ES2647072T3 - Niclosamide for the treatment of cancer metastasis - Google Patents

Abstract

Niclosamide or its derivative for use as a medicine for the inhibition and / or reduction of the spread of metastatic cancer, in which said niclosamide or its derivative is selected from the group consisting of ** Formula ** or compounds in which they are other halogens present in the positions occupied by Cl in said niclosamide or its derivatives.

Description

DESCRIPTION

Niclosamide for the treatment of cancer metastasis 5 FIELD OF THE INVENTION

Cancer metastasis is often associated with the activation of the Wnt / beta-catenin signaling pathway and the elevated expression of the S100A4 metastasis inducing gene. It has been recently shown that S100A4 is transcriptionally regulated by beta-catenin and that it is important for colon cancer and metastasis. The invention relates to niclosamide and its derivatives, which effectively inhibits the transcription of the S100A4 gene, which results in the inhibition of cell mobility, invasion, metastasis and proliferation of human cancer cells induced by S100A4.

Background of the invention

fifteen

During the last decades, the effectiveness of cancer treatment has improved considerably. However, the clinical outcome parameters, particularly the metaphysical situation, have only changed moderately. Therefore, the development of new approaches to fight cancer is the main objective of scientists as well as pharmaceutical companies.

twenty

Colorectal cancer is one of the most common malignant tumors with an upward incidence in Western countries. In the United States, this disease represents 10% of all cancers, and is currently the second or third cause of cancer-related death in men or women, respectively (10% both sexes combined). In Europe, in 2004, colorectal cancer was the second most common cancer in both 25 terms of incidence (376400 cases, 13%) and mortality (203 700 deaths, 12%). In Germany, colorectal cancer was also among the 20 most frequent causes of cancer-related death in 2003, with 18% in men after lung cancer and 11% in women, after breast cancer and of lung In 2007, more than 70,000 people suffered colorectal cancer in Germany and 30,000 died from this disease (
http://www.aerztezeitung.de). It was estimated that approximately 6% of the 30 German population, which is equal to approximately 5 million people, will suffer from colorectal cancer during their lifetime. Therefore, increasing efforts for understanding, prevention and intervention about this disease are extremely desirable.

Currently, colorectal cancer and its metastasis are understood as the result of early changes during tumor progression that determine metastatic capacity. Genetic abnormalities that occur during neoplastic transformation are essential for cancer to arise and most abnormalities occur early in the disease process but none of the abnormalities is known to be especially associated with metastasis. The "change of state" (= metastasis), when cancer spreads from its primary sites to secondary sites in the body is one of the milestones of cancer. The dissemination and growth of satellite lesions in other organs is responsible for more than 90% of deaths from neoplasia. Primary tumors can be removed by surgery but widely metastatic lesions are difficult to detect and are difficult or impossible to treat with adjuvant treatments. Metastasis is a multi-stage process, which involves the loss of cell adhesion, increased motility of cells, invasion of surrounding tissue, intravasation of blood vessels or the lymphatic system that enters the circulatory system, extravasation from the circulatory system, proliferation in a new secondary site, and construction of a vascular system to support growth. The ability of a tumor to facilitate metastasis is acquired through changes in the expression of genes and the environment.

There is extensive knowledge about the molecules that contribute to the metastatic phenotype, about the 50 pathways they control and about the genes they regulate. Molecular staging is an important prerequisite for improving diagnosis, prognosis and treatment since currently the patient's prognosis is still mainly defined by histopathological staging, a statistical description of the anatomical extent of tumor spread in a surgical sample. The molecular determinants of the progression and metastasis of colorectal cancer represent both the prognostic markers of metastasis and the targets for the intervention strategies that focus on the main objective of metastasis prevention.

Colorectal cancer is often associated with the activation of the Wnt / beta-catenin signaling pathway and the elevated expression of the S100A4 metastasis inducing gene. In addition to its function in cell-cell adhesion, beta-catenin is also an important mediator in the canonical Wnt signaling pathway. When no

Wnt signaling, two adapter proteins, the APC and AXIN tumor suppressor form the so-called beta-catenin destruction complex that facilitates the sequential phosphorylation of beta-catenin by CKI and GSK3-p in the amino terminal. Phosphorylations recruit the F box / WD protein with p-TrCP repeats containing E3 ubiquitin ligase, which marks beta-catenin for proteosomal degradation. The Wnt signaling pathway is activated by binding the Wnt ligand to the Frizzled transmembrane receptor, a serpentine receptor with a cysteine-rich amino terminal domain. The complex then interacts with the single-pass transmembrane protein of the LDL receptor family (LRP5 / 6). It is not clear how the FRZ / LRP complex regulates the kinase activity of the destruction complex. However, it is suggested that axin / GSK3-p activity is inhibited by a mechanism that involves the interaction of axin with LRP5 / 6 or the action of the disheveled molecule that binds to axin (DSH). Non-phosphorylated beta-10 catenin translocates to the nucleus where it binds to the amino terminus of the Tcf / Lef family (T lymphocyte factor / lymphoid promoter factor) of DNA binding proteins and activates transcription of the target genes. The Tcf / Lef proteins repress the target genes in the absence of beta-catenin but become transcriptional activators when they have joined beta-catenin.

15 The relevance of the Wnt pathway to cancer cells is indicated by the high percentage of mutations that occur in the genes in the Wnt pathway. For example, more than 90% of colorectal cancers show mutations that result in the activation of the Wnt pathway. These mutations generally affect the phosphorylation and stability of beta-catenin, hindering its degradation via ubiquitin. Non-phosphorylated betacatenin accumulates in the cytoplasm, is transported to the nucleus and interacts with the transcription factors of the TCF family to control the target genes. Nuclear accumulation of beta-catenin has been associated with late stages of tumor progression and the development of metastases, and the presence of mutated beta-catenin is associated with aggressive tumor growth and poor prognosis.

One of the biggest targets that is linked to metastasis formation is the calcium binding protein S100 25 A4 (S100A4), an 11kD protein, originally identified as metastasin 1 (MTS1).

S100A4 is overexpressed in many different types of cancer such as gallbladder, bladder, breast, esophagus, gastric, pancreatic, hepatocellular, non-small cell lung and especially colorectal cancer. The increased expression of S100A4 is strongly associated with the aggressiveness of a tumor, its ability to metastasize and low patient survival. However, the S100A4 protein itself is not tumorigenic because transgenic mice that overexpress S100A4 do not develop tumors per se. But, when S100A4 transgenic mice intersect with mice that show spontaneous tumor formation, it leads to aggressive tumor growth and metastasis. In addition, null S100A4 mice inoculated with highly metastatic mouse breast carcinoma cells do not show metastases. These observations 35 suggest that S100A4 is essential for the process of metastasis formation.

S100A4 plays a leading role in cellular processes such as migration, invasion, adhesion, which form the basis for metastasis formation. For example, S100A4 increases cellular motility by interacting with skeletal proteins, such as the non-muscular myosin II heavy chain (MYH9). In addition, 40 S100A4 participates in cell adhesion by interaction with the tyrosine phosphatase type F protein receptor (PTPRF) interacting protein, binding protein 1 (PPFIBP1; also known as liprin p-1) and promotes cell invasion and angiogenesis a through the over-regulation of matrix metallopeptidase (MMPs).

Despite the intense research revealed by the multitude of S100A4 roles, no inhibitor of S100A4 expression has been described and that this mode inhibits S100A4-mediated metastasis.

SUMMARY OF THE INVENTION

In light of the prior art, the underlying problem of the present invention is to provide an inhibitor of cancer metastasis.

This problem is solved through the characteristics of the independent claims. Preferred embodiments of the present invention are provided through the dependent claims.

Accordingly, the invention relates to the use of niclosamide and its derivatives for the inhibition and / or reduction of the spread of metastatic cancer, especially the migration and invasion of cancer cells.

High performance screening of 1280 small molecules was carried out to identify inhibitors of marker gene expression directed by the S100A4 promoter with a potential clinical antimetastatic activity. A highly effective substance - niclosamide - was identified as an anthelmintic drug approved for treatment.

of had infections. Surprisingly, niclosamide has a strong effect on the expression of S100A4 by inhibiting its transcription. In addition, niclosamide can be used to inhibit cell migration and invasion induced by S100A4 as well as cell proliferation and colony formation in vitro.

5 Cell migration, especially targeted cell migration, helps to create pathologies that include vascular diseases, chronic inflammatory diseases and the formation of tumors and metastases. Migration is a dynamic and cyclic process in which the cell extends a protrusion in its front part that then joins the substrate from which the cell is migrating. This is followed by a contraction that moves the cell body forward in the direction of the protrusion and finally the joints in the rear release 10 while the cell continues to move forward. The cycle is initiated by external signals (chemotactic molecules), which are detected and communicated inside the cell by specialized receptive proteins in the cell membrane. In response to these signals, the cells extend protrusions, by polymerizable actin, seeking new ground and detecting the direction from which they are receiving the signals. Once the direction of movement has been established, the machinery that allows movement is assembled in relation to the direction of migration. Adhesive complexes necessary for traction meet at the front of the protrusion, joining the protrusion to the substrate. Actomyosin filaments contract at the front of the cell and push the cell body towards protrusion. The release of the adhesive connections at the rear of the cell and the retraction of the tail complete the cycle. The instrumentation of this complex process resides in many molecules that serve to distinguish between the front and back of the cell and whose 20 actions are carefully timed. It was surprising to note that the addition of niclosamide or its derivatives to migratory or invasive cells inhibits both processes, especially if the processes are caused by S100A4.

Niclosamide is a chlorinated salicylanilide pesticide that is mainly used against aquatic organisms 25 vertebrates and crustaceans. It is an effective anthelmintic for the treatment of diphilobotriasis and hymenolepiasis. It is used for the treatment of tapeworm (fish, dwarf and beef).

The anthelmintic is primarily a chemical that is used to expel or destroy tapeworm in pets.

30

It has been shown that none of the various derivatives of niclosamide have been effective as niclosamide. Niclosamide or its derivatives are chosen from the group comprising the formulas:

image 1

image2

5

10

fifteen

twenty

However, some niclosamide derivatives have been shown to be effective for migration, invasion and cell metastasis produced by S100A4. Those skilled in the art know several chemical methods and techniques for modifying a chemical substance to generate a derivative of the invention, which still comprises the chemical base, such as the addition, deletion or substitution of a group or a functional group. Niclosamide is also known as 2 ', 5-dichloro-4'-nitrosalicylanilide, 2-hydroxy-5-chloro-N- (2-chloro-4-nitrophenyl) benzamide, 5-chloro-2'-chloro-4'- nitrosalicylanilide, 5-chloro-N- (2-chloro-4-nitrophenyl) salicylamide, Bayluscid, 5-chloro-N- (2-chloro-4-nitrophenyl) -2- hydroxy Benzamide, Dichlosale, Cestocid or Devermine.

