ES2764275T3 - Coronavirus - Google Patents

Coronavirus Download PDF

Info

Publication number
ES2764275T3
ES2764275T3 ES15750093T ES15750093T ES2764275T3 ES 2764275 T3 ES2764275 T3 ES 2764275T3 ES 15750093 T ES15750093 T ES 15750093T ES 15750093 T ES15750093 T ES 15750093T ES 2764275 T3 ES2764275 T3 ES 2764275T3
Authority
ES
Spain
Prior art keywords
coronavirus
seq
replicase gene
virus
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
ES15750093T
Other languages
English (en)
Inventor
Erica Bickerton
Sarah Keep
Paul Britton
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pirbright Institute
Original Assignee
Pirbright Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to GBGB1413020.7A priority Critical patent/GB201413020D0/en
Application filed by Pirbright Institute filed Critical Pirbright Institute
Priority to PCT/GB2015/052124 priority patent/WO2016012793A1/en
Application granted granted Critical
Publication of ES2764275T3 publication Critical patent/ES2764275T3/es
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/215Coronaviridae, e.g. avian infectious bronchitis virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • C12N9/127RNA-directed RNA polymerase (2.7.7.48), i.e. RNA replicase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07Nucleotidyltransferases (2.7.7)
    • C12Y207/07048RNA-directed RNA polymerase (2.7.7.48), i.e. RNA replicase
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5254Virus avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/54Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/70Multivalent vaccine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense
    • C12N2770/00011MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense ssRNA Viruses positive-sense
    • C12N2770/20011Coronaviridae
    • C12N2770/20021Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense
    • C12N2770/00011MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense ssRNA Viruses positive-sense
    • C12N2770/20011Coronaviridae
    • C12N2770/20022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense
    • C12N2770/00011MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense ssRNA Viruses positive-sense
    • C12N2770/20011Coronaviridae
    • C12N2770/20034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense
    • C12N2770/00011MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense ssRNA Viruses positive-sense
    • C12N2770/20011Coronaviridae
    • C12N2770/20051Methods of production or purification of viral material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense
    • C12N2770/00011MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense ssRNA Viruses positive-sense
    • C12N2770/20011Coronaviridae
    • C12N2770/20061Methods of inactivation or attenuation
    • C12N2770/20062Methods of inactivation or attenuation by genetic engineering
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense
    • C12N2770/00011MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA Viruses positive-sense ssRNA Viruses positive-sense
    • C12N2770/20011Coronaviridae
    • C12N2770/20071Demonstrated in vivo effect

Abstract

Un coronavirus atenuado, vivo, que comprende una variante del gen de la replicasa codificante de poliproteínas que comprenden una mutación en nsp-14, en donde la variante del gen de la replicasa codifica una proteína que comprende una mutación de aminoácidos de Val a Leu en la posición correspondiente a la posición 393 de SEQ ID NO: 7.A live, attenuated coronavirus comprising a variant of the replicase gene encoding polyproteins comprising a mutation in nsp-14, wherein the variant of the replicase gene encodes a protein comprising an amino acid mutation from Val to Leu in the position corresponding to position 393 of SEQ ID NO: 7.

Description

DESCRIPCIÓNDESCRIPTION

CoronavirusCoronavirus

Campo de la invenciónField of the Invention

La presente invención se refiere a un coronavirus atenuado que comprende una variante de gen de la replicasa, que hace que el virus tenga una patogenicidad reducida. La presente invención también se refiere al uso de dicho coronavirus en una vacuna para prevenir y/o tratar una enfermedad.The present invention relates to an attenuated coronavirus comprising a variant of the replicase gene, which causes the virus to have reduced pathogenicity. The present invention also relates to the use of said coronavirus in a vaccine to prevent and / or treat a disease.

Antecedentes de la invenciónBackground of the Invention

El virus de la bronquitis infecciosa (IBV) aviar, el agente etiológico de la bronquitis infecciosa (BI), es un patógeno altamente infeccioso y contagioso de las aves domésticas que se replica principalmente en el tracto respiratorio, pero también en las células epiteliales del intestino, riñón y oviducto. El IBV es miembro del Orden Nidovirales, Familia Coronaviridae, Subfamilia Coronavirinae y Género Gammacoronavirus; los coronavirus genéticamente muy similares causan la enfermedad en pavos, pintadas y faisanes.Avian infectious bronchitis virus (IBV), the etiologic agent of infectious bronchitis (BI), is a highly infectious and contagious pathogen of domestic birds that replicates mainly in the respiratory tract, but also in the intestinal epithelial cells , kidney and oviduct. IBV is a member of the Order Nidovirales, Family Coronaviridae, Subfamily Coronavirinae and Genus Gammacoronavirus; Genetically very similar coronaviruses cause disease in turkeys, guinea fowl, and pheasants.

Los signos clínicos de la BI incluyen estornudos, estertores traqueales, secreción nasal y respiración sibilante. Las aves de las que se aprovecha su carne tienen un aumento de peso reducido, mientras que las aves ponedoras ponen menos huevos y producen huevos de baja calidad. La infección respiratoria predispone a los pollos a infecciones bacterianas secundarias que pueden ser fatales en los polluelos. El virus también puede causar daño permanente en el oviducto, en especial, en polluelos, lo que conduce a una reducción de la producción y la calidad de los huevos; y en el riñón, conduciendo a veces a una enfermedad renal que puede ser fatal.The clinical signs of IB include sneezing, tracheal rales, runny nose, and wheezing. The birds for which their meat is used have a reduced weight gain, while the laying birds lay less eggs and produce low quality eggs. Respiratory infection predisposes chickens to secondary bacterial infections that can be fatal in chicks. The virus can also cause permanent damage to the oviduct, especially chicks, leading to reduced egg production and quality; and in the kidney, sometimes leading to kidney disease that can be fatal.

Se ha informado que el IBV es responsable de más pérdidas económicas para la industria avícola que cualquier otra enfermedad infecciosa. Aunque las vacunas vivas atenuadas y las vacunas inactivadas se usan universalmente en el control del IBV, la protección obtenida mediante el uso de la vacuna puede perderse debido a la descomposición de la vacuna o a la introducción de un nuevo serotipo de IBV que no esté relacionado con la vacuna usada, planteando un riesgo para la industria avícola.IBV is reported to be responsible for more economic losses to the poultry industry than any other infectious disease. Although live attenuated and inactivated vaccines are universally used in the control of IBV, the protection obtained through the use of the vaccine may be lost due to the breakdown of the vaccine or the introduction of a new IBV serotype that is not related to the vaccine used, posing a risk to the poultry industry.

Además, existe la necesidad en la industria de desarrollar vacunas que sean adecuadas para su uso in ovo, para mejorar la eficiencia y la rentabilidad de los programas de vacunación. Un desafío importante asociado con la vacunación in ovo es que el virus debe ser capaz de replicarse en presencia de anticuerpos maternos contra el virus, sin ser patógeno para el embrión. Las vacunas actuales contra el IBV se derivan después de múltiples pasadas en huevos embrionados, produciendo esto virus con patogenicidad reducida para los pollos, para que puedan usarse como vacunas vivas atenuadas. Sin embargo, dichos virus casi siempre muestran un aumento de la virulencia de los embriones y, por lo tanto, no pueden usarse para la vacunación in ovo, ya que reducen la capacidad de eclosión. En algunos casos, se observa una reducción del 70 % de la capacidad de eclosión.In addition, there is a need in the industry to develop vaccines that are suitable for in ovo use , to improve the efficiency and cost-effectiveness of vaccination programs. A major challenge associated with in ovo vaccination is that the virus must be able to replicate in the presence of maternal antibodies against the virus, without being pathogenic to the embryo. Current IBV vaccines are derived after multiple passages in embryonated eggs, this producing virus with reduced pathogenicity for chickens, so that they can be used as live attenuated vaccines. However, such viruses almost always show increased virulence of the embryos and therefore cannot be used for in ovo vaccination , as they reduce hatching capacity. In some cases, a 70% reduction in hatching capacity is observed.

La atenuación tras múltiples pasadas en huevos embrionados también presenta otras desventajas. Es un método empírico, pues la atenuación de los virus es aleatoria y diferirá cada vez que se pase el virus, por tanto, la pasada del mismo virus a través de una serie diferente de huevos con fines de atenuación conducirá a un conjunto diferente de mutaciones que conducirán a la atenuación. También hay problemas de eficacia asociados con el proceso: algunas mutaciones afectarán a la replicación del virus y algunas de las mutaciones pueden hacer que el virus esté demasiado atenuado. Las mutaciones también pueden ocurrir en el gen S, lo que también puede afectar a la inmunogenicidad, de modo que la respuesta inmunitaria deseada se vea afectada y la posible vacuna puede no proteger contra el serotipo necesario. Además, existen problemas asociados con la reversión a la virulencia y la estabilidad de las vacunas.Attenuation after multiple passes in embryonated eggs also has other disadvantages. It is an empirical method, since virus attenuation is random and will differ each time the virus is passed, therefore, passing the same virus through a different series of eggs for attenuation purposes will lead to a different set of mutations that will lead to attenuation. There are also efficacy issues associated with the process: some mutations will affect virus replication, and some of the mutations can cause the virus to be too attenuated. Mutations can also occur in the S gene, which can also affect immunogenicity, so that the desired immune response is affected and the possible vaccine may not protect against the necessary serotype. In addition, there are problems associated with reversion to virulence and vaccine stability.

Menachery, V. D. et al. (2014) J. Virol., vol. 88, no. 8, 4251 - 4264, Los documentos WO 2005/049814 A2 y WO 2004/092360 ya desvelaron un coronavirus que comprende una mutación en nsp-15 y nsp-16, así como medios y métodos de cómo llegar a un coronavirus que comprende dichas proteínas estructurales mutadas.Menachery, VD et al. (2014) J. Virol., Vol. 88, no. 8, 4251-4264, WO 2005/049814 A2 and WO 2004/092360 have already disclosed a coronavirus comprising a mutation in nsp-15 and nsp-16, as well as means and methods of how to reach a coronavirus comprising said proteins. mutated structures.

Es importante que se desarrollen vacunas nuevas y más seguras para el control del IBV. Por lo tanto, existe la necesidad de vacunas contra el IBV que no estén asociadas con estos problemas, en particular, vacunas que se pueden usar para la vacunación in ovo. It is important that new and safer vaccines are developed for IBV control. Therefore, there is a need for IBV vaccines that are not associated with these problems, in particular vaccines that can be used for in ovo vaccination .

Sumario de aspectos de la invenciónSummary of aspects of the invention

Los presentes inventores han usado un enfoque de genética inversa para atenuar racionalmente el IBV. Este enfoque es mucho más controlable que la atenuación aleatoria después de múltiples pasadas en los huevos embrionados, porque se conoce la posición de cada mutación y se puede deducir su efecto sobre el virus, es decir, el motivo de la atenuación.The present inventors have used a reverse genetics approach to rationally attenuate IBV. This approach is much more controllable than random attenuation after multiple passes in embryonated eggs, because the position of each mutation is known and its effect on the virus, that is, the reason for the attenuation, can be deduced.

Usando su enfoque de genética inversa, los presentes inventores han identificado diversas mutaciones que hacen que el virus tenga niveles reducidos de patogenicidad. Los niveles de patogenicidad pueden reducirse de manera que cuando el virus se administra a un huevo embrionado, es capaz de replicarse sin ser patógeno para el embrión. Dichos virus pueden ser adecuados para la vacunación in ovo, lo que es una ventaja significativa y supone una mejora con respecto a las vacunas atenuadas contra el IBV producidas tras múltiples pasadas en huevos embrionados.Using their reverse genetics approach, the present inventors have identified various mutations that cause the virus has reduced levels of pathogenicity. Pathogenicity levels can be reduced so that when the virus is administered to an embryonated egg, it is able to replicate without being pathogenic to the embryo. Such viruses may be suitable for in ovo vaccination , which is a significant advantage and an improvement over attenuated IBV vaccines produced after multiple passages in embryonated eggs.

