolaarinen seos kaikista mahdollisista nukleotidisekvensseistä, jotka voisivat koodata amidointientsyymille spesifisen aminohapposekvenssin. In order to ensure that the oligonucleotide probe to identify the gene in question may be prepared from an equimolar mixture of all possible nucleotide sequences which could encode the amidation enzyme specific for the amino acid sequence. Tällaisten seosten moni-: ': 20 mutkaisuus tekee niistä usein vähemmän kuin absoluuttisesti selektiivisiä ja siten on käytettävä yleensä useampaa kuin yhtä proteiinin aminohapposekvenssin aluetta vastaa- i · · • ', · via oligonukleotidiseoksia, jotta saadaan aikaan absoluuttisesti spesifinen selektiivisyys • » ·.* · määrätyn entsyymin suhteen. Such mixtures of multiple ': 20 curvature makes it less often than the absolute selectivity and thus is generally used in more than one of the amino acid sequence of the protein corresponding to the area i · •', · via oligonucleotide mixtures to obtain a specific absolute selectivity • »· *. · with respect to specified enzyme.

II · * * * • · • » II # V * 25 Vaihtoehtoisesti kyseessä olevan geenin suhteen selektiivinen oligonukleotidi voidaan valmistaa valmistamalla riittävän pituinen ainutlaatuinen nukleotidisekvenssi, niin että « · • » i * · ' · jopa hieman epätäydellinen komplementaarisuus haluttuun geeniin tuottaa stabiilin hyb- i · •; II · * * * • · • »II # A * 25 with respect Alternatively, the gene in question, selective oligonucleotide can be prepared by a sufficiently long unique nucleotide sequence, so that the« · • »i * · '· even slightly imperfect complementarity to the gene of interest to produce a stable hybrid i · •; · ' ridin. · 'Ridin. Tällä ainutlaatuisella sekvenssillä voi olla hyvin pieni mahdollisuus (pituudesta • · *. *. * riippuvainen) muodostaa stabiili hybridi muiden geenisekvenssien kanssa. This unique sequence can have a very small chance (length · • *. *. * Dependent) forms a stable hybrid with other gene sequences. Ainutlaatui- m *... * 30 nen sekvenssi muodostuu useimmiten proteiinisekvenssin j okaiselle aminohapolle käy- » : * ί tetystä kodonista. The unique m * ... * 30 consists of the sequence of the protein most often used for amino acid j okaiselle »: * ί tetystä codon. Kodonin käytön toistuvuus määrättyjen lajien kohdalla voidaan mää- » t •. the species frequency of codon usage can be determined provided »• s. ' · j rittää tunnettujen geenisekvenssien ja tämän lajin proteiinien vastaavien aminohappose- 36 110433 kvenssien ryhmityksestä. '· J corresponding to the potency of known gene sequences and proteins in this species, the amino acid sequences of the grouping 36 110433. Nämä menetelmät ovat hyvin tunnettuja molekyylibiologian asiantuntijoille. These methods are well known in the art of molecular biology experts.

Eräs toinen tapa, jota voidaan käyttää spesifisten oligonukleotidikoetinten valmistami-5 seksi, on liittää deoksi-inosiinitähteitä oligonukleotideihin maksimaalisen degeneraa-tioasteen omaaviin asemiin. Another method that can be used to generate specific oligonucleotide probes for manufacturing a sex 5 is connected deoxyinosine residues oligonucleotides omaaviin maximum Degener-rates for these positions. Tämä nukleotidisubstituutio toimii koetinnäytteen degene-raatioasteen vähentämiseksi ja siten sillä voi olla edullisia vaikutuksia valintaprosessiin. This nucleotide substitution is to reduce the sample probe degene-raatioasteen and therefore have beneficial effects on the selection process. (Deoksi-inosiinin käyttöä oligonukleotidikoettimessa on selitetty julkaisussa Ohtsuka et M., J. Biol. Chem., Voi. 260, s. 2605-08 (1985)). (It deoxy-inosine oligonucleotide probe is described in Ohtsuka et M., J. Biol. Chem., Vol. 260, pp. 2605-08 (1985)).

10 10

Olemme käyttäneet alfa-amidointientsyymin proteiinisekvenssejä useiden oligonukleotidikoetinten suunnittelemiseksi, joita voidaan käyttää amidointientsyymin cDNA:n eristämiseksi. We have used the alpha amidating enzyme protein sequences of several design of oligonucleotide probes which can be used amidating enzyme cDNA to isolate. Käytetyt sekvenssit ja koettimet, joita olemme valmistaneet, on esitetty taulukossa II. The sequences used and the probes we have prepared are shown in Table II. On huomattava, että jos molekyylibiologistilla olisi käytössään amino-15 happosekvenssit, hän voisi kehittää vaihtoehtoisia menetelmiä geenin eristämiseksi koe-tinhybridisaatiolla. It should be noted that if the molekyylibiologistilla would be using a 15-amino acid sequences, he could develop alternative methods for the isolation of the gene test tinhybridisaatiolla.

Näin tuotettuja oligonukleotidikoettimia on käytetty hyvin vakiintuneilla menetelmillä (ks. Molecular Cloning 1982) sekä plasmidi- että bakteriofagi-cDNA-kiijastojen seulo-20 miseksi ja alfa-amidointientsyymin cDNA:n eristämiseksi. oligonucleotide probes thus obtained is used by well established methods (see Molecular Cloning 1982.) as well as plasmid and bacteriophage cDNA libraries displayed on Screen the 20-order, and alpha-amidating enzyme from the cDNA to isolate.

Taulukko II table II

• · ' • · • · ♦ • · • · • :1: Tässä taulukossa on esitetty kaikki mahdolliset geenisekvenssit, jotka vastaavat alfa- • · · · : 1 · 1: 25 amidointientsyymiproteiinin valittuja alueita. · • '• • · · · ♦ • • • ·: 1: This table shows all possible gene sequences corresponding to the alpha • · · · 1 · 1: 25 amidating enzyme protein selected areas. Esitettyjen sekvenssien alapuolella on • · · : : : esitettyä muutamia geenin suhteen komplementaarisia oligonukleotidikoettimia, joita voidaan käyttään cDNA:n tunnistamiseksi ja eristämiseksi. sequences is presented below • · ·::: set a number of oligonucleotide probes complementary to the gene that can be used by the cDNA to identify and isolate.

• · * · · • · · • · III « · • I 1 • · I · · • · • · · • · * · » • · · • « « · • 0 · • » · 110433 37 *6.1 > o >0 w V} > M 2?> Hm 0H 0> fl> oi ®> mm® £· cd £ m h- o 2 i; • · * · · • · · • · III «· • I 1 • · I · · • · • · · • · * ·» • · · • «« · • 0 · • »· 110433 37 * 6.1> o ?> 0 V w}> m 2> Hm 0H 0> fl> o ®> mm® £ £ cd · m h o i 2; ^ _ 3ΦΗ· 2#| ^ _ 3ΦΗ · # 2 | 5 lQ ω 3 ft < =** ΙΟ 3 rt < „ ! 5 ft 3 lo ω <= ** ΙΟ 3 rt < "! oo 01ΜΦ ©·' tnH-fD 2i a tj t^ffl rt 3 m ω rt 2 . oo 01ΜΦ © · "TNH-FD 2 R a s t i ^ ffl rt rt 3 m ω 2. ae rt ® *< rt (1)¾ ω { 6 £ ** rt w X rt » S p. 1 H- I o O 471 l rt rt on “μ* & P* O n ® >-* e rt ® * <rt (1) ¾ {ω £ 6 ** rt rt X "S p, 1 H O 471 I o l rt rt is the" * μ * P & O's ®.> - *

OoQ £ S? OoQ £ S? ° ^ g ui to ^ SS '1 3.0 * s -so { *1 a ·* ° ^ * i 3 3 sa oi nn _ S- I *1 > > S cl K·» 1 ^ > tn tP* OM TO , >* Λ 5 3 O > *3 O » M i 0"3 , _ ,_ i Q n ci •"3 G m κι I rl > M tn •-3 ® ^ IO ä»C1C»w O > H3 OC u> | ° ^ g ^ ui to the SS '1 3.0 * p -SO {a · * 1 * ° ^ * I 3 3 sa O nn S _ I * 1>> K · S cl "1 ^> tn tp * OM TO ,> * Λ March 5 O> 3 * Z "m i, 0" 3, _, _ I Q n ci • "3 g of m κι rl I> tn m • ® -3 IO ^ s" C1C "w o> H3 OC u> | g? g? ^ i > ^ n p. I ^> ^ n p.

G jr ... i QO »< σ* 3 G Jr QO i ... »<σ * 3

*8 £ ! * £ 8! w Ω w P w w P Ω

> -M! > -M! > ' g * 3 £<. > 'G * 3 £ <. % >^n £«! %> ^ N £ «! MO ° o > hj oc « MO ° o> oc hj «

>Π>* ί n Π OM 03 M > Π> * Π ί the OM 03 M

^ o > o fS m J ~ Ώ ° *Gi> n ·< Φ O ^> o J ~ fS m Ώ ° * G> n · <Φ

3 KM ! 3 KM! gg S· 3vo -S gg 3V O · S -S

g coto, OO 0>^0 »n 3 ·.:· cin>3 3 S 1 "> ? »-η h ®o *. ·* 1 QQ no g Coto, OO 0> ^ 0> n 3 ·. · cin> 3 3 S 1 '> »-η · h ®Ò * 1 * QQ no?.

... IQ 0 OMM ... IQ 0 OMM

. . * : i t-. * I t. onho > o 'c·-· : .·. onho> o 'c · - ·. ·. 1 S £ o ό ... 1 o „ onm ·—* 1 S £ o ό ... No 1 "is m · - *

*··/ I '-'> *-3 > OO > *-3 OW ·· * / I '-'> * -3> OO> * -3 OW

: Y* ' GG o < ;;; : Y * 'GG o <;;; 1 *-* o on > ^ nom u> IH 2! 1 * - * o is> ^ nom u> H 2! >* <-3 I Ω O n 3Ή 1 en O o > n 3 »p· ; > * <-3 Ω I, O of the 3Ή 1 I O o> 3 »p ·; '.: 1 2 n *o • · IOO am .··*. '.. 1 2 n * o • · IOO am ·· *. 1 ° o > *-3 no en 1 S enr . 1 ° o> * -3 no I 1 S ENR. . . 1 > H ro h : : : 1 nn > *-3 oe en 1 QO > 1> H ro H::: 1 n> * -3 oe I 1 QO>

. . I e > WM I e> WM

··/ 1 >* n ►a ό -o :*·*: ' no > . ·· / 1> * n ►a ό -o: * · * 'no>. . . 1 on mm . 1 mm. . . 1 171 o > *-3 n tu 03 38 110433 1 No 171> TU * -3 March 38 110433

Ο ί° Λ » SS Ο ί Λ ° »SS

£ 85 I- oo h- ro g I oo £ 85 h ro g

2 w. 2 w. a tn rt S a t r t S

> g. > G. >g ro ^ “ «f g1 5“ rt » om ro > Ro g ^ "« f g1 5 "rt" om ro

It o 3 & rt “ £ £ " It o rt & 3 "£ £"

s ί S p ί S

ff 3 3 mj to tn Ό - - - _ rt □ h| ff March 3 mj tn Ό - - - □ _ rt h | > wi—1 3 ci> o > n -3 3 ro Ο π Λ Λ nn Ci (-1 tt> tr >o >-3 o ^o>n 1< c λ on ci o 2 to ό > W 3 ci-1> o> n -3 3 ro Ο π Λ Λ n n C (-1 tt> tr> o> ^ o -3 o> 1 <λ c is C 2 to ό

1-3Π 1-3 0 !>0 3 C 1-3Π 1-3 0!> 0 3 C

>b, >» >-3 1"3 nng £ o π Ώ 73 2 : : α ώ n ^ tn ® ·;1.· noi tn Ci>HO 2 \".: ' " 1-3 0 tr1 H ra σι *·': q 1-3 n en c . ! > 1-· : : : _3 i— ··· · > O >-3 ro : 1 : n ci • · Ci H- 03 .'.·. -3 o >n 1< ' > n > > B> »> 1 -3" 3 NNG £ o π Ώ 73 2: α ώ n ^ t · ®, 1. ordinates · C t> HO 2 \ '.:' 'tr1 1-3 0 H r σι * · "q 1-3 I n c> 1 ·.!: i _3 · · · ·> R> -3 ro: 1. the ci · • C 03 H '·.. -3 o> 1 < '> n>

Ci n to -3 o > Ci ta . C to -3 of o> C s. . . to # 2 • · 39 110433 _ S' β *· oro ω> ft OQ cl (D en <D > li ¢1 si »sg·- 5-¾ 51 Sg Sg ETU S" h £ S g « ξ 5* ^ 2 t—>c\ i—12. ό i—i σ»ι-ι < H- °H- ro ro ro go* ooo O H- rt rt m rt l μ. ui. tn ao & £ k VT « i 11 > H w ci > hn »ie >-3 >3: j> *-3 n> to to # 2 • · 39 110433 _ S 'β * · oro ω> ft OQ cl (D I <D> li ¢ 1 si "sg · - 5 ¾ 51 Sg Sg INTEREST S" h £ S g' ξ 5 * t ^ 2> c \ i-12. ό i σ i »ι-ι <H-° H ro ro ro go ooo O * H rt rt rt l m μ. swims. t ao & £ k VT «i 11> H w ci> he" ie> -3> 3 j> n * -3> to

On Cl er Is Cl er

Cl Cl O Cl >-3 1-9 > f-· to j HO 1-30 > Cl 3 Cl Cl O Cl> -3 1-9> · f to j HO 1-30> Cl 3

Cl Cl Q Ό m Cl Cl Q Ό m

Cl Cl O *-s ^ Ή. Cl Cl O ^ -s * Ή.

i-ii-«C10>*-äO[X i-II «C10> * - AO [X

on ci ci 3 n O Cl t— UI ™ »-· *-t H Cl > O *< ** «-3 > > H oi g* O ci ci n ro σ> £. is ci ci n O Cl 3 UI ™ t »- * t · H Cl> O * <**« -3>> H O O g * ci ci σ s ro> £.

ω ω ci > Cl >* OH »nooon ci > 2 ω ω ci> C> * OH »nooon ci> 2

G 14 h3 H > w -OC G 14 H h3> w -OC

>3 > Cl >ci >C1 HO *Ö > 3> C> ci> C1 HO * Z

Cl Cl Cl Cl O Cl n OHOHO >C13 ^ ··· '· ^ -3 HH > > tn Cl Cl Cl Cl Cl O's OHOHO> C13 ^ ··· '· ^ -3 HH>> tn

·· 3 H Η,-Η,η > »VO ·· 3 H Η, -Η, η> »VO

• ,· >C1 > Cl _ u HO 3 *'·'· Cl Cl G ® u_. • ·> C 1> C _ u HO 3 * '·' · C C G ® u_.

• · “4 H >1—1-' • · "4-H> 1-1-"

> O > O HOMO > O> O GAY

> ^ H 5 M > = H 5 M

... ·** en tn o Π) i-1 • · ... > *-9 01 : : : ci o ro m ci > ho <-* ro o ci ... · ** tn I Π o) i-1 · • ...> -9 * 01::: ci o ro m ci> ho <- * ro o ci

> 1—' M > 1- 'M

. . . . '· > Cl 3 ω ... '·> Cl 3 ω ...

O >ϋ ' : nnh* ci > ho O if* O> ϋ 'n NH * ci> ho if O *

.·.·. . ·. ·. > H > H

·.·.' ·. ·. ' Cl 3* I—1 C 3 * I-1

Cl n > H wn en I 40 110433 if Cl, n> I I H wn 40 110433 if

? ? 2 |g SJ 2 | SJ g

si s ? si s? si 15 : Si 15:

“tr ? "Tr? S S

η φ 9 3 ΓΤ 03 ►*· 01 η φ March 9 ΓΤ 03 ► * · 01

& p. HS & P. HS

h* ,+ <1 Ό ^ ui £ h * + <1 ul £ ^ Ό

£ 3 ' I £ 3 'I.

Λ> «3 gr- * > o < 5. Λ> «3 gr- *> o <5.

M n >^no » M -o M n> no ^ »M o

pi TS through TS

ο η ^ β ^ no i> y-3 n % °° Ο λ ^ Go >Ώ :': S g * 5 ο η ^ β ^ no i> y n-3% °° Ο λ ^ Go> Ώ 'S g * 5

*:·.· Λ . *:. · · Λ. § £ <·" S § £ <· "S

• *: nn OS Ω :*·': -° nn^5? • * nn OS Ω: * · ': - ° nn ^ 5? £*<» . £ * < ». ; ; na ' na '

' - · >-3 gO '- ·> -3 g'

··.*·* οι > o tr ^ :·.': ~ OJ c • · · » · · * * ·» • · · ·· * · * οι> o ^ tr. · ':. ~ OJ c • · · »· · · * *» • · ·

II II

• · # » · » · * 41 1 10433 • · # »·» · * 41 1 10433

Esimerkki 8 A. Alfa-amidointientswmille spesifisten monoklonaaiisten vasta-aineiden tuottaminen hiirissä 5 11 Balb/cJ-hiirtä immunisoitiin ja immunisaatiota tehostettiin amidointientsyymin puhdistetuilla valmisteilla. Example 8 A. Alpha-amidointientswmille monoklonaaiisten production of specific antibodies in mice May 11 Balb / cJ mice were immunized and boosted immunization with purified amidating enzyme preparation. Näiltä hiiriltä otettiin verta ja seerumi käsiteltiin ja titrattiin puskuroitua entsyymiä vastaan ELIS A-analyysillä. These mice were bled and the serum was treated and titrated against a buffered enzyme in an ELISA assay. Analyysi (käytetyt tekniikat ovat hyvin vakiintuneita) suoritettiin absorboimalla puhdistettu entsyymi polystyreenilevyyn, joka 10 pestiin sitten ja salvattiin (vasta-aineiden epäolennaisen sitoutumisen estämiseksi levyyn) naudan seerumialbumiinilla (BSA). Analysis (used techniques are well established) was performed by absorbing the purified enzyme polystyrene plate, which 10 was then washed and blocked (to prevent binding of irrelevant antibodies to the plate) with bovine serum albumin (BSA). Laimennettuja hiiren seerumeja (jotka sisälsivät oletettuja vasta-aineita amidointientsyymin suhteen) inkuboitiin sitten amidoin-tientsyymillä päällystetyllä levyllä ja pestiin. The diluted mouse sera (containing putative antibodies amidation rate) were then incubated with amidation enzyme of the coated-plate and washed. Toista vasta-ainetta (merkitty merkintäai-neella, alkalisella fosfataasilla, joka helpottaa ensimmäisen vastaaineen levyyn sidotti tuun entsyymiin tapahtuvan sitoutumisen vahvistusta) inkuboitiin sitten syvennyksissä. The second antibody (labeled merkintäai-agent, alkaline phosphatase, which facilitates the antibody of the first plate sidotti tuun binding to the enzyme amplification) were then incubated in the recesses. Pesemisen ja substraattiliuoksen lisäyksen jälkeen signaalia valvottiin kolorimetrisesti spektrofotomerisellä rekisteröintilaitteella. After addition of substrate solution and washing, the signal was monitored colorimetrically spektrofotomerisellä recorder. "Positiivisten" seerumeiden signaali-kohinasuhde oli vähintään 2:1. "Positive" sera signal-to-noise ratio of at least 2: 1.

20 7 hiirtä, joilla oli korkeampi tiitteri ELISAssa, tapettiin neljän päivän kuluttua lopulli- . July 20 mice with ELISA titer was higher, was killed four days after the final. ·. ·. sen immunisaation vahvistuksen jälkeen. After the immunization gain. Perna poistettiin aseptisesti ja möyhennettiin • · • · · · 6 •.:, (murskattiin mekaanisesti), jolloin saatiin kaikkiaan 132,6 x 10 splenosyyttiä, jotka • · [·.1. The spleen was removed aseptically and pulped • • · · · · 6 •:. (A mechanically crushed) to give a total of 132.6 x 10 splenocytes • · [· .1. yhdistettiin 122,8 x 106 NS-1 myeloomasoluun käyttämällä 1,28 ml PEG:tä (polyety- | leeniglykoli) 4000. Solut jaettiin määräosina viiteen 24 syvennyksen levyyn, jotka oli «»» · 1 · 1: 25 edellä päällystetty Balb/cJ-tymosyyteillä ja splenosyyteillä, jotka toimivat syöttösolui- • · ::: na. was combined with 122.8 x 106 NS-1 myeloma cells using 1.28 ml of PEG (polyethylene | glycol) 4000. The cells were divided into aliquots in five 24-well plate, which had «» »· 1 · 1: 25 coated on the Balb / cJ thymocytes and splenocytes, which operate syöttösolui- • · ::: na. Solut säilytettiin selektiivisissä HAT-väliaineissa, jotka mahdollistavat ainoastaan hybridisolujen eloonjäännin. The cells were maintained in selective HAT media that allow only the hybrid cells to survive.

» · » · · • ·» "...: Supematantit 116 syvennyksestä, joissa esiintyi klonaalista kasvua, analysoitiin radi- : V: 30 oimmuno-analyysi- ja ELISA-menetelmillä vasta-ainetuotannon suhteen. Radioimmu- • · : ' ' ': no-analyysi oli samanlainen kuin edellä esitetty ELISA sillä erotuksella, että toinen vas- : 1. ·. ta-aine oli merkitty I:llä ja radioaktiiviset laskut suoritettiin gammalaskimella. »·» · · · • » '...: The supernatants from the recess 116, which showed clonal growth were analyzed by the radical: A: 30 oimmuno analysis and ELISA methods for antibody production by radioimmunoassay · •:.' '' : no analysis was similar to that shown in the above ELISA except that the second response. · s-1 antibody was labeled I and radioactive calculations performed by a gamma counter.