Niclosamide and its derivatives can be applied to cancer cells in vitro or in vivo to inhibit the migration, invasion and cell metastasis produced by S100A4. Cancers are preferably classified by the type of cells to which the tumor resembles and, therefore, suspected of being the origin of the tumor. These types include:

• Carcinoma: Cancer produced by epithelial cells. This group presents many of the most common cancers, including breast, prostate, lung and colon cancers.

• Sarcoma: Cancer caused by connective tissue or mesenchymal cells.

• Lymphoma and leukemia: Cancer caused by hematopoietic cells.

• Germ cell tumor: Cancer caused by pluripotential cells. In adults these are frequently found in testicles and ovaries.

• Blastoma: A cancer derived from an "immature" precursor or embryonic tissue.

In a preferred embodiment, the cancer is chosen from the group comprised of breast cancer, colon cancer, ovarian carcinoma, osteosarcoma, cervical cancer, prostate cancer, lung cancer, synovial carcinoma, skin melanoma, pancreatic cancer or another cancer that is yet to be determined in which levels of S100A4 are elevated, over-regulated, mutated or altered in physiology compared to non-oncogenic cells. Cancer can be chosen from among cancers related to S100A4. Cancer can be caused by chemicals, infections, radiation, genetic abnormalities, physical trauma and physical agents. It was surprising to note that niclosamide is very effective in inhibiting the migration, invasion and metastasis of several cancers in which S100A4 is preferentially overexpressed. In the light of the invention, overexpression especially refers to an excess of the expression of a gene that produces an excess of its effect or of its product, in which the product preferably refers to proteins or RNA.

Niclosamide effectively inhibits the expression of S100A4, which affects the transcription of the S100A4 gene or the translation of mRNA into protein. It is preferable that niclosamide or its derivatives modulate the TCF / beta-catenin protein complex in the cancer cell. The S100A4 gene is preferably a target of the Wnt pathway and its expression is activated by transcription factors, preferably the TCF / beta-catenin transcription complex.

Modulation of the preferred TCF / beta-catenin transcription complex results in a stop or inhibition of transcription of the S100A4 gene.

The invention further relates to a method for the treatment of a tumor cancer comprising administration to a subject in need thereof or an effective amount of niclosamide or a derivative thereof.

In a preferred embodiment, the subject is preferably a person. It is preferable that the administration of niclosamide or its derivative inhibits or reduces the expression of S100A4, preferably by modulating a complex of

proteins comprising the transcription factors of TCF and beta-catenin.

In a preferred embodiment, the expression of S100A4 and the propagation of metastatic cancer cells is reduced or further inhibited by nucleic acid molecules, preferably through nucleic acids with complementarity to the mRNA or components of the Wnt pathway. Procedures for inhibition, blocking, deletion, activation or overexpression of a gene are known to those skilled in the art. For example, blocking or suppressing the expression of a gene could be performed by an antibody whose target is the translated protein, genetic modification of the cell, such as deletions or other target mutations, or the use of an anti-sense RNA, such as SiRNA or mRNA, to silence the protein before its translation into mRNA. However, it would also be preferable to activate or overexpress a component of the Wnt pathway. Activation of overexpression could be achieved by administering an active protein to the cell or by overexpression the particular protein in an expression vector or by transforming any other exogenous nucleic acid encoding the protein to be increased.

The invention also relates to a pharmaceutical composition comprising niclosamide or a derivative thereof for the inhibition and / or reduction of the spread of cancer metastases.

In a preferred embodiment, the pharmaceutical composition comprises at least one niclosamide or a derivative thereof with a pharmaceutically acceptable carrier, wherein said composition is a capsule, a pill or a coated pill, a suppository, an ointment, a cream, an injection solution and / or an infusion solution.

It is preferable in cancer cells that niclosamide inhibits the formation of the TCF / beta-catenin complex (CTNNB1) and thus interrupts transcription of the target gene.

25

In another preferred embodiment, the pharmaceutical composition used comprises a pharmaceutically acceptable carrier that is selected from the group consisting of fillers, disintegrants, binders, humectants, expansion agents, solution retardants, absorption enhancers, surfactants, adsorbents and / or lubricants. As a result, the pharmaceutical composition can be adjusted to the specific needs of various types of cancer.

In another preferred embodiment, the use of the pharmaceutical composition described above comprises niclosamide or derivatives thereof and one or more chemotherapeutic drugs. Chemotherapeutic drugs can be divided into alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors and other antitumor agents. All these drugs affect in some way the cell division or the synthesis and function of DNA.

Advantages such as low cost, clinical efficacy and low influence of adverse effects are evident in another preferred embodiment of niclosamide or its derivatives, including the method for the treatment of cancer, preferably cancer metastasis in a mammal comprising the mammal. administration of a pharmaceutically effective amount of the composition to the mammal in need of such treatment. It is preferable that the mammal is a person.

In a preferred embodiment, all potential areas of metastatic cancer can be effectively achieved since the method described above comprises a route of administration of the pharmaceutical composition that is selected from the group consisting of oral parenteral, intravenous, intra-arterial administration. , pulmonary, mucosal, topical, transdermal, subcutaneous, intramuscular, rectal, intracranial, intracerebroventricular, intracerebral, intravaginal, intrauterine, intrathecal or intraperitoneal.

An especially preferred embodiment comprises the procedure described above, wherein the route of administration of the compound is selected from an oral and parenteral administration. This embodiment allows the effective treatment of metastasis by applying different forms of compound release. Subcutaneous infections, for example, can be achieved immediately through the bloodstream by intravenous or, minimally invasive, application by oral application or through interstitial fluids by subcutaneous injection. Together, these different procedures for the application offer the possibility of antagonizing any metastasis through the optimal release route of the compound.

The invention also relates to niclosamide or derivatives thereof for the treatment of cancer metastases.

In a preferred embodiment the invention relates to the treatment of a group of patients who are identified by an increase in the expression of S100A4, preferably in which the cancer cells show an increase in the expression of S100A4. The expression of S100A4 can be determined using any procedure known in the art, such as RT-PCR for analysis of the increased expression of transcription 5 of S100A4 or immunologically based procedures such as western blot or ELISA for the detection of an increase in the S100A4 protein expression or any other diagnostic tool that can provide relative measurements of S100A4 expression compared to "normal" or "healthy" or "low risk" cells.

Accordingly, a preferred embodiment relates to niclosamide and derivatives thereof for the treatment of the prevention of metastasis of cancer cells in a patient or a group of patients identified by the increased expression of S100A4, in which a Body fluid and / or a patient's tissue that must be identified is analyzed to determine S100A4 expression levels. Body fluids may include aqueous humor and vitreous humor, bile, blood, blood serum, blood plasma, breast milk, cerebrospinal fluid, earwax (earwax), endolymph and perilymph, gastric juices, mucus (including nasal drainage and phlegm) , peritoneal fluid, pleural fluid, saliva, seborrhea (skin oil) sweat, tears, vaginal discharge, vomiting and urine.

The treatment of this particular group of patients with niclosamide represents a novel medical use of niclosamide that has not been suggested or disclosed in previous techniques. The novel effect of niclosamide on which the invention is based represents a novel technical effect that allows the novel medical use of niclosamide. The identification of the mechanism of functioning of niclosamide in relation to inhibition of S100A4 expression allows treatment with niclosamide that has a direct effect on the expression of the S100A4 gene. The direct connection between the expression of S100A4 and the treatment with niclosamide has not been proposed or suggested previously in previous techniques. The knowledge of the direct effect of niclosamide on the expression of S100A4 allows dosage guidelines that precisely adjust to the needs of the patient, thus allowing administration directly to the affected areas of the body in amounts that have a relevant effect without cause unwanted side effects. This treatment can be performed, for example, by direct treatment of colorectal cancer in subjects with colon cancer thereby providing an effective prevention of metastasis. Oral application is also preferable due to low toxicity after systemic administration.

30

The expression of S100A4 in tumors in patients with colon cancer proved to be prognostic for the development of metastasis. In addition, it has recently been demonstrated in the state of the art that the quantitative determination of transcription of S100A4 in plasma in patients with colon cancer is a prognosis and diagnosis for early stage cancers and the definition of patients at high risk of metastasis caused by S100A4. Niclosamide, however, is a novel inhibitor of the interaction of TCF / beta-catenin (CTNNB1) that affects metastasis caused by S100A4 that had not previously been proposed in combination with S100A4.

The medical application of niclosamide to prevent and / or reduce the expression of S100A4 and, consequently, prevent metastasis represents a novel combination between the medical indication (prevention of metastasis) 40 and the product (niclosamide) together with a novel technical effect (prevention and / or inhibition of S100A4 expression) which is unpredictable in light of known uses of niclosamide and the previously known function of S100A4. This novel technical effect also brings unexpected benefits, such as an increase in the survival of patients treated with the substances of the present invention, in addition to low S100A4 levels even long after (weeks) after the treatment has ended. It was not expected that treatment with niclosamide through direct inhibition of S100A4 expression would provide further prevention of metastasis and cancer cell migration.

The invention also relates to niclosamide and derivatives thereof for the treatment of cancerous metastases, including the inhibition and / or reduction of existing metastases and / or the prevention of the formation of cancerous metastases. In a preferred embodiment, niclosamide or a derivative thereof according to the invention can be applied in therapeutically effective doses to a patient at risk of metastasis, for example, a patient already under treatment of any cancer-related disease in the that a metastasis may arise.

Detailed description of the invention

55

The invention describes the identification of small molecule inhibitors (niclosamide and derivatives thereof), which significantly reduces the expression of S100A4, especially in colorectal carcinoma cells and specifically interferes with the migration and cell invasion caused by S100A4.

60 High-performance screening is presented that identifies the small anthelmintic molecule niclosamide as a

S100A4 expression transcription inhibitor that forms the basis of this novel antimetastatic action. It has been shown that, especially colon cancer cells, niclosamide inhibits the signal from the WNT / beta-catenin pathway (CTNNB1). Therefore, it blocked the expression of S100A4 in a manner dependent on concentration and time. In addition, niclosamide prevents migration and cell invasion induced by S100A4 as well as cell proliferation and colony formation in vitro. Consistently, mice presenting a colon cancer xenotransplant showed a clear reduction in S100A4 expression levels within the tumor tissue when the mice are treated with niclosamide or its derivatives. In addition, treatment with niclosamide, even when interrupted after 24 days, results in less liver and smaller metastases in xenotransplanted mice.

10

High performance screening is aimed at the identification of S100A4 transcription inhibitors. For this, the HCT116-S100A4p-LUC cells were used as a model of human colon cancer, since these cells have a constitutively active WNT signaling pathway due to a monoNellic mutation of CTNNBI. Thus, these cells show an endogenously high S100A4 promoter activity that allows constant expression of the marker gene. Screening of 1280 compounds from the LOPAC library identified niclosamide as the most promising inhibitor of S100A4 expression for in vivo tests.