Así pues, en un primer aspecto, la presente invención proporciona un coronavirus atenuado, vivo, que comprende una variante de gen de la replicasa codificante de poliproteínas que comprenden una mutación en nsp-14, en donde la variante del gen de la replicasa codifica una proteína que comprende una mutación de aminoácidos de Val a Leu en la posición correspondiente a la posición 393 de SEQ ID NO: 7.Thus, in a first aspect, the present invention provides a live, attenuated coronavirus comprising a polyprotein-encoding replicase gene variant comprising a mutation in nsp-14, wherein the replicase gene variant encodes a protein comprising an amino acid mutation from Val to Leu at the position corresponding to position 393 of SEQ ID NO: 7.

La variante del gen de la replicasa puede codificar además una proteína que comprende una o más mutaciones de aminoácidos seleccionadas de la lista de:The replicase gene variant can further encode a protein comprising one or more amino acid mutations selected from the list of:

de Pro a Leu en la posición 85 de SEQ ID NO: 6,from Pro to Leu at position 85 of SEQ ID NO: 6,

de Leu a lie en la posición 183 de SEQ ID NO: 8;from Leu to lie at position 183 of SEQ ID NO: 8;

de Val a Iie en la posición 209 de SEQ ID NO: 9.from Val to Iie at position 209 of SEQ ID NO: 9.

El gen de la replicasa puede codificar además una proteína que comprende la mutación de aminoácidos de Pro a Leu en la posición 85 de SEQ ID NO: 6.The replicase gene can further encode a protein comprising the Pro to Leu amino acid mutation at position 85 of SEQ ID NO: 6.

El gen de la replicasa puede codificar una proteína que comprende las mutaciones de aminoácidos de Val a Leu en la posición 393 de SEQ Id NO: 7; de Leu a lie en la posición 183 de SEQ ID NO: 8; y de Val a Iie en la posición 209 de SEQ ID NO: 9.The replicase gene can encode a protein comprising the Val to Leu amino acid mutations at position 393 of SEQ Id NO: 7; from Leu to lie at position 183 of SEQ ID NO: 8; and from Val to Iie at position 209 of SEQ ID NO: 9.

El gen de la replicasa puede codificar una proteína que comprende la mutaciones de aminoácidos de Pro a Leu en la posición 85 de SEQ iD NO: 6; de Val a Leu en la posición 393 de SEQ ID NO: 7; de Leu a lie en la posición 183 de SEQ ID NO: 8; y de Val a Iie en la posición 209 de SEQ ID NO: 9.The replicase gene can encode a protein comprising the Pro to Leu amino acid mutations at position 85 of SEQ iD NO: 6; Val to Leu at position 393 of SEQ ID NO: 7; from Leu to lie at position 183 of SEQ ID NO: 8; and from Val to Iie at position 209 of SEQ ID NO: 9.

El gen de la replicasa puede comprender una o más sustituciones de nucleótidos seleccionadas de la lista de: de C a T en la posición de nucleótido 12137;The replicase gene may comprise one or more nucleotide substitutions selected from the list of: from C to T at nucleotide position 12137;

de G a C en la posición de nucleótido 18114;from G to C at nucleotide position 18114;

de T a A en la posición de nucleótido 19047; yfrom T to A at nucleotide position 19047; and

de G a A en la posición de nucleótido 20139;from G to A at nucleotide position 20139;

en comparación con la secuencia mostrada como SEQ ID NO: 1.compared to the sequence shown as SEQ ID NO: 1.

El coronavirus puede ser un virus de la bronquitis infecciosa (IBV).The coronavirus can be an infectious bronchitis virus (IBV).

El coronavirus puede ser IBV M41.The coronavirus may be IBV M41.

El coronavirus puede comprender una proteína S, al menos parte de la cual sea de un serotipo del IBV distinto de M41.The coronavirus may comprise an S protein, at least part of which is from an IBV serotype other than M41.

Por ejemplo, la subunidad S1 o la proteína S completa pueden ser de un serotipo del IBV distinto de M41.For example, the S1 subunit or the entire S protein may be from an IBV serotype other than M41.

El coronavirus de acuerdo con el primer aspecto tiene una patogenicidad reducida en comparación con un coronavirus que exprese una replicasa de tipo silvestre correspondiente, de modo que cuando el virus se administra a un huevo embrionado, es capaz de replicarse sin ser patógeno para el embrión.The coronavirus according to the first aspect has reduced pathogenicity compared to a coronavirus expressing a corresponding wild-type replicase, so that when the virus is administered to an embryonated egg, it is capable of replication without being pathogenic to the embryo.

En un segundo aspecto, se proporciona una variante del gen de la replicasa como se define en las reivindicaciones. En un tercer aspecto, se proporciona una proteína codificada por una variante de gen de replicasa de coronavirus como se define en las reivindicaciones.In a second aspect, a variant of the replicase gene is provided as defined in the claims. In a third aspect, a protein encoded by a variant of the coronavirus replicase gene is provided as defined in the claims.

En un cuarto aspecto, se proporciona un plásmido que comprende un gen de la replicasa como se define en las reivindicaciones.In a fourth aspect, there is provided a plasmid comprising a replicase gene as defined in the claims.

En un quinto aspecto, se proporciona un método de creación del coronavirus como se define en las reivindicaciones que comprende las siguientes etapas:In a fifth aspect, a method of creating the coronavirus as defined in the claims is provided comprising the following steps:

(i) transfectar un plásmido de acuerdo con el cuarto aspecto de la invención a una célula hospedadora;(i) transfecting a plasmid according to the fourth aspect of the invention to a host cell;

(ii) infectar la célula hospedadora con un virus recombinante que comprende el genoma de una cepa de coronavirus con un gen de la replicasa;(ii) infecting the host cell with a recombinant virus comprising the genome of a coronavirus strain with a replicase gene;

(iii) permitir que se produzca una recombinación homóloga entre las secuencias del gen de la replicasa en el plásmido y las secuencias correspondientes en el genoma del virus recombinante para producir un gen de la replicasa modificado; e (iii) allowing homologous recombination to occur between the sequences of the replicase gene in the plasmid and the corresponding sequences in the genome of the recombinant virus to produce a modified replicase gene; and

(iv) seleccionar el virus recombinante que comprende el gen de la replicasa modificado.(iv) selecting the recombinant virus comprising the modified replicase gene.

El virus recombinante puede ser un virus vaccinia.The recombinant virus can be a vaccinia virus.

El método también puede incluir la etapa:The method may also include the stage:

(v) recuperar el coronavirus recombinante que comprende el gen de la replicasa modificado del ADN del virus recombinante de la etapa (iv).(v) recovering the recombinant coronavirus comprising the replicase gene modified from the recombinant virus DNA of step (iv).

Se proporciona una célula capaz de producir un coronavirus de acuerdo con el primer aspecto.A cell capable of producing a coronavirus according to the first aspect is provided.

En otro aspecto, se proporciona una vacuna que comprende un coronavirus como se define en las reivindicaciones y un vehículo farmacéuticamente aceptable.In another aspect, there is provided a vaccine comprising a coronavirus as defined in the claims and a pharmaceutically acceptable carrier.

También se describe en el presente documento un método de tratamiento y/o prevención de una enfermedad en un sujeto que comprende la etapa de administrar una vacuna de acuerdo con la invención al sujeto.Also disclosed herein is a method of treating and / or preventing a disease in a subject comprising the step of administering a vaccine according to the invention to the subject.

Otros aspectos de la invención proporcionan:Other aspects of the invention provide:

• la vacuna como se define en las reivindicaciones para su uso en la prevención de una enfermedad en un sujeto. También se describe en el presente documento el uso de un coronavirus de acuerdo con el primer aspecto en la fabricación de una vacuna para tratar y/o prevenir una enfermedad en un sujeto.• the vaccine as defined in the claims for use in preventing a disease in a subject. Also described herein is the use of a coronavirus according to the first aspect in the manufacture of a vaccine to treat and / or prevent disease in a subject.

La enfermedad puede ser bronquitis infecciosa (BI).The disease can be infectious bronchitis (BI).

El método de administración de la vacuna puede seleccionarse del grupo que consiste en; administración de gotas oculares, administración intranasal, administración en agua potable, inyección posterior a la eclosión e inyección in ovo. The method of administration of the vaccine can be selected from the group consisting of; administration of eye drops, intranasal administration, administration in drinking water, injection after hatching and injection in ovo.

La vacunación puede ser mediante vacunación in ovo. Vaccination can be by in ovo vaccination .

La presente invención también proporciona un método de producción de una vacuna como se define en las reivindicaciones que comprende la etapa de infectar una célula como se define en las reivindicaciones con un coronavirus como se define en las reivindicaciones.The present invention also provides a method of producing a vaccine as defined in the claims which comprises the step of infecting a cell as defined in the claims with a coronavirus as defined in the claims.

Descripción de las figurasDescription of the figures

Figura 1 - Cinética de crecimiento de M41-R-6 y M41-R-12 en comparación con M41-CK (M41 EP4) en células CK Figura 2 - Signos clínicos, tos metálica y respiración sibilante, asociados con M41-R-6 y M41-R-12 en comparación con M41-CK (M41 EP4) y Beau-R (Las barras muestran la simulación, Beau-R, M41-R 6, M41 - R 12, M41-CK EP4 de izquierda a derecha de cada punto de tiempo).Figure 1 - Growth kinetics of M41-R-6 and M41-R-12 compared to M41-CK (M41 EP4) in CK cells Figure 2 - Clinical signs, metallic cough and wheezing, associated with M41-R-6 and M41-R-12 compared to M41-CK (M41 EP4) and Beau-R (Bars show simulation, Beau-R, M41-R 6, M41 - R 12, M41-CK EP4 from left to right of each point of time).

Figura 3 - Actividad ciliar de los virus en anillos traqueales aislados de tráqueas tomadas de polluelos infectados. El 100 % de la actividad ciliar indica que no hay efecto producido por el virus; apatógeno, el 0 % de actividad indica la pérdida completa de la actividad ciliar, la ciliostasis completa, que indica que el virus es patógeno (las barras muestran la simulación, Beau-R, M41-R 6, M41-R 12, M41-CK EP4 de izquierda a derecha de cada punto de tiempo).Figure 3 - Ciliary activity of viruses in tracheal rings isolated from tracheas taken from infected chicks. 100% of the ciliary activity indicates that there is no effect produced by the virus; apathogenic, 0% activity indicates complete loss of ciliary activity, complete ciliostasis, indicating that the virus is pathogenic (bars show simulation, Beau-R, M41-R 6, M41-R 12, M41- CK EP4 from left to right of each time point).

Figura 4 - Signos clínicos, tos metálica, asociado con M41R-nsp10rep y M41R-nsp14,15,16rep en comparación con M41R-12 y M41-CK (M41 EP5) (Las barras muestran la simulación, M41-R12; M41 R-nsp10rep; M41 R-nsp14,15,16rep y M41-CK EP5 de izquierda a derecha de cada punto de tiempo).Figure 4 - Clinical signs, metallic cough, associated with M41R-nsp10rep and M41R-nsp14,15,16rep compared to M41R-12 and M41-CK (M41 EP5) (Bars show simulation, M41-R12; M41 R- nsp10rep; M41 R-nsp14,15,16rep and M41-CK EP5 from left to right of each time point).