• · · • · 110433 42 116 syvennyksestä 56 oli positiivisia vasta-ainetuotannon suhteen ja ne analysoitiin tämän jälkeen reaktiivisuuden suhteen alfa-amidointientsyymien suhteen. • • · · · 110 433 116 42 from the recess 56 were positive for antibody production by them, and were then analyzed for reactivity to alpha-amidating enzyme relationship. 25 kloonia, jotka näyttivät olevan positiivisia alfa-amidointientsyymien suhteen, kloonattiin sarja-laimennusprosessilla. 25 clones that appeared to be positive with respect to alpha-amidating enzyme, was cloned into the series of dilution. Primaariset kloonit analysoitiin sekä alfa-amidointientsyymien 5 että BSA:n suhteen (koska polystyreenilevyt oli salvattu BSA:lla, vasta-aineet, jotka oli sidottu levyyn, olivat voineet sitoutua pelkästään BSA:han tai ne oli absorboitu tällä epäspesifisesti) sen määrittämiseksi, olivatko ne todella spesifisiä amidointientsyymin suhteen. The primary clones were analyzed and alpha-amidating enzyme 5 and BSA (since the polystyrene plates were blocked with BSA, antibodies which were bound to the plate were able to bind only to BSA or had been absorbed by this non-specifically) to determine whether they were really specific for the amidating enzyme relationship. Kloonit, jotka omasivat signaalin alfa-amidointientsyymin suhteen, joka oli vähintään kaksi kertaa niin suuri kuin BSA:lle osoitettu signaali, kloonattiin jakosuh-lo teessä 1 solu/2 syvennystä. Clones that possessed the signal with respect to alpha-amidating enzyme, that was at least twice as high as the BSA signal addressed to a cloned into jakosuh-lo tea one cell / two wells.

Tertiaarisessa kloonausvaiheessa tehtiin 21 positiivista hybridomaa (ks. taulukko III) ja 20 niistä luonnehdittiin vasta-aineluokan suhteen sekä Ouchterlonyn että ELISAmene-telmällä. The tertiary cloning step was 21 positive hybridomas (see. Table III) and 20 characterized by the class of antibody relative to both Ouchterlony and ELISA-go method. Seitsemällätoista klooneista oli IgG2a:n ras- kaita ketjuja ja kolmella oli 15 IgGl :n raskaita ketjuja. Seventeen clones were IgG2a heavy chains and three had 15 IgGl heavy chains. Kaikkien kahdenkymmen kloonin määritettiin erittävän vasta-aineita, joissa on kappa-kevytketjuja. Any two of ten clones were determined to secrete antibodies with kappa light chains.

Jokaista linjaa kasvatetaan yksilöllisesti irto viljelyssä ja solujen määräosat jäädytetään nestemäisessä typessä. Each line of the insert are grown individually in culture and cells aliquots are frozen in liquid nitrogen. Pristaani-esikäsitellyt Balb/cJ-hiiret injektoitiin intraperitoneaa- 20 lisesti 5 x 106 hybridooma-solulla. Pristane-primed BALB / cJ mice were injected intraperitoneally 20 ic spread of 5 x 106 hybridoma cells. Viikkoa myöhemmin hiirille, joissa ei esiintynyt .·. A week later, the mice, which did not occur. ·. askiitistuumoria, annettiin solujen tehosteinjektio. askiitistuumoria, the cells were given a booster injection. Askiitisneste ja veri poistettiin 1 - 2 • » viikon kuluttua. Askiitisneste and blood was removed from 1 to 2 • "weeks. Käsittelyn jälkeen askiitis ja seerumit analysoitiin ja tiirattiin alfa-amidointientsyymin suhteen samoin kuin negatiivisten antigeenien suhteen (esimerkiksi • :': naudan seerumialbumiini, valkuainen, hiilianhydraasi ja kasvuhormonia vapauttava a · · · i' · 1: 25 tekijä) vasta-ainespesifisyyden varmistamiseksi. After the treatment, askiitis and sera were analyzed and the terns of alpha-amidating enzyme in terms of, as well as with respect to the negative antigens (for example, • ': bovine serum albumin, protein, carbonic anhydrase, and growth hormone releasing a · · · i' · 1: 25 factor) to ensure antibody specificity.

0 0 0 0

• M • M

• · · • · · 0 0 0 01 0 0 1 0 0 0 0 0 0 0 0 0 01 0 0 0 0 0 0 t 0 0 1 0 0 0 0 0 0 0 0 0 0 0 ♦ 0 0 0 0 0 • · · • · · 0 0 0 01 0 0 1 0 0 0 0 0 0 0 0 0 01 0 0 0 0 0 0 t 0 0 1 0 0 0 0 0 0 0 0 0 0 0 ♦ 0 0 0 0 0

Taulukko III table III

43 110433 43 110433

Balb/c-alfa-amidointientsyymin monoklonaaliset solulinjat 5 Monoclonal cell lines from Balb / c Alpha-amidating enzyme 5

SoluIinja Raskasketju Tiitteri1 4-1-4-20-3 IgG2a -1:5,000 4-1-4-18-1 1gG2a 1° 4-5-7-3 19G2a -1:5,000 4-2-3-17-7 igG2a 3- 7-1-20-24 19G2a -1:10,000 4- 8-15-2-6 IgG2a 4-7-21-14-9 ig^a 4-10-45-1-16 igG2a 15 54-2-1-39-2 IgG2a -1:10,000 4-6-12-3-17 19G2a 52-1-31-24-2 IgG2a 4-3-11-46-1 IgG2a 3- 7-9-9-3 IgG2a 86-1-38-15 IgG, 1:1.000 20 ^ 4- 5-6-1 IgG^^ 1:1,000 4-4-24-3-5 IgG2a -1:5,000 ;v 4-H-3-1-8 IgG1 '8-9-94-4-2 IgG2a :2 4-10-30-3-1 IgG2a : 75-10-17-14-4 IgG- 25 y 2a ' · 92-10-26-32-39 Ei luokiteltu * 2 · • · · * · · * 2 » 2 • » » · · 30 t » » · · , ·. Cell lines derived heavy chain IgG2a Tiitteri1 4-1-4-20-3 to 1: 5,000 4-1-4-18-1 1gG2a ° 4-5-7-3 19G2a 1 to 1: 5,000 4-2-3-17-7 igG2a 3- 7-1-20-24 19G2a to 1: 10,000 4- 8-15-2-6 IgG2a 4-7-21-14-9 ig ^ a 54- 15 4-10-45-1-16 igG2a 2-1-39-2 IgG2a to 1: 10,000 4-6-12-3-17 19G2a 52-1-31-24-2 IgG2a 4-3-11-46-1 IgG2a 3- 7-9-9- 3 86-1-38-15 IgG 2a, IgG, 1: 1000 20 ^ ^^ 4- 5-6-1 IgG 1: IgG2a 4-4-24-3-5 1.000 to 1: 5.000, v 4-H-3 IgG1 -1-8 '8-9-94-4-2 IgG2a two 4-10-30-3-1 IgG2a 75-10-17-14-4 25 IgG 2a y' · 26/10/92 -32-39 Not classified * 2 · • · · * · · * 2 »2 •» »· · 30 t» »· · ·. : 1 Askiitisnesteet tiirattiin 100 ng:llä puhdasta entsyymiä kiinteäfaasisessa ELISAssa. 1 Askiitisnesteet terns of 100 ng of pure enzyme in a solid phase ELISA.

44 110433 B. Hiirissä valmistettujen monoklonaalisten vasta-aineiden puhdistusmenetelmä 44 110433 cleaning method B. produced monoclonal antibodies in mice

Yllä olevilla menetelmillä valmistetut α-amidointientsyymille spesifiset monoklonaali-5 set vasta-aineet puhdistetaan seuraavasti. prepared by the above methods, α-amidation enzyme specific monoclonal set-5 antibodies were purified as follows. Useista samalla kloonilla inokuloiduista hiiristä kerättyjä askiitis-nesteitä käytettiin vasta-ainelähteenä. A number of clones collected from the same mice were inoculated askiitis fluids were used as source of antibody. Askiitisneste laimennettiin (5-kertaiseksi) 10 mM MES:illä, pH 5,6. Askiitisneste was diluted (5-fold) in 10 mM MES public, pH 5.6. Laimennettu askiitis-neste laitettiin 1,5 x 20 cm:n pylvääseen, joka sisälsi 40 pm ABX sekasilikahartsia (JT Baker), joka oli edellä tasapainotettu 10 mM MES-puskurilla, pH 5,6. Askiitis-diluted liquid was placed 1.5 x 20 cm column containing 40 pm of ABX sekasilikahartsia (JT Baker) which had been equilibrated with the 10 mM MES buffer, pH 5.6. Monoklonaaliset vasta-aineet eluoitiin pyl-io väästä käyttämällä 0 - 500 mM natriumasetaattigradienttia, pH 7,0. Monoclonal antibodies were eluted from the column with flippers-io using 0 - 500 mM natriumasetaattigradienttia, pH 7.0. Puhdistettuja vasta-aineita sisältävät fraktiot yhdistettiin, testattiin spesifisen aktiivisuuden suhteen ja varastoitiin 4 °C:ssa myöhempää käyttöä varten. The purified antibodies were pooled, tested for specific activity, and stored at 4 ° C for later use.

C. a-amidointientswmille spesifisten polvklonaalisten vasta-aineiden tuottaminen ka-15 noissa C. a amidointientswmille specific polyclonal antibodies to ka-15 production in these

Intravenoosisia, intramuskulaarisia ja subkutaanisia injektioita annettiin kahdelle munivalle kanalle käyttämällä kaikkiaan n. 50 pg puhdistettua α-amidointientsyymiä Ri-biadjuvantissa kummankin kanan kohdalla. Intravenous, intramuscular and subcutaneous injections were administered to two laying hen with a total of approx. 50 pg of purified α-amidating enzyme R-biadjuvantissa into each chicken. Ribi-adjuvantti on täysin metabolisoituva 20 lipidiemulsiojäijestelmä, joka koostuu kanan lymfosyyttien mitogeenistä ja adjuvantista vastaainereaktion parantamiseksi antigeenien suhteen siipikarjassa (Ribi Immunochem t « · · ' ·:: Research, Montana). Ribi adjuvant is entirely metabolisable 20 lipidiemulsiojäijestelmä consisting of mitogenic and adjuvant chicken lymphocytes to improve the antibody response to antigens in poultry (Ribi Immunochem t «· · '· :: Research, Montana). Alkuimmunisoinnin jälkeen annettiin kaksi tehosteinjektiota kah- • · . After the initial immunization, two booster was given two • ·. ' : den viikon välein käyttämällä n. 30 pg entsyymiä kanaa kohden. '. Every six weeks by using 30 pg of enzyme per chicken. Eläimistä otettiin verta : : i 21. päivänä ja 35. päivänä ja seerumit käsiteltiin ja analysoitiin spesifisten vasta- • ',· 25 aineiden läsnäolon suhteen seuraavalla menetelmällä: molempien kanojen seerumit, 0. Animals were bled: i at day 21 and day 35 and the sera processed and analyzed for specific antibody • ', · the presence of material 25 by the following procedure: sera from both chickens, 0.

• i » \ '· · päivä (esi-immuuni), 21. päivä ja 35. päivä, analysoitiin kiinteäfaasisella ELISAlla puh distetun a-amidointientsyymin 100 ng.tä vastaan. • i »\ '· · day (pre-immune), day 21 and day 35, were analyzed by solid phase ELISA tel-proven a-amidating enzyme against 100 ng.tä. Naudan seerumialbumiinia käytettiin ' * * ' negatiivisena kontrollinoa epäspesifiselle vastaainesitoutumiselle. Bovine serum albumin was used as '*' negative kontrollinoa nonspecific vastaainesitoutumiselle. Entsyymille spesifi- • * • · ·' set vasta-aineet osoitettiin kanin kanan IgG:n vastaisilla alkalisella fosfataasilla merki- • · '·.:. Enzyme specificity • * • · · "Set antibodies were detected with rabbit chicken IgG anti-alkaline phosphatase importance • · '·.:. · 30 tyillä seerumeilla. · 30 tyillä sera.

t » 1 ' ·': Yllä esitettyjen menetelmien tulokset osoittivat, että spesifisiä vasta-aineita voitiin tt osoittaa kanan 257 seerumeissa 35. päivänä. T "1" · "the results of the methods described above showed that specific antibodies could be tt 257 shows chicken sera on day 35. Suhteessa 1:10.000 laimennettu seerumi 110433 45 tuotti signaalikohinasuhteeksi n. 4:1. Relative to 1: 10,000 diluted serum 110433 45 gave the signal to a 4:. 1. Kanassa 258 esiintyi entsyymille spesifisiä vasta-aineita 21. ja 35. päivänä. In chicken 258 showed enzyme-specific antibodies 21 and day 35. Molemmista verenotoista suhteessa 1:10.000 laimennetut seerumit tuottivat signaalikohinasuhteeksi n. 4:1. Both bleed with 1: 10,000 diluted sera yielded the signal to a 4:. 1. Munien kerääminen molemmista ka-| Collection of the eggs of both potassium | noista käynnistettiin 5 6. päivänä. those launched 5 6 December. Esi-immuunien munien ja immunisoinnin j älkeisten 5 munien polyetyleeniglykoli- (PEG) saostuksella eristetyt IgY:t analysoitiin Ouchter-lonyn menetelmillä ja entsyymille spesifiset vastaaineet analysoitiin ELISAlla. 5 eggs in the polyethylene glycol pre-immune eggs and immunization j älkeisten (PEG) is isolated by precipitation of the IgY's were analyzed Ouchter-lonyn methods and enzyme-specific antibodies were analyzed by ELISA.

D. Kanan IgY-vasta-aineiden puhdistus io α-amidointientsyymille spesifisiä linnun polyklonaalisia vasta-aineita valmistettiin kanoissa yllä esitetyllä tavalla. D. Purification of chicken IgY antibodies io α-amidation enzyme specific for the avian polyclonal antibodies prepared in chickens as described above. Immunisoitujen kanojen munat kerättiin ja joko upotettiin parafiiniin tai jäädytettiin, kunnes ne käytettiin IgY:n puhdistamiseksi. Immunized hens' eggs were harvested and either frozen or paraffin embedded until used IgY purifying. Munanvalkuaiset erotettiin keltuaisista, jotka sisälsivät a-AE:lle spesifisiä vasta-aineita. The egg whites were separated yolks containing alpha-AE-specific antibodies. Munankeltu-aiset laimennettiin 3-kertaisiksi käyttämällä 10 mM natriumfosfaattia, pH 7,5, joka si-15 sälsi 0,1 M NaChä ja 0,01 % natriumatsidia. Munankeltu-whites, diluted 3-fold using 10 mM sodium phosphate, pH 7.5, Si-15 Salsi 0.1 M NaCl and 0.01% sodium azide. PEG-saostuksen alkuvaihe suoritettiin käyttämällä PEG 8000:n 3,5:n loppukonsentraatiota. PEG precipitation of the first step was carried out using PEG 8000 as final concentration: 3.5 approx. Sakan annettiin muodostua 30 minuutin ajan huoneen lämpötilassa, sitten se lingottiin ja supematantti (sisälsi IgY:tä) säästettiin. Precipitate was allowed to form for 30 minutes at room temperature, then centrifuged and the supernatant (containing the IgY) saved. Lisää PEG:tä lisättiin supematanttiin lopullisen konsentraation saattamiseksi 12,5 %:iin PEG:tä. More PEG was added to the supernatant to bring the final concentration to 12.5% ​​PEG. IgY-vastaaineet saostettiin tässä PEG:n konsentraatiossa japelletoi-20 tiin linkoamalla. The IgY antibodies precipitated at this PEG concentration japelletoi-20 added by centrifugation. Tämän puhdistuvaiheen IgY-vasta-aineet puhdistettiin edelleen kahdel-la menetelmällä: »t » » • · * · * !'·*: 1) Saostetut IgY-vasta-aineet suspendoitiinuudelleen 10 mM MES:issä, pH 5,6, sitten • · t ί { dialysoitiin yön yli 4 °C:ssa tätä samaa puskuria vastaan. This puhdistuvaiheen IgY antibodies were purified further by the process with t-: "T" "• · · * * '* ·: 1) The precipitated IgY antibodies suspendoitiinuudelleen 10 mM MES, pH 5.6, then • · t {ί dialyzed overnight at 4 ° C against the same buffer. Näyte laitettiin sitten 1,5 x 20 < » · • V 25 cm:n pylvääseen, joka sisälsi 40 pm seka-ABX-silikahartsia (JT Baker). The sample was then placed in a 1.5 x 20 < "• V · 25 cm column containing 40 pM mixed ABX silikahartsia (JT Baker). Seuraava •« · V · puhdistusjäijestys oli sama kuin se, joka esitettiin askiitis-nesteen yhteydessä. • Next «· V · puhdistusjäijestys was the same as that which was presented in connection with askiitis-liquid.

• · • · * ' * * ' 2) Vaihtoehtoisesti IgY:tä sisältävä pelletti suspendoitiin uudelleen alkupuskuriin ja · · • • * '*' 2) Alternatively, the IgY-containing pellet was resuspended and alkupuskuriin

Ml • I Ml • I

• * · ' sitten saostettiin uudelleen käyttämällä kyllästettyä ammoniumsulfaattia (3:1 v/v). • * · 'is then again precipitated using saturated ammonium sulfate (3: 1 v / v).

• · V,: 30 IgY:tä sisältävä pelletti suspendoitiin uudelleen pieneen määrään tislattua H20:ta ja • · V ,: 30 IgY-containing pellet was resuspended in a small amount of distilled H20 O and

Ml :... · varastoitiin 4 °C:ssa myöhempää käyttöä varten. MI · ... stored at 4 ° C for later use. Kanan IgY:n immobilisaatiomenetel- i I * * *: mä on esitetty esimerkissä 12. Chicken IgY immobilisaatiomenetel- i I * * * I is shown in Example 12.

» * tii • II • · « 110433 »* Tues • II • ·« 110433

Esimerkki 9 Example 9

Alfa-amidointientswmiaktiivisuuden kineettiset tutkimukset Alfa-amidointientswmiaktiivisuuden kinetic studies

Alfa-amidointientsyymi, joka oli puhdistettu homogeeniseksi (sekä medullaarisista kil-5 pirauhaskarsinooman CA-77-soluviljelystä että vastaavasta tuumorikudoksesta, joka oli poistettu laboratoriorotista), toimii inaktiivisten glysiinillä laajennettujen peptidipro-hormonien muunnossa bioaktiivisiksi C-terminaaliksi amideiksi. The alpha-amidating enzyme purified from gay sex gene (as well as medullary kil 5 pirauhaskarsinooman CA-77 cell culture, and the corresponding tumor tissue that had been removed to laboratory), in the inactive glycine-extended peptidipro hormones conversion bioactive C-terminal amides. Tutkimuksiimme perustuen prohormonin C-terminaalisen aminohapon on oltava glysiinitähde, jotta entsyymi tunnistaa senja amidoi sen seuraavasti: io amidointientsyymi RX-Gly-COOH + 02 -> RX-CONH2 + HCO-COOH + H20 pelkistin hapetettu pelkistin is Tämän aktiivisuuden in vitro-uudelleenmuodostus vaatii ehdottomasti peptidisubstraatin lisäksi molekyylihappea ja pelkistysainetta (L-askorbiinihappoa). Based on studies of the prohormone C-terminal amino acid must have a glycine residue, so that the enzyme recognizes senja amidoi the following: io amidating enzyme RX-Gly-COOH + 02 -> Rx-CONH 2 + HCO-COOH + H20 reducing agent is oxidized reducing agent is present activity in vitro re-forming insists definitely a peptide substrate in addition to molecular oxygen and a reducing agent (L-ascorbic acid). Olemme kuitenkin todenneet, että entsymaattista aktiivisuutta voidaan olennaisesti lisätä lisäämällä Cu+2-ioneja (kuparisulfaattia) ja katalaasia. We have found, however, that the enzymatic activity can be substantially increased by the addition of Cu + 2 ions (copper sulfate) and catalase. Tämä eksogeeninen kupari sidotaan entsyymillä ja käytetään molekyylihapen sitomis-ja aktivoimispaikkana. This exogenous copper is bound to an enzyme and used to bind the molecular oxygen and aktivoimispaikkana. Toisaalta katalaasi on ent-20 syymi, joka toimii vetyperoksidin huuhtelemiseksi, jota voisi muuten kerääntyä sivure- « « · · . On the other hand catalase is ent-20 enzyme, which acts to flush the hydrogen peroxide, which could otherwise accumulate in sivure- «« · ·. * ·:: aktioiden johdosta, joissa tarvitaan happea, askorbaattia, kuparia, ja joka voisi hävittää « · !*·*: amidointientsyymin. * · :: due to carbohydrates, which require oxygen, ascorbate, copper, and could dispose of «· * · *! Amidating enzyme.

♦ · • · · • · · · \ Olemme onnistuneesti kehittäneet herkkiä ei-radiometrisiä analyysimenetelmiä alfa- • · · : 25 amidointientsyymiaktiivisuuden osoittamiseksi. ♦ • · · · • · · · \ We have successfully developed a sensitive non-radiometric methods of analysis of alpha • · ·: 25 to demonstrate amidointientsyymiaktiivisuuden. Näissä analyyseissä käytetään synteetti siä tripeptidisubstraatteja. In these assays, a synthetic SIA tripeptidisubstraatteja. Näiden substraattien amidointia valvotaan edullisesti erotta- • · *. These substrates amidation preferably controlled separation • · *. *: maila ja määrittämällä laadullisesti tuote (amidoitu dipeptidi ja substraattitripeptidi) • · · * käyttämällä HPLC:tä. * Racket and determining product quality (amidated dipeptide and substraattitripeptidi) • · * using HPLC. Herkimmässä kehitetyistä analyyseistä käytetään substraattina • · v.: monodansyyli-L-Tyr-Val-Gly:tä. developed in the most sensitive assays are used as the substrate • · v .: monodansyyli-L-Tyr-Val-Gly. Tämä yhdiste voidaan osoittaa erittäin alhaisilla ta- •... · 30 soilla, koska dansyyliryhmä on fluoresoiva. This compound can be demonstrated very low TA • ... • 30 levels because the dansyl group is fluorescent. Siten tämän analyysin herkkyyttä voidaan verrata muissa laboratorioissa kehitettyihin samankaltaisiin radiometrisiin analyyseihin. Thus, this sensitivity analysis can be compared to developed in other laboratories to similar radiometric analysis.