Niclosamide is an anthelmintic drug that can be hydrolytically divided by the cells of the gastrointestinal tract. The metabolism of niclosamide by tumor cells could explain that the inhibition of the expression of S100A4 was interrupted even by small changes in the structure of niclosamide. The variation in aqueous solubility may be an additional factor underlying this initial result of the structure-activity.

The decreasing effect of S100A4 with a single dose of niclosamide was limited to a 24-hour time frame. However, this time frame could be extended by applying daily doses of niclosamide to achieve a constant reduction of S100A4 expression in vitro and in vivo. Once this level has been achieved, nicosamide-induced suppression of S100A4 together with inhibition of motility and cell proliferation remain stable even after niclosamide treatment has been discontinued.

Inhibition of S100A4 expression by hRNA experiments or overexpression of endogenous inhibitors such as phospholipase PLA2G2A or interferon-y (IFN-y) results in reduced cell motility and invasiveness. According to this result, treatment with niclosamide, for example, colon cancer cells, leads to reduced cell migration as well as invasion. The inhibitory effect of niclosamide on cell motility can be overcome by the ectopic overexpression of S100A4. These observations 35 again emphasize the central role of S100A4 on cell motility that leads to colon cancer metastasis.

It had previously been observed in RNAi experiments that depression of S100A4 levels resulted in the stopping of the G2 / M phase of pancreatic cancer cells and repressed proliferation rates in gastric cancer cells. It had been shown that treatment with niclosamide resulted in a reduction of S100A4 expression and simultaneously a reduction in cell proliferation. However, these effects appear to be independent since the overexpression of S100A4 cannot overcome the antiproliferative effect of niclosamide.

The mutation of the WNT pathway is a fundamental stage for the development of colon cancer that leads to a constitutive activity of the pathway and expression of the target gene. The activity of the WNT pathway plays a central role in homeostasis of the colon. Interference with this route therefore carries the risk of unwanted adverse effects. Niclosamide as a drug approved by the Food and Drug Administration (FDA) is used in the clinic for the treatment of helminthiasis where it has been proven that it has only mild adverse effects in humans when taken for orally. In the models of mice with xenotransplantation, non-toxic concentrations were found to be effective in reducing the level of expression of S100A4 within the tumor tissue and substantially reducing liver metastases. Interestingly, the inhibitory action in vivo of interrupted treatment with niclosamide was almost as strong as in mice that were continuously treated with niclosamide. Despite discontinuation of niclosamide treatment, the expression of S100A4 in spleen tumors as well as the formation of liver metastases was inhibited for 26 days after the end of treatment. In addition, discontinued treatment with niclosamide still had an important effect in prolonging overall survival.

The term "nucleic acids" refers to a DNA or RNA nucleic acid molecule, either single stranded or double stranded, as is commonly understood by one skilled in the art. Preferred nucleic acids of the

Present invention relates to DNA expression vectors, plasmids, RNA molecules.

The term "exogenous nucleic acids" refers to nucleic acids that have not originated from the cell that has been transformed. The nucleic acid sequence may be contained within the genome of the organism in which the nucleic acid molecule is transformed. However, the nucleic acid molecule itself must be transformed inside the target cells, thus originating from an external source. Said exogenous nucleic acids can be synthetic in nature, can be produced recombinantly or be purified or extracted from other organisms or stem cells from any other source external to the cell to be transformed. In the present invention, the exogenous nature does not necessarily refer to the sequence of the nucleic molecule but to its origin. The molecule that is then encoded by the nucleic acid can therefore be a protein or a peptide also encoded by the genome of the recipient cell.

The introduction of exogenous nucleic acids can be carried out by transfection, transduction, transformation or any other process of genetic modification or transformation. It can occur naturally, as occurs when a virus infects cells or artificially. Artificial transfection methods include but are not limited to chemical methods that include calcium phosphate precipitation, DEAE - complex formation with dextran and lipid mediated DNA transfer, physical methods including electroporation, microinjection and biolistic particle supply (gene cannon) and the use of recombinant viruses manipulated in the laboratory as vectors.

twenty

The term "transformation" refers to carrying exogenous nucleic acids inside the cell through either natural or chemical methods.

The term "derivative" refers to any change in a base compound defined in the present application. The term "derivative" is used to describe a compound that can be an effective agent by itself / in its own right or in the derived form. Preferred derivatives are those provided in Figure 5A. An additional derivation in each of the modified residues is known to one skilled in the art and therefore other derivatives are included in the present invention. For example, additional halogens at various positions occupied by Cl are obvious derivatives that are included within the scope of the present invention.

30

As used herein "pharmaceutical composition" means a composition comprising niclosamide or its derivative so that the composition can be used safely and efficiently as products to obtain or achieve a desired result. The term "pharmaceutical composition" as used herein means compositions that result from the combination of individual components which themselves are pharmaceutically acceptable. For example, when intravenous administration is envisaged, the components are suitable or acceptable (both in quality and quantity) for intravenous administration. Niclosamide or its derivatives can be administered to mammals, especially humans, using various routes of administration, such as intravenous, subcutaneous or intramuscular. The administered dose should be considered by the person skilled in the art so that it is therapeutically effective as a therapy to treat or avoid the symptoms of cancer, mainly metastasis.

The description presented herein is directed to a pharmaceutical composition that can be administered through several routes including the oral, intraperitoneal, intravenous, subcutaneous, intramuscular route or directly in or on the affected individual. When the pharmaceutical composition is delivered by an injection, the injection of niclosamide or its derivative can be by a single injection or several injections inside or outside the body and the injection (s) can be given in a single day or for several days. The daily dose is administered to a subject so that the daily amount of niclosamide supplied to a subject from the pharmaceutical composition is approximately that which is therapeutically effective for the treatment of symptoms associated with cancer, especially metastasis. In addition, the pharmaceutical composition may optionally include additional components such as salts, stabilizers and antimicrobials without departing from the essence and scope of the claimed invention. The pharmaceutical composition of the present invention contains niclosamide or its derivatives and a pharmaceutically acceptable carrier.

The amount and nature of the niclosamide or its derivatives to be incorporated in the composition may vary depending on the desired therapeutic effect and the period of time during which the composition provides a therapeutic effect. The amount of niclosamide or its derivatives in the pharmaceutical composition is what will provide a therapeutically effective amount for the treatment of symptoms associated with cancer, especially metastasis. Obviously, the concentration and character of the niclosamide or its derivatives to be included in the pharmaceutical composition will vary depending on the components used in the pharmaceutical composition 60, the route by which it is administered, the symptoms and details of the cancer that requires treatment as well

other factors known to those skilled in the art.

The use of the terms "patient" or "person" may be exchanged herein, and they refer to mammals, which include but are not limited to primates including apes and humans.

5

As used, the terms "treatment", "treat" and the like refer to the fact of obtaining a desired pharmacological and / or physiological effect. The effect can be prophylactic in terms of complete or partial prevention of a cancer metastasis and / or it can be therapeutic in terms of a partial or complete cure for cancer metastasis and / or adverse effects attributable to the disease. "Treatment" as used herein refers to a disease in a mammal, particularly in a person, and includes: (a) preventing the disease from appearing in a subject suffering from cancer; (b) the inhibition of the disease, that is, the arrest of its development and metastasis; and (c) mitigate the disease, that is, cause a regression of the disease.

As used herein, the term "treatment" is further defined as the application or administration of one or more compounds or pharmaceutical compositions of the present invention that include niclosamide in a subject, in which the subject suffers from cancer as It has been indicated earlier in this document, symptoms associated with cancer, in which the purpose is cure, relief, mitigation, alteration, remedy, improvement or affect cancer, preferably cancer metastasis.

twenty

However, "therapeutic" and "prophylactic" treatments should be considered in a broader context. The term "therapeutic" does not necessarily imply that a subject is treated until full recovery. Similarly, "prophylactic" does not necessarily mean that the subject does not develop at any time symptoms that are associated with cancer metastasis.

25

Therefore, therapeutic and prophylactic treatment includes an improvement in the symptoms of a particular disease or a prevention or otherwise a reduction in the risk of developing a particular disease. The term "prophylactic" can be considered as a reduction in the severity or occurrence of a particular disease, preferably metastasis. "Therapeutic" can also reduce the severity of an existing disease.

The terms application and administration are used as synonyms herein and refer to the use of a pharmaceutical composition or compound to treat a patient.

The term "effective dose" as used herein, refers to the amount of an active ingredient high enough to (a) prevent the disease from appearing in a subject that may suffer from cancer; (b) inhibit the disease, that is, stop its metastasis; and (c) mitigate the disease, that is, cause metastasis to regress, but low enough to avoid serious side effects. A safe and effective amount of an active ingredient may vary with the specific galenic formulation, pharmaceutical composition and other similar factors.

As used herein, "vehicle" includes all and each of the solvents, media dispersers, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delay agents, buffers, vehicle solutions, suspensions, colloids and the like. The use of these media and agents in pharmaceutically active substances is known in the art. Except in the case that a conventional medium or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

Physiologically acceptable vehicles are well known in the art. Examples of liquid vehicles are 50 sterile aqueous solutions that do not contain additive materials in the active ingredients and water, or contain a buffer such as sodium phosphate with a physiological value of pH, physiological saline or both, as phosphate buffered saline. In addition, aqueous vehicles may contain more than one buffered salt, as well as salts such as sodium and potassium chlorides, dextrose, propylene glycol, polyethylene glycol and other solutions. Liquid compositions may also contain liquid phases in addition to water and excluding water. Examples of said additional liquid phases are glycerin, vegetable oils such as cotton oil, organic esters and ethyl oleate and water-oil emulsions. A pharmaceutical composition contains niclosamide or a derivative thereof in the present invention.

The oral bioviability of niclosamide is preferably 10%, therefore oral treatment in 60 mammals with a dose of 50 mg / kg - 400 mg / kg, preferably 100 mg / kg - 350 mg / kg, more preferably

150 - 300 mg / kg of niclosamide is possible, the substance could also be applied intraperitoneally. According to WHO studies, mice chronically fed with 200 mg / kg showed no adverse effects for a total period of two years of observation. The conclusion, from these studies, is that the administration of niclosamide for a long period of time does not present adverse effects in healthy animals.

5 This represents a significant benefit in the application of niclosamide for the treatment and prevention of metastasis, since it can be administered in relatively high doses without adverse effects.

The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an inappropriate or similar allergic reaction when administered to a patient.

10

The term "pharmaceutically acceptable carrier" as used herein means any material or substance with which the active ingredient (niclosamide or a derivative thereof) is formulated to facilitate its application or dissemination to the locus to be treated, by for example, by dissolving, dispersing or diffusing said composition and / or to facilitate its storage, transport or handling without affecting its effectiveness. The pharmaceutically acceptable carrier can be a solid, a liquid or a gas that has been compressed to form a liquid, that is, the compositions of the present invention can be suitably used as concentrates, emulsions, solutions, granulates, powders, vaporizers, aerosols, suspensions, ointments, creams, pills, pills or sprayers.