Figura 5 - Actividad ciliar de M41R-nsp10rep y M41R-nsp14,15,16rep en comparación con M41-R-12 y M41-CK en anillos traqueales aislados de tráqueas tomadas de polluelos infectados (las barras muestran la simulación; M41-R12; M41R-nsp10rep; M41R-nsp14,15,16rep y m 41-CK EP5 de izquierda a derecha de cada punto de tiempo).Figure 5 - Ciliary activity of M41R-nsp10rep and M41R-nsp14,15,16rep compared to M41-R-12 and M41-CK in tracheal rings isolated from tracheae taken from infected chicks (bars show simulation; M41-R12; M41R-nsp10rep; M41R-nsp14,15,16rep and m 41-CK EP5 from left to right of each time point).

Figura 6 - Signos clínicos, tos metálica, asociado con M41R-nsp10, 15rep, M41R-nsp10, 14, 15rep, M41R-nsp10, 14, 16rep, M41R-nsp10, 15, 16rep y M41-K en comparación con M41-CK (Las barras muestran la simulación, M41R-nsp10,15rep1; M41R-nsp10,14,16rep4; M41R-nsp10,15,16rep8; M41R-nsp10,14,15rep10; M41-K6 y M41-CK EP4 de izquierda a derecha de cada punto de tiempo).Figure 6 - Clinical signs, metallic cough, associated with M41R-nsp10, 15rep, M41R-nsp10, 14, 15rep, M41R-nsp10, 14, 16rep, M41R-nsp10, 15, 16rep, and M41-K compared to M41-CK (Bars show simulation, M41R-nsp10,15rep1; M41R-nsp10,14,16rep4; M41R-nsp10,15,16rep8; M41R-nsp10,14,15rep10; M41-K6 and M41-CK EP4 from left to right of each point of time).

Figura 7 - Signos clínicos, respiración sibilante, asociado con M41R-nsp10, 15rep, M41R-nsp10, 14, 15rep, M41R-nsp10,14, 16rep, M41 R-nsp1 0, 15, 16rep y M41-K en comparación con M41-CK (Las barras muestran la simulación, M41R-nsp10,15rep1; M41R-nsp10,14,16rep4; M41R-nsp10,15,16rep8; M41R-nsp10,14,15rep10; M41-K6 y M41-CK EP4 de izquierda a derecha de cada punto de tiempo).Figure 7 - Clinical signs, wheezing, associated with M41R-nsp10, 15rep, M41R-nsp10, 14, 15rep, M41R-nsp10,14, 16rep, M41 R-nsp1 0, 15, 16rep, and M41-K compared to M41 -CK (Bars show simulation, M41R-nsp10,15rep1; M41R-nsp10,14,16rep4; M41R-nsp10,15,16rep8; M41R-nsp10,14,15rep10; M41-K6 and M41-CK EP4 from left to right of each time point).

Figura 8 - Actividad ciliar de M41R-nsp1 0, 15rep, M41 R-nsp1 0, 14, 15rep, M41R-nsp10, 14, 16rep, M41R-nsp10, 15, 16rep y M41-K en comparación con M41-CK en anillos traqueales aislados de tráqueas tomadas de polluelos infectados (las barras muestran la simulación, M41R-nsp10,15rep1; M41R-nsp10,14,16rep4; M41R-nsp10,15,16rep8; M41R-nsp10,14,15rep10; M41-K6 y M41-CK Ep4 de izquierda a derecha de cada punto de tiempo).Figure 8 - Ciliary activity of M41R-nsp1 0, 15rep, M41 R-nsp1 0, 14, 15rep, M41R-nsp10, 14, 16rep, M41R-nsp10, 15, 16rep and M41-K compared to M41-CK in rings tracheae isolated from tracheae taken from infected chicks (bars show simulation, M41R-nsp10,15rep1; M41R-nsp10,14,16rep4; M41R-nsp10,15,16rep8; M41R-nsp10,14,15rep10; M41-K6 and M41 -CK Ep4 from left to right of each time point).

Figura 9 - Cinética del crecimiento de rIBV en comparación con M41-CK en células CK. La Fig. 9A muestra los resultados para M41-R y M41-K. La Fig. 9B muestra los resultados para M41-nsp10 rep; M41 R-nsp14, 15, 16 rep; M41 R-nsp1 0, 15 rep; M41 R-nsp10, 15, 16 rep; M41R-nsp10, 14, 15 rep; and M41R-nsp10, 14, 16.Figure 9 - Growth kinetics of rIBV compared to M41-CK in CK cells. Fig. 9A shows the results for M41-R and M41-K. Fig. 9B shows the results for M41-nsp10 rep; M41 R-nsp14, 15, 16 rep; M41 R-nsp1 0.15 rep; M41 R-nsp10, 15, 16 rep; M41R-nsp10, 14, 15 rep; and M41R-nsp10, 14, 16.

Figura 10 - Posición de las mutaciones de aminoácidos en las secuencias mutadas de nsp10, nsp14, nsp15 y nsp16.Figure 10 - Position of the amino acid mutations in the mutated nsp10, nsp14, nsp15 and nsp16 sequences.

Figura 11 - A) Tos metálica; B) Síntomas respiratorios (respiración sibilante y estertores combinados) y C) Actividad ciliar de rIBV M41R-nsp10,14 rep y rIBV M41R-nsp10,16 rep en comparación con M41-CK (Las barras muestran la simulación, M41R-nsp10,14rep; M41R-nsp10,16rep y M41-K de izquierda a derecha de cada punto de tiempo). Figure 11 - A) Metal cough; B) Respiratory symptoms (wheezing and rales combined) and C) Ciliary activity of rIBV M41R-nsp10,14 rep and rIBV M41R-nsp10,16 rep compared to M41-CK (Bars show simulation, M41R-nsp10,14rep ; M41R-nsp10,16rep and M41-K from left to right of each time point).

Descripción detalladaDetailed description

La presente invención proporciona un coronavirus que comprende una variante del gen de la replicasa que, cuando se expresa en el coronavirus, hace que el virus tenga una patogenicidad reducida en comparación con un coronavirus correspondiente que comprende el gen de la replicasa de tipo silvestre.The present invention provides a coronavirus comprising a variant of the replicase gene which, when expressed in the coronavirus, causes the virus to have reduced pathogenicity compared to a corresponding coronavirus comprising the wild-type replicase gene.

CORONAVIRUSCORONAVIRUS

Gammacoronavirus es un género de virus animales que pertenece a la familia Coronaviridae. Los coronavirus son virus con envoltura que tienen un genoma de ARN monocatenario de sentido positivo y una simetría helicoidal. Gammacoronavirus is a genus of animal virus that belongs to the Coronaviridae family . Coronaviruses are enveloped viruses that have a positive-sense single-stranded RNA genome and helical symmetry.

El tamaño genómico de los coronavirus varía de aproximadamente 27 a 32 kilobases, siendo el tamaño más largo de entre todos los virus de ARN conocidos.The genomic size of coronaviruses varies from approximately 27 to 32 kilobases, being the longest size among all known RNA viruses.

Los coronavirus infectan principalmente el tracto respiratorio superior o el tracto gastrointestinal de mamíferos y aves. Se conocen de cinco a seis cepas diferentes de coronavirus que infectan a los seres humanos. El coronavirus humano más publicado, el SARS-CoV, causante del síndrome respiratorio agudo grave (SARS), tiene una patogenia única, porque causa infecciones del tracto respiratorio superior e inferior, y también puede causar gastroenteritis. El coronavirus del síndrome respiratorio del Medio Oriente (MERS-CoV) también causa una infección en el tracto respiratorio inferior en los seres humanos. Se cree que los coronavirus causan un porcentaje significativo de todos los resfriados comunes en adultos humanos.Coronaviruses mainly infect the upper respiratory tract or the gastrointestinal tract of mammals and birds. Five to six different strains of coronavirus are known to infect humans. The most widely published human coronavirus, SARS-CoV, which causes severe acute respiratory syndrome (SARS), has a unique pathogenesis, because it causes upper and lower respiratory tract infections, and can also cause gastroenteritis. The Middle East respiratory syndrome coronavirus (MERS-CoV) also causes an infection in the lower respiratory tract in humans. Coronaviruses are believed to cause a significant percentage of all common colds in human adults.

Los coronavirus también causan una variedad de enfermedades en animales de ganado y mascotas, algunas de las cuales pueden ser graves y suponen una amenaza para la industria agrícola. Los coronavirus económicamente significativos de animales de ganado incluyen el virus de la bronquitis infecciosa (IBV), que causa principalmente enfermedades respiratorias en pollos y que afecta gravemente a la industria avícola en todo el mundo; el coronavirus porcino (gastroenteritis transmisible, TGE) y el coronavirus bovino, que provocan diarrea en animales jóvenes. El coronavirus felino tiene dos formas, el coronavirus entérico felino es un patógeno de menor importancia clínica, pero la mutación espontánea de este virus puede provocar peritonitis infecciosa felina (FIP), una enfermedad asociada con una alta mortalidad.Coronaviruses also cause a variety of diseases in livestock and pet animals, some of which can be serious and pose a threat to the agricultural industry. Economically significant coronaviruses from livestock animals include infectious bronchitis virus (IBV), which primarily causes respiratory disease in chickens and severely affects the poultry industry worldwide; porcine coronavirus (transmissible gastroenteritis, GER) and bovine coronavirus, which cause diarrhea in young animals. Feline coronavirus has two forms, feline enteric coronavirus is a minor clinical pathogen, but spontaneous mutation of this virus can cause feline infectious peritonitis (FIP), a disease associated with high mortality.

También hay dos tipos de coronavirus canino (CCoV), uno que causa la enfermedad gastrointestinal leve, y uno que ha resultado ser causante de la enfermedad respiratoria. El virus de la hepatitis de ratón (MHV) es un coronavirus que causa una enfermedad epidémica murina con una alta mortalidad, en especial, entre colonias de ratones de laboratorio.There are also two types of canine coronavirus (CCoV), one that causes mild gastrointestinal disease, and one that has been found to cause respiratory disease. Mouse hepatitis virus (MHV) is a coronavirus that causes a murine epidemic disease with high mortality, especially among colonies of laboratory mice.

Los coronavirus se dividen en cuatro grupos, como se muestra a continuación:Coronaviruses are divided into four groups, as shown below:

AlfaAlpha

• Coronavirus canino (CCoV)• Canine coronavirus (CCoV)

• Coronavirus felino (FeCoV)• Feline coronavirus (FeCoV)

• Coronavirus humano 229E (HCoV-229E)• Human Coronavirus 229E (HCoV-229E)

• Virus de la diarrea epidémica porcina (PEDV)• Swine Epidemic Diarrhea Virus (PEDV)

• Virus de la gastroenteritis transmisible (TGEV)• Transmissible gastroenteritis virus (TGEV)

• Coronavirus humano NL63 (NL o New Haven) • Human coronavirus NL63 (NL or New Haven)

BetaBeta

• Coronavirus bovino (BCoV)• Bovine coronavirus (BCoV)

• Coronavirus respiratorio canino (CRCoV): común en el sudeste asiático y en Micronesia• Canine respiratory coronavirus (CRCoV): common in Southeast Asia and Micronesia

• Coronavirus humano OC43 (HCoV-OC43)• Human coronavirus OC43 (HCoV-OC43)

• Virus de la hepatitis de ratón (MHV)• Mouse hepatitis virus (MHV)

• Virus de la encefalomielitis hemaglutinante porcina (HEV)• Porcine hemagglutinating encephalomyelitis virus (HEV)

• Coronavirus de rata (RCV). El coronavirus de rata es bastante frecuente en el este de Australia, donde, en marzo/abril de 2008, se ha encontrado entre colonias de roedores nativos y salvajes.• Rat coronavirus (RCV). Rat coronavirus is quite common in eastern Australia, where, in March / April 2008, it has been found between colonies of native and wild rodents.