• · « · · * · · 110433 47 • · «· * · · · 110433 47

Olemme käyttäneet tätä analyysiä alfa-amidointientsyymin kineettisten ominaisuuksien tutkimiseksi. We have used this analysis to study the kinetic properties of alpha-amidating enzyme. Etenkin kineettiset parametrit Km ja Vmax on määritetty tutkimalla sub-straattikonsentraation vaihtelun vaikutusta entsyymiaktiivisuuteen. In particular, the kinetic parameters Km and Vmax is determined by examining the sub-straattikonsentraation will affect the enzyme activity. Km on affiniteetin mitta, joka entsyymillä on erityisen substraatin suhteen. Km is a measure of the affinity that the enzyme has a specific relation to the substrate. Mitä pienempi Km on, sitä pie-5 nempi on affiniteetti. The smaller the Km, the pie-5 nempi is affinity. Vmax on maksimaalinen nopeus, jossa entsyymi muuntaa sub- ij straatin tuotteeksi ja joka havaitaan substraatin kyllästyskonsentraatioissa (so sub- ! straattia on läsnä suurena ylimääränä entsyymin suhteen). Vmax is the maximum rate at which the enzyme converts the sub-ij product as substrate and detecting the saturation concentration of the substrate (i.e., sub! Straat is present in large excess relative to the enzyme).

| | ji ji

Tyypillisessä amidointientsyymianalyysissä reaktiojärjestelmä (50 ui) käsittäisi entsyy-io miä (n. 7 pg), dansyyli-L-TyrVal-Gly:tä (korkeintaan 40 μΜ), L-askorbiinihappoa (3 mM), katalaasia (0 -100 pg ml'1) ja kuparisulfaattia (0-2 uM) 60 mM TES-puskurissa, pH 7,0. In a typical amidointientsyymianalyysissä the reaction system (50 ul) would comprise an enzyme-io systems (7 pg.), Dansyl-L-TyrVal-Gly (up to 40 μΜ), L-ascorbic acid (3mM), catalase (0 -100 pg ml- 1), and copper (0-2 M) in 60 mM TES buffer, pH 7.0. Reaktio käynnistetään 37 °C:ssa lisäämällä entsyymiä ja päätetään määrätyn ajan kuluttua lisäämällä 0,1 M EDTA:ta (loppukonsentraatio), joka sitoo kuparin tekemällä se sellaiseksi, että se ei ole entsyymin käytettävissä. The reaction is initiated at 37 ° C by the addition of enzyme and terminated after a predetermined time by the addition of 0.1 M EDTA (final concentration), which binds copper, by making it so that it is not available for the enzyme.

15 15

Alfa-amidointientsyymi omaa korkean affiniteetin dansyyli-LTyr-Val-Gly:n entsymaat- tisen amidoinnin suhteen, jolloin Km on 1 - 2 pM. The alpha-amidating enzyme has a high affinity for dansyl-LTyr-Val-Gly tisen respect to enzymatic amidation with a Km is the 1 to 2 pM. Tämä arvo näyttää olevan vakio entsyymin puhtausasteesta huolimatta. This value appears to be constant in spite of the degree of purity of the enzyme. Siten entsyymivarastolla, joka on johdettu Thus, the enzyme storage batteries, which is derived from

Sephacryl S-300 kromatografiasta, on sama Km kuin entsyymin elektroforeettisesti ; Sephacryl S-300 chromatography is the same Km as the electrophoretically enzyme; ; ; 20 puhtailla valmisteilla, joka on johdettu Mono Q-kromatografiasta (pH 8,0) tai alemman • · · · /··; 20 with purified preparations derived from the Mono Q chromatography (pH 8.0) or lower • · · · / ··; molekyylipainon omaavista muodoista, jotka on analysoitu Mono Q-kromatografialla, pH 6,0. the molecular weight of these formats, which were analyzed on a Mono Q chromatography at pH 6.0. Toisaalta, kuten odotettiin, Vmax-arvot (ilmaistuna proteiinin mg:a kohden) : : *: vaihtelevat olennaisesti puhdistusasteen mukaisesti. On the other hand, as expected, V max values ​​(expressed as mg of protein per a): *: vary substantially in accordance with the degree of cleaning. Siten kun Sephacryl S-300:sta joh- \ ' · detun varaston Vmax on n. 50- 100 nmoolia tuotetta/min./mg proteiinia, puhtaan tuu- ·' 25 morientsyymin Vmax on n. 5000 nmoolia tuotetta/mg proteiinia. Thus, when a Sephacryl S-300 due to \ "availability · Vmax is the nozzle sections of 50 to 100 nmol product / min / mg protein, tumor · pure.. '25 morientsyymin Vmax is about 5000 nmol product / mg protein..

• · • tl •. · • • • teaspoon. ·: Olemme todenneet, että askorbaatti ja substraatti voivat kilpailla keskenään entsyymistä • · · • · •. ·: We have found that ascorbate, and the substrate can compete with one another enzyme · • · • · •. · ' joissakin olosuhteissa. · "In some circumstances. Esimerkiksi jos substraatin konsentraatiota lisätään olennaisesti • · ί, V kyllästystason yli, entsyymiaktiivisuus laimenee entsyymin ja askorbiinihapon välisen • » · :· 30 heikentyneen vuorovaikutuksen johdosta. For example, if the concentration of the substrate has been substantially increased over ί • · V saturation, diluted in enzyme activity between the enzyme and the ascorbic acid • »· · 30 due to the weakened interaction. Siten jokaiselle erityiselle substraatille näyt- • ' · *: tää olevan hieno tasapaino optimaalisten substraatti/askorbaattitasojen välillä riippuen • · : ' \: entsyymin affiniteetista erityisen substraatin suhteen. Thus for each particular substrate samples • '· * MPLIANCEWITH to be a fine balance, depending on the optimal substrate / between askorbaattitasojen • ·' \ 'special affinity for the enzyme to the substrate.

f 48 110433 f 48 110433

Amidointientswmin affiniteetti glvsiinillä laajennettujen peptidien suhteen Amidointientswmin glvsiinillä affinity with respect to the extended peptides

Olemme käyttäneet monodansyyli-L-Tyr-Val-Gly-amidoinnin analyysiä herkkyyskoet-timena amidointientsyymin ja useiden gly-laajennettujen peptidiprohormonien väliselle 5 reaktiolle. We have used monodansyyli-L-Tyr-Val-Gly-amidation analysis of the sensitivity of the test-solvent-amidating enzyme, and between the plurality of extended gly-5 peptidiprohormonien reaction. Tämän tutkimuksen tarkoituksena oli tutkia entsyymin suhteellista affiniteettia määrättyjen erityyppisten peptidisubstraattien sitoutumisen suhteen. The purpose of this study was to investigate the different types of peptide substrates with respect to the relative affinity of the enzyme provided for engagement. Vaikka olemme osoittaneet aikaisemmin, että entsyymi amidoi onnistuneesti ihmisperäisen kalsitoniinin ja ihmisperäisen kasvuhormonia vapauttavan tekijän glysiinillä laajennettuja prekurso-risubstraatteja, tämä ei kerro mitään entsyymin kyvystä sitoa ensisijaisesti näitä tai mui-10 ta peptidejä toistensa suhteen. While we have shown previously that the enzyme amidoi successful human calcitonin and human growth hormone releasing factor glycine-extended prekurso Receptor Substrate, this says nothing about the ability of the enzyme to bind primarily to these or mui-10 ta peptides relative to each other.

Olemme osoittaneet, että glysiinillä laajennettu alfa-melanosyyttiä stimuloiva hormoni, substranssi P, vasopressiinianalogit ja kasvuhormonia vapauttava tekijä ovat keskinäisessä vuorovaikutuksessa suurella affiniteetilla amidointientsyymin kanssa estäen sitä is metabolisoimasta dansyyli-LTyr-Val-Gly:tä. We have demonstrated that the glycine-extended alpha-melanocyte-stimulating hormone, substranssi P, vasopressin analogues and growth hormone releasing factor are interacting with high affinity with the amidation enzyme, preventing it is metabolised dansyl-LTyr-Val-Gly. Edelleen ihmisperäisen glysiinillä laajennetun kalsitoniinin, neuropeptidi Y:n, kolekystokiniinin, kortikotrofiinia vapauttavan tekijän ja kalsitoniini-geenin sukuisen peptidin viittä C-terminaalista aminohappotähdettä vastaavat pentapeptidimallit osoittavat kilpailua tässä analyysissä. Further, glycine-extended human calcitonin, neuropeptide Y, cholecystokinin, corticotrophin releasing factor and calcitonin gene-related peptide of the five C-terminal amino acid residues corresponding to pentapeptidimallit show competition in this assay. Toisin sanoen entsyymi pystyy sitomaan ja oletettavasti amidoimaan kaikki nämä 20 glysiinillä laajennetut peptidisubstraatit. In other words, the enzyme is capable of binding and presumably the amidation of these glycine-extended 20 peptide substrates.

t I · * • · • · · f · I t * · • · • · · · f

Sitä vastoin tutkittaessa näitä substraatteja vastaavia amidoituja peptidejä niiden todet-i : *: tiin olevan paljon vähemmän kykeneviä olemaan vuorovaikutuksessa entsyymin kanssa, i * : Tämän entsyymin katalyyttisen paikan kapasiteetti tunnistaa suuri määrä glysiinillä laa- v : 25 jennettuja substraatteja tekee siitä erittäin käyttökelpoisen yleisen reagenssin yhdistel- mä-DNAtekniikalla tuotetun peptidiprohormonin kaupalliselle amidoinnille. In contrast, the study of the substrates corresponding to amidated peptides of the true-i * to be much less able to interact with the enzyme, i * the catalytic site of this enzyme is to recognize the capacity of a large number of glycine quality of v-extended substrates 25 makes it a very useful general reagent a combination of I-DNAtekniikalla commercial amidation peptidiprohormonin produced.

« · «·

Esimerkki 10 • · • s/· DNA-sekvenssin koodaavan huipun III α-amidointientswimn eristys 30 : * · ': Koko RNA valmistettiin rotan MTC-kudoksesta käyttämällä guanidiinitiosyanaatti- : * \ i menetelmää. Example 10 • • p · / · a DNA sequence of peak III α-amidointientswimn encoding insulation 30 * · ': Total RNA was prepared using the rat MTC tissue guanidiinitiosyanaatti- * \ I method. Poly-A-RNA valittiin oligodT-selluloosalla. Poly A RNA was selected with oligo-cellulose.

49 110433 cDNA-svnteesi 49 110433 cDNA svnteesi

Kaksisäikeinen cDNA valmistettiin hyvin tunnetuilla menetelmillä. Double-stranded cDNA was prepared by well-known methods. Käyttämällä rotan MTC-kudoksesta peräisin olevaa poly-A-RNA:ta mallina ja oligo-dTi2-i8:ta pohjana 5 ensimmäinen säiesynteesi suoritettiin entsymaattisessa reaktiossa käänteistransskriptaa-silla. Use of the rat MTC tissue-derived poly-A-RNA as template and oligo-dTi2-i8 as a basis 5 säiesynteesi first subjected to an enzymatic reaction, a reverse transcriptase-public. cDNA ja RNA erotettiin ja RNA pilkottiin alkalilla. The cDNA and RNA was isolated and the RNA was digested with alkali. cDNArn toinen säiesynteesi itsekäynnistettiin käyttämällä E. colin DNA-polymeraasia I. Sl-nukleaasisulatusta käytettiin cDNA.n hiusneulasilmukoiden poistamiseksi ja cDNA:n yksisäikeisten alueiden hajottamiseksi. cDNA as second säiesynteesi itself was started using E. coli DNA polymerase I. SI nukleaasisulatusta was used to remove the cDNA and the cDNA hiusneulasilmukoiden to degrade the single-stranded regions. DNApolymeraasi I:n kanssa suoritetun reaktion jälkeen tasaisten päiden 10 tuottamiseksi kaksoissäikeinen cDNA käsiteltiin EcoRlmetylaasilla ja s-adenosyyli- metioniinillä EcoRl-paikkojen metyloimiseksi ja niiden suojaamiseksi myöhemmältä entsymaattiselta lohkaisulta. DNA polymerase I. After the reaction with the 10 produce blunt ends of the cDNA kaksoissäikeinen EcoRlmetylaasilla and treated with p-adenosyl- methionine to methylate the EcoRI-sites and to protect them from subsequent enzymatic cleavage. EcoRl-sitojat yhdistettiin cDNA:han. EcoRI linkers were joined to the cDNA. EcoRl-sulatuksen jälkeen ylimääräiset sitojat erotettiin cDNA:sta ja cDNA jakofraktioitiin Sepharose 4B-pylväällä. After defrosting, the additional EcoRI linkers were separated from the cDNA and the cDNA jakofraktioitiin Sepharose 4B column. Yhtä tällaista synteesiä varten molekyylit, jotka olivat suurempia kuin 500 15 emäsparia, kerättiin, kun taas toisessa molekyylit, jotka olivat suurempia kuin 1000 emäsparia, yhdistettiin kloonausta varten. For one such synthesis, molecules of greater than 500 15 base pairs was collected, while in the other molecules that were greater than 1000 base pairs were pooled for cloning.

λ gtl 1 cDNA-kiriaston muodostaminen . GTL λ 1 cDNA Library formation. ·. ·. 20 Sitojilla sovitetun kaksisäikeisen cDNA:n synteesin jälkeen molekyylejä käytettiin 20 arranged binders a double-stranded cDNA was then used in the synthesis of molecules

'.:; ':.; cDNA-kiqastojen tuottamiseksi vektorissa Xgt 11. Tämä suoritettiin liittämällä cDNA to produce a cDNA-vector kiqastojen XGT 11. This was accomplished by linking the cDNA

;*·; ; * ·; Xgt 11 DNA:han,joka oli lohkaistu EcoRl:llä ja käsitelty fosfataasilla vektori-DNA:n : : *: itseyhdistymisen estämiseksi. XGT 11 DNA which had been cleaved with EcoRI and phosphatase treated vector DNA: * prevent self unification. DNA:n liittämisen jälkeen rekombinoidut DNA:t pakat- : · : tiin in vitro infektioosisten bakteriofagihiukkasten tuottamiseksi. DNA after incorporation recombined DNAs are packaged: ·: the in vitro to produce infectious bakteriofagihiukkasten. (Pakkaamisuutteet : : : 25 ovat kaupallisesti saatavia yhtiöltä Promega Biotech tai Clontech Laboratories tai ne voidaan valmistaa vakiomenetelmillä). (Packaging extracts::: 25 are commercially available from Promega Biotech or Clontech Laboratories or can be prepared by standard methods).

• · * • · ... * DN A:n pakkaamisen j älkeen määräosia pakkausseoksesta testattiin kirj astoj en rekom- : Y: binanttien määrän määrittämiseksi. • • · · * ... * DN A packaging following upon the number of elements were tested as package lit recombinant libraries it: Y: determining the number of recombinants. Yhden kirjaston todettiin sisältävän n. 2,57x106 :,,,: 30 infektioosista hiukkasta, joista n. 78 % oli ilmeisiä rekombinantteja (muodostaen selvät \' · '; plakit X-Gal-levyillä kasvatettaessa IPTG:n läsnäollessa). One of the library were found to contain the 2,57x106: ,,,:.. 30 infectious particles, of which about 78% were apparent recombinants (forming a clear \ '·'; plaques with X-Gal-IPTG plates when grown in the presence of). Toisen kirjaston todettiin : * ·. The second library were found: * ·. I sisältävän n. 2,75 x 106 kaikkiaan plakin muodostavia yksiköitä ja n. 81 % ilmeisiä re kombinantteja. I-containing approx. 2.75 x 106 total plaque forming units and approx. 81% apparent to re kombinantteja.

110433 50 110433 50

Kirjaston analysointi The library analysis

Sen tunnistamiseksi, mikä rekombinoitu bakteriofagi sisälsi alfa-amidointientsyymin 5 proteiinin cDNA:n, fagit analysoitiin radioaktiivisesti merkityillä oligonukleotidi-koettimilla, jotka oli muodostettu alfa-amidointientsyymin spesifisistä aminohapposekvensseistä. The identifying which recombinant bacteriophage containing alpha amidating enzyme cDNA 5 of the protein's, the phages were analyzed for the radioactively labeled oligonucleotide probes, which were formed from the alpha-amidation enzyme specific amino acid sequences. (Ks. esimerkki 7, taulukko II). (See., Example 7, Table II). Analysointi suoritettiin päällystämällä bak-teriofaginäytteet ja nostamalla fagit selluloosanitraattisuodatuskiekoille. Analysis was carried out by coating the bak teriofaginäytteet and lifting the phage selluloosanitraattisuodatuskiekoille. Menetelmät fagien immobilisoimiseksi selluloosanitraattisuodattimilla ovat laajalti tunnettuja. Methods of immobilizing the phages of cellulose nitrate are widely known in the art. Jo-10 kaisesta levystä saadut kaksoissuodattimet hybridisoitiin 32P-merkityllä oligonukleoti-dillä AE 9. Hybridisaatio suoritettiin 37 °C:ssa 20 - 24 tunnin kuluessa, 6 x NET, 0,5 % NP40, 5 x Denhardt'in liuosta, 100 pg/ml lohen siemenneste-DNA:ta, oligonukleotidi-koettimella 0,3 - 0,4 pmoolissa/mg. Even the double-10 filters data from each plate were hybridized with 32P-labeled oligonucleotide AE ​​9. Hybridization hydride at 37 ° C for 20 - 24 hours, 6 x NET, 0.5% NP40, 5 x Denhardt's solution, 100 pg / ml salmon sperm DNA, an oligonucleotide probe 0.3 - 0.4 pmoolissa / mg. Hybridisaation jälkeen suodattimet pestiin 6 x SCC:ssä 44 45 °C:ssa useiden tuntien ajan ja röntgenfilmattiin. After hybridization, the filters were washed in 6 x SSC at 44 to 45 ° C for several hours and röntgenfilmattiin. Positiivisesti hybridisoi-15 tuvat fagit tunnistettiin yhdenmukaisina täplinä kaksoissuodattimilla. Positively hybridized to a 15-Huts phages identified as consistent as spots on the double. Nämä puhdistettiin rikastamalla järjestyksessä useilla päällystys-ja hybridisointikier- roksilla. These purified by enriching the order of the coating and a plurality of beds to hybridisointikier-. N. 4 - 5 x 104 analysoidusta fagista 18 tunnistettiin AE 9:llä. N. 4 to 5 x 104 phage analyzed, 18 were identified by AE 9.

Spesifisyyden vertaamiseksi valinnassa suoritettiin hybridisaatio toisella alfa-20 amidointientsyyminukleotidillä, AE 8:11a. Comparing the specificity of the hybridization with the selection of another alpha-20 amidointientsyyminukleotidillä EA 8: 11 a. Tämä koetus osoitti, että vähintään neljä kah- • » 11 · •.:. This test showed that at least four two • »11 • ·.:. deksasta fagista sisälsivät alfa-amidointientsyymiproteiinisekvenssien cDNArn. deksasta phage containing the cDNA as alpha-amidointientsyymiproteiinisekvenssien. Tämä • * • ♦ • V. vahvistettiin ylimääräisellä oligonukleotidihybridisaatiolla (AE 4:llä ja AE 5:llä) sa- : moin kuin DNAsekvenssianalyysillä. This • * • ♦ • V was confirmed by an additional oligonucleotide hybridization (AE 4 and AE by 5) the same: well as the DNAsekvenssianalyysillä.

t M · • · · • · · • · 25 α-amidointientswmin ilmaisu •, ' · · Huipun III a AE:lla, jolle olemme määrittäneet proteiinisekvenssit, on molekyylipaino- '... · na n. 75.000 daltonia. T · M • • · · · · · 25 • α-amidointientswmin • expression, '· · peak IIIa AE, respectively, which we have determined the protein, the molecular weight is' ... na · s to 75,000 Daltons.. Jos aminohapon keskimääräiseksi molekyylipainoksi otetaan 120 : V: daltonia, silloin amidointientsyymissä on korkeintaan 625 aminohappoa. If the weight average molecular weight amino acid into 120 V daltons, then the amidating enzyme has up to 625 amino acids. 625 aminoha- : _ 30 pon geenin täytyy sisältää vähintään 1875 emäsparia. Amino acids 625: 30 _ acid, the gene must contain at least 1875 base pairs. Kaikki neljä cDNArta, jotka : v. olemme eristäneet amidointientsyymille spesifisinä, ovat riittävän suuria koodaamaan :" ·. · täysin α-amidointientsyymiproteiinin. Yksi cDNAklooneista, λ AE 1, on pituudeltaan n. All four of the cDNA, which are: v. Have isolated the amidation enzyme specific to detect, are large enough to encode: "· · completely α-amidating enzyme protein One of the cDNA clones, λ AE 1, has a length of approx...