The compound of the pharmaceutical composition disclosed herein and containing the active ingredient may be presented in a form suitable for oral use, for example, pills, troches, pills, aqueous or oily suspensions, powders or granules. dispersibles, emulsions, hard or soft capsules or syrups or elixirs. Compositions intended for oral use may be prepared according to any method known in the art for the preparation of pharmaceutical compositions or compositions and said compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, agents dyes and preservatives to provide pharmaceutically effective and tasty preparations. The pills contain the active ingredient in a mixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of pills. These excipients may be, for example, inert diluents, such as calcium carbonate, sodium carbonate, calcium phosphate or sodium phosphate; granulating agents and other disintegrating agents in addition to niclosamide or derivatives thereof, for example, corn starch or alginic acid; binding agents, for example, starch, gelatin or acacia and lubricating agents, for example, magnesium stearate, stearic acid or talc. The pills may not be coated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thus provide sustained action over a long period of time. For example, a time-retarding material such as glycerol monostearate or glycerol distearate can be used. They can also be coated using the techniques described in the U.S. Pat. Nos. 4,256,108; 4,166,452; and 4,265,874, to form osmotic therapeutic pills to control release. A pharmaceutical composition may also contain, or alternatively contain, one or more drugs that may be linked to a modular agent or may be free in the composition. Virtually any drug can be administered in combination with the niclosamide or derivatives thereof disclosed herein and an additional modulating agent, for various reasons described below. Examples of types of drugs that can be administered with niclosamide or their derivatives and a modulating agent include analgesics, anesthetics, antianginals, antifungals, antibiotics, anticancer drugs (e.g., taxol or mitomycin C), anti-inflammatories (e.g., ibuprofen and indomethacin ), anthelmintics, antidepressants, antidotes, antiemetics, antihistamines, 45 antihypertensives, antimalarials, antimicrotubule agents (e.g., colchicine or alkaloids of Vinca), antimigraphic agents, antimicrobials, antipsychotics, antipyretics, antiseptic agents, for example antiseptic agents protein kinase C or inhibitors of intracellular calcium mobilization, cough suppressants, antivirals, appetite suppressants, cardioactive drugs, chemical dependency drugs, cathartics, chemotherapeutic agents, coronary vasodilators, cerebral or peripheral contraceptives, sedatives, diuretics, expectorant It is 50 growth factors, hormonal agents, hypnotics, immunosuppressive agents, narcotic antagonists, parasympathomimetics, calming, stimulants, sympathomimetics, toxins (for example, cholera toxin) tranquilizers and urinary anti-infectives.

Formulations or compositions for oral use may also be presented as hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent, for example calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules in which the active ingredient is mixed with water or an oil medium, for example, peanut oil, liquid paraffin or olive oil. Aqueous suspensions contain the active materials mixed with excipients suitable for the preparation of aqueous suspensions. Such excipients are suspending agents, for example, sodium carboxymethyl cellulose, methyl cellulose, hydroxymethyl cellulose, gum tragacanth and acacia gum; dispersing agents or humectants may be a

natural phosphatide, for example lecithin or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long aliphatic chain alcohols, for example heptadecaethylene oxyethanol, or oxide condensation products of ethylene with partial esters derived from fatty acids and a hexitol such as polyoxyethylene with partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan polyoxyethylene monooleate. Aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl, p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose or saccharin.

10 Oily suspensions can be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example, beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those described above and flavoring agents may be added to provide a tasty oral preparation. These compositions can be preserved by the addition of an antioxidant such as ascorbic acid.

Dispersible powders and granules suitable for the preparation of an aqueous suspension by the addition of water provide the active ingredient in a mixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Examples of suitable dispersing or wetting agents and suspending agents, for example, sweetening, flavoring and coloring agents may also be present.

The terms "active compound" or "active ingredient" refer in the present invention especially to niclosamide or derivatives thereof.

The preparation of an active compound containing a protein as an active ingredient is known in the art. Normally, said compounds are prepared as injectables, both as liquid solutions or suspensions; Solid forms suitable for solution in, or suspension in, liquid can also be prepared before injection. The preparation can also be emulsified.

A "therapeutically effective amount" is preferably an amount sufficient to partially or completely inhibit the metastasis of a cancer.

Although the invention has been described in relation to specific embodiments and examples, it should be noted that other embodiments that utilize the concept of the present invention are possible without departing from the scope of the invention. The present invention is defined by the elements of the claims and each and every one of the modifications, variations or equivalents that are framed within the spirit and scope of the principles on which it is based.

EXAMPLES

40

Example 1: High performance screening for S100A4 inhibitors

Colon cancer cells that stably express a luciferase marker gene construct directed by a human S100A4 promoter, HCT116-S100A4p-LUC were screened with the library of pharmacologically active compounds (LOPAC; Figure 1, A) . The LOPAC library represents a collection of 1280 well characterized small cell inhibitors. In a 4-concentration primary screening, 34 compounds were found to inhibit the expression of luciferase directed by the S100A4 promoter by more than 50% compared to control cells treated with DMSO (Figure 1B). In parallel, cell viability was determined using an assay by the Alamar blue method to assess whether some of the inhibitory effects were caused by cytotoxicity (data not shown). Of the 34 effective compounds, 11 compounds more effectively inhibited expression of the reporter gene at concentrations that were not toxic or only slightly affected cell viability. To confirm the inhibitory capacity of the selected compounds and to establish more precisely the concentration-response curves, these 11 compounds were titrated using a 20-concentration again screening with triplicate wells of double dilutions with the highest concentration of the test. 100 pM Concentration-response tests confirmed that niclosamide (2 ', 5-dichloro-4'-nitrosalicylanilide) was the strongest candidate with respect to inhibition of expression of the reporter gene (Figure 1, C).

Example 2: Effect of niclosamide on mRNA and S100A4 protein expression

To determine the applicable concentration of niclosamide, the cytotoxicity of niclosamide on HCT116 cells was analyzed. Exposure of HCT116 cells to increasing concentrations of niclosamide reduced cell viability in a concentration-dependent manner (EC50 = 2.2 pM; 95% IC 1.87 to 2.92 pM) (Figure 2, A). By selecting a concentration range from 0.1pM to 2.5 pM niclosamide, the expression of endogenous S100A4 in HCT116 cells was analyzed and it was found that S100A4 mRNA and protein levels were reduced in a concentration dependent manner ( Figure 2, B). Concentrations greater than 0.5 pM of niclosamide reduced the amount of endogenous S100A4 mRNA to less than 50% of solvent treated controls (control vs niclosamide, 1 pM average 47.4%, 95% CI, 39.3% at 55.4%; P <.01, 1.5 pM average 39.2%, 95% CI 11.4% at 89.7%; P <.01, 2 pM average 39.1, 95% CI 18.3% to 59.9%, P <.01.2.5 pM average 36.7%, Cl 95% 10 18.6% to 54.8%; P <.001). Similar effects were observed at the level of the S100A4 protein. No change in expression of S100A4 could be detected with concentrations below 1pM of niclosamide. With respect to the optimal concentration that showed minimal cytotoxicity and maximum inhibition of S100A4 expression, 1pM niclosamide was used in other experiments.

15 The time dependence of the niclosamide-mediated reduction of S100A4 expression was then analyzed. After a single dose of niclosamide the levels of mRNA and S100A4 protein in HCT116 cells were reduced to less than 50% after 18 hours and 24 hours, respectively (control vs niclosamide, 18 hours average 47.5%, CI 95 % 43.9% to 51.1%; P <.001; 24 hours average 47.4%, 95% CI 39.4% to 55.4%, P> .001), but returned to the control level later 30-48 hours (Figure 2, C). When HCT116 cells are treated daily with 1 pM niclosamide, a constant reduction in S100A4 mRNA and protein levels were observed at approximately 50% of solvent treated control cells (control vs niclosamide, 24 hours average 46, 0%, 95% CI 38.7% to 53.3%, P <.001; 48 hours average 44.5%, 95% CI 32.2% to 56.8%, P <.001; 72 average hours 59.5%, 95% CI 50% to 69.2%, P <.001) (Figure 2, D).

Similar to wild-type HCT116 cells, exposure of HCT116-vector cells to niclosamide also showed approximately 50% inhibition of S100A4 expression compared to solvent-treated control cells (HCT116-control vector vs niclosamide , mean 100% vs. 57.8%, mean difference 42.0%, 95% CI 31.9% to 52.1%, P <.0001) (Figure 2, E). In HCT116-S100A4 cells, the level of S100A4 mRNA was 6 times higher than HCT116-vector cells because the ectopic expression of the S100A4 cDNA construct 30 directed by the CMV promoter. Accordingly, the expression of the S100A4 protein increased in HCT116-S100A4 cells. In contrast to HCT116-vector cells, exposure of HCT116-S100A4 to niclosamide resulted in a non-reduction of S100A4 mRNA (control HCT116-S100A4 vs niclosamide, mean 717.0% vs. 612.3%, mean difference 104, 7%, 95% CI -110.0 to 319.5, not statistically significant) and protein levels.

35

Example 3: Effect of niclosamide on cell migration and S100A4-induced invasion

S100A4 is the main regulator of cellular motility. Thus, the effect of niclosamide on cell migration induced by S100A4 on HCT116-vector and HCT116-S100A4 cells was analyzed. The number of migrated cells was inhibited in HCT116-vector cells in the presence of niclosamide (control vs niclosamide, mean 100.0% vs. 43.0%, mean difference 57.0%, 95% CI 40.3% to 73.7 %, P <.0001) (Figure 3, A). On the contrary, the migration rates of HCT116-S100A4 cells did not show a reduction with niclosamide treatment (control vs niclosamide, mean145.0% vs. 117.0%, mean difference 28%, 95% CI -7.8% at 63.9%, not statistically significant).

Four. Five

The invasion rates of the HCT116-vector and HCT116-S100A4 cells were also determined, since it is well known that S100A4 stimulates cell invasion. The number of invaded cells decreased in HCT116-vector cells treated with niclosamide (control vs niclosamide, mean 100% vs. 30.1%, mean difference 69.9%, 95% CI 10.9% to 128.9%, P = .021) (Figure 3, B). On the contrary, treatment with niclosamide had no effect on the 50 invasion rates of HCT116-S100A4 cells (control vs niclosamide, mean111.4% vs. 122.5%, mean difference - 11.1%, 95% CI -54 , 9% to 32.8%, not statistically significant).

In addition, the effect of niclosamide on directed migration in the wound closure trial was analyzed. In the absence of niclosamide, the HCT116-vector and HCT116-S100A4 cells completely closed the wound inserted 55 after 4 days (Figure 3, C). The wound closure was impaired in the HCT116-vector cells treated with niclosamide. On the contrary, HCT116-S100A4 cells had the ability to migrate into the wound and close the hole despite the presence of niclosamide. In summary, exposure to niclosamide restricted the motility of the cells and their invasiveness. This effect was specific for S100A4 since the ectopic overexpression of S100A4 exceeds niclosamide-mediated inhibition of cell motility.