• (Sin nombre común hasta el momento) (HCoV-HKU1)• (No common name so far) (HCoV-HKU1)

Coronavirus del síndrome respiratorio agudo grave (SARS-CoV)Coronavirus of severe acute respiratory syndrome (SARS-CoV)

• Coronavirus del síndrome respiratorio del Medio Oriente (MERS-CoV)• Middle East respiratory syndrome coronavirus (MERS-CoV)

GammaGamma

• Virus de la bronquitis infecciosa (IBV)• Infectious bronchitis virus (IBV)

• Coronavirus de Turquía (virus de la enfermedad de Bluecomb)• Turkish Coronavirus (Bluecomb disease virus)

• Coronavirus del faisán• Pheasant coronavirus

• Coronavirus de la pintada• Graffiti coronavirus

DeltaDelta

• Coronavirus del bulbul (BuCoV)• Bulbul coronavirus (BuCoV)

• Coronavirus del tordo (ThCoV)• Thrush coronavirus (ThCoV)

• Coronavirus de Lonchura (MuCoV)• Coronavirus of Lonchura (MuCoV)

• Coronavirus porcino (PorCov) HKU15• Porcine coronavirus (PorCov) HKU15

La variante del gen de la replicasa del coronavirus de la presente invención puede derivarse de un alfacoronavirus tal como TGEV; un betacoronavirus tal como MHV; o un gammacoronavirus tal como IBV.The variant of the coronavirus replicase gene of the present invention can be derived from an alphacoronavirus such as TGEV; a betacoronavirus such as MHV; or a gammacoronavirus such as IBV.

Como se usa en el presente documento, la expresión "derivado de" significa que el gen de la replicasa comprende esencialmente la misma secuencia de nucleótidos que el gen de la replicasa de tipo silvestre del coronavirus relevante. Por ejemplo, la variante del gen de la replicasa de la presente invención puede tener hasta un 80 %, 85 %, 90 %, 95 %, 98 % o 99 % de identidad con la secuencia de replicasa de tipo silvestre. La variante del gen de la replicasa de coronavirus codifica una proteína que comprende una mutación en una o más proteínas no estructurales (nsp)-10, nsp-14, nsp-15 o nsp-16 en comparación con la secuencia de tipo silvestre de la proteína no estructural.As used herein, the term "derived from" means that the replicase gene comprises essentially the same nucleotide sequence as the wild type replicase gene of the relevant coronavirus. For example, the replicase gene variant of the present invention can have up to 80%, 85%, 90%, 95%, 98%, or 99% identity with the wild-type replicase sequence. The coronavirus replicase gene variant encodes a protein comprising a mutation in one or more non-structural proteins (nsp) -10, nsp-14, nsp-15, or nsp-16 compared to the wild type sequence of the non-structural protein.

IBVIBV

La bronquitis infecciosa aviar (BI) es una enfermedad respiratoria aguda y altamente contagiosa de los pollos causante de importantes pérdidas económicas. La enfermedad se caracteriza por signos respiratorios que incluyen jadeos, tos, estornudos, estertores traqueales y secreción nasal. En los pollos jóvenes, se puede presentar dificultad respiratoria grave. En las capas, la dificultad respiratoria, la nefritis, la disminución de la producción de huevos, y la pérdida de calidad interna del huevo y de calidad de la cáscara del huevo son comunes.Avian infectious bronchitis (IB) is an acute and highly contagious respiratory disease in chickens that causes significant economic losses. The disease is characterized by respiratory signs including gasping, coughing, sneezing, tracheal rales, and a runny nose. In young chickens, severe respiratory distress may occur. In the layers, respiratory distress, nephritis, decreased egg production, and loss of internal egg quality and egg shell quality are common.

En los pollos de engorde, la tos y el traqueteo son signos clínicos comunes, extendiéndose rápidamente a todas las aves de la instalación. La morbilidad es del 100 % en los conjuntos de aves sin vacunar. La mortalidad varía según la edad, la cepa del virus y las infecciones secundarias, pero puede ser de hasta el 60 % en los conjuntos de aves sin vacunar.In broilers, coughing and rattling are common clinical signs, rapidly spreading to all birds in the facility. Morbidity is 100% in unvaccinated sets of birds. Mortality varies by age, virus strain, and secondary infections, but can be as high as 60% in unvaccinated sets of birds.

El primer serotipo de IBV que se identificó fue Massachusetts, pero, en Estados Unidos, varios serotipos, incluyendo Arkansas y Delaware, se encuentran actualmente en circulación, además del tipo de Massachusetts identificado originalmente.The first IBV serotype to be identified was Massachusetts, but several serotypes, including Arkansas and Delaware, are currently in circulation in the United States, in addition to the originally identified type of Massachusetts.

La cepa del IBV Beaudette se obtuvo después de al menos 150 pasadas en embriones de polluelo. El IBV Beaudette ya no es patógeno para las pollos eclosionados, pero mata rápidamente a los embriones.The IBV Beaudette strain was obtained after at least 150 passages in chick embryos. The IBV Beaudette is no longer pathogenic for hatched chickens, but it quickly kills embryos.

H120 es una cepa comercial de vacuna atenuada viva del serotipo de IBV Massachusetts, atenuada mediante aproximadamente 120 pasadas en huevos de pollo embrionados. H52 es otra vacuna de Massachusetts, y representa un virus de una pasada anterior y ligeramente más patógeno (pasada 52) durante el desarrollo de H120. Las vacunas a base de H120 se usan comúnmente.H120 is a commercial live attenuated vaccine strain of the IBV Massachusetts serotype, attenuated by approximately 120 runs in embryonated chicken eggs. H52 is another Massachusetts vaccine, and represents a virus from an earlier and slightly more pathogenic pass (pass 52) during the development of H120. H120-based vaccines are commonly used.

BI QX es un aislado de campo virulento del IBV. A veces se le conoce como "QX chino", ya que se aisló originalmente después de brotes de la enfermedad en la región china de Qingdao a mediados de la década de los 90 del siglo pasado. Desde entonces, el virus se ha extendido hacia Europa. Desde 2004, se han identificado problemas graves de producción de huevos con un virus muy similar en partes de Europa occidental, predominantemente en los Países Bajos, pero también se ha informado de casos producidos en Alemania, Francia, Bélgica, Dinamarca y Reino Unido. BI QX is a virulent field isolate from IBV. It is sometimes referred to as "Chinese QX" as it was originally isolated after outbreaks of the disease in the Chinese region of Qingdao in the mid-1990s of the last century. Since then, the virus has spread to Europe. Since 2004, serious egg production problems with a very similar virus have been identified in parts of Western Europe, predominantly in the countries Low, but cases in Germany, France, Belgium, Denmark and the United Kingdom have also been reported.

El Instituto de Investigación holandés de Deventer identificó el virus aislado de los casos holandeses como una nueva cepa que denominaron D388. La conexión con China provino de otras pruebas que mostraron que el virus era un 99 % similar a los virus QX chinos. Ahora se ha desarrollado una cepa de vacuna viva atenuada del IBV de tipo QX.The Dutch Deventer Research Institute identified the virus isolated from the Dutch cases as a new strain that they named D388. The connection to China came from other tests that showed the virus to be 99% similar to Chinese QX viruses. Now a live attenuated IBX strain of type QX has been developed.

El IBV es un virus con envoltura que se replica en el citoplasma celular y que contiene un genoma de ARN de sentido positivo no segmentado, monocatenario. El IBV tiene un genoma de ARN de 27,6 kb y, como todos los coronavirus, contiene las cuatro proteínas estructurales; Glicoproteína pico (S), proteína de membrana pequeña (E), proteína de membrana integral (M) y proteína de nucleocápside (N) que interactúa con el ARN genómico.IBV is an enveloped virus that replicates in the cell cytoplasm and contains a single-stranded, non-segmented, positive-sense RNA genome. The IBV has a 27.6 kb RNA genome and, like all coronaviruses, contains all four structural proteins; Peak glycoprotein (S), small membrane protein (E), integral membrane protein (M), and nucleocapsid protein (N) that interacts with genomic RNA.

El genoma se organiza de la siguiente manera: UTR de 5' - gen de la polimerasa (replicasa) - genes de proteínas estructurales (S-E-M-N) - UTR de 3'; donde la UTR son regiones no traducidas (cada ~500 nucleótidos en iBv ). The genome is organized as follows: 5 'UTR - polymerase gene (replicase) - structural protein genes (S-E-M-N) - 3' UTR; where the UTR are untranslated regions (every ~ 500 nucleotides in iBv).

La envoltura lipídica contiene tres proteínas de membrana: S, M y E. La proteína S del IBV es una glicoproteína de tipo I que se oligomeriza en el retículo endoplasmático y se ensambla en un homotrímero insertado en la membrana del virión a través del dominio transmembrana y se asocia a través de interacciones no covalentes con la proteína M. Tras la incorporación a partículas de coronavirus, la proteína S es responsable de la unión al receptor de la célula diana y la fusión de las membranas víricas y celulares. La glicoproteína S consiste en cuatro dominios: una secuencia señal que se escinde durante la síntesis; el ectodominio, que está presente en el exterior de la partícula de virión; la región transmembrana responsable de anclar la proteína S en la bicapa lipídica de la partícula de virión; y la cola citoplasmática.The lipid envelope contains three membrane proteins: S, M and E. The IBV protein S is a type I glycoprotein that oligomerizes in the endoplasmic reticulum and assembles itself into a homotimer inserted into the membrane of the virion through the transmembrane domain. and is associated through non-covalent interactions with protein M. Upon incorporation into coronavirus particles, protein S is responsible for binding to the target cell receptor and fusion of viral and cell membranes. Glycoprotein S consists of four domains: a signal sequence that is cleaved during synthesis; the ectodomain, which is present on the outside of the virion particle; the transmembrane region responsible for anchoring protein S in the lipid bilayer of the virion particle; and the cytoplasmic tail.

T odos los coronavirus también codifican un conjunto de genes proteicos auxiliares de función desconocida que no son necesarios para la replicación in vitro, pero pueden desempeñar un papel en la patogénesis. El IBV codifica dos genes auxiliares, genes 3 y 5, ambos expresan dos proteínas auxiliares 3a, 3b y 5a, 5b, respectivamente.All coronaviruses also encode a set of helper protein genes of unknown function that are not necessary for in vitro replication , but may play a role in pathogenesis. The IBV encodes two auxiliary genes, genes 3 and 5, both expressing two auxiliary proteins 3a, 3b and 5a, 5b, respectively.

la variante del gen de replicasa del coronavirus de la presente invención puede derivarse de un IBV. Por ejemplo, el IBV puede ser IBV Beaudette, H120, H52, IB QX, D388 o M41.the coronavirus replicase gene variant of the present invention can be derived from an IBV. For example, the IBV can be IBV Beaudette, H120, H52, IB QX, D388, or M41.