2.200 nukleotidiä. 2200 nucleotides. Ensimmäisillä 50 nukleotidillä toisesta päästä laskien se aloittaa 110433 51 koodaamisen aminohapposekvensseille, joka on tunnistettu huipun III entsyymin ami-nopäätteenä. The first 50 nucleotides from one end of it to start counting 110433 51 encoding the amino acid sequences identified in the peak III enzyme, amino-nopäätteenä. Tästä syystä voidaan päätellä, että cDNA sisältää koko koodauskapasitee-tin, joka tarvitaan huipun III entsyymille. It can therefore be concluded that the cDNA contains the entire koodauskapasitee-catalyst, required for the peak III enzyme. Kim tunnetaan tämä informaatio ja nukleoti-disekvenssit 2.200 emäsparin cDNA:n päissä, on suhteellisen yksinkertaista sovittaa 5 cDNA perimäkloonausta varten prokaryoottiseen isäntään, kuten E. coliin. Kim, this information is known, and the nucleotide sequences 2200 bp cDNA ends, it is relatively simple to adapt the cDNA for 5 perimäkloonausta prokaryotic host, such as E. coli.

Eräs mahdollinen menetelmä, jota voidaan soveltaa λ ΑΕΙ cDNA:han, on esitetty kuviossa XXXII. One possible method that can be applied λ ΑΕΙ cDNA is shown in Figure XXXII. Esimerkiksi λ ΑΕΙ :n 2.200 emäsparin cDNA-sovite eristetään rekom-binoidun bakteriofagi-DNA:n EcoRl-sulatuksen ja agaroosigeelielektroforeesin jälkeen. For example, λ ΑΕΙ the 2200 bp cDNA isolated from the fitting Rekom-cholera bacteriophage DNA after EcoRl-melting and agarose gel electrophoresis.

10 Se kloonataan pBR322:n EcoRl-paikkaan plasmidipAE8-l:n tuottamiseksi. 10, it is cloned into the pBR322 EcoRI site of plasmidipAE8-l to produce. pAE8-l sisältää ainutlaatuisen Kpnllohkaisupaikan cDNA-sekvensseissä ja ainutlaatuisen Hind ΙΙΙ-paikan pBR322-sekvensseissä. pAE8-l contains a unique Kpnllohkaisupaikan cDNA sequences and a unique Hind ΙΙΙ slot pBR322 sequences. pAE8-l:n sulatus Kpnlrllä ja Hind III:lla tuottaa n. pAE8-l Kpnlrllä melting and Hind III to produce approx.

2,15 ke:n fragmentin, joka on menettänyt n. 62 cDNA.n emäsparia (cDNA:n aminopäät-teen koodaavan pään). 2.15 kb fragment, which has lost the 62 bp cDNA. (CDNA coding for the amino termini of tea head). Aminohappojen muodostamiseksi takaisin, jotka löydettiin hui-15 pun III amidointientsyymin amino-päätteessä ja cDNA:n sovittamiseksi kloonausta varten ilmaisuplasmidiin, Kpnl-Hind III-päätteinen fragmentti liitetään oligonukleotidi-sitomissovittajiin. to form the back of the amino acids that were found hui pump 15 III amidating enzyme amino-terminus and cDNA cloning for adjusting the ilmaisuplasmidiin, Kpn I-Hind III-terminal fragment is ligated to oligonucleotide sitomissovittajiin. Esitetyssä esimerkissä käytetään E. colin ilmaisuplasmidia pHH233-2, jota toimittaa Pharmacia. In the illustrated example, an E. coli ilmaisuplasmidia pHH233-2, supplied by Pharmacia. 2,15 ke:n cDNA-fragmentti liitetään kaksisäikeiseen sito-jasovittajaan, joka koostuu .·; 2.15 kb cDNA fragment is ligated to double-stranded sito-jasovittajaan consisting ·;. 20 ..: : 5, 3' .··*·: AE17 (+) 3 0 CATGTCATTTTCCAATGAATGCCTTGGTAC : s ta :'v ja ' ·'· E ' 3 ' ::: AE18(-}2 2 CAAGGCATTCATTGGAAAATGA : at a. .. 20: 5, v, 3 '·' · E '3' ::: AE18 (-} CAAGGCATTCATTGGAAAATGA February 2 '* · ··: AE17 (+) 3 0 CATGTCATTTTCCAATGAATGCCTTGGTAC: p s.' At a .

• · · • · • · V : 25 • · · • · • · V: 25

Sovitettu fragmentti liitetään sitten plasmidiin pKK233-2 DNA, joka on edellä lohkaistu • · :. Flowing fragment is then ligated into the plasmid pKK233-2 DNA that has been cleaved from the • ·. ' ·: NcoLllä ja Hind 111:11a, 4,6 ke:n lineaarisen vektorin tuottamiseksi. '·: NcoI and Hind 111: 11a, 4.6 kb produce a linear vector. Liitetty tuote, • · · • · • · · * pAE12, sisältää cDNA:n alfa-amidointientsyymin, jota edeltää ATG-käynnistyskodoni • · :,:: ja ribosomin sitomispaikka ja hybridin valvonnassa IPTG-indusoitava edistin, trc. Connected to the product, • • · · · · · • * pAE12, contains the cDNA for alpha-amidating enzyme, which precedes the ATG initiation codon • ·:, ::, and a ribosome binding site and under the control of the IPTG-inducible hybrid promoter, the trc. Gee- :30 niä seuraa 5S-geeni ja transskription terminaatiopaikka. Gene 30 of the nia 5S gene and transcription of the termination. pAE12:n IPTGindusoitava il- •' * *: maisu saadaan aikaan plasmidi-DNA:n transformaation jälkeen E. coli-kantaan laciq- • · genotyypillä. pAE12 the air IPTGindusoitava • '* * term not a plasmid DNA after transformation of E. coli strain laciq- • · genotype.

52 110433 λΑΕ1:η 2.2 ke:n cDNA-sovitteen osittainen DNA-sekvenssi 2,2 ke:n sovite poistetaan λ AEl:n EcoRl-sulatuksella ja sovite merkitään 32p:llä. 52 110433 λΑΕ1: η 2.2 kb cDNA adapter partial DNA sequence of 2.2 kb of the fitting removed from the λ AEL EcoRI digestion and the fitting labeled with 32P. Sekundaarisen Hinc 11:11a suoritetun sulatuksen jälkeen saatavat 1,6 ke:n ja 0,6 ke:n frag-5 mentit sekvenssoidaan Maxamin ja Gilbertin kemiallisella hajotusmenetelmällä. obtained after thawing 11a carried 1.6 kb of the secondary Hinc 11 and 0.6 kb frag-five segments sequenced by the Maxam-Gilbert chemical degradation procedure.

DNA-sekvenssi, joka saadaan EcoRl -pään λ AE-1 :n 600 ke:n fragmentin Maxam-Gilbert-sekvenssoinnilla: 10 vvvv 50v aattccggtctttaagaggtttaaagaaactaccagatcattttccaatg vvvv lOOv The DNA sequence obtained by EcoRI -pään λ AE-1 in the 600 kb fragment of Maxam-Gilbert sequencing: 10 yy yy 50v aattccggtctttaagaggtttaaagaaactaccagatcattttccaatg lOOv

AATGCCTTGGTACCATTGGACCAGTCACCCCTCTTGATGCATCAGATTTT AATGCCTTGGTACCATTGGACCAGTCACCCCTCTTGATGCATCAGATTTT

vvvv 150v yyyy 150v

GCGCTGGATATTCGCATGCGTGGGGTTACACCTAAAGAGTCTGACACATA GCGCTGGATATTCGCATGCGTGGGGTTACACCTAAAGAGTCTGACACATA

vvvv 200v yyyy 200v

CTTTCTGCACGTCCATGCGTCTACCT CTTTCTGCACGTCCATGCGTCTACCT

20 DNA-sekvenssi, joka saadaan EcoRl -pään λ AE-1 :n 1600 ke:n fragmentista Maxam- .'·*·: Gilbert-sekvenssoinnilla: • · • » • · * I i » • · · t • · · i « » vvvv 50v 20 DNA sequence, which is obtained by EcoRI -pään λ AE-1 in the 1600 kb fragment of Maxam '* · ·. Gilbert sequencing: · • • »• * i · i» • • · s · · · i «» yyyy 50v

25 AATTCCGTCTCAGTTTCTGTTTCTCTTGCATCTTCTGCAATTCTGAGGAG 25 AATTCCGTCTCAGTTTCTGTTTCTCTTGCATCTTCTGCAATTCTGAGGAG

vvvv lOOv yyyy lOOv

:' ·. '·. · GTGGGTTTGTTCTCCACTTTGGGTTCGACAACTGCCTCGGCTTCTTTG AT · AT GTGGGTTTGTTCTCCACTTTGGGTTCGACAACTGCCTCGGCTTCTTTG

'...· vvvv 150v '... · yyyy 150v

TTCGTGGACTTCGATGCCAGCCTTTTTAACTGACGCATGCTCCATTTTTT TTCGTGGACTTCGATGCCAGCCTTTTTAACTGACGCATGCTCCATTTTTT

• # · ,···. • # ·, ···. vvvv 200v yyyy 200v

30 CGGTCAGGGTGAACTTCCACACGGTGTTGTGTGTGCGCTCGAAGACCG 30 CGGTCAGGGTGAACTTCCACACGGTGTTGTGTGTGCGCTCGAAGACCG

110433 53 ij 110433 53 ij

Sekvenssihomologian tutkiminen olieonukleotidikoettimen AE8(-)22 suhteen Examination of the sequence homology olieonukleotidikoettimen AE8 (-) at 22

Tietokonetutkimus suoritettiin homologian tutkimiseksi aminohappojen, joita käytettiin koettimen AE8 (Leu-Gly-Thr-IleGly-Pro-Val-Thr) tuottamiseksi, ja λΑΕ1:η 600 ke:n 5 fragmentin DNA-osasekvenssin translaation välillä. Computer study was conducted to investigate the homology of amino acids, which were used the probe AE8 (Leu-Gly-Thr-IleGly-Pro-Val-Thr) to produce, and λΑΕ1: η 600 kb fragment of DNA 5 a partial sequence of the translation.

Saatiin täydellisen homologian alue ja tätä aluetta on tähdennetty tähdillä DNA-sekvenssissä ja isoilla kirjaimilla aminohappojen kohdalla. Obtained complete homology region and this region has been highlighted by asterisks in the DNA sequence and upper case letters mark amino acids. Aminohapot, jotka on identifioitu puhdistetun amidointientsyymin NH2-terminaalisella sekvenssoinnilla, on io esitetty sulkumerkeissä. The amino acids identified in the purified amidating enzyme from the NH2-terminal sequencing, io is shown in parenthesis. Aminohappoesitykset, joiden havaitaan poikkeavan niistä, jotka ennustettiin DNAsekvenssillä, on merkitty merkillä Aminohappoesitykset, which are found to differ from that predicted by the DNA sequence are marked with

AATTCCGGTCTTTAAGAGGTTTAAAGAAACTACCAGATCATTTTCCAATG AATTCCGGTCTTTAAGAGGTTTAAAGAAACTACCAGATCATTTTCCAATG

----·----+----·----+----·----+----·----+----1----+ so ipvfkrfkettr(sfsne 15 + ********************** ---- · ---- + ---- + ---- · ---- · ---- · ---- + ---- + ---- 1 ---- + i.e. ipvfkrfkettr (sfsne 15 + **********************

AATGCCTTGGTACCATTGGACCAGTCACCCCTCTTGATGCATCAGATTTT AATGCCTTGGTACCATTGGACCAGTCACCCCTCTTGATGCATCAGATTTT

----·----+—-—·----+----1----+----1----+----·----+ JOO ---- · ---- · --- + ---- + ---- 1 ---- + ---- 1 ---- + ---- + ---- · JOO

C LGT IGPVTpl dasdf + + C LGT IGPVTpl dasdf +

GCGCTGGATATTCGCATGCCTGGGGTTACACCTAAAGAGTCTGACACATA GCGCTGGATATTCGCATGCCTGGGGTTACACCTAAAGAGTCTGACACATA

—---1----+----1----+----1----+----1——+----1----+ 150 20 aldirm.p)gvtpke sdty *'· · + 1 ---- ---- ---- 1 ---- + ---- + ---- + ---- 1 1 - 1 + ---- + ---- 150 20 aldirm.p) gvtpke sdty * '· · +

CTTTCTGCACGTCCATGCGTCTACCT CTTTCTGCACGTCCATGCGTCTACCT

----·----+----1----+----·- 176 .1 flhvhast. · ---- ---- + ---- + ---- 1 ---- · - 176 .1 flhvhast.

• · 1 tt 1 • · · · • · · * 1 · • · • · : : ·1 25 Esimerkki 11 • " - • hh · 1 1 • • · · · · · · * 1 • • · ·: 1 · 11 25 Example of • "-

Entsyymin immobilisointi • 1 1 • < · • · t · » The enzyme immobilization • 1 1 • <· • · T · »

• I • I

.. · ' a-AE:n puhdistus: 1 » • · · • · :.,. · .. 'a-AE Cleaning: 1 »• • · · ·.,. 1 30 Ennen immobilisointia α-amidointientsyymi puhdistettiin heikon anioninvaihto- ja gee- V '': lisuodatuskromatografian (esimerkki 4) avulla. January 30 Prior to immobilization α-amidating enzyme purified by weak anion exchange and gel V '' filtration chromatography (Example 4). Joissakin tapauksissa entsyymivalmiste t # ' · · voidaan puhdistaa edelleen käyttämällä joko immunoaffiniteettikromatografiaa tai fe- nyylisefaroosikromatografiaa. In some cases, the enzyme preparation # s' · · can be further purified by immunoaffinity chromatography using either a phenyl or nyylisefaroosikromatografiaa. Tämän jälkeen suoritettava immobilisointimenetelmä on 110433 54 riippumaton puhdistusmenetelmästä, mutta tavallisesti spesifisen aktiivisuuden tulisi olla vähintään 25 mU ja etenkin 50 mU tai korkeampi. After this, the immobilization is performed 110433 54 independent of the purification process, but generally should be a specific activity of at least 25 mU, especially 50 mU or higher.

a-AE:n immobilisointi: 5 α-amidointientsyymin immobilisointitekniikka perustuu kolmen komponentin, entsyymin, akryyliamidin (PAN) vesiliukoisen kopolymeerin ja alhaisen molekyylipainon omaavan silloitusreagenssin (TET) samanaikaiseen reaktioon. a-AE Immobilization: 5 α-amidating enzyme Immobilization is based on having three component enzyme, acrylamide (PAN) of the water-soluble copolymer and a low molecular weight crosslinking agent (TET) simultaneous reaction. Esivalmistettu polymeeri (PAN) koostuu akryyliamidista ja N-akrylosukkinimidistä, joka on polymeroitu THF-io liuoksessa käyttämällä termistä aloitusta atsobisillä (isobutyronitriili). A preformed polymer (PAN) consists of acrylamide and N-akrylosukkinimidistä, which is polymerized in THF solution using thermal io start of azobis (isobutyronitrile). Silloitusreagenssi voi olla α, ω -diamiini, trietyleenitetramiini, (TET) kystamiini. Crosslinking agent may be α, ω-diamine, triethylenetetramine, (TET) cystamine. Diamiinin reaktio PAN:in aktiiviesteriryhmien kanssa silloittaa polymeeriketjut amidisidosten kautta ja muodostaa liukenemattoman geelin. PAN reaction of the diamine with the activated ester groups in the polymer chains cross-linked through amide bonds and forms an insoluble gel. Entsyymin aminofunktiot (mieluummin lysiinin ε-aminoryhmä) reagoivat samanaikaisesti jäljellä olevien aktiiviestereiden kanssa geelissä 15 ja muodostavat stabiileja kovalenttisia amidisidoksia. Amino functions of the enzyme (preferably the ε-amino group of lysine) react simultaneously with the remaining activated esters in the gel 15 to form a stable covalent amide bonds. Immobilisointi suoritetaan substraatin ja kofaktoreiden läsnäollessa. The immobilization is carried out in the presence of substrate and cofactors catalyst. Korkean affiniteetin omaavan substraatin ja ko-faktoreiden läsnäolo konsentraatioissa, jotka ovat suurempia kuin Km, inhiboivat PAN-aktiiviestereiden ja nukleofiilisten ryhmien väliset reaktiot entsyymin katalyyttisessä paikassa tai sen lähellä suojaten näin entsyymiä kemialliselta inaktivoitumiselta. The presence of a high affinity for the substrate and co-factor at concentrations that are higher than the Km, inhibit reactions between the PAN active esters and nucleophilic groups in the catalytic site of the enzyme or close so as to protect the enzyme from inactivation by chemical.

20 t · · · 20 t · · ·

Immobilisaatio-olosuhteet • · · · t | Immobilization conditions • · · · t | Osittain puhdistettu a-AE tehdään liukenevaksi 30 mM HEPESpuskurissa, pH 7,0. Partially purified alpha-AE made soluble by the presence of 30 mM Hepes buffer, pH 7.0.

• · I • · I

• PANin ja TETin suhde muodostetaan siten, että 15 % aktiiviestereistä jäävät reagoimat- ·.* : 25 ta ja toimivat siten α-amidointientsyymin sitomispaikkoina. • the ratio of PAN and Tetín is formed so that 15% remain unreacted aktiiviestereistä · *. 25 and to thus act as binding sites for α-amidation enzyme. Vakio PAN-liuos on 20%:nen (w/w). The standard PAN solution is 20% of (w / w). α-amidointientsyymin reaktioseos koostuu 0,2 μΜ CuS04:stä, 40 μΜ dansyyli-His-Phe-GIy:stä ja 10 mM askorbaatistaja 0,5 - 2,0 mg:sta α-ΑΕ/g PANia. α-amidating enzyme reaction mixture consists of 0.2 μΜ CuS04 to 40 μΜ dansyl His-Phe-Gly-through and 10 mM askorbaatistaja 0.5 - 2.0 mg of α-ΑΕ / g Pan.

• · « '", ' TET-konsentraatio lasketaan siten, että se on yhtä suuri kuin 0,85 ekvivalenttia primaa- * * · ' ' rista amiinia/ekvivalentti aktiiviesteriä. Tavallisesti optimiolosuhteiden määrittämiseksi ' · · ·' 30 reaktio ilman entsyymiä suoritetaan geeliytymisajan vahvistamiseksi, so aika, joka t I · * '· vaaditaan TET.n lisäyksen jälkeen geelin muodostuksen aikaansaamiseksi, <x- * · "· amidointientsyymin immobilisoinnin optimisaannot saadaan silloin, kun entsyymin li säys siirretään lähemmäksi geeliytymispistettä. • · '' '' TET concentration is calculated in such a way that it is as high as 0.85 equivalents of the primary * * · '' amine of / aktiiviesteriä equivalent. Generally, the determination of the optimal '· · ·' 30 the reaction is carried out without enzyme gel time the establishment, i.e. the time t I · * '· required after the addition of TET.n to achieve gel formation, <* · x' · amidating enzyme immobilization optimum yields are obtained when the enzyme li formate is moved closer to the gel point. Yleisenä sääntönä on, että mitä lyhy- 110433 55 emmän aikaa entsyymi on alttiina PANin vaikutukselle ennen geelinmuodostumista, sitä korkeampi on aktiivisen immobilisoidun entsyymin saanto. The general rule is that the shorter 110433 55 proves a shorter time for the enzyme is exposed to the PAN before gelling, the higher the yield of active immobilized enzyme. Useimpien reaktioiden kohdalla a-AE (n. 2,0 mg/g PANia) lisätään 45 60 sekuntia TET:n jälkeen. Most of the reactions of a-AE (. Of 2.0 mg / g Pan) is added in 45 to 60 seconds TET after. Entsyymiä sisältävän geelin annetaan seistä huoneen lämpötilassa n. tunnin ajan kytkentäreaktion s päättymisen mahdollistamiseksi. The enzyme-containing gel is allowed to stand at room temperature for approx. one hour to allow the coupling reaction to the end of the page. 60 minuutin kuluttua geeli jauhetaan huhmarella ja petkeleellä, jolloin saadaan fragmentteja, joiden koko on keskimäärin 100 μ. After 60 minutes the gel is ground with a mortar and pestle to give fragments having an average size of 100 μ. Nämä hiukkaset pestään ammoniumsulfaatilla sitoutumattomien lähtöaineiden poistamiseksi ja jäljellä olevien aktiivisesteriryhmien muuntamiseksi amideiksi peittämällä näin reaktiiviset ryhmät. The ammonium sulfate particles are washed to remove unbound starting materials and the remaining aktiivisesteriryhmien for conversion to amides by covering the thus-reactive groups. Aktiivisen α-amidointientsyymin saannon oletetaan olevan immobilisaa-10 tion jälkeen vähemmän kuin 60 %. Of active α-amidating enzyme yield is assumed to be after Immobilis-10 State less than 60%. Immobilisaation jälkeiset pesuvedet voivat sisältää 30-40 % alkuaktiivisuudesta. Post-immobilization washing water may contain 30-40% of the initial activity. α-amidointientsyymi voidaan ottaa talteen pesuvesistä lisäämällä ammoniumsulfaattikonsentraatiota 45 %:iin, mikä saa aikaan sen, että aktiivinen α-amidointientsyymi saostuu. α-amidating enzyme can be recovered from the wash water by the addition of ammonium sulfate concentration to 45%, which results in that the active α-amidating enzyme precipitates.