Example 4: Effect of niclosamide on anchorage-dependent and independent cell growth

Anchor-dependent cell proliferation was measured in the presence or absence of niclosamide and dependent on the level of expression of S100A4. Exposure of HCT116-vector cells and HCT116-S100A4 cells to niclosamide resulted in a reduction of cell proliferation in both cell lines regardless of the level of S100A4 expression (Figure 3 D). Anchor independent cell growth was analyzed by a colony formation assay. HCT116-vector cells treated with solvent and HCT116-S100A4 cells were both capable of forming large colonies within seven days (Figure 3 E). However, treatment with niclosamide clearly reduces the size of the colonies of the HCT116-10 vector cells and the HCT116-S100A4 cells. In addition, the number of colonies of HCT116-vector and HCT116-S100A4 cells was severely reduced (HCT116-control vector vs niclosamide, mean 100% vs. 6.8%, mean difference 93.2%, 95% CI, 84.2 at 102.2%, P <0001; HCT116-S100A4 control vs niclosamide, mean 105.8% vs. 5.0%, mean difference 100.7%, 95% CI, 89.5% to 11.9%, P <0001) (Figure 3 F). In summary, inhibition of cell proliferation and colony formation by niclosamide was independent of the level of endogenous or ectopic expression of S100A4. fifteen

Example 5: Effect of niclosamide on S100A4-induced proliferation and motility of human colon cancer cells

The effects of niclosamide on the expression of S100A4 on the colon cancer cell lines SW620, LS174T, SW480 and DLD-1 were then analyzed. Niclosamide treatment reduced the level of S100A4 mRNA in SW620, LS174T and SW480 cells to less than 30% of the respective solvent treated control (control SW620 vs niclosamide, mean 100.0% vs. 31.2%, mean difference 68, 8%, 95% CI 49.1% to 88.5%, P <.0001; LS174T control vs niclosamide, mean 65.5% vs. 13.5%, mean difference 51.9%, 95% CI 38, 3% to 65.6%, P <.0001, SW480 control vs niclosamide, mean 41.0% vs. 6.0%, mean difference 35.0%, 95% CI, 27.1% to 42.9%, P < .0001) (Figure 25 4, A). In DLD-1 cells the S100A4 mRNA was barely detectable and remained unchanged under niclosamide treatment. In addition, niclosamide reduced the expression of S100A4 protein in SW620, LS174T and SW480 cells, while S100A4 protein was not detected in the solvent and in DLD-1 cells treated with niclosamide.

30 Treatment with niclosamide reduced the cell migration rate of SW620, LS174T and SW480 cells to less than 50% of the respective solvent-treated control (SW620 control vs niclosamide, mean 100.0% vs. 47.9%, mean difference 52, 1%, 95% CI 25.4% to 78.9%, P = .0005; LS174T control vs niclosamide, mean 68.2% vs. 26.8%, mean difference 41.3%, 95% CI 16.3 % at 66.3%, P = .0024, SW480 control vs niclosamide, mean 21.7% vs. 10.6%, mean difference 11.1%, 95% CI, 1.2% to 2.1%, P = .0297) . The solvent-treated DLD-1 cells had the lowest migration rate, which was no longer affected by the niclosamide treatment (Figure 4, B). Similarly, cell inhibition of SW620, LS174T and SW480 cells at less than 30% of the respective solvent-treated control (SW620 control vs. niclosamide, mean 100.0% vs. 25.1%, mean difference 74.9%, CI 95% 48.4% to 101.4%, P <.0001; LS174T control vs niclosamide, mean 63.2% vs. 23.6%, mean difference 39.5%, 95% CI 8.7% to 70 , 4%, P = .013, SW480 control vs niclosamide, mean 47.7% vs. 12.8%, mean difference 34.9%, 95% CI, 12.3% to 40 57.5%, P =, 0031) (Figure 4, C). The low invasion rate of solvent-treated DLD-1 cells was not affected by niclosamide treatment. Direct migration of SW620, LS174T, SW480 and DLD-1 cells, measured in the wound closure test, was impaired by niclosamide treatment compared to the respective solvent treated control (Figure 4 D). Consistent with its low migration rate, solvent-treated DLD-1 cells did not close the wound until day 4.

Four. Five

Anchor-dependent cell proliferation of the four cell lines was inhibited under niclosamide treatment (Figure 4, E). In addition, independent anchor growth was impaired when SW620, LS174T, SW480 and DLD-1 cells were exposed to niclosamide, resulting in clearly smaller cell colonies (Figure 4F). Treatment with niclosamide reduced the number of colonies to less than 50 50% in all four colon cancer cell lines (SW620 control vs niclosamide, mean 100.0% vs. 3.6%, mean difference 96.4%, 95% CI 78.0% to 114.8%, P <.0001; LS174T control vs niclosamide, mean 90.6% vs. 15.9%, mean difference 74.6%, 95% CI 58.3% to 91.0%, P <.0001; SW480 control vs niclosamide, mean 68.1% vs. 4.3%, mean difference 63.8%, 95% CI 52.2% to 75.4%, P <.0001; DLD- 1 control vs niclosamide, mean 82.6% vs. 10.1%, mean difference 72.5%, 95% CI 52.5% at 92.4%, P <.0001) (Figure 4, G). In summary, in the cells of colon cancer with expression levels of S100A4, niclosamide inhibited migration and cell invasion. Cell proliferation was inhibited regardless of the level of expression of S100A4.

Example 6: Efficiency of niclosamide derivatives on cell expression and migration S100A4

60 The effect of structural changes in the niclosamide molecule on its ability to limit the

S100A4 expression (Figure 5 A). To compare the efficiency of niclosamide and its derivatives to inhibit the expression of S100A4, it was applied to all compounds according to the treatment conditions defined for niclosamide. In contrast to the observed effects of niclosamide, no reduction in S100A4 mRNA and protein levels was detected in any of the six niclosamide derivatives (Figure 5B). However, 5 other derivatives did show a significant decrease in migration rates when analyzing cell migration (Figure 5 C). In summary, none of the niclosamide derivatives achieved the effect of niclosamide to prevent the expression of S100A4 and cellular motility induced by S100A4. However, other derivatives maintained an effect against cell motility and showed more effective results in some aspects, for example in speed or effect in several models in addition to potential improvements in solubility and potential pharmaceutical formulation. It was concluded that these changes in the structure of niclosamide result in a loss of its efficacy on the inhibition of S100A4 expression but provide other potentially beneficial effects.

Example 7: Effect of niclosamide on constitutively active WNT signaling

As previously published, HCT116 cells are heterozygous for mutated CTCTNBI resulting in constitutively active WNT signaling and S100A4 expression. Applying the LEF / TCF transcription factor indicator in the assay (TOP / FOPflash), the activity of the WNT / CTNNB1 pathway of the HCT116 cells treated with niclosamide was analyzed, as well as their HAB-68mut and HAB-92wt null derived cells that they only present the mutated allele or the natural type allele of CTNNBI respectively. In the absence of niclosamide, WNT pathway activity increased 1.3 times in HAB-68mut cells and decreased 2.9 times in HAB-92wt cells compared to HCT116 cells. Niclosamide exposure resulted in a decrease in WNT pathway activity in HCT116, HAB-68mut and HAB-92wt cells (control HCT116 vs niclosamide, mean 1.00 vs. 0.39, mean difference 0.61, CI 95% 0.41 to 0.81, P <.0001; HAB-68mut control vs niclosamide, mean 1.39 vs. 0.50, mean difference 0.90, 95% CI 0.64 to 1.16, P <, 0001 ; HAB-92wt control vs niclosamide, mean 0.36 vs 0.21, mean difference 0.15, 95% CI 0.05 to 0.25, P = .0077) (Figure 6, A). Niclosamide treatment also resulted in a decrease in the expression of S100A4 mRNA and protein (control HCT116 vs. niclosamide, mean 1.00 vs. 0.46, mean difference 0.54, 95% CI 0.43 to 0 , 65, P <, 0001; HAB-68mut control vs

niclosamide, mean 1.17 vs 0.62, mean difference 0.55, 95% CI 0.41 to 0.69, P <, 0001; HAB-92wt control vs

Niclosamide, mean 0.03 vs. 0.01, mean difference 0.02, 95% CI Cl -0.001 to 0.047, P = ,, not statistically

30) (Figure 6, B). Therefore, the migration rates of HCT116 and HAB-68mut cells are

reduced to the HAB-92wt level after treatment with niclosamide (control HCT116 vs niclosamide, mean 1.00 vs. 0.45, mean difference 0.54, 95% CI 0.22 to 0.87, P <, 0001; HAB- 68mut control vs niclosamide, average 1.30 vs 0.39,

mean difference 0.91, 95% CI 0.62 to 1.20, P <.0001; HAB-92wt control vs niclosamide, mean 0.36 vs 0.32,

mean difference 0.04, 95% CI 0.08 to 0.16, not statistically significant) (Figure 6, C). In short, the

Niclosamide inhibits transcription of the target gene dependent on WNT signaling despite a pathway

constitutively active of WNT / CTNNB1.

Example 8: Mode of action of niclosamide on the WNT / CTNNB1 pattern

40 Active WNT signaling is highly dependent on nuclear CTNNB1. Therefore, the amount of nuclear CTNNB1 under increasing concentrations of niclosamide was analyzed. Exposure of HCT116 cells to increasing concentrations of niclosamide for 18 hours did not change the level of nuclear CTNNB1 protein (Figure 6, D). However, no reduction was observed in WNT / CTNNB1 signaling or in S100A4 gene expression. This leads to the hypothesis that niclosamide can act within the nucleus to inhibit the formation of the complete CTNNB1 / TCF transcription activator. This hypothesis was tested by EMSA, applying biotinylated oligonucleotides that encompass the TCF binding site of the S100A4 promoter. The oligonucleotide changes caused by the union of TCF and CTNNB1 / TCF were detected in the absence of niclosamide (Figure 6, E), which is consistent with the previous results. The presence of CTNNB1 within the complex was verified by the formation of the complex with monoclonal anti-CTNNB1 which leads to a super-displacement. Exposure of HCT116 cells at increasing concentrations of niclosamide disrupted the CTNNB1 / TCF / oligo complex in a concentration dependent manner. It has not been possible to detect an over-displacement in the nuclear extracts of cells treated with 1 pM niclosamide. Based on these results, the ChIP assay demonstrated that the S100A4 promoter sequence cannot be amplified by PCR after immunoprecipitation of CTNNB1 from cell extracts treated with niclosamide, but a PCR product was detected in cell extracts. treated with solvent Figure 6, F). The latter was already observed by Stein et al. No PCR product could be detected when control G immunoglobulin was used for precipitation or when the FOS promoter sequence was amplified by PCR. In summary, it was concluded that treatment with niclosamide inhibits the formation of the CTNNB1 / TCF complex and therefore inhibits transcription of the WNT / CTNNB1 target gene.