El IBV puede ser IBV M41. M41 es un serotipo Massachusetts prototipo que se aisló en EE.UU. en 1941. Es un aislado usado en muchos laboratorios de todo el mundo como una mancha de laboratorio patógena y se puede obtener de ATCC (VR-21™). Varios productores de vacunas también usan variantes atenuadas como vacunas de IBV contra serotipos Massachusetts que causan problemas en el campo. Los presentes inventores escogieron usar esta cepa, ya que habían trabajado durante muchos años en este virus, y porque se dispone de la secuencia completa del genoma del virus. El aislado de M41, M41-CK, usado por los presentes inventores se adaptó para crecer en células primarias de riñón de pollo (CK) y, por lo tanto, se consideró susceptible de recuperarse como un virus infeccioso de un ADNc del genoma completo. Es representativo de un IBV patógeno y, por lo tanto, puede analizarse en busca de mutaciones que causen la pérdida o reducción de la patogenicidad.The IBV can be IBV M41. M41 is a Massachusetts prototype serotype that was isolated in the USA in 1941. It is an isolate used in many laboratories around the world as a pathogenic laboratory stain and can be obtained from ATCC (VR-21 ™). Several vaccine producers also use attenuated variants such as IBV vaccines against Massachusetts serotypes that cause problems in the field. The present inventors chose to use this strain, since they had worked for many years on this virus, and because the complete sequence of the virus genome is available. The M41 isolate, M41-CK, used by the present inventors was adapted to grow in primary chicken kidney (CK) cells and was therefore considered susceptible to recovery as an infectious virus from a full genome cDNA. It is representative of a pathogenic IBV and can therefore be analyzed for mutations that cause loss or reduction of pathogenicity.

La secuencia genómica del IBV M41-CK se proporciona como SEQ ID NO: 1.The genomic sequence of the IBV M41-CK is provided as SEQ ID NO: 1.

SEQ ID NO: 1 Secuencia del IBV M41-CK SEQ ID NO: 1 Sequence of the IBV M41-CK

ACTTAAGATAGATATTAATATATATCTATCACACTAGCCTTGCGCTAGATTTCCAACTTAACTTAAGATAGATATTAATATATATCTCTATCACACTAGCCTTGCGCTAGATTTCCAACTTA

ACAAAACGGACTTAAATACCTACAGCTGGTCCTCATAGGTGTTCCATTGCAGTGCACTTTACAAAACGGACTTAAATACCTACAGCTGGTCCTCATAGGTGTTCCATTGCAGTGCACTTT

AGTGCCCTGGATGGCACCTGGCCACCTGTCAGGTTTTTGTTATTAAAATCTTATTGTTGCAGTGCCCTGGATGGCACCTGGCCACCTGTCAGGTTTTTGTTATTAAAATCTTATTGTTGC

TGGTATCACTGCTTGTTTTGCCGTGTCTCACTTTATACATCCGTTGCTTGGGCTACCTAGTGGTATCACTGCTTGTTTTGCCGTGTCTCACTTTATACATCCGTTGCTTGGGCTACCTAG

t a t c c a g c g t c c t a c g g g c g c c g t g g c t g g t t c g a g t g c g a a g a a c c t c t g g t t c a t c t at a t c c a g c g t c c t a c g g g c g c c g t g g c t g g t t c g a g t g c g a a g a a c c t c t g g t t c a t c t a

GCGGTAGGCGGGTGTGTGGAAGTAGCACTTCAGACGTACCGGTTCTGTTGTGTGAAATACGCGGTAGGCGGGTGTGTGGAAGTAGCACTTCAGACGTACCGGTTCTGTTGTGTGAAATAC

GGGGTCACCTCCCCCCACATACCTCTAAGGGCTTTTGAGCCTAGCGTTGGGCTACGTTCTGGGGTCACCTCCCCCCACATACCTCTAAGGGCTTTTGAGCCTAGCGTTGGGCTACGTTCT

CGCATAAGGTCGGCTATACGACGTTTGTAGGGGGTAGTGCCAAACAACCCCTGAGGTGACCGCATAAGGTCGGCTATACGACGTTTGTAGGGGGTAGTGCCAAACAACCCCTGAGGTGAC

AGGTTCTGGTGGTGTTTAGTGAGCAGACATACAATAGACAGTGACAACATGGCTTCAAGCAGGTTCTGGTGGTGTTTAGTGAGCAGACATACAATAGACAGTGACAACATGGCTTCAAGC

CTAAAACAGGGAGTATCTCCCAAACTAAGGGATGTCATTCTTGTATCCAAAGACATTCCTCTAAAACAGGGAGTATCTCCCAAACTAAGGGATGTCATTCTTGTATCCAAAGACATTCCT

GAACAACTTTGTGACGCTTTGTTTTTCTATACGTCACACAACCCTAAGGATTACGCTGATGAACAACTTTGTGACGCTTTGTTTTTCTATACGTCACACAACCCTAAGGATTACGCTGAT

GCTTTTGCAGTTAGGCAGAAGTTTGATCGTAATCTGCAGACTGGGAAACAGTTCAAATTTGCTTTTGCAGTTAGGCAGAAGTTTGATCGTAATCTGCAGACTGGGAAACAGTTCAAATTT

GAAACTGTGTGTGGTCTCTTCCTCTTGAAGGGAGTTGACAAAATAACACCTGGCGTCCCAGAAACTGTGTGTGGTCTCTTCCTCTTGAAGGGAGTTGACAAAATAACACCTGGCGTCCCA

GCAAAAGTCTTAAAAGCCACTTCTAAGTTGGCAGATTTAGAAGACATCTTTGGTGTCTCT CCCTTTGCAAGAAAATATCGTGAACTTTTGAAGACAGCATGCCAGTGGTCTCTTACTGTA GAAACACTGGATGCTCGTGCACAAACTCTTGATGAAATTTTTGACCCTACTGAAATACTT TGGCTTCAGGTGGCAGCAAAAATCCAAGTTTCGGCTATGGCGATGCGCAGGCTTGTTGGA GAAGTAACTGCAAAAGTCATGGATGCTTTGGGCTCAAATATGAGTGCTCTTTTCCAGATT TTTAAACAACAAATAGTCAGAATTTTTCAAAAAGCGCTGGCTATTTTTGAGAATGTGAGT GAAT'TACCACAGCGTATTGCAGCACTTAAGATGGCTTTTGCTAAGTGTGCCAAGTCCATT AC-TGTTGTGGTTATGGAGAGGACTCTAGTTGTTAGAGAGTTCGCAGGAACTTGTCTTGCA AGCATTAATGGTGCTGTTGCAAAATTCTTTGAAGAACTCCCAAATGGTTTCATGGGTGCT AAAATTTTCACTACACTTGCCTTCTTTAGGGAGGCTGCAGTGAAAATTGTGGATAACATA CCAAATGCACCGAGAGGCACTAAAGGGTTTGAAGTCGTTGGTAATGCCAAAGGTACACAA GTTGTTGTGCGTGGCATGCGAAATGACTTAACACTGCTTGACCAAAAAGCTGAAATTCCT GTGGAGTCAGAAGGTTGGTCTGCAATTTTGGGTGGACATCTTTGCTATGTCTTTAAGAGT GGTGATCGCTTTTACGCGGCACCTCTTTCAGGAAATTTTGCATTGCATGATGTGCATTGT TGTGAGCGTGTTGTCTGTCTTTCTGATGGTGTAACACCGGAGATAAATGATGGACTTATT CTTGCAGCAATCTACTCTTCTTTTAGTGTCGC.AGAACTTGTGGCAGCCATTAAAAGGGGT GAACCATTTAAGTTTCTGGGTC.ATAAATTTGTGTATGCAAAGGATGCAGCAGTTTCTTTT ACATTAGCGAAGGCTGCTACTATTGCAGATGTTTTGAAGCTGTTTCAATCAGCGCGTGTGGCAAAAGTCTTAAAAGCCACTTCTAAGTTGGCAGATTTAGAAGACATCTTTGGTGTCTCT CCCTTTGCAAGAAAATATCGTGAACTTTTGAAGACAGCATGCCAGTGGTCTCTTACTGTA GAAACACTGGATGCTCGTGCACAAACTCTTGATGAAATTTTTGACCCTACTGAAATACTT TGGCTTCAGGTGGCAGCAAAAATCCAAGTTTCGGCTATGGCGATGCGCAGGCTTGTTGGA GAAGTAACTGCAAAAGTCATGGATGCTTTGGGCTCAAATATGAGTGCTCTTTTCCAGATT TTTAAACAACAAATAGTCAGAATTTTTCAAAAAGCGCTGGCTATTTTTGAGAATGTGAGT GAAT'TACCACAGCGTATTGCAGCACTTAAGATGGCTTTTGCTAAGTGTGCCAAGTCCATT AC-TGTTGTGGTTATGGAGAGGACTCTAGTTGTTAGAGAGTTCGCAGGAACTTGTCTTGCA AGCATTAATGGTGCTGTTGCAAAATTCTTTGAAGAACTCCCAAATGGTTTCATGGGTGCT AAAATTTTCACTACACTTGCCTTCTTTAGGGAGGCTGCAGTGAAAATTGTGGATAACATA CCAAATGCACCGAGAGGCACTAAAGGGTTTGAAGTCGTTGGTAATGCCAAAGGTACACAA GTTGTTGTGCGTGGCATGCGAAATGACTTAACACTGCTTGACCAAAAAGCTGAAATTCCT GTGGAGTCAGAAGGTTGGTCTGCAATTTTGGGTGGACATCTTTGCTATGTCTTTAAGAGT GGTGATCGCTTTTACGCGGCACCTCTTTCAGGAAATTTTGCATTGCATGATGTGCATTGT TGTGAGCGTGTTGTCTGTCTTTCTGATGGTGTAACACCGGAGATAAATGATGGACTTATT CTTGCAGCAATCTACTCTTCTTTTAGTGTCGC.AGAACTTGTGGCAGCCATTAAAAGGGGT GAACCATTTAAGTTTCTGGGTC.ATAAATTTGTGTATGCAAAGGATGCAGCAGTTTCTTTT ACATTAGCGAAGGCTGCTAC TATTGCAGATGTTTTGAAGCTGTTTCAATCAGCGCGTGTG