15 Immobilisoidut geelihiukkaset ovat sopivia jaksottaiseen amidointireaktioon, jossa hiukkaset pidetään suspensiossa mekaanisella sekoittimella. 15 immobilized gel particles are suitable for intermittent amidation reaction, in which the particles are kept in suspension by a mechanical stirrer. Kun entsymaattinen reaktio on päättynyt, hiukkasten annetaan laskeutua ja amidoidun peptidituotteen sisältävä su-pematantti dekantoidaan. When the enzymatic reaction has ended, the particles are allowed to settle and containing the amidated peptide product is decanted Sun-pematantti. Tämä menetelmä ei ole optimaalinen suurimittaisiin reaktioihin. This method is not optimal for large-scale reactions. Entsyymiä sisältävät geelihiukkaset eivät ole tarpeeksi jäykkiä niiden pakkaamisek- || The enzyme-containing gel particles are not rigid enough for packing their || 20 si pylvääseen ja järkevien virtausnopeuksien aikaansaamiseksi. 20 Si column and obtain reasonable flow rates. Tämän ongelman eli- « · minoimiseksi on mahdollista käyttää kahta vaihtoehtoista tapaa: • · · • · * · :: 1. Geelin annetaanpolymeroitua lasihelmien läsnäollessa. This problem of organ «· minoimiseksi is possible to use two alternative ways: • · · • · · * :: 1. annetaanpolymeroitua gel in the presence of glass beads. Tavallisesti minuuttia ennen • · · * * · . Normally, minutes before • · · * * ·. ' geeliytymispistettä lasihelmet lisätään reaktioseokseen ja sekoitetaan mekaanisella se- IM # · * ' ' 25 koittimella, kunnes helmet on peitetty PAN-liuoksen kerroksella. 'Gel point of glass beads is added to the reaction mixture and mixed by mechanical stirring IM # · *' '25 a mixer until the beads are covered with a layer of PAN solution. Tämän sekamateriaa lin virtausominaisuudet ovat paljon paremmat kuin pelkkien geelihiukkasten vir- » · » • I · I,. This mixed material lin flow properties are much better than just the flow of the gel particles »·» • I · I ,. * tausominaisuudet. * Ensemble of the characteristics.

• · II · 1 · * ·' 2. Vaihtoehtoisesti PAN-hiukkaset sekoitetaan suodatusapuaineen, Celite 545:n kanssa. • II · 1 · · · * "2. Alternatively a PAN particles are mixed with a filter aid, Celite 545 with.

> · · # * ' ·; > · · # * '·; · ' 30 Tavallisesti PAN:in ja Celiten seos valmistetaan PAN:in kanssa, joka muodostaa alle 8 »· » • '· % w/w (kuivapaino) seoksesta. · "30 Generally, PAN, and the mixture was Celite, prepared by the PAN with in, which constitutes less than 8" · "•" ·% w / w (dry weight) of the mixture. Tämän tyyppisen pylvään muodostamiseksi geelihiuk- I · '. To form this type of column geelihiuk- I · '. ' *: kaset suspendoidaan 50 mM Tris:HCl:ään, pH 7,0, ja Celite 545 lisätään sekoittaen jat kuvasti ja sekoitetaan vielä 2 tunnin ajan. '* Particles suspended in a 50 mM Tris HCl, pH 7.0, and the Celite 545 is added with stirring JAT reflected and stirred for a further 2 hours. Pylväs pakataan tällä lietteellä (3 x 40 cm) ja 110433 56 pylvään lämpötila pidetään 37 °C:ssa amidointireaktion helpottamiseksi. The column is packed with this slurry (3 x 40 cm), and 110433 56 the column temperature is maintained at 37 ° C to facilitate the amidation reaction. Käyttämällä tätä menetelmää pidetään virtausnopeutena 8-101/päivä. Using this method is considered a flow rate of 8-101 / day.

Eräs mielenkiintoinen vaihtoehto pylväskromatografialle on käyttää tangentiaalista vir-5 tausjärjestelmää. An interesting option is the use of column chromatography, tangential vir 5 measurement system. PAN-polymeeri kaadetaan ennen geeliytymispistettä 0,45 pm.n poly-sulfonihuokostukilevylle. The PAN polymer prior to gel point is poured into 0.45 Pm.n poly sulfonihuokostukilevylle. Geeliytymisen jälkeen levyt voidaan leikata sellaisiksi, että ne sopivat tangentiaalisen virtauksen Millipore- tai New Brunswick-ultrasuodatusyksikköihin. After gelling, the sheets can be cut such that they are suitable for tangential flow or a New Brunswick Millipore ultrafiltration units. Tässä mallissa polysulfoni-PAN-immobilisoitu entsyymi-geeli-sekalevyt pinotaan kerroksiksi, jolloin saadaan valtava pintaalan lisäys. In this model, polysulfone-PAN-immobilized enzyme gel was mixed plates are stacked in layers to obtain a huge increase in the surface area. Tämä me-io netelmä voidaan korottaa suoraan virtausnopeuksiin, jotka ovat litroja minuutissa. This we-io method can be increased by directly flow rates, which are of liters per minute. Tämän tyyppinen järjestelmä saa aikaan myös mukavan menetelmän reaktioseoksen kierrättämiseksi peptidisubstraatin amidoinnin maksimoimiseksi. This type of system also provides a convenient method of recycling the reaction mixture to maximize the amidation of the peptide substrate.

Etuihin, jotka saavutetaan immobilisoimalla α-amidointientsyymi, kuuluvat entsyymin is talteenotto ja uudelleenkäyttö. The advantages are achieved by immobilizing the α-amidating enzyme, the enzyme is belonging to the recovery and re-use. Toiseksi immobilisoitu matriisi lisää entsyymin stabiiliutta ja saa aikaan entsyymin käsittelymuodon, jota voidaan käyttää suurimittaisissa amidointireaktioissa (substraatin määrien ollessa grammoista kiloihin) pidennettyjen aikajaksojen kuluessa. Second, the immobilized enzyme matrix increases the stability of the enzyme and causes the processing mode that can be used in large-scale amidation reaction (the substrate in amounts of grams to kilograms) over extended periods of time.

20 Esimerkki 12 ft· « ' * : Immunoaffiniteettipvlvään valmistus epäpuhtaiden alfa- Γ**: amidointientsvvmikoostumusten puhdistamiseksi • * • i « • · · • ta i « · · ' ' ί A. Immobilisaatio: • · " ' " it « * » · 25 Käytetty immobilisaatiomatriisi oli syaanibromidi-aktivoitu Sepharose 4B (Pharmacia). 20 Example 12 ft · '' * Immunoaffiniteettipvlvään Preparation of impure alpha Γ ** purify amidointientsvvmikoostumusten • i • * «• • · · s i '·' 'ί A. Immobilization: • ·' '' it '*" · Used 25 immobilisaatiomatriisi was cyanogen bromide-activated Sepharose 4B (Pharmacia).

• « ' 1 Kuiva geeli pestiin ensin 1 mM HCl:llä (200 mg/g hartsia) kiinteän tuen paisuttamiseksi • · ' t » «· * ja pesemiseksi. • « '1 dry gel was first washed with 1mM HCl (200 mg / g of resin) to swell the solid support • ·' s» «* · and washing. N. 40 mg puhdistettua polyklonaalista vasta-ainetta, joka oli puhdistettu About 40 mg of purified polyclonal antibody purified from

• I • I

V, · kanan munankeltuaisista, dialysoitiin 100 mM HaHCC^a vastaan, pH 8,3, joka sisälsi V · chicken egg yolks was dialyzed against 100 mM HaHCC a ^, pH 8.3, containing

Ml 1,,.: 30 0,5 M NaCkä. 1 ml ,,. 30 0.5 M NaCl. Kytkentä suoritettiin käyttämällä 8 ml edellä paisutettua ja pestyä kiinte- The coupling was carried out using 8 ml of the swollen and washed in solid

;' ; ' *': ää tukea. * 'HCl support. Reaktio suoritettiin kolmen tunnin kuluessa huoneen lämpötilassa 100 mM The reaction was carried out for three hours at room temperature in 100 mM

:* *. : * *. i natriumbikarbonaattipuskurissa, pH 8,3, joka sisälsi 500 mM NaCkä, jota käytettiin proteiinin epäspesifisen sitoutumisen estämiseksi kiinteään tukeen. i sodium bicarbonate buffer, pH 8.3, containing 500 mM NaCl, was used to block non-specific binding of the protein to a solid support. Geelin jäljellä olevat 110433 57 aktiiviset ryhmät salvattiin käyttämällä 0,2 M glysiiniä. The gel remaining 57 110433 active groups were blocked using 0.2M glycine. Salpausvaiheen jälkeen geeli pestiin 4-5 kertaa käyttämällä korkean ja alhaisen pH-arvon omaavien puskureiden sykliä (korkean pH-arvon omaava puskuri 100 mM NaHCCb pH 8,3 + 500 mM NaCl, alhaisen pH-arvon omaava puskuri 100 mM asetaatti pH 4,0 + 500 mM NaCl). After the blocking step the gel was washed 4-5 times using high and low pH-value-buffers cycle (with a high pH value of the buffer to 100 mM NaHCO pH 8.3 + 500 mM NaCl, having a low pH buffer with 100 mM acetate pH 4.0 + 500 mM NaCl). Nämä 5 pesuvaiheet poistivat sitoutumattoman proteiinin ja salpausreagenssin (glysiini) hartsista. These five washing steps were removed and the unbound protein blocking reagent (glycine) resin. Immunoaffiniteettihartsi varastoitiin 4 °C:ssa emäksisen pH:n omaavassa puskurissa, joka sisälsi mertiolaattia bakteriostaattisena aineena. Immunoaffiniteettihartsi stored at 4 ° C in an alkaline pH omaavassa buffer containing merthiolate a bacteriostatic agent. Koko seuraava immunoaffiniteet-tikromatografia suoritetaan 4 °C:ssa. All of the following immunoaffiniteet-chromatography with performed at 4 ° C. Samanlaista menetelmää voidaan käyttää puhdistettujen monoklonaalisten vasta-aineiden immobilisoimiseksi. A similar method can be used to immobilize purified monoclonal antibodies.

10 B. Immunoaffiniteettikromatografia 10 B. immunoaffinity

Immunoaffiniteettipylvästä käytettiin vaihtoehtoisena erittäin tehokkaana vaiheena a- AE:n puhdistuksessa. An immunoaffinity column was used as an alternative highly effective step A AE purification. CA-77-soluista peräisin oleva kudosviljelyväliaine (ks. esimerkki 15 4) laimennetaan tislatulla vedellä ja pumpataan DEAE-anioninvaihtopatruunan läpi, joka on edellä tasapainotettu 20 mM Bis Tris-HCl:llä pH 6,0. (. See example 15 4) The CA-77 cells derived from tissue culture medium was diluted with distilled water and pumped through a DEAE-anioninvaihtopatruunan equilibrated in 20 mM bis Tris-HCl above at pH 6.0. α-amidointientsyymi elu- oidaan patruunasta 50 mM Tris:HCl:llä pH 7,0, joka sisältää 500 mM NaCl.ä. α-amidating enzyme oidaan eluted from the cartridge with 50 mM Tris HCl, pH 7.0, containing 500 mM NaCl.ä. a-AE- aktiivisuuden sisältävät fraktiot joko dialysoidaan Tris-HCl-puskuria, pH 7,0, vastaan, tai puhdistetaan edelleen käyttämällä geelisuodatuskromatografiaa (esimerkki 4) ennen . alpha-AE activity containing fractions were either dialyzed against Tris-HCl buffer, pH 7.0, or further purified using gel filtration chromatography (Example 4) before. ·. ·. 20 immunoaffiniteettikromatografiaa. 20 immunoaffinity. a-AE:tä sisältävät näytteet ohjataan immunoadsorp- •.:. a-AE-containing samples is controlled by immunoadsorption •.:. tiopylvään läpi neutraalissa pH-arvossa. tiopylvään through a neutral pH. Vasta-aineet sitovat spesifisesti a-amidointi- entsyymin, kun taas epäpuhtaat proteiinit eivät sitoudu ja ne poistetaan eluentissa. The antibodies specifically bind to alpha-amidation enzyme, whereas the contaminating proteins do not bind and is removed in the eluent. a- : : 1: AE-aktiivisuus voidaan eluoida pylväästä käyttämällä 100 mM glysiini :HCl-puskuria • · · pH 3,0 (voidaan käyttää muita desorptioaineita, mukaanlukien ureaa, dioksaania, ety- • · » :: 1 25 leeniglykolia ja Nalrtä). A: 1: AE activity may be eluted from the column using 100mM glycine: HCl buffer pH • · 3.0 (desorbent may be used in other, including urea, dioxane, ethylene · • »1 25 :: glycol and Nalrtä ). Fraktiot kerätään 1,0 M Tris:HCl:ään pH 7,0 puskurijäqestel- män puhdistamiseksi säilyttäen samalla a-AE-aktiivisuus. Fractions were collected in 1.0 M Tris HCl pH 7.0 puskurijäqestel- while maintaining the purification system at the same time a-AE activity.

• · · • · • · 1 • 1 • 1 • · · • t # · • · · 58 110433 • · · • · · • 1 • 1 • 1 • • · · · # t • · · 58 110433

Yhteenveto keksinnön hyödyntämismahdollisuuksista 1. Entsymaattinen koostumus, joka sisältää vähintään yhtä alfa-amidointientsyymiä, joka pystyy katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin peptidiketjunsa C-5 päätteessä glysiinitähteen sisältävän peptidyyliyhdisteen muuntoa vastaavaksi peptidyy-liamidiyhdisteeksi, jossa on aminoiyhmä mainitun C-terminaalisen glysiinin paikalla, ja joka entsymaattinen koostumus on riittävän puhdas alfa-amidointientsyymeissä, niin että entsymaattisen koostumuksen spesifinen aktiivisuus on vähintään n. 25 mU/mg proteiinia, ja että entsymaattinen koostumus on riittävän vapaa proteolyyttisestä aktiivisuudesta, joka 10 pystyy haj ottamaan vähintään yhden kokonaisuuden, joita ovat peptidyyliyhdiste, vastaava peptidyyliamidi ja alfa-amidointientsyymit, niin että mainittu koostumus voi katalysoida muuntoa, kun peptidyy liyhdiste sisältää L-aminohappoja. Summary of the potential uses of the invention 1. An enzymatic composition comprising at least one alpha-amidating enzyme capable of catalyzing the peptidyl compounds containing oxygen and a reducing agent in the presence of at least a peptide chains at C-5 in the terminal glycine residue conversion to the corresponding peptidyy-liamidiyhdisteeksi with aminoiyhmä said C-terminal glycine location, and the enzymatic composition is sufficiently pure alpha-amidating enzyme, so that the specific activity of the enzymatic composition is at least approx. 25 mU / mg protein, and that the enzymatic composition is sufficiently free of proteolytic activity, which 10 is capable dec receive the at least one entity, such as the peptidyl corresponding peptidyl amide and alpha-amidating enzyme, so that said composition may catalyze the conversion of the peptidyy containing compound comprises L-amino acids.

Entsymaattinen koostumus sisältää edullisesti vähintään yhtä alfa-amidointientsyymiä, 15 joka voidaan saada medullaarisista kilpirauhaskarsinoomatuumoreista, esimerkiksi rotan medullaarisista kilpirauhaskarsinoomatuumoreista. Preferably, the enzymatic composition includes at least one alpha-amidating enzyme, 15 which can be medullary kilpirauhaskarsinoomatuumoreista, e.g., rat medullary kilpirauhaskarsinoomatuumoreista.

Entsymaattinen koostumus sisältää edullisesti vähintään yhtä alfa-amidointientsyymiä, joka voidaan saada IVI-10029:stä (sittemmin ATCC CRL 10919) peräisin olevasta soluvil-20 jelyväliaineesta. Preferably, the enzymatic composition includes at least one alpha-amidating enzyme, which can be obtained by IVI-10029 to (and subsequently ATCC CRL 10919) derived from the culture medium, the cell culture-20.

» · » ♦ . »·» ♦. ' · ·: 2. Entsymaattinen koostumus, joka sisältää vähintään yhtä alfa-amidointientsyymiä, joka . '· ·: 2. The enzymatic composition comprising at least one alpha-amidating enzyme, which. ' : pystyy katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin C-päätteessään glysii- • · •. 'Capable of catalyzing the oxygen and the reducing agent in the presence of at least a C-terminal glycine · • •. · · nitähteen sisältävän peptidyylisubstraatin muuntoa vastaavaksi peptidyyliamidiksi, jossa on • ': 25 aminoryhmä mainitun C-terminaalisen glysiinin paikalla, jossa alfa-amidointientsyymin · Peptidyl substrate-containing residue to the conversion to the corresponding peptidyl amide having • ': 25 amino group of the C-terminal glycine location, wherein the alpha-amidating enzyme

• M • M

:: ilmeinen molekyylipaino on n. 60.000 - n. 65.000 daltonia mitattuna geelisuodatuskroma- tografialla ja n. 73.000 - n. 75.000 daltonia mitattuna elektroforeesilla natriumdodekyyli- • · sulfaatti/polyakryyliamidigeelillä, ettäalfa-amidointientsyymi eluoidaanpH-arvon6 omaa- ♦ · · ·;·' valla natriumkloridiliuoksella anioninvaihtopylväästä (tasapainotettu pH-arvossa 6, hiuk- • · , v. · 30 kaskoko 10 pm, ontelotilavuus 40 % ja geeli, jonka varattu ryhmä on -CHh-hT-(0¾¾ ja :... · jonka ionikapasiteetti on 0,28 - 0,36 mmoolia/ml), jolloin pH 6-eluointi tapahtuu ensin • * ·': natriumkloridikonsentraatiossa, joka on n. 220 mM tai sen yli, että alfa-amidointientsyymi • · : eluoidaan pH-arvon 8 omaavalla natriumkloridiliuoksella anioninvaihtopylväästä (tasapai notettu pH-arvossa 8), jolloin pH 8-eluointi tapahtuu ensin natriumkloridikonsentraatiossa, 110433 59 joka on n. 250 mM tai sen yli, ja että alfa-amidointientsyymin optimaalinen aktiivisuus on pH-arvossa 4 :: apparent molecular weight of approximately 60,000 - 65,000 daltons as measured by the gel filtration chromatography and the 73,000 - 75,000 Dalton as measured by the electrophoresis on sodium dodecyl • · sulfate / polyacrylamide gel, and alpha-amidating enzyme eluoidaanpH-arvon6 omaa- ♦ · · ·,.... · 'a solution of sodium chloride anion exchange column (equilibrated to pH 6, the particle • · v · 30 size was 10 microns, a void volume of 40% and a gel whose charged group is -CHh-HT (0¾¾ and:. ... · an ionic capacity of 0.28 - 0.36 mmol / mL) to pH 6 with elution comes first • * · ': sodium chloride concentration, which is about 220 mm or more than that of alpha-amidating enzyme • ·: eluted with 8 has a pH value of brine. anion exchange column (weighted Balance pH 8) to a pH of 8-elution takes place first of sodium chloride, 110433 59 which is approx. 250 mM or more, and that alpha-amidating enzyme has optimal activity at pH 4 ,5 - 5,5 (mitattuna dansyyli-L-Try-Val-Gly:n fraktiolla, joka on muunnettu dansyyli-L-Try-Val-CONH2:ksi 16 minuutissa), että alfa-amidointientsyymi on riittävän puhdas alfa-amidointientsyymeissä, niin että entsymaattisen koostumuksen spesifinen ak-5 tiivisuus on vähintään n. 25 mU/mg proteiinia. 5 - 5.5 (measured with dansyl-L-Try-Val-Gly fraction, which has been converted dansyl-L-Try-Val-CONH 2 KSI for 16 minutes), and alpha-amidating enzyme is sufficiently pure alpha-amidating enzyme, so that the composition of the specific enzymatic ak-5 tiivisuus of at least approx. 25 mU / mg protein.

Edellä mainitun entsymaattisen koostumuksen alfa-amidointientsyymin isoelektrinen piste on n. pH 4,8 määritettynä ei-denaturoidulla isoelektrisellä tarkennusakryyliamidigeelillä, ja alfa-amidointientsyymin N-terminaalinen aminohapposekvenssi on 10 12 3 4 NH2-Ser-Phe-Ser-Asn tai sen homologi. The above-mentioned enzymatic composition comprising an alpha-amidating enzyme has an isoelectric point of approx. PH 4.8 as determined by isoelectric non-denatured tarkennusakryyliamidigeelillä, and alpha-amidating enzyme N-terminal amino acid sequence 10 12 3 4-NH2-Phe Ser-Ser-Asn, or a gay Log.

15 3. Entsymaattinen koostumus, joka sisältää vähintään yhtä alfa-amidointientsyymiä tai sen aktiivista fragmenttia tai homologia, joka sisältää peptidiketjun, joka on olennaisesti homologinen vähintään yhden seuraavan aminohapposekvenssin suhteen: ! 15 3. An enzymatic composition comprising at least one alpha-amidating enzyme or an active fragment or gay Pathology, containing the peptide which is substantially homologous to at least one of the following amino acid sequence: i 20 ! i 20! .·. . ·. (a) *;V -Ser-Phe-Ser-Asn-Glu-Cys-Leu-Gly-Thr-Ile-Gly-Pro- (S) *; V Ser-Phe-Ser-Asn-Glu-Cys-Leu-Gly-Ile-Thr-Gly-Pro-

Val-Thr-Pro-Leu-Asp-Ala-Ser-Asp-Phe-Ala-Leu-Asp-Ile- ' ·1 Arg-Met-Pro • 1 • · · ::v (b) : 1 ! Val-Thr-Pro-Leu-Asp-Ala-Ser-Asp-Phe-Ala-Leu-Asp-Ile '· 1 Arg-Met-Pro • 1 • · · :: v (b): 1! 25 -Ser-Met-Gln-Pro-Gly-Ser-Asp-Gln-Asn-His-Phe-Ser-' Gln-Pro-Thr- Vi (c) • · · -Asn-Gly-Gln-Trp-Thr-Leu-Ile-Gly-Arg- 30 '!1 -Phe-Val-Thr-Gln-Trp-Gly-Glu-, t 1 » 25 -Ser-Met-Gln-Pro-Gly-Asp-Ser-Gln-Asn-His-Phe-Ser "Gln-Thr-Pro-V (c) • · ·-Asn-Gly-Gln-Trp-Thr Ile-Leu-Gly-Arg-30 '! 1-Phe-Val-Thr-Gln-Trp-Gly-Glu, t 1 »

• I • I

• · · · • · · • · 110433 60 ja joka koostumus on riittävän puhdas alfa-amidointientsyymissä, niin että koostumuksen spesifinen aktiivisuus on vähintään n. 25 mU/mg proteiinia ja että koostumus on riittävän vapaa proteolyyttisestä aktiivisuudesta, joka pystyy hajottamaan vähintään yhden kokonai-i suuden, joita ovat substraattipeptidyyliyhdiste, vastaava peptidyyliamidituote ja al- 5 fa-amidointientsyymit, niin että koostumus voi katalysoida alfa-amidointireaktiota, kun peptidyyliyhdiste sisältää L-aminohappoja. • · · · • · · • · 110433 60 and the composition is sufficiently free of alpha-amidating enzyme, so that the specific activity of the composition is at least approx. 25 mU / mg protein and that the composition is sufficiently free of proteolytic activity capable of degrading at least one kokonai -i industry, which are substraattipeptidyyliyhdiste, peptidyyliamidituote and the corresponding alkyl 5-fa-amidating enzyme, so that the composition can catalyze the alpha-amidation reaction, when the peptidyl compounds containing L-amino acids.