Example 9: Effect of niclosamide on metastasis formation in vivo

Then, the effect of niclosamide on metastasis formation in mice with xenotransplantation was monitored by non-invasive image capture in vivo by luminescence. On day 8 after intrasplenic transplantation of the HCT116-CMVp-LUC cells, which express firefly luciferase stably, a visible spleen tumor was formed in the solvent treated control mouse and in the 20 mg niclosamide treated mouse per kg (Figure 7, A). The lateral image showed that the spleen tumor signal increased in the mouse treated with solvent and niclosamide until it reached a maximum on day 24. Differences in the location of the signal were found in the ventral image. In the control mice the signal of hepatic metastasis could be detected which was confirmed by the capture of the image in situ and by isolation of the liver and spleen. In mice treated with niclosamide were not detected or only small liver metastases were detected.

Niclosamide had the ability to inhibit S100A4 expression in vivo, since S100A4 mRNA levels were reduced in mice treated with niclosamide (control vs. 2 x 15 mg per kg, mean 100.0% vs. 58.4%, mean difference 41.7%, CI 95% 21.6% to 61.8%, P <, 001; control vs. 20 mg per kg, mean 100.0% vs. 67.2%, mean difference 32.9%, 95% CI 14.1% to 51.7%, P <.001) (Figure 7, B). The classification of liver metastases decreased in mice treated with niclosamide compared to mice treated with solvent (100.0% mean control, 95% CI -15.4% to 215.4%; 2 x 15 mg per average kg 36, 1%, 95% CI 12.4% at 59.8%; 20 mg per kg average 3, .9%, 95% CI 22.6% at 53.1%) (Figure 7, C). In summary, it was concluded that treatment with niclosamide inhibits the in vivo formation of S100A4-induced metastasis.

Example 10: Long-term effect of niclosamide treatment in vitro and in vivo

Next, the effect of S100A4-mediated metastasis formation was investigated when niclosamide treatment was discontinued. To address this, HCT116 cells were treated daily with niclosamide for three consecutive days. On day 4 the niclosamide was removed. The expression of S100A4 in these cells remained repressed up to approximately 50% of the respective solvent treated control for 24, 48 and 72 hours after the interruption of niclosamide exposure (control vs niclosamide 24 hours post-treatment, mean101.9 % vs 58.0%, mean difference 43.9%, 95% CI 31.0% to 56.8%, P = .0002; control vs niclosamide 48 hours 30 post-treatment, mean 98.1% vs 44, 4%, mean difference 53.7%, 95% CI 33.2% to 74.1%, P = .0011; control vs niclosamide 72 average difference 100.0% vs 57.9%, mean difference 42.1% , 95% CI 16.6% to 67.6%, P = .0193) (Figure 8, A). In addition, the S100A4 protein was clearly reduced for three days after discontinuation of niclosamide treatment. Cell migration rates in these cells remained repressed up to less than 30% of the respective solvent-treated control up to three days after the elimination of niclosamide (control vs niclosamide 24 hours post-treatment, mean 100.0% vs. 18, 7%, mean difference 81.3%, 95% CI 40.7% at 122.0%, P = .0004; control vs niclosamide 48 hours post-treatment, mean 100.0% vs. 12.2%, mean difference 87.8%, 95% CI 54.9% at 120.7%, P <.0001; control vs niclosamide 72 mean difference 108.8% vs. 10.4%, mean difference 98.4%, 95% CI 41 , 5% to 155.4%, P = .0017) (Figure 8, B).

The anchorage-dependent proliferation of niclosamide-treated HCT116 cells was inhibited compared to the solvent-treated control (Figure 8, C). After five days, control cells treated with solvent reached the maximum. The withdrawal of niclosamide on day 5 did not reverse the inhibition of cell proliferation during the next five days when compared to cells treated continuously with niclosamide.

In addition, metastasis formation was investigated in vivo under continuous and discontinuous treatment with niclosamide. The total survival of the mice treated with niclosamide was extended compared to the mice treated with solvent (control vs discontinuous treatment, mean survival 24 days vs 46.5 days, ratio 0.52, 95% Cl 0.19 to 0.84 , P =. 0012; control vs. continuous treatment, mean survival 24 days vs 43 days; ratio 0.56, 95% Cl 0.24 to 0.88, P = .0012) (Figure 8 D). In addition, no difference in total survival was observed in mice 50 in which treatment was discontinued at 24 days compared to mice under conditions of continuous treatment with niclosamide.

At each individual endpoint of each mouse, the liver and spleen were removed and the image capture was applied by luminescence in vivo. All mice developed a spleen tumor. However, tumor growth in mice treated with niclosamide, either continuously or discontinuously, was clearly delayed compared to mice treated with solvent (Figure 8, E). The size of liver metastases in mice treated with niclosamide continuously or discontinuously was clearly reduced compared to animals treated with solvent. In mice treated with niclosamide discontinuously, liver metastases were slightly greater than those in mice treated with niclosamide continuously. However, the luminescence signals 60 of the liver metastases of the control animals were stronger at day 29 than the signal of

Hepatic metastases of mice treated with niclosamide continuously or discontinuously at day 50 indicating a long-term inhibition of niclosamide metastasis formation.

Quantification of the level of S100A4 mRNA in the spleen tumor tissue revealed that in mice treated with 5 niclosamide the S100A4 mRNA was repressed (control vs. discontinuous treatment, mean 100.0% vs. 60%, mean difference 40.0% , 95% CI 3.9% to 50.1%, P <, 001; control vs. continuous treatment, mean 100.0% vs. 73%, mean difference 27%, 95% CI 15.8% to 64.2 %, P <, 05) (Figure 8, F). In addition, no statistically significant difference was detected in the level of S100A4 expression in mice with continuous versus discontinuous treatment with niclosamide. According to this result, liver metastasis was reduced in mice treated with niclosamide compared to control mice (control vs discontinuous treatment, mean 100.0% vs. 34.9%, mean difference 65.1%, 95% CI 18.4% to 111.9%, P <, 01; control vs. continuous treatment, mean 100.0% vs. 10.9%, mean difference 89.1%, 95% CI 45.3% to 133.0% , P <.001) (Figure 8, G). In addition, no statistically significant difference was detected in mice with discontinuous treatment versus mice with continuous treatment with niclosamide. In summary, even when niclosamide is not given continuously, the expression of S100A4 and metastasis formation were seriously inhibited which leads to prolonged overall survival.

The use of animal models in the examples provided above is not limiting for the present invention whose intended use is the application in human subjects. The mouse model represents a standardized model accepted for application in humans and provides reliable support for application in 20 mammals, preferably humans.

MATERIALS AND METHODS USED IN THE EXAMPLES

Cell lines and cell cultures

25

Human colon cancer cell lines SW620, LS174T, SW480, DLD-1 and HCT116 were all grown in RPMI-1640 medium (PAA Laboratories, Pasching, Austria) supplemented with 10% fetal bovine serum (FBS; Invitrogen). HCT116 cells have previously been described as heterozygous for mutation deletion of codon 45 in one of two CTNNB1 alleles that results in the loss of a serine 45 30 which is the initial phosphorylation site in beta-catenin protein (CTNNB1 ) necessary for proteosomal degradation. Homologous recombination was used to delete the wild-type CTNNB1 allele that results in the HAB-68mut clone. derived from the HCT116 cell or to delete the dCTNNBI mutated allele that results in the HAB-92wt clone derived from the HCT116 cell. Both cell clones were kindly provided by Dr. Todd Waldman (Georgetown University, Washington, District of Columbia). All 35 cells were briefly expanded in culture and kept frozen in several replicated vials. The cell banks were tested by PCR and by culture methods and found to contain no mycoplasma. To authenticate the HAB-68mut and HAB-92wt cell lines as derivatives of HCT116, genotyping with short tandem repeats (STR) was carried out on August 2010 using the ABI (Applied Biosystems) identification device. STR genotypes matched the genotypes published for HCT116. All 40 cells were kept in a humidified incubator at 37 ° C and 5% CO2.

Monoclonal and polyclonal antibodies

The anti-human mouse monoclonal antibody-CTNNB1 and the anti-human mouse monoclonal antibody tubulin-45 p1 (TUBB1) were purchased from BD Biosciences, Heidelberg, Germany. The monoclonal antibody against the human cell proliferation nuclear antigen (PCNA) was purchased from Cell Signaling Technologies, Danvers, MA. Polyclonal rabbit anti-S100A4 human antibody was purchased from Dako, Glostrup, Denmark. Goat polyclonal goat anti-glyceraldehyde-3-phosphate dehydrogenated (GAPDH) human and horseradish peroxidase-conjugated anti-goat antibody (HRP) were purchased from Santa Cruz Biotechnology, Santa Cruz, CA. Anti-50 rabbit conjugated with HRP was purchased from Promega Madison, WI. HRP-conjugated anti-mouse IgG and anti-mouse IgM were purchased from Invitrogen.

Stable transfection of HCT116 cells

55 The S100A4 promoter sequence (-1487 bp sequence above the S100A4 transcription initiation site) was amplified by PCR from a vector kindly provided by Dr David Allard (Peninsula Medical School, Universities of Exeter and Plymouth, Exeter, UK) and was cloned into a pGL1.4 vector (Invitrogen) to make the firefly luciferase (LUC) gene under the control of the S100A4 promoter with a neomycin resistance cassette. This construct was transfected into HCT116 cells to obtain HCT116-S100A4p-LUC cells. The S100A4 cDNA sequence was cloned from a kindly supplied vector

by Dr. Claus Heizmann (University of Zurich, Zurich, Switzerland) in a pcDNA3.1 vector with a puromycin resistance cassette. This construct was transfected into the HCT116 cells to obtain the HCT116-S100A4 cells or the empty vector to obtain the HCT116-vector cells. The LUC indicator gene was cloned under the control of the CMV promoter and transfected into HCT116 cells to obtain HCT116-CMVp-LUC cells.

5 All cloned constructs were prepared in our laboratory and sequenced in a correct structural orientation. All transfections were performed with Metafectene (Biontex Laboratories, Munich, Germany), according to the manufacturer's instructions. To obtain the cells that express the transgene in a stale way, mg per mL of neomycin (PAA Laboratories) or 1 pg per mL of puromycin (Invitrogen, Carlsbad, CA) was used for the selection.