AfsAGTAGAAGATGTTTGGTCTTCACTTACTGAAAAGTCTTTTGAATTCTGGAGGCTTGCA TATGGAAAAGTGCGTAATCTCGAAGAATTTGTTAAGACTTGTTTTTGTAAGGCTCAAATG GCGATTGTGATTTTAGCGACAGTGCTTGGAGAGGGCATTTGGCATCTTGTTTCGCAAGTC ATCTATAAAGTAGGTGGTCTTTTTACTAAAGTTGTTGACTTTTGTGAAAAATATTGGAAA GGTTTTTGTGCACAGTTGAAAAGAGCTAAGCTCATTGTCACTGAAACCCTCTGTGTTTTG AAAGGAGTTGCACAGCATTGTTTTCAACTATTGCTGGATGCAATACAGTTTATGTATAAA AGTTTTAAGAAGTGTGCACTTGGTAGAATCCATGGAGACTTGCTCTTCTGGAAAGGAGGT GTGCAC.AAAATTATTCAAGAGGGCGATGAAATTTGGTTTGACGCCATTGATAGTATTGAT GTTGAAGATCTGGGTGTTGTTCAAGAAAAATTGATTGATTTTGATGTTTGTGATAATGTG ACACTTCCAGAGAACCAACCCGGTCATATGGTTCAAATCGAGGATGACGGAAAGAACTAC ATGTTCTTCCGCTTCAAAAAGGATGAGAACATTTATTA.TACACCAATGTCACAGCTTGGT GCTATTAATGTGGTTTGCAAAGCAGGCGGTAAAACTGTCACCTTTGGAGAAACTACTGTG CAAGAAATACCACCACCTGATGTTGTGTTTATTAAGGTTAGCATTGAGTGTTGTGGTGAA CCATGGAATACAATCTTCAAAAAGGCTTATAAGGAGCCCATTGAAGTAGAGACAGACCTC ACAGTTGAACAATTGCTCTCTGTGGTCTATGAGAAAATGTGTGATGATCTCAAGCTGTTT CCGGAGGCTCCAGAACCACCACCATTTGAGAATGTCACACTTGTTGATAAGAATGGTAAA GATTTGGATTGCATAAAATCATGCCATCTGATCTATCGTGATTATGAGAGCGATGATGAC ATCGAGGAAGAAGATGCAGAAGAATGTGACACGGATTCAGGTGATGCTGAGGAGTGTGAC ACTAATTCAGAATGTGAAGAAGAAGATGAGGATACTAAAGTGTTGGCTCTTATACAAGAC CCGGCAAGTAACAAATATCCTCTGCCTCTTGATGATGATTATAGCGTCTACAATGGATGT ATTGTTCATAAGGACGCTCTCGATGTTGTGAATTTACCATCTGGTGAAGAAACCTTTGTT GTCAATAACTGCTTTGAAGGGGCTGTTAAAGCTCTTCCGCAGAAAGTTATTGATGTTCTA GGTGACTGGGGTGAGGCTGTTGATGCGCAAGAACAATTGTGTCAACAAGAATCAACTCGG GTCATATCTGAGAAATCAGTTGA.GGGTTTTACTGGTAGTTGTGATGCAATGGCTGAACAA GCTATTGTTGAAGAGCAGGAAATAGTACCTGTTGTTGAACAAAGTCAGGATGTAGTTGTT TTTACACCTGCAGACCTAGAAGTTGTTAAAGAAACAGCAGAAGAGGTTGATGAGTTTATT CTCATTTCTGCTGTCCCTAAAGAAGAAGTTGTGTCTCAGGAGAAAGAGGAGCCACAGGTT GAGCAAGAGCCTACCCTAGTTGTTAAAGCACAACGTGAGAAGAAGGCTAAAAAGTTCAAA GTTAAACCAGCTACATGTGAAAAACCCAAATTTTTGGAGTACAAAACATGTGTGGGTGAT TTGGCTGTTGTAATTGCCAAAGCATTGGATGAGTTTAAAGAGTTCTGCATTGTAAACGCT GCAAATGAGCACATGTCGCATGGTGGTGGCGTTGCAAAGGCAATTGCAGACTTTTGTGGA CCGGACTTTGTTGAATATTGCGCGGACTATGTTAAGAAACATGGTCCACAGCAAAAACTT GTCACACCTTCATTTGTTAAAGGCATTCAATGTGTGAATAATGTTGTAGGACCTCGCCAT GGAGACAGCAACTTGCGTGAGAAGCTTGTTGCTGCTTACAAGAGTGTTCTTGTAGGTGGA GTGGT'TAACTATGTTGTGCCAGTTCTCTCATCAGGGATTTTTGGTGTAGATTTTAAAATA TCAATAGATGCTATGCGCGAAGCTTTTAAAGGTTGTGCCATACGCGTTCTTTTATTTTCT CTGAGTCAAGAACACATCGATTATTTCGATGCAACTTGTAAGCAGAAGACAATTTATCTT ACGGAGGATGGTGTTAAA.TACCGCTCTGTTGTTTTAAAACCTGGTGATTCTTTGGGTCAA TTTGGACAGGTTTTTGCAAGAAATAAGGTAGTCTTTTCGGCTGATGATGTTGAGGATAAA GAAATCCTCTTTATACCCACAACTGACAAGACTATTCTTGAATATTATGGTTTAGATGCG CAAAAGTATGTAACATATTTGCAAACGCTTGCGCAGAAATGGGATGTTCAATATAGAGAC AATTTTGTTATATTAGAGTGGCGTGACGGAAATTGCTGGATTAGTTCAGCAATAGTTCTC CTTCAAGCTGCTAAAATTAGATTTAAAGGTTTTCTTGCAGAAGCATGGGCTAAACTGTTG GGTGGAGATCCTACAGACTTTGTTGCCTGGTGTTATGCAAGTTGCAATGCTAAAGTAGGT GATTTTTCAGATGCTAATTGGCTTTTGGCCAATTTAGCAGAACATTTTGACGCAGATTAC ACAAATGCACTTCTTAAGAAGTGTGTGTCGTGCAATTGTGGTGTTAAGAG'TTATGAACTT AGGGGTCTTGAAGCCTGTATTCAGCCAGTTCGAGCACCTAATCTTCTACATTTTAAAACG CAATATTCAAATTGCCCAACCTGTGGTGCAAGTAGTACGGATGAAGTAATAGAAGCTTCA TTACCGTACTTATTGCTTTTTGCTACTGATGGTCCTGCTACAGTTGATTGTGATGAAAAT GCTGTAGGGACTGTTGTTTTCATTGGCTCTACTAATAGTGGCCATTGTTATACACAAGCC GATGGTAAGGCTTT'TGACAATCTTGCTAAGGATAGAAAATTTGGAAGGAAGTCGCCTTAC ATTACAGCAATGTATACACGTTTTTCTCTTAGGAGTGAAAATCCCCTACTTGTTGTTGAA CATAGTAAGGGTAAAGCTAAAGTAGTAAAAGAAGATGTTTCTAACCTTGCTACTAGTTCT AAAGCCAGTTTTGACGATCTTACTGACTTTGAACAGTGGTATGATAGCAACATCTATGAG AGTCTTAAAGTGCAGGAGACACCTGATAATCTTGATGAATATGTGTCATTTACGACAAAG GAAGATTCTAAGTTGCCACTGACACTTAAAGTTAGAGGTATCAAATCAGTTGTTGACTTT AGGTCTAAGGATGGTTTTACTTATAAGTTAACA.CCTGA_TACTGATGAAAATTCAAAAA.CA CCAGTCTACTACCCAGTCTTGGATTCTATTAGTCTTAGGGCAATATGGGTTGAAGGCAGT GCTAATTTTGTTGTTGGGCATCCAAATTATTATAGTAAGTCTCTCCGAATTCCCACGTTT TGGGAAAATGCCGAGAGCTTTGTTAAfiATGGGTTATAAAATTGATGGTGTAACTATGGGC CTTTGGCGTGCAGAACACCTTAATAAACCTAATTTGGAGAGAATTTTTAACATTGCTAAG AAAGCTATTGTTGGATCTAGTGTTGTTACTACGCAGTGTGGTAAAATA.CTAGTTAAAGCA GCTACATACGTTGCCGATAAAGTAGGTGATGGTGTAGTTCGCAATATTACAGATAGAATT AAGGGTCTTTGTGGATTCACACGTGGCCATTTTGAAAPlGAAAATGTCCCTACAATTTCTA AAGACACTTGTGTTCTTTTTCTTTTATTTCTTAAAGGCTAGTGCTAAGAGTTTAGTTTCT AGCTATAAGATTGTGTTATGTAAGGTGGTGTTTGCTACCTTACTTATAGTGTGGTTTATA TACACAAGTAATCCAGTAGTGTTTACTGGAATACGTGTGCTAGACTTCCTATTTGAAGGT TCTTTATGTGGTCCTTATAATGACTACGGTAAAGATTCTTTTGATGTGTTACGCTATTGT GCA.GGTGA.TTTTACTTGTCGTGTGTGTTTACATGATAGAGATTCACTTCATCTGTACAAA CATGCTTATAGCGTAGAACAAATTTATAAGGATGCAGCTTCTGGCATTAACTTTAATTGG AATTGGCTTTATTTGGTCTTTCTAATATTATTTGTTAAGCCAGTGGCAGGTTTTGTTATT ATTTGTTATTGTGTTAAGT.ATTTGGTATTGAGTTCAACTGTGTTGCAAACTGGTGTAGGT TTTCTAGATTGGTTTGTAAAAACAGTTTTTACCCATTTTAATTTTATGGGAGCGGGATTT TATTTCTGGCTCTTTTACAAG.ATATACGTfiCAAGTGC.ATCATATATTGTA.CTGTAAGGAT GTAACATGTGAAGTGTGCAAGAGAGTTGCACGCAGCAACAGGCAAGAGGTTAGCGTTGTA GTTGGTGGACGCAAGCAAATAGTGCATGTTTACACTAATTCTGGCTAT.AACTTTTGTAAG AGACATAATTGGTATTGTAGAAATTGTGATGATTATGGTCACCAAAATACATTTATGTCC CCTGAAGTTGCTGGCGAGCTTTCTGAAAAGCTTAAGCGCCATGTTAAACCTACAGCATAT GCTTACCACGTTGTGTATGAGGCATGCGTGGTTGATGATTTTGTTAATTTAAAATATAAG GCTGCAATTCCTGGTAAGGATAATGCATCTTCTGCTGTTAAGTGTTTCAGTGTTACAGAT TTTTTAAAGAAAGCTGTTTTTCTTAAGGAGGCATTGAAATGTGAACAAATATCTAATGAT GGTTTTATAGTGTGTAATACACAGAGTGCGCATGCACTAGAGGAAGCAAAGAATGCAGCC GTCTATTATGCGCAATATCTGTGTAAGCCAATACTTATACTTGACCAGGCACTTTATGAG CAATTAAIAGTAGAGCCTGTGTCTAAGAGTGTTATAGATAAAGTGTGTAGCATTTTGTCT AATATAATATCTGTAGATACTGCAGCTTTAAATTATAAGGCAGGCACACTTCGTGATGCT CTGCTTTCTATTACTAAAGACGAAGAAGCCGTAGATATGGCTATCTTCTGCCACAATCAT GAAGTGGAATACACTGGTGACGGTTTTACTAATGTGATACCGTCATATGGTATGGACACT GATAAGTTGA.CA.CCTCGTGATAGAGGGTTTTTGATAAATGCA.GA.TGCTTCTATTGCTAAT TTAAGAGTCAAAAATGCTCCTCCGGTAGTATGGAAGTTTTCTGATCTTATTAAATTGTCT GACAGTTGCCTTAAATATTTAATTTCAGCTACTGTCAAGTCAGGAGGTCGTTTCTTTATA ACAAAGTCTGGTGCTAAACAAGTTATTTCTTGTCATACCCAGAAACTGTTGGTAGAGAAA AAGGCAGGTGGTGTTATTAATAACACTTTTAAATGGTTTATGAGTTGTTTTAAATGGCTT TTTGTCTTTTATATACTTTTTACAGCATGTTGTTTGGGTTACTACTATATGGAGATGAAT AAAAGTTTTGTTCACCCCATGTATGATGTAAACTCCACACTGCATGTTGAAGGGTTCAAA