4. Entsymaattinen koostumus, joka sisältää vähintään yhtä alfa-amidointientsyymiä, joka pystyy katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin C-päätteessään glysii-10 nitähteen sisältävän peptidyylisubstraatin muuntoa vastaavaksi peptidyyliamidiksi, jossa on aminoryhmä mainitun C-terminaalisen glysiinin paikalla, ja jossa alfa-amidointientsyymin ilmeinen molekyylipaino on n. 60.000 - n. 65.000 daltonia mitattuna geelisuodatuskroma-tografialla ja vähemmän kuin n. 55.000 daltonia mitattuna elektroforeesilla natriumdode-kyylisulfaatti/polyakryyliamidigeelillä, että alfa-amidointientsyymi eluoidaan pH-arvon 6 15 omaavalla natriumkloridiliuoksella anioninvaihtopylväästä (tasapainotettu pH-arvossa 6, hiukkaskoko 10 pm, ontelotilavuus 40 % ja geeli, jonka varattu ryhmä on -CH2-N*-(CH3)3 ja jonka ionikapasiteetti on 0,28 - 0,36 mmoolia/ml), jolloin eluointi tapahtuu ensin natri-umkloridikonsentraatiossa, joka on n. 160 mM tai sen yli, ja että alfa-amido 4. An enzymatic composition comprising at least one alpha-amidating enzyme capable of catalyzing the oxygen and the reducing agent in the presence of at least a C-terminal peptidyl substrate containing the glycine-10 residue in the conversion to the corresponding peptidyl amide having an amino group at the C-terminal glycine location, and wherein the alpha-amidating enzyme apparent a molecular weight of about 60,000 -.. of 65,000 daltons as measured geelisuodatuskroma-chromatography and less than about 55,000 daltons measured by electrophoresis on natriumdode-dodecyl sulfate / polyacrylamide gel, and alpha-amidating enzyme is eluted with a pH value of 6 15 has a sodium chloride anion exchange column (equilibrated to pH 6, particle size. 10 microns, a void volume of 40% and a gel whose charged group is -CH2-n + - (CH 3) 3, and having an ionic capacity of 0.28 - 0.36 mM / ml), the elution takes place first-umkloridikonsentraatiossa sodium, which is the . 160 mM or more, and that of alpha-amido intientsyymin optimaalinen aktiivisuus on pH-arvossa 7,0 - 8,5 (mitattuna dansyyli-L-Tiy-Val-Gly:n 20 fraktiolla, joka on muunnettu dansyyli-L-Try-Val-CONH2:ksi 16 minuutissa), että entsy-: *: maattinen koostumus on riittävän puhdas alfa-amidointientsyymeissä, niin että entsymaat- intientsyymin optimal activity at pH 7.0 - 8.5 (measured with dansyl-L-tiy-Val-Gly fraction 20, which is modified for dansyl-L-Try-Val-CONH 2 KSI for 16 minutes), the entsy -: *: matic composition is sufficiently pure alpha-amidating enzyme, so that the enzymatic

f · · I I f · ·

. . ' · ': tisen koostumuksen spesifinen aktiivisuus on vähintään n. 25 mU/mg proteiinia. '·'. The specific activity of tissue regeneration is at least about 25 mU / mg protein.

t » · • · • · •. t »· • · • · •. ji 5. Entsymaattinen koostumus, joka sisältää vähintään yhtä alfa-amidointientsyymiä, joka : *. ji 5. An enzymatic composition comprising at least one alpha-amidating enzyme, which:. · 25 pystyy katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin C-päätteessään glysii- * · · :. · 25 capable of catalyzing the oxygen and the reducing agent in the presence of at least a C-terminal glycine * · ·. * * nitähteen sisältävän peptidyylisubstraatin muuntoa vastaavaksi peptidyyliamidiksi, jossa on aminoryhmä mainitun C-terminaalisen glysiinin paikalla, ja jossa alfa-amidointientsyymin '. * * peptidyl substrate containing residue to the conversion to the corresponding peptidyl amide having an amino group at the C-terminal glycine location, and wherein the alpha-amidating enzyme ". *: ilmeinen molekyylipaino on n. 60.000 - n. 65.000 daltonia mitattuna geelisuodatuskroma- • · ♦ • · • · · * tografialla ja alle n. 55.000 daltonia mitattuna elektroforeesilla natriumdodekyyli- . *:... An apparent molecular weight of about 60,000 - of 65,000 Daltons as measured by gel filtration • ♦ • · · • · · * chromatography and less than about 55,000 Daltons as measured by electrophoresis on a sodium dodecyl. ·.: 30 sulfaatti/polyakryyliamidigeelillä, että alfa-amidointientsyymi eluoidaan pH-arvon 6 :... · omaavalla natriumkloridiliuoksella anioninvaihtopylväästä (tasapainotettu pH-arvossa 6, • ' · ': hiukkaskoko 10 pm, ontelotilavuus 40 % ja geeli, jonka varattu ryhmä on -CH2-N+-(CH3)3 :' ·.: ja jonka ionikapasiteetti on 0,28 - 0,36 mmoolia/ml), jolloin pH 6-eluointi tapahtuu ensin » * natriumkloridikonsentraatiossa, joka on n. 160 mM tai sen yli, ja että alfa-amidointientsyy- 61 110433 ( mi eluoidaan pH-arvon 8 omaavalla natriumkloridiliuoksella anioninvaihtopylväästä (tasa- painotettu pH-arvossa 8), jolloin pH 8-eluointi tapahtuu ensin natriumkloridikonsentraa-tiossa, joka on n. 185 mM tai sen yli, ja että alfa-amidointientsyymin optimaalinen aktiivi-j suus on pH-arvossa 5,0 - 8,5 (mitattuna dansyyli-L-Try-Val-Gly:n fraktiolla, joka on j 5 muunnettu dansyyli-L-Try-Val-CONHf.ksi 16 minuutissa), että alfa-amidointientsyymi on riittävän puhdas alfa-amidointientsyymeiss · .: 30 sulfate / polyacrylamide gel, and alpha-amidating enzyme is eluted with a pH value of 6: For a ... · sodium chloride anion exchange column (equilibrated to pH 6, • '·': particle size 10 pm; pore volume of 40% and a gel whose charged group is -CH2-n + - (CH 3) 3 '· .: and having an ionic capacity is 0.28 - 0.36 mmol / mL) to pH 6 with elution occurs first "* sodium chloride concentration, which is about 160 mM, or from it. over, and that alpha-amidointientsyy- 61 110433 (mi eluted with a pH value of 8 has a sodium chloride anion exchange column (equilibrated at pH 8) to a pH of 8-elution occurs first natriumkloridikonsentraa-State, which is approx. 185 mm or more and that the alpha-amidation enzyme optimal active-J content is at pH 5.0 - 8.5 (measured with dansyl-L-Try-Val-Gly fraction, which is converted to j 5 dansyl-L-Try-Val CONHf.ksi 16 minutes), and alpha-amidating enzyme is sufficiently pure alpha-amidointientsyymeiss , niin että entsymaattisen koostumuksen spesifinen aktiivisuus on vähintään n. 25 mU/mg proteiinia. , So that the specific activity of the enzymatic composition is at least approx. 25 mU / mg protein.

6. Entsymaattinen koostumus, joka sisältää vähintään yhtä alfa-amidointientsyymiä, joka 10 pystyy katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin C-päätteessään glysii- nitähteen sisältävän peptidyylisubstraatin muuntoa vastaavaksi peptidyyliamidiksi, jossa on aminoryhmä mainitun C-terminaalisen glysiinin paikalla, ja jossa alfa-amidointientsyymin ilmeinen molekyylipaino on n. 60.000 - n. 65.000 daltonia mitattuna geelisuodatuskroma-tografialla ja n. 73.000 - n. 75.000 daltonia mitattuna elektroforeesilla natriumdodekyyli-15 sulfaatti/polyakryyliamidigeelillä, että alfa-amidointientsyymi eluoidaan pH-arvon 6 omaavalla natriumkloridiliuoksella anioninvaihtopylväästä (tasapainotettu pH-arvossa 6, hiukkaskoko 10 pm, ontelotilavuus 40 % ja geeli, jonka varattu ryhmä on -CHi-bT-(CH3)3 ja jonka ionikapasiteetti on 0,28 - 0,36 mmoolia/ml), jolloin pH 6-eluointi tapahtuu ensin [ natriumkloridikonsentraatiossa, joka on n. 200 mM tai sen yli, ja että alfa-am 6. An enzymatic composition comprising at least one alpha-amidating enzyme, which 10 is capable of catalyzing the oxygen and the reducing agent in the presence of at least a C-terminal peptidyl substrate containing a glycine residue in the conversion to the corresponding peptidyl amide having an amino group at the C-terminal glycine location, and wherein the alpha-amidating enzyme apparent a molecular weight of about 60,000 -.. of 65,000 daltons as measured geelisuodatuskroma-chromatography and the 73,000 -.. of 75,000 daltons measured by electrophoresis on sodium dodecyl-15 sulfate / polyacrylamide gel, and alpha-amidating enzyme is eluted with a pH value of 6 has a sodium chloride anion exchange column (equilibrated to pH 6 a particle size of 10 microns, pore volume of 40% and a gel whose charged group is -CHI-BT (CH 3) 3, and having an ionic capacity is 0.28 - 0.36 mmol / mL) to pH 6 with elution takes place in the [sodium chloride concentration; which is approx. 200 mM or more, and that alpha-am idointientsyy- 20 mi eluoidaan pH-arvon 8 omaavalla natriumkloridiliuoksella anioninvaihtopylväästä (tasa-j : painotettu pH-arvossa 8), jolloin pH 8-eluointi tapahtuu ensin natriumkloridikonsentraa- ,' ” tiossa, joka on n. 220 mM tai sen yli, ja että alfa-amidointientsyymin optimaalinen aktiivi- • ': suus on pH-arvossa 4,5 - 5,5 (mitattuna dansyyli-L-Try-Val-Gly:n fraktiolla, joka on • · : muunnettu dansyyli-L-Try-Val-CONH2:ksi 16 minuutissa), että entsymaattinen koostumus : 25 on riittävän puhdas alfa-amidointientsyymeissä, niin että entsymaattisen koostumuksen • · · '. idointientsyy- 20 mi eluted with a pH value of 8 has a sodium chloride anion exchange column (j equal weighted pH 8), wherein the pH of the elution with a 8-natriumkloridikonsentraa- occurs first, "" State, which is 220 mM or more, and that. alpha-amidating enzyme activity optimum • 'content is at pH 4.5 - 5.5 (measured with dansyl-L-Try-Val-Gly fraction, which is a • ·: modified dansyl-L-Try-Val CONH 2 KSI for 16 minutes), the enzymatic composition: 25 is sufficiently pure alpha-amidating enzyme, so that the enzymatic composition • · · '. ' 1 spesifinen aktiivisuus on vähintään n. 25 mU/mg proteiinia. '1 specific activity of at least about. 25 mU / mg protein.

• »» t • 1 1 ' : Edellä mainitussa entsymaattisessa koostumuksessa mainitun vähintään yhden al- *; • "" T • 1 1 'in said enzymatic composition of the above-mentioned at least one alkyl *; · 1 fa-amidointientsyymin isoelektrinen piste on n. pH 5,8, ja alfa-amidointientsyymin N- :.:. . · 1 f-amidating enzyme has an isoelectric point of pH 5.8, and an alpha-amidating enzyme N:.:. · 30 terminaalinen aminohapposekvenssi on • » • · 110433 62 NH2-Phe-Lys-Glu-Thr-Thr-Arg tai sen homologi. · 30 terminal amino acid sequence is: • »• · 62 110433 NH2-Phe-Lys-Glu-Thr-Thr-Arg or its gay Log.

5 7. Entsymaattinen koostumus, joka sisältää vähintään yhtä alfa-amidointientsyymiä, joka pystyy katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin C-päätteessään glysii-nitähteen sisältävän peptidyylisubstraatin muuntoa vastaavaksi peptidyyliamidiksi, jossa on aminoryhmä mainitun C-terminaalisen glysiinin paikalla, ja jossa alfa-amidointientsyymin 10 ilmeinen molekyylipaino on n. 60.000 - n. 65.000 daltonia mitattuna geelisuodatuskroma-tografialla ja n. 73.000 - n. 75.000 daltonia mitattuna elektroforeesilla natriumdodekyyli-sulfaatti/polyakryyliamidigeelillä, että alfa-amidointientsyymi eluoidaan pH-arvon 6 omaavalla natriumkloridiliuoksella anioninvaihtopylväästä (tasapainotettu pH-arvossa 6, hiukkaskoko 10 pm, ontelotilavuus 40 % ja geeli, jonka varattu ryhmä on -CH2-N*-(CH3)3 15 ja jonka ionikapasiteetti on 0,28 - 0,36 mmoolia/ml), jolloin pH 6-eluointi tapahtuu ensin natriumkloridikonsentraatiossa, joka on n. 240 mM tai sen yli, että alfa-amidoi 5 7. An enzymatic composition comprising at least one alpha-amidating enzyme capable of catalyzing the oxygen and the reducing agent in the presence of at least a C-terminal peptidyl substrate containing a glycine-residue in the conversion to the corresponding peptidyl amide having an amino group at the C-terminal glycine location, and wherein the alpha-amidating enzyme 10 the apparent molecular weight of about 60,000 -.. of 65,000 daltons as measured geelisuodatuskroma-chromatography and the 73,000 -.. of 75,000 daltons measured by electrophoresis on sodium dodecyl sulfate / polyacrylamide gel, and alpha-amidating enzyme is eluted with a pH value of 6 has a sodium chloride anion exchange column (equilibrated to pH 6 a particle size of 10 microns, pore volume of 40% and a gel whose charged group is -CH2-n + - (CH 3) 3 15 and having an ionic capacity is 0.28 - 0.36 mmol / mL) to pH 6 with elution takes place first of sodium chloride which is approx. 240 mM or more, and alpha-amidoi ntientsyymi eluoidaan pH-arvon 8 omaavalla natriumkloridiliuoksella anioninvaihtopylväästä (tasapainotettu pH-arvossa 8), jolloin pH 8-eluointi tapahtuu ainoastaan natriumkloridikonsentraatiossa, joka on n. 250 mM tai sen yli, että entsymaattinen koostumus on riittävän 20 puhdas alfa-amidointientsyymeissä, niin että entsymaattisen koostumuksen spesifinen ak-; ntientsyymi eluted with 8 has a pH-value of the solution of sodium chloride anion exchange column (equilibrated to pH 8) to a pH of 8-elution takes place only in the sodium chloride concentration which is approx. 250 mM or more, the enzymatic composition is sufficiently 20 pure alpha-amidating enzyme, so that the enzymatic The specific activity of the composition; *: tiivisuus on vähintään n. 25 mU/mg proteiinia. *. Tiivisuus of at least about 25 mU / mg protein.

• · • ·

Edellä mainitut entsymaattiset koostumukset ovat riittävän puhtaita alfa-amidointient- • · ;.: syymeissä, niin että niiden spesifinen aktiivisuus on edullisesti vähintään n. 50 mU/mg * * · • *,: 25 proteiinia, tai vähintään n. 150 mU/mg proteiinia, tai joissakin tapauksissa vähintään n. The above-mentioned enzymatic compositions are sufficiently pure alpha-amidointient- • ·;. Syymeissä, so that their specific activity is preferably at least about 50 mU / mg * * · • * ,: 25 proteins, or at least about 150 mU / mg.. protein, or, in some cases, at least about.

M» · 1500 mU/mg proteiinia. M »· 1500 mU / mg protein.

• · « *. • · «*. *: Edellä mainitut entsymaattiset koostumukset ovat riittävän vapaita proteolyyttisestä aktii- a · · s · »·. *: The above mentioned enzymatic compositions are sufficiently free of proteolytic active · a · p · »·. * visuudesta, j oka pystyy haj ottamaan vähintään yhden kokonaisuuden, j oita ovat peptidyy- ::: 30 liyhdiste, vastaava peptidyyliamidi ja alfa-amidointientsyymit, niin että koostumus voi •,,,: katalysoida alfa-amidointireaktiota, kun peptidyyliyhdiste sisältää L-aminohappoja. Isotype * j thorn dec able to receive at least one entity j formulations are peptidyl ::: 30 metal compound, a corresponding peptidyl amide and an alpha-amidating enzyme, so that the composition can • ,,,: catalyze the alpha-amidation reaction, when the peptidyl compounds containing L-amino acids .

| | I I

• · : * ·, | • ·: * ·, | 8. Homogeeninen puhdistettu entsyymivalmiste, joka sisältää peptidyyli-glysiini-alfa- amidointimono-oksygenaasia ja pystyy katalysoimaan ainakin peptidiketjun C-päätteessä 110433 63 glysiinitähteen sisältävän peptidyyliyhdisteen muuntoa vastaavaksi peptidyyliamidiksi, jossa on aminoryhmä mainitun C-terminaalisen glysiinin paikalla, joka peptidyyliyhdiste on puhdistettu luonnollisista lähteistä tai valmistettu yhdistelmä-DNA-tekniikalla, ja valmisteen spesifinen entsyymiaktiivisuus on vähintään 25 mU/mg proteiinia, ja puhdistettu 5 entsyymituote on riittävän vapaa proteolyyttisestä aktiivisuudesta, joka pystyy hajottamaan vähintään yhden kokonaisuuden, joita ovat peptidyyliyhdiste, vastaava peptidyyliamidi ja alfa-amidointientsyymit, niin että mainittu koostumus voi katalysoida muuntoa, kun peptidyyliyhdiste sisältää L-aminohappoja. 8. A homogeneous purified enzyme preparation containing peptidyl-glycine-alpha-amidointimono-monooxygenase and capable of catalyzing at least the peptide C-terminal peptidyl compounds containing 110433 63 glycine residue conversion to a corresponding peptidyl amide having an amino group at the C-terminal glycine location that peptidyl compounds have been purified from natural sources, or produced by recombinant DNA technology, and product-specific enzyme activity of at least 25 mU / mg protein, and the purified 5 enzyme product is sufficiently free of proteolytic activity capable of degrading at least one entity, such as the peptidyl corresponding peptidyl amide and an alpha-amidating enzyme, and that said composition may catalyze the conversion of the peptidyl compounds containing L-amino acids.

10 Homogeenisen puhdistetun entsyymivalmisteen spesifinen entsyymiaktiivisuus voi olla yli 1500 mU/mg proteiinia. 10 homogeneous purified enzyme preparation, the activity of a specific enzyme may be more than 1500 mU / mg protein.

9. Puhdistettu entsyymivalmiste, joka on johdettu medullaarisista kilpirauhasarsinooma-kudoksista, niiden solulinjoista tai tällaisista solulinjoista peräisin olevista kudosviljely-15 väliaineista, ja joka valmiste sisältää peptidyyli-glysiini-alfa-amidointimono-oksygenaasia ja pystyy katalysoimaan ainakin peptidiketjun C-päätteessä glysiinitähteen sisältävän peptidyyliyhdisteen muuntoa vastaavaksi peptidyyliamidiksi, jossa on aminoryhmä mainitun C-terminaalisen glysiinin paikalla, jolloin peptidyyliyhdiste tai polypeptidi on puhdistettu luonnollisista lähteistä tai valmistettu yhdistelmä-DNA-tekniikalla, että valmisteen spe-20 sifinen entsyymaattinen aktiivisuus on vähintään 1500 mU/mg proteiinia ja se on riittävän : *: vapaa proteolyyttisestä aktiivisuudesta, joka pystyy hajottamaan peptidyyliyhdisteen, vas- .' 9. The purified enzyme preparation which is derived from the medullary kilpirauhasarsinooma-tissues of origin of the cell lines, or such cell lines in tissue culture-15 media, and the preparation containing peptidyl-glycine-alpha-amidointimono-monooxygenase and capable of catalyzing at least the peptide C-terminal peptidyl compounds containing a glycine residue conversion a corresponding peptidyl amide having an amino group at the C-terminal glycine location, wherein the peptidyl or polypeptide is purified from natural sources or produced by recombinant DNA technology in the preparation of SPE-20 specific sequence entsyymaattinen activity of at least 1500 mU / mg protein and are sufficiently * : free of proteolytic activity capable of degrading peptidyl response ". ·:: taavan peptidyyliamidin tai alfa-amidointientsyymit, niin että koostumus voi katalysoida I'·': muuntoa, kun peptidyyliyhdiste sisältää L-aminohappoja. · :: corresponding peptidyl amide or alpha-amidating enzyme, so that the composition may catalyze I '·' conversion, to the peptidyl compounds containing L-amino acids.

* · · · : 25 Medullaariset kilpirauhaskarsinoomakudokset on mieluiten johdettu rotan kudoksista ja -.· ' spesifinen entsymaattinen aktiivisuus on vähintään n. 150 mU/mg proteiinia. * · · · 25 medullary kilpirauhaskarsinoomakudokset is preferably derived from rat tissues, and - · "specific enzymatic activity of at least about 150 mU / mg protein...