10

High performance screening

For high throughput screening, 2.5 x 103 cells per well of HCT116-S100A4p-LUC cells were seeded in 384 well opaque white plates (Perkin Elmer, Waltham, MA) using a BIOMEK 2000 automatic pipetting system (Beckman Coulter, Brea, CA). The 1280 compounds from the library of pharmacologically active compounds (LOPAC 1280; obtained from Sigma-Aldrich, St Louis, MO) were initially dissolved in dimethylsulfoxide (DMSO) and then diluted in RPMI-1640 culture medium. Samples of the test compounds were then added to the test plates containing the cells that were treated for 24 hours with each of the compounds at concentrations of 0.1 pM, 1 pM, 10 pM and 100 pM (a only 20 well per concentration). After the treatment compound, luciferase expression was determined using a Britelite reagent (Perkin Elmer) in a Wallac Victor reader (Perkin Elmer). In parallel, the cytotoxicity of the compounds in 384-well transparent polystyrene plates (Costar) was measured by the Alamar blue cytotoxicity test (Sigma-Aldrich). After 24 hours of treatment with the compound, Alamar blue diluted in RPMI-1640 medium without serum was added to each well and incubation was continued for four hours. The 25 loops were then read in a Victor Wallac reading at an excitation wavelength of 530 nm and an emission wavelength of 590 nm. Both luminescence and Alamar blue fluorescence data, eight wells with control vehicles were expressed as mean and the results of the test compound (single well) were expressed as a percentage of the control. Concentrations effective to reduce the activity of luciferase or Alamar blue fluorescence by 50% were obtained from the concentration-response curves by linear interpolation. The ratio between Alamar blue vs luciferase representing the proportion of toxicity vs. activity (> 2.0) was used for triage of the screening data. In addition, as a screening for selectivity, inhibitory compounds were also analyzed based on their ability to inhibit expression of the luciferase constituent or HIF-1a-directed indicator in U251 glioma cell lines in a previous high-performance LOPAC screening. Compounds that show the best evidence for selective inhibition of the indicator without being because of its toxicity were then subjected to a detailed concentration-response test in both assays using double wells per concentration and twice 20 dilutions from a ceiling concentration of 100 pM

Drugs and treatments

Niclosamide (2 ', 5-dichloro-4'-nitrosalicylanilide) was obtained from Sigma-Aldrich (St Louis, MO). Niclosamide derivatives were obtained from Drug Synthesis and Chemistry Branch, Developmental Therapeutics Program, NCI, Bethesda, MD. All drugs were solubilized in DMSO for in vitro application. Niclosamide in vivo was administered as a 10% suspension of cremophor EL (BASF, Ludwigshafen, Germany) and a 0.9% NaCl solution.

Four. Five

Quantitative polymerase chain reaction with reverse transcription (qRT-PCR)

Total RNA was isolated from 4 x 105 cells seeded in 6-well plates 24 hours before lysing the cells with Trizol reagent (Invitrogen). The RNA was extracted with a Trizol (Invitrogen) 50 RNA extraction reagent according to the manufacturer's instructions. The quantification of the ARB was performed with Nanodrop (Peqlab) and 50 ng of total RNA were transcribed in reverse with random hexamers in 10 mM MgCl2; 1x rT buffer, 250 pM of mixture dNTPs, 1 U per pL of RNAse inhibitor and 2.5 U per pL MuLV of reverse transcriptase (all from Applied Biosystems). The reaction took place at 42 ° C for 15 minutes, 99 ° C for 5 minutes and subsequent cooling at 5 ° C for 5 minutes. The cDNA product was amplified in a total volume of 10 pL in a 96-well plate 55 in a LightCycler 480 (Roche) using the following conditions: 95 ° C, 10 minutes, followed by 45 cycles of 95 ° C for 10 seconds, 61 ° C for 30 seconds and 72 ° C for 4 seconds. For the quantification of S100A4 cDNA, the following primers and probes were used: 5'-CTCAGCGCTTCTTCTTTC-3 'end primer, 5'-GGGTCAGCAGCTCCTTTA-3' reverse primer, 5'-TGTGATGGTGTCCACCTT6AC6T40ACRTCRAC6T40AC probe -TCGGGCAAAGAGGGTGACAAGT -3 '. For the quantification of the cDNA of the consecutive glucose-6-phosphate dehydrogenase (G6PD) genes, the hG6PDH Kit was used

de Roche (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions. Data analysis was carried out with LightCycler® 480 software version 1.5.0 SP3. The average of the duplicates was calculated for each qRT-PCR reaction. Each mean value of the expressed gene was normalized to the respective mean amount of G6PD cDNA.

5

Immunoblot

For total protein extraction, the cells were lysed with RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 1% Nonidet P-40, supplemented with complete protease inhibitor tablets; Roche) for 30 minutes on 10 ice. To isolate the nuclear protein fraction, the nE-PER Nuclear and Cytoplasmic Extraction (Pierce) kit was used according to the manufacturer's instructions. Protein concentration was quantified using the bicinconinic acid (BCA) protein assay reagent (Pierce) according to the manufacturer's instructions and lysates of equal protein concentration were separated with SDS-PAGE and transferred to an Extra nitrocellulose membrane. Hybond C (Amersham Biosciences). The membranes were incubated in a blocking solution containing 5% of skimmed milk powder and 1% serum bovine albumin (DSA) for 1 hour at room temperature. The membranes were incubated overnight at 4 ° C with S100A4 anti-human rabbit antibody (dilution, 1: 1500), anti-human mouse antibody -CTNNB1 (dilution, 1: 1000), anti-human mouse antibody TUBB1 ( dilution, 1: 1000), goat anti-human antibody GAPDH antibody (dilution, 1: 500) or anti-human mouse antibody PCNA (dilution, 1: 1000) followed by incubation for 1 hour at room temperature with anti antibody - 20 goat conjugated with HRP (dilution, 1: 10,000), anti-rabbit (dilution, 1: 10,000), anti-mouse IgG (dilution, 1: 10,000) or anti-mouse IgM (dilution, 1: 10,000). The antibody-protein complexes are visualized with an electrochemical luminescence reagent (ECL) (100mM Tris-HCl, 0.025% w / v luminol, 0.011% w / v para-hydroxycoumaric acid, 10% v / v dimethyl sulfoxide, 0.004% H2O2 v / v, pH 8.6) and subsequent exposure to CL-XPosure ™ Films (Pierce) from 1 second to 20 minutes. Immunoblotting for GAPDH and PCNa served as a protein load control. Immunoblotting for p-tubulin served to control that the nuclear extracts did not contain cytoplasmic protein. All experiments were performed at least three times independently.

Transpocillo migration test in the Boyden chamber and invasion

30 HCT116, SW620, LS174T, SW480 and DLD-1 cells were used in cell migration and invasion analyzes performed with a Boyden chamber assay. 400 pL containing 2.5 * 105 cells were seeded in a transposite chamber with 12.0 pm pore size membrane filter (Millipore, Schwalbach, Germany). For invasion, the filter membranes were coated with 50 pL Matrigel (diluted 1: 3 in RPMI-1640; BD Biosciences) 10 minutes before seeding the cells. Fresh medium (600 pL) was added to the bottom of the chamber and the cells were allowed to engage in the boxes for 15 hours. Both chambers were treated with niclosamide1 pM niclosamide or the respective amount of DMSO and incubated at 37 ° C and 5% CO2 in a humidified incubator for 24 hours. The boxes were then removed and the cells that had migrated through the membrane to the lower chamber were trypsinized and counted in a Neubauer chamber (LO-Laboroptik, Bad Homburg, Germany). Each well was counted ten times. Each migration or invasion experiment 40 was carried out in duplicate. The average number of migrated or invaded cells was determined from at least three independent experiments.

Wound closure test

For the wound closure test, the HCT116, SW620, LS174T, SW480 and DLD-1 were grown to obtain a 60% confluent monolayer culture in which a wound approximately 300 pm wide was caused with a tip of sterile pipette The medium was changed to remove non-adherent cells and the injured monolayer was treated with 1 pM niclosamide or the respective amount of DMSO every 24 hours for 4 consecutive days. Progress in wound closure is monitored by micro-photographs taken with a 10X magnification of 50 a Leica DM IL optical microscope (Leica Microsystems) on day 0 and day 4. The wound closure experiment was carried out. out three times independently.

Anchor dependent cell proliferation

55 For the determination of cell proliferation, 2 * 103 cells of HCT116, SW620, LS174T, SW480 and DLD-1 were seeded in a 96-well plate (one plate for each day) and left 24 hours for them to catch on the bottom of the well. From that moment, the cells were treated every day with niclosamide1 pM or the respective amount of DMSO. For the determination of viable cells, 4,5-dimethyl-2-thiazol) -2,5-diphenyl-2H-tetrazolium bromide (MTT; Sigma) was added to a final concentration of 0.2 m per mL and incubated for 3 hours at 37 ° C 60 and 5% CO2 in a humidified incubator. MTT was reduced to form purple formazan crystals by

mitochondria of living cells and the increase in metabolized MTT reflected an increase in the number of cells. The recrystallized MTT was dissolved again with 10% SDS in 10 mM HCl and the absorption was measured at 560 nm. MTT measurements were performed daily for 5 consecutive days. The average MTT metabolization was determined from two independent experiments, each performed in triplicate.

5

Colony Formation Test

Anchor independent cell proliferation analysis was achieved by the soft agar colony formation assay. A bottom layer containing 0.5% w / v agarose, RPMI-1640 medium, 10% FBS and 1 pM niclosamide or the respective amount of DMSO was added to a 6 cm 0 plate and incubated at room temperature under sterile conditions for 10 minutes. A top layer containing 8 * 103 cells, 0.33% w / v agarose, RPMI-1640.10% FBS medium and 1 pM niclosamide or the respective amount of DMSO was added to the solidified bottom layer. The cells were seeded as single cells in the soft agar and incubated in a humidified incubator at 37 ° C and 5% CO2 for 7 days. Colony formation was visualized by a 10X magnification for an overview and a 40X magnification for single colonies on a Leica DM IL (Leica Microsystems) optical microscope. Cell quantification was achieved by counting cell colonies of more than 4 cells in 10 squares of 1 pm2. Colony formation experiments were repeated twice, each in triplicate.

20 Test of the activity pattern of the WNT / CTNNB1 marker

In an indicator assay the activity of lymphoid enhancer binding factor 1 (LEF) / transcription factor (TCF), also known as the TOP / FOPflash assay (Promega, Madison, WI) was previously used to analyze the activity of the WNT / CTNNB1 pathway in human colon cancer cells. It comprises the TOPflash plasmid that contains a hexamerican repeat of the LEF / TCF binding element upwards of a thymidine kinase and firefly luciferase promoter as the reporter gene. The FOPflash plasmid comprises the exact sequence of the FOPflash plasmid, but with mutated points at the LEF / TCF binding sites. In the assay, 8 * 104 HCT116 cells were seeded in 24-well plates and left 24 hours to be hooked to the bottom of the well. Cells were transferred with TOPflash or FOPflash plasmids using Metafecten according to the manufacturer's instructions 24 hours before they were treated with 1 pM niclosamide or the respective amount of DMSO for another 24 hours. Luciferase activity as a reading of the LEF / TCF activity and thus the activity of the WNT / CTNNB1 pathway was measured through a Steady GlowTM luciferase assay system (Promega) according to the manufacturer's instructions 24 hours in the SpectraFluor Plus (Tecan) luminescence reader with an exposure time of 1500 milliseconds and a capture of 150. The expression of the TOPflash indicator gene (which represents the activity of the WNT pathway) was normalized until the expression of the FOPflash indicator gene (which represents the basal expression of the indicator gene and the efficiency of transfection). The average of three independent experiments is provided here, although each experiment was performed in duplicate.