GTTATAGACAAAGGTGTTATTAGAGAGATTGTGTCAGAAGATAATTGTTTCTCTAATAAG TTTGTTAATTTTGACGCCTTTTGGGGTAAATCATATGAAAATAATAAAAACTGTCCAATT GTTACAGTTGTTA.TAGATGGTGACGGGACAGTAGCTGTTGGTGTTCCTGGTTTTGTATCA TGGGTTATGGATGGTG'ITATGTTTGTGCATATGACACAGACTGATCGTAGACCTTGGTAC ATTCCTACCTGGTTTAATAGAGAAATTGTTGGTTACACTCAGGATTCAATTATCACTGAG GGTAGTTTTTATACATCTATAGCATTATTTTCTGCTAGATGTTTATATTTAACAGCCAGC AATACACCTCAATTGTATTGTTTTAATGGCGACAATGATGCACCTGGAGCCTTACCATTT GGTAGTATTATTCCTCATAGAGTATACTTCCAACCTAATGGTGTTAGGCTTATAGTTCCA CAACAAATACTGCATACACCCTACATAGT'GAAGTTTGTTTCAGACAGCTATTGTAGAGGT AGTGTATGTGAGTATACTAAACCAGGTTACTGTGTGTCACTAGACTCCCAATGGGTTTTG TTTAATGATGAATACATTAGTAAACCTGGCGTTTTCTGTGGTTCTACTGTTA.GAGAA.CTT ATGTTTAATATGGTTAGTACATTCTTTACTGGTGTCAACCCTAATATTTATATTCAGCTA GCAACTATGTTTTTAATACTAGTTGTTATTGTGTTAATTTTTGCAATGGTTATAAAGTTT CAAGGTGTTTTTAAAGCTTATGCGACCATTGTGTTTACAATAATGTTAGTTTGGGTTA.TT AATGCATTTGTTTTGTGTGTACATAGTTATAATAGTGTTTTAGCTGTTATATTATTAGTA CTCTATTGCTATGCATCATTGGTTACAAGTCGCAATACTGCTATAATAATGCATTGTTGG CTTGTTTTTACCTTTGGTTTAATAGTACCCACATGGTTGGCTTGTTGCTATCTGGGATTT ATTCTTTATATGTACACACCGTTGGTTTTCTGGTGTTACGGTACTACTAAAAATACTCGT AAGTTGTATGATGGCAACGAGTTTGTTGGTAATTATGACCTTGCTGCGAAGAGCACTTTT GTTATTCGTGGTACTGAATTTGTTAAGCTTAlCGAATGAGATAGGTGATAAATTTGAAGCC TATCTTTCTGCGTATGCTAGACTTAAATACTATTCAGGCACTGGTAGTGAGCAAGATTAC TTGCAAGCTTGTCGTGCATGGTTAGCTTATGCTTTGGACCAATATAGAAATAGTGGTGTT GAGGTTGTTTATACCCCACCGCGTTACTCTATTGGTGTTAGTAGACTACACGCTGGTTTT AAAAAACTAGTTTCTCCTAGTAGTGCTGTTGAGAAGTGCATTGTTAGTGTCTCTTATAGA GGCAATAATCTTAATGGACTGTGGCTGGGTGATTCTATTTACTGCCCACGCCATGTGTTA GGTAAGTTTAGTGGTGACCAGTGGGGTGACG'IACTAAACCTTGCTAATAATCATGAGTTT GAAGTTGTAACTCAAAATGGTGTTACTTTGAATGTTGTCAGCAGGCGGCTTAlAAGGAGCA GTTTTAATTTTACAAACTGCAGTTGCCAATGCTGAAACTCCTAAGTATAAGTTTGTTAAA GCTAATTGTGGTGATAGTTTCACTATAGCTTGTTCTTATGGTGGTACAGTTATAGGACTT TACCCTGTCACTATGCGTTCTAATGGTACTATTAGAGCATCTTTCCTAGCAGGAGCCTGT GGCTCAGTTGGTTTTAATATAGAAAAGGGTGTAGTTAATTTCTTTTATATGCACCATCTT GAGTTACCTAATGCATTACACACTGGAACTGACCTAATGGGTGAGTTTTATGGTGGTTAT GTAGATGAAGAGGTTGCGCAAAGAGTGCCACCAGATAATCTAGTTACTAACAlATATTGTA GCATGGCTCTATGCGGCAATTATTAGTGTTAAAGAAAGTAGTTTTTCACAACCTAAATGG TTGGAGAGTACTACTGTTTCTATTGAAGATTA.CAATAGGTGGGCTAGTGATAATGGTTTT ACTCCATTTTCCACTAGTACTGCTATTACTAAATTAAGTGCTATAACTGGGGTTGATGTT TGTAAACTCCTTCGCACTATTATGGTAAAfiAGTGCTCAATGGGGTfiGTGATCCCATTTTfi GGACAATATAATTTTGAAGACGAATTGACACCAGAATCTGTATTTAATCAAGTTGGTGGT GTTAGGTTACAGTCTTCTTTTGTAAGAAAAGCTACATCTTGGTTTTGGAGTAGATGTGTA TTAGCTTGCTTCTTGTTTGTGTTGTGTGCTATTGTCTTATTTACGGCAGTGCCACTTAAG TTTTATGTACATGCAGCTGTTATTTTGTTGATGGCTGTGCTCTTTATTTCTTTTACTGTT AAACATGTTATGGCATACATGGACACTTTCCTATTGCCTACATTGATTACAGTTATTATT GGAGTTTGTGCTGAAGTCCCTTTCATATACAATA.CTCTAATTAGTCAAGTTGTTATTTTC TTAAGCCAATGGTATGATCCTGTAGTCTTTGATACTATGGTACCATGGATGTTATTGCCA TTAGTGTTGTACACTGCTTTTAAGTGTGTACAAGGCTGCTATATGAATTCTTTCAATACT TCTTTGTTAATGCTGTATCAGTTTATGAAGTTAGGTTTTGTTATTTACACCTCTTCAAAC ACTCTTACTGCATATACAGAAGGTAATTGGGAGTTATTCTTTGAGTTGGTTCACACTATT GTGTTGGCTAATGTTAGTAGTAATTCCTTAATTGGTTTAATTGTTTTTAAGTGTGCTAAG TGGATTTTATATTATTGCAATGCAACATACTTTAATAATTATGTGTTAATGGCAGTCATG GTTAATGGCATAGGCTGGCTTTGCACCTGTTACTTTGGATTGTATTGGTGGGTTAATAAA GTTTTTGGTTTAACCTTAGGTAAATACAATTTTAAAGTTTCAGTAGATCAATATAGGTAT ATGTGTTTGCATAAGGTAAATCCACCTAAAACTGTGTGGGAGGTCTTTACTACAAATATA CTTATACAAGGAATTGGAGGCGATCGTGTGTTGCCTATAGCTACAGTGCAATCTAAATTG AG T G AT G T AAAG T G TAC AAC 'TGTTGTTT T'AAT G C AG C T T T T G AC T AAG C T 'T AAT G T T GAA GC.AAATTCAAAAATGCATGCTTATCTTGTTGAGTTACACAATAAAATCCTCGCATCTGAT GATGTTGGAGAGTGCATGGATAATTTATTGGGTATGCTTATAACACTATTTTGTATAGAT TCTACTATTGATTTGGGTGAGTATTGTGATGATATACTTAAGAGGTCAACTGTATTACAA TCGGTTACTCAAGAGTTTTCGCACATACCCTCGTATGCTGAATATGAAAGAGCTAAGAGT ATTTATGAAAAGGTTTTAGCCGATTCTAAAAATGGTGGTGTAACACAGCAAGAGCTTGCT GCATATCGTAAAGCTGCCAATATTGCAAAGTCAGTTTTTGATAGAGACTTGGCTGTTCAA AAGAAGTTAGATAGCATGGCAGAACGTGCTATGACAACAATGTATAAAGAGGCGCGTGTA ACTGATAGAAGAGCAAAATTAGTTTCATCATTACATGCACTACTTTTTTCAATGCTTñAG AñAATAGATTCTGAGAAGCTTAATGTCTTATTTGACCAGGCGAATAGTGGTGTTGTACCC CTAGCAACTGTTCCAATTGTTTGTAGTAATAAGCTTACCCTTGTTATACCAGACCCAGAG AC.GTGGGTCAAGTGTGTGGAGGGTGTGCATGTTACATATTCAACAGTTGTTTGGAATATA g a c t g t g t t a c t g a t g c c g a t g g c a c a g a g t t a c a c c c c a c t t c t a c a g g t a g t g g a t t g ACTTACTGTATAAGTGGTGATAATATAGCATGGCCTTTAAAGGTTAACTTGACTAGGAAT GGGCATAATAAGGTTGATGTTGCCTTGCAAAATAATGAGCTTATGCCTCACGGTGTAAAG ACAAAGGCTTGCGTAGCAGGTGTAGATCAAGCACATTGTAGCGTTGAGTCTAAATGTTAT TATACAAGTATTAGTGGCAGTTCAGTTGTAGCTGC.TATTACCTCTTCAAATCCTAATCTG AAAGTAGCCTCTTT'TTTGAATGAGGCAGGTAATCAGATTTATGTAGACTTAGACCCACCA TGTAAATTTGGTATGAAAGTGGGTGATAAGGTTGAAGTTGTTTACCTGTATTTTATAAAA AATACGAGGTCTATTGTAAGAGGTATGGTACTTGGTGCTATATCTAATGTTGTTGTGTTA CAATCTAAAGGTCATGAGACAGAGGAAGTGGATGCTGTAGGCATTCTCTCACTTTGTTCT TTTGCAGTAGATCCTGCGGATACATATTGTAAATATGTGGCAGCAGGTAATCAACCTTTA GGTAACTGTGTTAAAATGTTGACAGTACATAATGGTAGTGGTTTTGCAATAACATCAAAG CCAAGTCCAACTCCGGATCAGGATTCTTATGGAGGAGCTTCTGTGTGTCTTTATTGTAGA GCACATATAGCACACCCTGGCGGAGCAGGAAATTTAGATGGACGCTGTCAATTTAAAGGT TCTTTTGTGCAAATACCTACTAC-GGAGAAAGATCCTGTTGGATTCTGTCTACGTAACAAG GTTTGCACTGTTTGTCAGTGTTGGATTGGTTATGGATGTCAGTGTGATTCACTTAGACAA CCTAAACCTTCTGTTCAGTCAGTTGCTGTTGCATCTGGTTTTGATAAGAATTATTTAAAC GGGTACGGGGTAGCAGTGAGGCTCGGCTGATACCCCTAGCTAATGGATGTGACCCCGATG TTGTAAAGCGAGCCTTTGATGTTTGTAATAAGGAATCAGCCGGTATGTTTCAAAATTTGA AGCGTAACTGTGCACGATTCCAAGAAGTACGTGATACTGAAGATGGAAATCTTGAGTATT GTGATTCTTATTTTGTGGTTAAACAAACCACTCCTAGTAATTATGAACATGAGAAAGCTT GTTATGAAGACTTAAAGTCAGAAGTAACAGCTGATCATGATTTCTTTGTGTTCAATAAGA ACfiTTTATAATATTAGTAGGCAGAGGCTTACTAAGTATACTATGATGGATTTTTGCTATG CTTTGCGGCACTTTGACCCAA.AGGATTGCGAAGTTCTTAAAGAAATACTTGTCACTTATG GTTGTíiTAGAAGATTATCACCCTAAGTGGTTTGAAGAGAATAAGGATTGGTACGACCCAA TAGAAAACCCTAAATATTATGCCATGTTGGCTAAAATGGGACCTATTGTACGACGTGCTT TATTGAATGCTATTGAGTTCGGAAACCTCATGGTTGAAAAAGGTTATGTTGGTGTTATTA CACTTGATAACCAAGATCTTAATGGCAAATTTTATGATTTTGGTGATTTTCAGAAGACAG