·.*·': Medullaarisena kilpirauhaskarsinoomana voi olla esimerkiksi IVI 10028 (sittemmin ATCC · * · ':. Medullary carcinoma of the thyroid may be, for example, IVI 10028 (ATCC later

• * · *75168) ja solulinjana IVI 10029 (sittemmin ATCC CRL 10919). • * · * 75168) and cell line IVI 10029 (now ATCC CRL 10919).

:Y: 30 • · · : 10. Menetelmä vähintään yhden alfa-amidointientsyymin puhdistamiseksi, joka pystyy : *.'. Y: 30 • · · 10. A method for purifying at least one alpha-amidating enzyme capable of: *. '. katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin C-päätteessään glysiinitähteen ,·',· sisältävän peptidyyliyhdisteen muuntoa vastaavaksi peptidyyliamidiksi, jossa on amino ryhmä mainitun C-terminaalisen glysiinin paikalla, jossa menetelmässä alfa-ami- 64 110433 dointientsyymin sisältävä koostumus alistetaan sekä kokoekskluusiokromatografiaan, joka pystyy erottamaan proteiinityypit, joiden ilmeinen molekyylipaino on n. 58.000 - n. 67.000 daltonia, että vahvaan anioninvaihtokromatografiaan käyttämällä anioninvaihtohartsia, joka pystyy sitomaan alfa-amidointientsyymin, ja eluoidaan alfa-amidointientsyymi suola-5 liuoksella. catalyzing oxygen and a reducing agent in the presence of at least a C-terminal glycine residue, · '·-containing peptidyl conversion to a corresponding peptidyl amide having an amino group of said C-terminal glycine-spot, in which method the alpha-amino-64 110433 a composition containing dointientsyymin subjected to both size exclusion chromatography capable of separating types of protein with an apparent molecular weight of about 58,000 -.. of 67,000 daltons, the strong anion exchange chromatography using an anion exchange resin capable of binding the alpha-amidating enzyme, and eluting alpha-amidating enzyme from 5-salt solution.

Vahva anioninvaihtokromatografia suoritetaan edullisesti kokoekskluusiokromatografian jälkeen ja se suoritetaan kokoekskluusiokromatografian eluentin osalla, joka omaa alfa-amidointientsyymin tunnusomaisen aktiivisuuden. A strong anion exchange chromatography is preferably carried out after size exclusion chromatography and size exclusion chromatography is carried out portion of the eluent, which has an alpha-amidating enzyme activity characteristic.

! ! 10 I Menetelmä voi käsittää edelleen ylimääräisen anioninvaihtokromatografiavaiheen ennen kokoekskluusiokromatografiavaihetta, sekä toisen anioninvaihtokromatografiavaiheen vah-I van anioninvaihtokromatografiavaiheen jälkeen. 10 I. The method may further comprises an additional size exclusion chromatography steps prior to anion exchange chromatography, anion exchange chromatography and a second vah-I obtained after the anion exchange chromatography.

15 Joko vahva anioninvaihtokromatografiavaihe tai toinen anioninvaihtokromatografiavaihe voidaan suorittaa emäksisessä pH-arvossa ja toinen happamassa pH-arvossa. 15 of either a strong anion exchange chromatography or another anion exchange chromatography step may be carried out in a basic pH range and a second acidic pH.

Menetelmässä alfa-amidointientsyymi voidaan johtaa anioninvaihtokromatografialla vilje- lyväliaineesta, jota on käytetty medullaarisen kilpirauhaskarsinoomasolulinjan kasvattami- 20 seksi. Method, the alpha amidating enzyme may be derived from the culture medium by anion exchange chromatography, which is used for increasing medullary kilpirauhaskarsinoomasolulinjan 20 Sex. Menetelmässä medullaarinen kilpirauhaskarsinoomakudos homogenoidaan vesipi- : ': toisessa väliaineessa, homogenaatti lingotaan ja linkouksen supematantti alistetaan ammo- *«* * .***: niumsulfaattisaostukseen. The method medullary kilpirauhaskarsinoomakudos homogenized in an aqueous: 'the second medium, the homogenate was centrifuged and the supernatant was subjected to ammonium spinning * «* * ***. Niumsulfaattisaostukseen.

• · * 11. Menetelmä alfa-amidointientsyymikoostumuksen tehokasta valmistusta varten, jossa : * · · : '.: 25 menetelmässä kerätään vähintään yksi epäpuhdas alfa-amidointientsyymi luonnollisesta tai ! • · * 11. A method for the efficient preparation of an alpha-amidointientsyymikoostumuksen in which: * · '. 25 comprising collecting at least one impure alpha-amidating enzyme from a natural or! v · rekombinoidusta lähteestä, alistetaan epäpuhdas entsyymi sekä kokoekskluusio kromatografiaan, joka pystyy erottamaan proteiinityypit, joiden ilmeinen molekyylipaino » * » *. v · recombined source, the crude enzyme and subjected to size exclusion chromatography capable of separating a protein types, with an apparent molecular weight "*» *. on n. 58.000 - n. 67.000 daltonia, että anioninvaihtokromatografiaan käyttämällä anionin- • · • · · * vaihtohartsia, joka pystyy sitomaan entsyymin, että alfa-amidointientsyymi eluoidaan •, ·* #: 30 anioninvaihtohartsista suolaliuoksella, jonka konsentraatio on yli 250 mM, että eluoitu II t :: entsyymi on riittävän puhdas, niin että koostumuksen spesifinen aktiivisuus on vähintään • ' * ': n. 25 mU/mg proteiinia. .. Is about 58,000 - 67,000 Daltons of the anion-exchange chromatography using an anion • • · · · * exchange resin capable of binding the enzyme, and alpha-amidating enzyme is eluted • · * # 30 anion exchange resin with brine having a concentration of over 250 mM, that eluted II t :: enzyme is sufficiently pure, so that the specific activity of the composition is at least • '*'. 25 mU / mg protein.

III III

110433 65 110433 65

Mainittu vähintään yksi alfa-amidointientsyymi kerätään mieluummin valitsemalla solulin-ja, joka pystyy ilmaisemaan vähintään yhden alfa-amidointientsyymin, keräämällä solulin-jan kasvuun käytettyä soluviljelyväliainetta. The at least one alpha-amidating enzyme is collected preferably by selecting Solulin and capable of detecting at least one alpha-amidating enzyme, collecting the cell culture medium used for growth of Solulin-jan.

5 12. Menetelmä alfa-amidoidun peptidyylituotteen valmistamiseksi, jossa menetelmässä saadaan aikaan jokin edellä kuvattu entsymaattinen koostumus ja peptidyyliyhdiste, jossa on ainakin peptidiketjun C-päätteessä glysiinitähde, saatetaan reagoimaan koostumuksen entsymaattisesti tehokkaan määrän läsnäollessa riittäväksi aikaa peptidyyliyhdisteen muuntamiseksi vastaavaksi peptidyyliamidiksi, jossa on aminoryhmä C-terminaalisen glysiinin 10 paikalla. 5 12. The method of alpha-amidated peptidyylituotteen, in which method there is provided an enzymatic composition and the peptidyl compounds which have been described above, at least the peptide C-terminal glycine residue, is reacted with a compound enzymatically effective amount of the presence of a sufficient time for conversion to the corresponding peptidyl peptidyl amide having an amino group at C terminal glycine in 10 locations. Entsyymi johdetaan mieluiten eläimen kudosuutteesta, jona käytetään medullaa-rista kilpirauhaskarsinoomakudosta, medullaarisia kilpirauhaskarsinoomasolulinjoja, näistä solulinjoista peräisin olevaa kudosviljelyväliainetta tai näiden yhdistelmää. The enzyme is preferably derived from an animal tissue extract, which the used medullaa-Rista kilpirauhaskarsinoomakudosta, medullary kilpirauhaskarsinoomasolulinjoja, derived from these cell lines in tissue culture medium, or a combination thereof. Reaktio tapahtuu edullisesti kupari-ionien läsnäollessa, tai hapen ja pelkistysaineen läsnäollessa. The reaction preferably takes place in copper ions in the presence of oxygen and a reducing agent or a catalyst.

15 Pelkistysaineena voidaan käyttää askorbiinihappoa, askorbiinihapposuoloja, dihydroksifu-j maraattia, metallisia syanidiyhdisteitä ja tetrahydropteriiniä, edullisesti askorbaattia. 15 can be used as the reducing agent ascorbic acid, ascorbic acid, dihydroksifu j fumarate, metal cyanide and tetrahydropterin, preferably ascorbate.

Reaktio tapahtuu edullisesti vähintään yhden yhdisteen läsnäollessa, jona on katalaasi, etanoli, kaliumjodidi tai niiden seos, vielä edullisemmin askorbaatin, katalaasin ja kupa-20 ri-ionien läsnäollessa. The reaction is preferably carried out in the presence of at least one compound which is to catalase, ethanol, potassium iodide, or a mixture thereof, more preferably, ascorbate, catalase, copper-20 and r-ions.

• · • · · * · ' · · · Peptidyyliyhdiste voi olla esimerkiksi peptidi, joka sisältää kalsitoniinisekvenssin, joka • « i * · * · sisältää karboksyyli-terminaalisen glysiinitähteen. • • · · · · * '· · · peptidyl compounds can be, for example, a peptide containing kalsitoniinisekvenssin that • «* i * · · includes a carboxyl-terminal glycine residue.

• f * * * • · · • t · ♦ i * * : 25 13. Menetelmä kalsitoniinin valmistamiseksi, j ossa menetelmässä saadaan aikaan sub- • i * : t > » straatti, joka sisältää aminohapposekvenssin, joka vastaa vähintään yhden kalsito- niinityypin aminohapposekvenssiä, että substraattisekvenssissä on glysiinitähde sen kar- • · *. • f * * * • • · t · i * ♦ * 25 13. A method for preparing a calcitonin, in which method there is provided a sub- • i * t> »as substrate, which contains an amino acid sequence corresponding to at least one type of calcitonin the amino acid sequence, the substrate sequence is a glycine residue at its carboxy • · *. ' · i boksyylipäätteessä, ja sitten substraatti saatetaan reagoimaan alfa-amidointientsyymikoos- '... · tumuksen läsnäollessa, joka sisältää vähintään yhtä alfa-amidointientsyymiä, joka pystyy : *: ': 30 katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin C-päätteessään glysiinitähteen : : sisältävän peptidyyliyhdisteen muuntoa vastaavaksi peptidyyliamidiksi, jossa on amino- l1. '· I boksyylipäätteessä, and then the substrate is reacted with the alpha-amidointientsyymikoos-' ... · composition in the presence of which contains at least one alpha-amidating enzyme capable of: *: ': 30 to catalyze the oxygen and the reducing agent in the presence of at least a C-terminal glycine residue: -containing peptidyl conversion to the corresponding peptidyl amide having an amino l1. *. *. ryhmä mainitun C-terminaalisen glysiinin paikalla, että alfa-amidointientsyymi on riittävän » · .'• j puhdas alfa-amidointientsyymeissä, niin että entsymaattisen koostumuksen spesifinen ak- • · tiivisuus on vähintään n. 25 mU/mg proteiinia, edullisesti vähintään n. 50 mU/mg proteii- 66 110433 nia ja se on riittävän vapaa proteolyyttisestä aktiivisuudesta, joka pystyy hajottamaan vähintään yhden kokonaisuuden, joita ovat peptidyyliyhdiste, vastaava peptidyyliamidi ja alfa-amidointientsyymit, niin että koostumus voi katalysoida muuntoa, kun peptidyyliyhdiste sisältää L-aminohappoja. a group of said C-terminal glycine location, and alpha-amidating enzyme is sufficiently "·." • j pure alpha-amidating enzyme, so that the specific activity of the enzymatic composition • · tiivisuus of at least approx. 25 mU / mg protein, preferably at least about. 50 mU / mg protein 66 110433 albumin, and is sufficiently free of proteolytic activity capable of degrading at least one entity, such as the peptidyl corresponding peptidyl amide and an alpha-amidating enzyme, so that the composition may catalyze the conversion of the peptidyl compounds containing L-amino acids. Vielä edullisemmin entsymaattisen koostumuksen aktiivi-5 suus on vähintään n. 150 mU/mg proteiinia. More preferably, the enzymatic composition of the active-5 content of at least approx. 150 mU / mg protein.

Substraatti voidaan saada aikaan yhdistelmätekniikalla, jossa eristetään tai valmistetaan DNA-sekvenssi, joka pystyy ilmaisemaan kalsitoniiniaminohapposekvenssin, liitetään DNA-sekvenssi plasmidiin ja indusoidaan plasmidin transformaatio isäntäsoluun, 10 joka pystyy ilmaisemaan tämän DNA-sekvenssin. The substrate may be achieved by a combination of techniques, isolating or preparing a DNA sequence which is capable of detecting kalsitoniiniaminohapposekvenssin, joined to the DNA sequence of a plasmid and the plasmid is induced transformation of the host cell 10 which is able to express the DNA sequence.

Ennen substraatin saattamista reagoimaan entsymaattisen koostumuksen läsnäollessa substraatti voidaan muuntaa siten, että sen rakenteella C-terminaalisen glysiinin N-terminaalisella sivulla on molekyylirakenne, joka on identtinen vähintään yhden luon-15 nossa esiintyvän kalsitoniinisekvenssin vastaavan osan kanssa. Before being placed on the substrate of the enzymatic reaction of the composition in the presence of the substrate may be modified such that the structure of the C-terminal glycine in the N-terminal side has a molecular structure that is identical to the corresponding portion of at least one kalsitoniinisekvenssin nature occurring, and 15.

Kalsitoniini on edullisesti ihmisperäistä tai lohen kalsitoniinia tai niiden analogeja. Calcitonin is preferably of human origin, or salmon calcitonin or analogs thereof. 1 » « 1 »«

Menetelmä kasvuhormonia vapauttavan tekijän valmistamiseksi, jossa menetelmässä 20 saadaan aikaan substraatti, joka sisältää aminohapposekvenssin, joka vastaa vähintään yhden kasvuhormonia vapauttavan tekijän aminohapposekvenssiä, jolloin substraattisekvens- tfj | Process for the preparation of growth hormone releasing factor, the method comprising providing a substrate 20, which contains an amino acid sequence corresponding to at least one growth hormone releasing factor amino acid sequence, wherein the substraattisekvens- tfj | sissä on ainakin sen karboksyylipäätteessä glysiinitähde, ja sitten substraatti saatetaan rea- • « goimaan alfa-amidointientsyymikoostumuksen läsnäollessa, joka sisältää vähintään yhtä is, at least the carboxyl-terminus glycine residue, and then the substrate is reacting • «moiety with the alpha-amidointientsyymikoostumuksen the presence of which contains at least one

• · I • · I

• *,: alfa-amidointientsyymiä, j oka pystyy katalysoimaan hapen ja pelkistysaineen läsnäollessa • 9 :. • * ,: alpha-amidating enzyme, j thorn is capable of catalyzing the oxygen and the reducing agent in the presence of • 9. · : 25 ainakin C-päätteessään glysiinitähteen sisältävän peptidyyliyhdisteen muuntoa vastaavaksi • · » ! ·: At least 25 C-terminal peptidyl compounds containing glycine residue conversion to the corresponding • · »! '. '. · peptidyyliamidiksi, jossa on aminoryhmä mainitun C-terminaalisen glysiinin paikalla, että '. · Peptidyl amide having an amino group at the C-terminal glycine location, and '. * · entsymaattinen koostumus on riittävän puhdas alfa-amidointientsyymeissä, niin että ent symaattisen koostumuksen spesifinen aktiivisuus on vähintään n. 25 mU/mg proteiinia, ' · ': edullisesti vähintään n. 50 mU/mg proteiinia ja se on riittävän vapaa proteolyyttisestä ak- • * •; * · Enzymatic composition is sufficiently pure alpha-amidating enzyme, and that the ex specific activity of the enzymatic composition is at least about 25 mU / mg protein, '·'.., Preferably at least about 50 mU / mg protein and are sufficiently free of proteolytic activity • * •; · ' 30 tiivisuudesta, joka pystyy hajottamaan vähintään yhden kokonaisuuden, joita ovat pepti- v.: dyyliyhdiste, vastaava peptidyyliamidi ja alfa-amidointientsyymit, niin että koostumus voi ·'...· katalysoida muuntoa, kun peptidyyliyhdiste sisältää L-aminohappoja. · "New 30-tight, capable of degrading at least one entity, in which the peptide .: dyyliyhdiste, a corresponding peptidyl amide and an alpha-amidating enzyme, so that the composition may · '... · catalyze the conversion of the peptidyl compounds containing L-amino acids. Vielä edullisemmin ' · *: entsymaattisen koostumuksen spesifinen aktiivisuus on vähintään n. 150 mU/mg proteii- nia. Even more preferably, '· *. The specific activity of the enzymatic composition is at least about 150 mU / mg of protein.

110433 67 110433 67

Substraatti voidaan saada aikaan yhdistelmätekniikalla, jossa eristetään tai valmistetaan DNA-sekvenssi, joka pystyy ilmaisemaan kasvuhormonia vapauttavan tekijän aminohapposekvenssin, liitetään DNA-sekvenssi sopivaan plasmidiin ja indusoidaan plasmidin 5 transformaatio sopivaan isäntäsoluun, joka pystyy ilmaisemaan tämän DNA-sekvenssin. The substrate may be achieved by a combination of techniques, isolating or preparing a DNA sequence which is capable of detecting growth hormone releasing factor amino acid sequence, joined to the DNA sequence into a suitable plasmid and the plasmid is induced by 5 Transformation of a suitable host cell, which can express the DNA sequence.

Ennen substraatin saattamista reagoimaan entsymaattisen koostumuksen läsnäollessa substraatti voidaan muuntaa siten, että sen rakenteella C-terminaalisen glysiinin N-terminaalisella sivulla on molekyylirakenne, joka on identtinen vähintän yhden kasvu-10 hormonia vapauttavan tekijän vastaavan osan kanssa. Before being placed on the substrate of the enzymatic reaction of the composition in the presence of the substrate may be modified such that the structure of the C-terminal glycine in the N-terminal side has a molecular structure that is identical to at least one growth 10 hormone-releasing factor with a corresponding member.

15. Menetelmä kalsitoniini-geenin sukuisen peptidin valmistamiseksi, jossa menetelmässä saadaan aikaan substraatti, joka sisältää aminonapposekvenssin, joka vastaa vähintään yhden kalsitoniini-geenin sukuisen peptidityypin aminohapposekvenssiä, jolloin substraat-15 tisekvenssissä on sen karboksyylipäätteessä glysiinitähde, ja sitten substraatti saatetaan reagoimaan alfa-amidointientsyymikoostumuksen läsnäollessa, joka sisältää vähintään yhtä alfa-amidointientsyymiä, joka pystyy katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin C-päätteessään glysiinitähteen sisältävän peptidyyliyhdisteen muuntoa vastaavaksi peptidyyliamidiksi, jossa on aminoryhmä mainitun C-terminaalisen glysiinin paikalla, että 20 entsymaattinen koostumus on riittävän puhdas alfa-amidointientsyymeissä, niin että entsymaattisen koostumuksen spesifinen aktiivisuus on vähintään n. 25 mU/mg proteiinia, : : edullisesti vähintään n. 50 mU/mg proteiinia ja se on riitt 15. Process for the preparation of related peptide calcitonin-gene, the method comprising providing a substrate comprising a aminonapposekvenssin corresponding to at least one-related calcitonin gene peptide to the amino acid sequence, wherein in the substrate-15 bit sequence is the carboxyl-terminus glycine residue, and then the substrate is reacted with the alpha-amidointientsyymikoostumuksen in the presence of comprising at least one alpha-amidating enzyme capable of catalyzing the oxygen and the reducing agent in the presence of at least a C-terminal peptidyl compounds containing a glycine residue conversion to a corresponding peptidyl amide having an amino group at the C-terminal glycine in the spot that 20 enzymatic composition is sufficiently pure alpha-amidating enzyme, and that the specific activity of the enzymatic composition is at least about 25 mU / mg protein. preferably, at least about 50 mU / mg protein and it is sufficient for. vän vapaa proteolyyttisestä ak- ·/“ tiivisuudesta, joka pystyy hajottamaan vähintään yhden kokonaisuuden, joita ovat pepti- » 1 · • V dyyliyhdiste, vastaava peptidyyliamidi ja alfa-amidointientsyymit, niin että koostumus voi • » :.: : 25 katalysoida muuntoa, kun peptidyyliyhdiste sisältää L-aminohappoja. Vän free of proteolytic activity · / "tight new capable of degrading at least one entity, such as a peptide» 1 · • V dyyliyhdiste, a corresponding peptidyl amide and an alpha-amidating enzyme, so that the composition can • »:.:: 25 to catalyze the conversion of the peptidyl compounds containing L-amino acids. Vielä edullisemmin : V entsymaattisen koostumuksen spesifinen aktiivisuus on vähintään n. 150 mU/mg proteii- * nia. Even more preferably, V enzymatic specific activity of the composition is at least about 150 mU / mg protein * albumin..

• 1 *; • 1 *; ': Substraatti voidaan saada aikaan yhdistelmätekniikalla, jossa eristetään tai valmistetaan •; 'The substrate may be obtained by recombinant technology, wherein the isolated or prepared in •; · 1 30 DNA-sekvenssi, joka pystyy ilmaisemaan kalsitoniini-geenin sukuisen peptidin aminohap-::: posekvenssin, liitetään DNA-sekvenssi sopivaan plasmidiin ja indusoidaan plasmidin :: transformaatio sopivaan isäntäsoluun, joka pystyy ilmaisemaan tämän DNA-sekvenssin. · January 30 DNA sequence which is able to express calcitonin gene-related peptide of the amino - acid sequence :::, joined to the DNA sequence into a suitable plasmid and plasmid :: induced transformation of a suitable host cell, which can express the DNA sequence.