CGCCTGGTGCTGGTGTTCCTGTTTTTGATACGTATTATTCTTACATGATGCCCATCATAG CCATGACTGATGCGTTGGCACCTGAGAGGTATTTTGPiATATGATGTGCATAAGGGTTATAl AATCTTATGATCTCCTCAAGTATGATTATACTGAGGAGAAACAAGATTTGTTTCAGAAGT ACTTTAAGTATTGGGATCAAGAGTATCACCCTAA.CTGTCGCGACTGTAGTGATGACAGGT GTTTGATACATTGTGCAAACTTCAACATCTTGTTTTCTACACTTGTACCGCAGACTTCTT TCGGTAATTTGTGTAGAAAGGTTTTTGTTGATGGTGTACCATTTATAGCTACTTGTGGCT ATCATTCTAAGGAACTTGGTGTTATTATGAATCAAGATAACACCATGTCATTTTCAAAAA TGGGTTTGAGTCAACTCATGCAGTTTGTTGGAGATCCTGCCTTGTTAGTGGGGACATCCA ATAAATTAGTGGATCTTAGAACGTCTTGTTTTAGTGTTTGTGCTTTAGCGTCTGGTATTA CTCATCAAACGGTAAAACCAGGTCACTTTAACAAGGATTTCTACGATTTTGCAGAGAAGG CTGGTATGTTTAAGGAAGGTTCTTCTATACCACTTAAACATTTCTTCTACCCACAGACTG GTAATGCTGCTATAAACGATTATGATTATTATCGTTATAACAGGCCTACCATGTTTGATA TACGTCAACTTTTATTTTGTTTAGAAGTGACTTCTAAATATTTTGAATGTTATGAAGGCG GCTGTATACCAGCAAGCCAAGTTGTAGTTAACAA.TTTAGATAAGAGTGCAGGTTATCCGT TCAATAAGTTTGGAAAGGC.CCGTCTCTATTATGAAATGAGTCTAGAGGAGCAGGACCAAC TCTTTGAGAGTACAAAGAAGAACGTCCTGCCTACTATAACTCAGATGAATTTAAAATATG CCATATCCGCGAAAAATAGAGCGCGTACAGTGGCAGGTGTGTCTATCCTTTCTACTATGA CTAATAGGCAGTTTCATCAGAAGATTCTTAAGTCTATAGTCAACACTAGAAACGCTCCTG TAGTTATTGGAACAACCAAG'TTTTATGGCGGTTGGGATAACATGTTGAGAAACCTTATTC AGGGTGTTGAAGACCCGATTCTTATGGGTTGGGATTATCCAAAGTGTGATAGAGCAATGC CTAATTTGTTGCGTATAGCAGCATCTTTAGTACTCGCTCGTAAACACACTAATTGTTGTA CTTGGTCTGAACGCGTTTATAGGTTGTATAATGAATGCGCTCAGGTTTTATCTGAAACTG TCTTAGCTACAGGTGGTATATATGTGAAACCTGGTGGTACTAGCAGTGGAGATGCTACTA CTGCTTATGCAAACAGTGTTTTCAACATAATACAAGCCACATCTGCTAATGTTGCGCGTC TTTTGAGTGTTATAACGCGTGATATTGTATATGATGACATTAAGAGCTTGCAGTATGAAT TGTACCAGCAGGTTTATA.GGCGAGTC.AATTTTGACCCAGCA.TTTGTTGAAAAGTTTTATT CTTATTTGTGTAAGAATTTCTCA.TTGATGATCTTGTCTGACGACGGTGT TGTTTGTTATA ACAACACATTAGCCAAACAAGGTCTTGTAGCAGA.TATTTCTGGTTTTAGAGAAGTTCTCT ACTATCAGAACAATGTTTTTATGGCTGATTCTAAATGTTGGGTTGAACCAGATTTAGAAA AAGGCCCACATGAATTTTGTTCACAGCACACAATGTTAGTGGAGGTTGATGGTGAGC.CTA GATACTTGCCATATCCAGACCCATCACGTATTTTGTGTGCATGTGTTTTTGTAGATGATT TGGATAAGACAGAATCTGTGGCTGTTATGGAGCGTTATATCGCTCTTGCCATAGATGCGT ACCCACTAGTACATCATGAAAATGAGGAGTACAAGAAGGTATTCTTTGTGCTTCTTTCAT ACATCAGAAAACTCTATCAAGAGCTTTCTCAGAATATGCTTATGGACTACTCTTTTGTAA TGGATATAGATAAGGGTAGTAAATTTTGGGAACAGGAGTTCTATGAAAATATGTATAGAG CCCCTACAACATTACAGTCTTGTGGCGTTTGTGTAGTGTGTAATAGTCAAACTATATTGC GCTGTGGTAATTGTATTCGCAAACCATTTTTGTGTTGTAAGTGTTGCTATGACCATGTCA TGCACACAGACCACAAAAATGTTTTGTCTATAAATCCTTACAlTTTGCTCACAGCCAGGTT GTGGTGAAGCAGATGTTACTAAATTGTACCTCGGAGGTATGTCATACTTCTGCGGTAATC ATAAACCAAAGTTATCAATACCGTTAGTATCTAATGGTACAGTGTTTGGAATTTACAGGG CTAATTGTGCAGGTAGCGAAAATGTTGATGATTTTAATCAACTAGCTACTACTAATTGGT CTACTGTGGAACCTTATATTTTGGCAAATCGTTGTGTAGATTCGTTGAGACGCTTTGCTG CAGA.GACA.GTAAAAGCTACA.GAAGAATTACATAAGCAACAATTTGCTAGTGCAGAAGTGA GAGAAGTACTCTCAGATCGTGAATTGATTCTGTCTTGGGAGCCAGGTAAAACCAGGCCTC CA.TTGAATAGAAATTATGTTTTCACTGGCTTTCACTTTACTAGAACTAGTAAAGTTCAGC TCGGTGATTTTACATTTGAAAAAGGTGAAGGTAAGGACGTTGTCTATTATCGAGCGACGT C T AC T G C T AA AT T G T C T G T T GG AG A.C A T T T T T G T T T T A AC C T C AC AC A AT GT T G T T T C T C TTATAGCGCCAFiCGTTGTGTCCTCAGCAAACCTTTTCTAGGTTTGTGAATTTAAGACCTA ATGTGATGGTACCTGCGTGTTTTGTAAATAiACATTCCATTGTACCATTTAGTAGGCAAGC AGAAGCGTACTACAGTACAAGGCCCTCCTGGCAGTGGTAAATCCCATTTTGCTATAGGAT TGGCGGCTTACTTTAGTAACGCCCGTGTCGTTTTTACTGCATGCTCTCATGCAGCTGTTG ATGCTTTATGTGAAAAAGCTTTTAAGTTTCTTAAAGTAGATGATTGCACTC.GTATAGTAC CTCAAAGGACTACTATCGATTGCTTCTCTAAGTTTAAAGCTAATGACACAGGCAAAAAGT ACA.TTTTTAGTACT?iTTAA.TGCCTTGCCAGAAGTTAGTTGTGACATTCTTTTGGTTGACG AGGTTAGTATGTTGACCAATTACGAATTGTCTTTTATTAATGGTAAGATAAACTATCAATAfsAGTAGAAGATGTTTGGTCTTCACTTACTGAAAAGTCTTTTGAATTCTGGAGGCTTGCA TATGGAAAAGTGCGTAATCTCGAAGAATTTGTTAAGACTTGTTTTTGTAAGGCTCAAATG GCGATTGTGATTTTAGCGACAGTGCTTGGAGAGGGCATTTGGCATCTTGTTTCGCAAGTC ATCTATAAAGTAGGTGGTCTTTTTACTAAAGTTGTTGACTTTTGTGAAAAATATTGGAAA GGTTTTTGTGCACAGTTGAAAAGAGCTAAGCTCATTGTCACTGAAACCCTCTGTGTTTTG AAAGGAGTTGCACAGCATTGTTTTCAACTATTGCTGGATGCAATACAGTTTATGTATAAA AGTTTTAAGAAGTGTGCACTTGGTAGAATCCATGGAGACTTGCTCTTCTGGAAAGGAGGT GTGCAC.AAAATTATTCAAGAGGGCGATGAAATTTGGTTTGACGCCATTGATAGTATTGAT GTTGAAGATCTGGGTGTTGTTCAAGAAAAATTGATTGATTTTGATGTTTGTGATAATGTG ACACTTCCAGAGAACCAACCCGGTCATATGGTTCAAATCGAGGATGACGGAAAGAACTAC ATGTTCTTCCGCTTCAAAAAGGATGAGAACATTTATTA.TACACCAATGTCACAGCTTGGT GCTATTAATGTGGTTTGCAAAGCAGGCGGTAAAACTGTCACCTTTGGAGAAACTACTGTG CAAGAAATACCACCACCTGATGTTGTGTTTATTAAGGTTAGCATTGAGTGTTGTGGTGAA CCATGGAATACAATCTTCAAAAAGGCTTATAAGGAGCCCATTGAAGTAGAGACAGACCTC ACAGTTGAACAATTGCTCTCTGTGGTCTATGAGAAAATGTGTGATGATCTCAAGCTGTTT CCGGAGGCTCCAGAACCACCACCATTTGAGAATGTCACACTTGTTGATAAGAATGGTAAA GATTTGGATTGCATAAAATCA TGCCATCTGATCTATCGTGATTATGAGAGCGATGATGAC ATCGAGGAAGAAGATGCAGAAGAATGTGACACGGATTCAGGTGATGCTGAGGAGTGTGAC ACTAATTCAGAATGTGAAGAAGAAGATGAGGATACTAAAGTGTTGGCTCTTATACAAGAC CCGGCAAGTAACAAATATCCTCTGCCTCTTGATGATGATTATAGCGTCTACAATGGATGT ATTGTTCATAAGGACGCTCTCGATGTTGTGAATTTACCATCTGGTGAAGAAACCTTTGTT GTCAATAACTGCTTTGAAGGGGCTGTTAAAGCTCTTCCGCAGAAAGTTATTGATGTTCTA GGTGACTGGGGTGAGGCTGTTGATGCGCAAGAACAATTGTGTCAACAAGAATCAACTCGG GTCATATCTGAGAAATCAGTTGA.GGGTTTTACTGGTAGTTGTGATGCAATGGCTGAACAA GCTATTGTTGAAGAGCAGGAAATAGTACCTGTTGTTGAACAAAGTCAGGATGTAGTTGTT TTTACACCTGCAGACCTAGAAGTTGTTAAAGAAACAGCAGAAGAGGTTGATGAGTTTATT CTCATTTCTGCTGTCCCTAAAGAAGAAGTTGTGTCTCAGGAGAAAGAGGAGCCACAGGTT GAGCAAGAGCCTACCCTAGTTGTTAAAGCACAACGTGAGAAGAAGGCTAAAAAGTTCAAA GTTAAACCAGCTACATGTGAAAAACCCAAATTTTTGGAGTACAAAACATGTGTGGGTGAT TTGGCTGTTGTAATTGCCAAAGCATTGGATGAGTTTAAAGAGTTCTGCATTGTAAACGCT GCAAATGAGCACATGTCGCATGGTGGTGGCGTTGCAAAGGCAATTGCAGACTTTTGTGGA CCGGACTTTGTTGAATATTGCGCGGACTATGTTAAGAAACATGGTCCACAGCAAAAACTT GTCACACCTTCATTTGTTAAAGGCATTCAATGTGTGAATAATGT TGTAGGACCTCGCCAT GGAGACAGCAACTTGCGTGAGAAGCTTGTTGCTGCTTACAAGAGTGTTCTTGTAGGTGGA GTGGT'TAACTATGTTGTGCCAGTTCTCTCATCAGGGATTTTTGGTGTAGATTTTAAAATA TCAATAGATGCTATGCGCGAAGCTTTTAAAGGTTGTGCCATACGCGTTCTTTTATTTTCT CTGAGTCAAGAACACATCGATTATTTCGATGCAACTTGTAAGCAGAAGACAATTTATCTT ACGGAGGATGGTGTTAAA.TACCGCTCTGTTGTTTTAAAACCTGGTGATTCTTTG