» · · * · · · 110433 68 »* · · · · · 110433 68

Ennen substraatin saattamista reagoimaan entsymaattisen koostumuksen läsnäollessa substraatti voidaan muuntaa siten, että sen rakenteella C-terminaalisen glysiinin N-terminaalisella sivulla on molekyylirakenne, joka on identtinen vähintään yhden kalsito-niini-geenin sukuisen peptidin vastaavan osan kanssa. Before being placed on the substrate of the enzymatic reaction of the composition in the presence of the substrate may be modified such that the structure of the C-terminal glycine in the N-terminal side has a molecular structure that is identical to that of at least one calcitonin-related gene, bast portion of the peptide.

5 16. Menetelmä alfa-amidointientsyymikoostumusten valmistamiseksi, jossa menetelmässä saadaan aikaan DNA-sekvenssi, joka pystyy koodaamaan alfa-amidointientsyymin, liitetään DNA-sekvenssi ilmaisuvektoriin, indusoidaan ilmaisuvektorin transformaatio isän-täsoluun, joka pystyy ilmaisemaan DNA-sekvenssin ja valitaan edullisesti isäntäsolut, 10 joissa on tämä DNA-sekvenssi ja jotka ilmaisevat sen. 5 16. A method for the preparation of alpha-amidointientsyymikoostumusten, the method comprising providing a DNA sequence capable of encoding an alpha-amidating enzyme, ligating DNA sequence of an expression inducing of an expression transformation is the father-stem cells, which can express the DNA sequence, and preferably is selected from the host cells, 10 with this is the DNA sequence and which express it.

Menetelmässä vähintään osa mainitusta DNA-sekvenssistä on cDNA, joka on johdettu polyadenyloiduista RNArsta solun koko RNA:sta, jonka tiedetään ilmaisevan alfa-amidointientsyymin, ja jossa cDNA on eristetty selektiivisesti sen jälkeen, kun se on 15 tunnistettu oligonukleotidikoettimilla, jotka ovat spesifisesti komplementaarisia emässe-kvenssien suhteen, jotka pystyvät koodaamaan aminohapposekvenssit, joita on läsnä al-fa-amidointientsyymissä. In the method, at least a portion of said DNA sequence is a cDNA derived from polyadenylated RNA of total cellular RNA, which is known to alpha-amidating enzyme, and wherein the cDNA is selectively isolated, after a 15-identified oligonucleotide probes that are specifically complementary to emässe- with respect to sequences, which are capable of encoding amino acid sequences that are present in the al-fa-amidating enzyme. DNA-sekvenssissä on vähintään yksi seuraavista fragmenteista (a) vvvv 50v The DNA sequence of at least one of the following fragments: (a) yy 50v

20 AATTCCGGTCTTTAAGAGGTTTAAAGAAACTACCAGATCATTTTCCAATG 20 AATTCCGGTCTTTAAGAGGTTTAAAGAAACTACCAGATCATTTTCCAATG

V vvv lOOv V vvv lOOv

AATGCCTTGGTACCATTGGACCAGTCACCCCTCTTGATGCATCAGATTTT AATGCCTTGGTACCATTGGACCAGTCACCCCTCTTGATGCATCAGATTTT

• * » · · · vvvv 150v • * »· · · yyyy 150v

GCGCTGGATATTCGCATGCCTGGGGTTACACCTAAAGAGTCTGACACATA GCGCTGGATATTCGCATGCCTGGGGTTACACCTAAAGAGTCTGACACATA

• ,·, vvvv 200v : 25 ctttctgcacgtccatgcgtctacct • · · (b) vvvv 50v aattccgtctcagtttctgtttctcttgcatcttctgcaattctgaggag • * * vvvv lOOv 30 gtgggtttgttctccactttgggttcgacaactgcctcggcttctttgat vvvv 150v . • ·, yyyy 200v: 25 ctttctgcacgtccatgcgtctacct • · · (b) yyyy 50v aattccgtctcagtttctgtttctcttgcatcttctgcaattctgaggag • * * yyyy yyyy lOOv 30 gtgggtttgttctccactttgggttcgacaactgcctcggcttctttgat 150v. · · ·. · · ·. ttcgtggacttcgatgccagcctttttaactgaccgatgctccatttttt • » vvvv 200v • ·* cggtcagggtgaacttccacacggtgttgtgtgtgcgctcgaagacgg • · | • ttcgtggacttcgatgccagcctttttaactgaccgatgctccatttttt »yyyy 200v • · • · * cggtcagggtgaacttccacacggtgttgtgtgtgcgctcgaagacgg | · ( • · · • · 110433 69 17. Immobilisoitu alfa-amidointientsyymikoostumus, joka sisältää vähintään yhtä alfa-amidointientsyymiä, joka pystyy katalysoimaan hapen ja pelkistysaineen läsnäollessa ainakin peptidiketjun C-päätteessä glysiinitähteen sisältävän peptidyyliyhdisteen muuntoa vastaavaksi peptidyyliamidiksi, jossa on aminoryhmä mainitun C-terminaalisen glysiinin pai- 5 kalla, jolloin entsyymi on sidottu kovalenttisella sidoksella suoraan tai epäsuorasti tukeen, joka on riittävän jäykkä joko yksinään tai yhdessä muiden materiaalien kanssa kestämään glysiinillä laajennetun peptidyylisubstraatin yhtäjaksoista virtausta yli 24 tunnin ajan menettämättä olennaisesti alfa-amidointiaktiivisuutta, että koostumus on riittävän puhdas al-fa-amidointientsyymeissä, niin että koostumuksen spesifinen aktiivisuus on vähintään n. 25 10 mU/mg proteiinia ja että koostumus on riittävän vapaa proteolyyttisestä aktiivisuudesta, joka pystyy hajottamaa · (• · · • · 110433 69 17. The immobilized alpha-amidointientsyymikoostumus comprising at least one alpha-amidating enzyme capable of catalyzing the oxygen and the reducing agent in the presence of at least the peptide C-terminal peptidyl compounds containing a glycine residue conversion to a corresponding peptidyl amide having an amino group at the C-terminal glycine weight of 5 shellac, wherein the enzyme is bound by a covalent bond to directly or indirectly support which is rigid enough, either alone or in combination with other materials to withstand the glycine-extended peptidyl substrate contiguous flow of more than 24 hours without loss of substantially alpha-amidointiaktiivisuutta that the composition is sufficiently pure al -FA-amidating enzyme, so that the specific activity of the composition is at least about. October 25 mU / mg protein and that the composition is sufficiently free of proteolytic activity capable of degrading n vähintään yhden kokonaisuuden, joita ovat substraattiyhdiste, vastaava peptidyyliamidituote ja alfa-amidointientsyymit, niin että koostumus voi katalysoida alfa-amidointireaktiota, kun peptidyyliyhdiste sisältää L-aminohappoja. the at least one entity, such as the substrate compound, a corresponding peptidyyliamidituote and alpha-amidating enzyme, so that the composition can catalyze the alpha-amidation reaction, when the peptidyl compounds containing L-amino acids.

15 Edullisesti entsyymi on kovalenttisesti sidottu geeliin, joka on muodostettu α,ω -di-amiinisilloitusaineella silloitetun akryyliamidin vesiliukoisesta kopolymeeristä. 15 Preferably, the enzyme is covalently bound to the gel formed on α, ω-di-crosslinked amine crosslinking a water-soluble acrylamide copolymer.

18. Immunoaffmiteettipylväs alfa-amidointientsyymin epäpuhtaiden näytteiden puhdistamiseksi, jossa pylväässä on immunoaffmiteettihartsia, joka sisältää immobilisoidun matrii- 20 sin, joka ei liukene vesiliuokseen eikä hajoa alfa-amidointientsyymin, glysiinillä laajennettujen peptidyyliyhdisteiden tai vastaavien peptidyyliamidien vaikutuksessa, jolloin matrii-: '; 18. Immunoaffmiteettipylväs the purification of alpha-amidating enzyme from impure samples, which is immunoaffmiteettihartsia a column containing an immobilized matrix 20 sequence, which is insoluble in aqueous solution and does not degrade alpha-amidating enzyme, glycine extended peptidyl compounds, or corresponding peptidyl the influence, wherein the matrix '; sissa on funktionaalisia ryhmiä, jotka pystyvät sitomaan proteiineja, ja jossa ryhmät on / j: sidottu kovalenttisesti monoklonaalista tai polyklonaalista alkuperää oleviin vas- . tries have functional groups capable of binding proteins, and wherein the groups is / j-covalently bound to the monoclonal or polyclonal origin of the response. 1 t: ta-aineisiin, jotka sitovat selektiivisesti alfa-amidointientsyymin. 1 t of materials which selectively bind alpha-amidating enzyme. Edullisesti hartsin funk- •, · 1 25 tionaalinen ryhmä on aktivoitu syaanibromidilla. Preferably, the functionalized resin • · January 25 tionaalinen group is activated with cyanogen bromide.

• · · • · • 1 1 • · • · • » · • · · » · * · » · · • · · · • » » > > • · · · • • 1 1 • · • · • »• · · ·» · * · »· · • · · · •» »>>

Claims (4)

70 110433 70 110433
1. En isolerad DNA-sekvens, kännetecknad därav, att : A. DNA-sekvensen kodar för peptidyl-glycin-alfa-amiderande • · monooxygenas; 1. I insulated by the DNA sequence, characterized in that: A. the DNA sequence coding for peptidyl-Glycine-alpha-amiderande • · monooxygenase; och • V 25 :.· * B. DNA-sekvensen kan hybridiseras med ätminstone tvä av • följande oligonukleotidsonder: 3' 5 Oligo- TTA CTC ACG GAC CCG TGG TAA CCG GGA CAC CAC TGG GGG GAC CTA CG nukleotid- TG • · sond • Science V 25. * B · DNA sequences with the kan hybridiseras • At least the TVA of följande oligonukleotidsonder: 3 'oligonucleotide 5 CTC ACG GAC TTA CCG TGG TAA CCG GGA CAC TGG CAC GGG GAC CTA CG TG nukleotid- • · SOND
30 AE1 Iti 3' 5' Oligo- TTA CCG GTC ACC TG :Y: nukleotid- GTT .*,! 30 E1 Iti 3 'to 5' oligonucleotide TTA CCG GTC ACC TG Y. Nukleotid- GTT * ,! sond A*14 :v. SOND A * 14 v. 3' 5' : .· 35 Oligo- TTA CCG GTC ACC TG : nukleotid- GAT sond AE5 v2 110433 3' 5' Oligo- TAC GTC GGI CCI AG I CTG GTC TT nukleotid- T AT sond AE6 3' 5' 3 'to 5':. · 35 Oligo TTA CCG GTC ACC TG GAT nukleotid- SOND AE5 110433 v2 3 'to 5' oligonucleotide GGI CCI TAC GTC CTG GTC AG I TT T AT nukleotid- SOND AE6 3 'to 5'
5 Oligo- TAC GTC GGI CCI TCA CTG GTC TT nukleotid- T GAT sond AE7 Oligo- 3' 5' nukleotid- AC CCG TGG TAA CCG GGA CAC TG sond IIIIII II AE8 10 3' 5' Oligo- AAA CAC TGC GTC ACC CCC CT nukleotid- GIITI sond AE9 3' 5' Oligo- CTG GTC TTG GTG AA nukleotid- AAA sond AE10 3' 5' Oligo- CTG GTT TTG GTG AA nukleotid- AAA sond AE11 Oligo 5 GGI CCI TAC GTC CTG TCA GTC GAT CT T nukleotid- SOND AE7 oligonucleotide 3 'to 5' nukleotid- AC CCG TGG TAA CCG GGA CAC TG SOND II, III-III AE8 March 10 '5' oligo- TGC CAC GTC AAA ACC CCC CT nukleotid- GIITI SOND AE9 3 'to 5' oligonucleotide CTG GTC TTG GTG AAA AA nukleotid- SOND AE10 3 'to 5' oligonucleotide CTG GTG GTT TTG AAA AA nukleotid- SOND AE11
1. Eristetty DNA-sekvenssi, tunnettu siitä että 1. An isolated DNA sequence, characterized in that
5 A. DNA-sekvenssi koodaa peptidyyli-glysiini-alfa-amidointimono-oksygenaasin; 5 A. The DNA sequence encoding a peptidyl-glycine-alpha-amidointimono-oxygenase; ja B. DNA-sekvenssi on hybridisoitavissa ainakin kahden seuraavassa esitettävän oligonukleotidikoettimen kanssa: 10 3' 5 Oligo- TTA CTC ACG GAC CCG TGG TAA CCG GGA CAC CAC TGG GGG GAC CTA CG nukleoti- TG dikoetin ΆΕ1 3' 5' Oligo- TTA CCG GTC ACC TG nukleoti- GTT dikoetin AE4 3' 5' Oligo- TTA CCG GTC ACC TG nukleoti- GAT dikoetin AE5 3' 5' Oligo- TAC GTC GGI CCI AGI CTG GTC TT nukleoti- T AT dikoetin AE6 3' 5' : Oligo- TAC GTC GGI CCI TCA CTG GTC TT nukleoti- TGAT ·.'.*· dikoetin ··,·, AE7 : Oligo- 3' 5» : nukleoti- AC CCG TGG TAA CCG GGA CAC TG dikoetin IIIIIIII • ·' AE8 • · · * * * 3' 5' Oligo- AAA CAC TGC GTC ACC CCC CT nukleoti- GIITI ;'· I dikoetin *· " AE9 .··' 3' 5' Oligo- CTG GTC TTG GTG AA nukleoti- A AA ,···, dikoetin AE10 !'·*: 3' 5' \ Oligo- CTG GTT TTG GTG AA : nukleoti- A AA dikoetin AE11 110433 and B. a DNA sequence hybridizable to at least double in the next presented with an oligonucleotide probe: 10 3 'Oligo 5 CTC ACG GAC TTA CCG TGG TAA CCG GGA CAC TGG CAC GGG GAC CTA CG TG dikoetin ΆΕ1 nucleotide 3' to 5 'oligonucleotide TTA CCG TG GTC ACC GTT dikoetin AE4 nucleotide 3 'to 5' oligonucleotide CCG TTA GTC GAT ACC TG dikoetin AE5 nucleotide 3 'to 5' oligonucleotide TAC GTC GGI CCI AGI CTG GTC TT nucleotide T AT dikoetin AE6 3 'to 5' oligo - TAC GTC GGI CCI TCA CTG GTC TT at nucleotide TGAT · '* dikoetin · ·· ·, AE7: Oligo 3.' 5 »: a nucleotide AC CCG TGG TAA CCG GGA CAC TG dikoetin IIIIIIII • · '• AE8. · * * * 3 'to 5' oligo- TGC CAC GTC AAA ACC CCC CT nucleotide GIITI; '* · I · dikoetin "·· AE9.' 3 '5' oligonucleotide CTG GTC TTG GTG AA A AA nucleotide, ···, dikoetin AE10 '· * 3'! 5 '\ oligonucleotide CTG GTG GTT TTG AA nucleotides A, AA dikoetin AE11 110433
2. Prokaryoottinen tai eukaryoottinen isäntäsolu, tunnettu siitä, että se on transformoitu tai transfektoitu ekspressiovektorilla, joka sisältää patenttivaatimuksen 1 mukaisen DNA-sekvenssin. 2. A prokaryotic or eukaryotic host cell, characterized in that it is transformed or transfected with an expression vector comprising a DNA sequence according to claim 1. 5 5
3. Menetelmä peptidyyli-glysiini-alfa-amidointimono-oksygenaasi (PAM) rekombinanttiekspressioon, tunnettu siitä että viljellään patenttivaatimuksen 2 mukaisia isäntäsoluja riittävän kauan PAM:n ekspression aikaansaamiseksi ja sen 10 jälkeen otetaan talteen PAM. 3. The method of peptidyl-glycine alpha-amidointimono monooxygenase (PAM) for recombinant expression, characterized in that the culturing host cells according to claim 2 PAM long enough to effect the expression and thereafter recovering the PAM 10.
4. Menetelmä amidoidun peptidin valmistamiseksi, tunnettu siitä että saatetaan C-terminaalisen glysiinin omaava peptidi kosketukseen hapen sekä pelkistimen kanssa 15 patenttivaatimuksen 3 mukaisella rekombinanttimenetelmällä valmistetun peptidyyli-glysiini-alfa-amidointimono-oksygenaasin läsnäollessa. 4. Process for the preparation of the amidated peptide, characterized by reacting a peptide having a C-terminal glycine of oxygen and a reducing agent prepared by the recombinant method according to claim 15 into contact 3 peptidyl-glycine-alpha-amidointimono-oxygenase present. 20 20
2. En prokariotisk eller eukariotisk värdcell, kännetecknad därav, att den är transformerad eller transfekterad med en expressionsvektor, som innehäller DNA-sekvensen enligt :*: patentkravet 1. • · · · t · * 25 2. I prokariotisk eller eukariotisk värdcell, characterized, in that it is transformerad eller transfekterad with a expressionsvektor, som containing from DNA sequences according to: *: Claim 1. • · · · · s 25 *
3. Förfarande för rekombinantexpression av peptidyl-glycin- j alfa-amiderande monooxygenas (PAM) , kännetecknat därav, att I tt · jV. 3. A method for rekombinantexpression of the peptidyl-glycin- j amiderande alpha-monooxygenase (PAM), characterized in that the jV · I tt. man odlar värdceller enligt patentkravet 2 tillräckligt < · länge för att ästadkomma expression av PAM och därefter ätervinner PAM. Man odlar värdceller according to claim 2 tillräckligt <länge · In order to obtain such expression of PAM PAM and thereafter ätervinner. 30 30
» * * • · ,···, 4. Förfarande för framställning av en amiderad peptid, * · · .·, kännetecknat därav, att man bringar en peptid, som • · » i * · innehäller C-terminal glycin, i kontakt med syre samt ett reduktionsmedel i närvaro av en peptidyl-glycin-alfa-i ",· 35 amiderande monooxygenas, som framställts enligt *,*·: rekombinantförfarandet enligt patentkravet 3. »* • ·, ···, 4. A process for the preparation of a amiderad of Peptide * · ·. ·, Characterized in that the man bringar I peptides, som • ·» i * · containing from C-terminal Glycine, in contact Syre samt with a reduktionsmedel in the presence of a peptidyl-Glycine-alpha-i ", · 35 amiderande monooxygenase, som prepared according to the *; * ·: rekombinantförfarandet according to claim 3.
FI935385A 1984-09-27 1993-12-01 alpha amidating enzyme-coding DNA sequence, host cells and a method for producing an amidated peptides FI110433B (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US06/655,366 US4708934A (en) 1984-09-27 1984-09-27 α-amidation enzyme
US65536684 1984-09-27
US07/086,161 US6319685B1 (en) 1984-09-27 1987-08-14 Alpha-amidating enzyme compositions and processes for their production and use
US8616187 1987-08-14

Publications (3)

Publication Number Publication Date
FI935385A FI935385A (en) 1993-12-01
FI935385A0 FI935385A0 (en) 1993-12-01
FI110433B true FI110433B (en) 2003-01-31

Family

ID=34915250

Family Applications (1)

Application Number Title Priority Date Filing Date
FI935385A FI110433B (en) 1984-09-27 1993-12-01 alpha amidating enzyme-coding DNA sequence, host cells and a method for producing an amidated peptides

Country Status (1)

Country Link
FI (1) FI110433B (en)

Also Published As

Publication number Publication date
FI935385D0 (en)
FI110433B1 (en)
FI935385A (en) 1993-12-01
FI935385A0 (en) 1993-12-01

Similar Documents

Publication Publication Date Title
Galen et al. New monoclonal antibodies directed against human renin. Powerful tools for the investigation of the renin system.
ARAI et al. Amino‐acid sequence of feather keratin from fowl
Walter et al. Antibodies specific for the carboxy-and amino-terminal regions of simian virus 40 large tumor antigen
Takeya et al. DNA sequence of the viral and cellular src gene of chickens. 1. Complete nucleotide sequence of an EcoRI fragment of recovered avian sarcoma virus which codes for gp37 and pp60src.
TIMPL et al. Nidogen: A new, self‐aggregating basement membrane protein
US4589881A (en) Polypeptide
Huang et al. Cathepsin D isozymes from porcine spleens. Large scale purification and polypeptide chain arrangements.
CA2021912C (en) Erythropoietin (epo) peptides and antibodies directed against these
FI83538B (en) Foerfarande Foer a production of a hybridomcellinje.
Tam Synthetic peptide vaccine design: synthesis and properties of a high-density multiple antigenic peptide system
AU689777B2 (en) Assay for cardiac troponin I
Kozuka et al. Purification and characterization of bovine lung endothelin receptor.
US4851341A (en) Immunoaffinity purification system
Cerff et al. Subunit structure of higher plant glyceraldehyde-3-phosphate dehydrogenases (EC 1.2. 1.12 and EC 1.2. 1.13).
US5011912A (en) Hybridoma and monoclonal antibody for use in an immunoaffinity purification system
JP2540508B2 (en) How to catalyze chemical reactions
Kim et al. Expression of transglutaminase 1 in human epidermis
AU699748B2 (en) Recombinant HK2 polypeptide
EP0683234A1 (en) ANTIBODY AGAINST $g(b)-AMYLOID OR DERIVATIVE THEREOF AND USE THEREOF
US4816561A (en) Biologically active polypeptides
Ishibashi et al. Structures of tremerogens A-9291-I and A-9291-VIII: peptidal sex hormones of Tremella brasiliensis
US5516639A (en) Antibodies specific for human prostate glandular kallkrein
Schielen et al. The sequence A alpha-(148-160) in fibrin, but not in fibrinogen, is accessible to monoclonal antibodies
Rahman et al. Topography of connexin32 in rat liver gap junctions. Evidence for an intramolecular disulphide linkage connecting the two extracellular peptide loops
JP2665850B2 (en) Recognizing the C-terminus of hBNP monochrome - monoclonal antibody

Legal Events

Date Code Title Description
MA Patent expired