Electrophoretic mobility change test

40

The electrophoretic mobility change test (EMSA) was performed as described above. 5 * 106 HCT116 cells were seeded in a 10 cm culture plate and left 15 hours to engage at the bottom of the plate. The cells were treated with 0.1 niclosamide; 0.3; 0.6 or 1 pM or the respective amount of DMSO for 24 hours. For each condition, 5 pg of extracted nuclear protein was incubated 30 minutes at room temperature with 0.05% w / v poly dhdC, 0.5 mM Tris, 0.05 mM EDTA, 2.5% w / v glycerol, 0.2% v / v NP-40, 5 mM MgCl2 and biotinylated double-stranded oligonucleotides (sense 5'- CCGGGCATGGGGATCCCCACCCCAGTTTTTGTTTCTGAATCTTTATTTTTTTAAGAGACACA-3 ', antisense 3'- GGCCCGTACCCCTAGAGAGAGAGAGAGATATAA TAGAGAGAGAGA4A TAGAGAGAGAA TAGAGAGAGAT binding site of the TAGAGAGAGAGATAAAAAGAGA4A binding site of the binding . 1.25 pg of CTNNB1 monoclonal antibody 50 (BD Biosciences) was added for super displacement. Electrophoresis separation of the protein-oligonucleotide complexes were performed in Novex 6% TBE pre-cast gels (Invitrogen) and in TBE buffer (45 mM Tris, 45 mM boric acid, 1 mM EDTA, pH 8.3) for 60 minutes at 100 V. The capillary transfer of the protein-oligonucleotide complexes to the HybondTM-N nylon membrane (Amersham Biosciences) occurred in 20x SSC buffer (3M NaCl, 300 mM Na3C6H5O7, pH 7) overnight. Cross-linking of DNA transferred to the membrane occurred at 250 mJ per cm2 for 1 minute on the FL-20-M FluoLink Crosslinker (Bachofer). The visualization of biotin labeled DNA was performed with a LightShift Chemiluminescent EMSA kit (Pierce) according to the manufacturer's instructions. A representative of at least two independent experiments is shown here.

60 Chromatin Immunoprecipitation

Chromatin immunoprecipitation (ChIP) has been described above to determine the binding of CTNNBI to the S100A4 promoter. For the preparation of cell lysates, 1 * 106 HCT116 cells were seeded on a 10 cm plate or 15 hours before they were treated with 1 pM niclosamide or the respective amount of DMSO for 24 hours. The cells were incubated with 1% formaldehyde for 10 minutes at room temperature to ensure reversible cross-linking of proteins and DNA. The cells were washed twice with ice-cold PBS and lysed buffer A (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH8) was lysed for 10 minutes on ice. The cell lysates were sonicated for 20 pulses at 40% power and centrifuged at 10,000 rpm for 10 minutes. The supernatants were transferred to a new tube and one third of the diluted supernatant was stored at -20 ° C and ultimately served as a starting control. For immunoprecipitation the diluted supernatant was incubated 5 pg of monoclonal antibody CTNNB1 or 5 pg of lgG control (both from BD Biosciences) overnight at 4 ° C. Protein G balls (Invitrogen) were added and incubated for 2 hours at 4 ° C. Unbound protein was washed twice with wash buffer A (10 mM Tris, 0.1% SDS, 0.1% Nadeoxylate, 1% Triton X-100, 1 mM EDTA, 0.5 mM EGTA, 140 mM NaCl, pH 8) , once with wash buffer B (wash buffer A, 6% w / v 15 NaCl) and twice are TE buffer (20 mM Tris, 1 mM EDTA, pH 8). Elution of the protein-DNA complex from the balls occurred by incubation with 1.5% w / v SDS solution for 15 minutes at room temperature followed by centrifugation at 3000 rpm for 1 minute. To ensure complete elution, a second elution of the balls is carried out in a 0.5% SDS solution for 15 minutes at room temperature followed by centrifugation at 3000 rpm for 1 minute. Cross-linking was reversed at 68 ° C for 4 hours and the residual protein 20 was digested with proteinase K (Fermentas, St.Leon-Rot, Germany) at 55 ° C for 2 hours. The DNA was purified by precipitation and PCR amplification of the TCF binding site of the S100A4 promoter was carried out (5'-TGTTCCCCTCCAGATCCC-3 'forward primer; 5'-GGCTATGCTCAaGcCACTG-3' reverse primer). PCR amplification of the homologous promoter sequence (FOS) of the viral oncogene of murine viral osteosarcoma FBJ not regulated by CTNNB1 (forward primer 5'-CCTTAATATTCCCACACATGGC-3 ', reverse primer 5'- 25 CTGCGTTTGGAAGCAGAAAGT-3') served as control. The expected amplicons for S100A4 and FOS had a size of 167- or 149 bp, respectively. ChlP was performed in two independent experiments.

In vivo image capture by luminescence of metastasis formation

30 All experiments were carried out in accordance with UKCCCR guidelines and were approved by local authorities (Ministry of Health and Social Affairs, Berlin, Germany). HCT116-CMVp-LUC cells (3 * 106 cells per mouse, resuspended in 50 pL of PBS) were transplanted in spleen in stray mice with severe non-obscene diabetes combined with immunodeficiency (NOD-SCID) 6 weeks old. The mice were randomly assigned to 3 groups and the treatment of the mice was initiated 24 hours after transplantation of the 35 cells. The mice in the control group (n = 9) were treated with daily doses of the solvent. Mice from the second group (n = 9) were treated daily intraperitoneally with 20 mg per kg of niclosamide. Mice from the third group (n = 9) were treated intraperitoneally with two doses of 15 mg per kg of niclosamide per day. The endpoints of the experiments were reached when the mouse appeared dying and / or when the spleen tumor was palpable. This is what happened with most control mice on day 24. For long-term in vivo experiments, mice were randomly assigned to 3 groups. The mice in the control group (n = 6) were treated intraperitoneally with daily doses of the solvent. Mice from the second group (n = 6) were treated daily intraperitoneally with 20 mg per kg of niclosamide. Mice from the third group n = 6) were treated daily intraperitoneally for 24 days with 20 mg per kg of niclosamide and the remaining days with solvent. Mice were sacrificed by cervical dislocation when the tumor reached a maximum size of 45 according to local authorities.

The spleen (as a transplant site) and the liver (as the target organ of metastasis) were removed. The amount of S100A4 mRNA in the tumor was determined by isolation of TRizol RNA from the cryo-sections of the tumor and by quantitative real-time RT-PCR. The level of metastasis was assessed by score. For each liver, a score was calculated as the sum of the volumes of the individual metastases. For each metastasis the formula [width2] x length was applied.

To capture the images in vivo by luminescence, they were anesthetized with 35 mg per kg of Hypnomidate (Jassen-Cilag, Neuss, Germany) and received 150 mg per kg of D-luciferin intraperitoneally (Biosynth, Staad, 55 Switzerland) dissolved in sterile PBS. Image capture was carried out with a NightOWL LB 981 system (Berthold Technologies, Bad Wildbad, Germany) with exposure times of 1 second to 20 seconds. ImageJ version 2.3 was used for color coding of signal strength (which has a gray scale of 256) and layered photos.

60 Statistical analysis

All calculations were performed with GraphPad Prism version 4.01. The Student test was used for the comparison of only two groups. It was extended to an analysis of the two-tailed variance and one way for the comparison of the control group with several treated groups followed by the Bonferroni post hoc multiple comparison. In the 5 cytotoxicity tests the values of the maximum effective concentration at which cell viability is reduced to 50% (EC50) were calculated using the sigmoidal dose response curve of x = log (x) transformed data. A Kaplan Meier analysis was used to represent overall survival and the differences between the curves were analyzed by the Logrank test. All tests were two-tailed, and P values below 0.05 were considered statistically significant. If not indicated otherwise, the means are described with a confidence interval of 95%.

DESCRIPTION OF THE FIGURES

Figure 1.

Identification of niclosamide by high performance screening

15 Figure 2.

Effect of niclosamide on mRNA and cellular expression of S100A4 in human colon cancer cells

Figure 3

Effect of niclosamide on motility and cell proliferation

20 Figure 4.

Effect of niclosamide on colon cancer cells SW620, LS174T, SW480 and DLD-1.

Figure 5

■ Effect of niclosamide and its derivatives on the expression of S100A4 and cellular mobility induced by S100A4.

25 Figure 6.

Effect of niclosamide on constitutively active WNT / CTNNB1 signaling

Figure 7

In vivo luminescence monitoring of the effect of niclosamide on metastasis in a mouse xenoimplant

30 Figure 8.

Long-term effects of niclosamide treatment in vitro and in vivo

DETAILED DESCRIPTION OF THE FIGURES

35 Figure 1 Identification of niclosamide by high performance screening.

(A) Schematic representation of the marker system applied to high performance screening. The sequence comprising the 1487 bp S100A4 promoter above the S100A4 transcription initiation site controlled the expression of the firefly luciferase (Firefly) marker (LUC). The construct was stably expressed by HCT116-S100A4p-LUC cells that were most exposed to compounds

from the library of pharmacologically active compounds (LOPAC) 1280. As described, luciferase activity and cell viability were determined. (B) Schematic summary of high performance screening. (C) Re-aged 20-concentrations of niclosamide in HCT116-S100A4p-LUC cells. The cells were exposed to 20 double dilutions of niclosamide in duplicate wells per dilution for 24 hours. Luciferase activity and viability of the

cells. Error bars represent the standard deviation for the two duplicate wells in each dilution.

Figure 2 Effect of niclosamide on mRNA and S100A4 cell expression in human colon cancer cells.

(A) Determination of the cytotoxicity of niclosamide on HCT116 cells. Cells were treated with increasing concentrations of niclosamide for 24 hours and cell viability was calculated. (B) Effect of increasing concentrations of niclosamide on the expression of S100A4. HTC116 55 cells were treated with increasing concentrations of niclosamide for 24 hours. The expression of

S100A4 was determined by quantitative polymerase chain reaction with reverse transcription (qRT-PCR) and Immunoblotting. (C) Time dependence of the effect of niclosamide on the expression of S100A4. HTC116 cells were treated with a single dose of 1pM niclosamide for 24 hours and the expression of S100A4 was analyzed by qRT-PCR and immunoblot at the indicated time points. 60 Black lines indicate the treatment conditions selected for other experiments. (D) Effect

5

10

fifteen

twenty

25

30

35

40

Four. Five

fifty

55

60

of the daily doses of niclosamide on the expression of S100A4. HTC116 cells were treated daily with 1pM niclosamide and the expression of S100A4 was analyzed by qRT-PCR and immunoblot. Data are presented as mean ± SD (n> 2). The differences in the treated groups were compared with the control group by a two-way one-way variance analysis and a Bonferroni post hoc multiple comparison test.

(E) Effect of niclosamide on HTC116-vector and HTC116-S100A4 cells. HTC116-vector and HTC116-S100A4 cells are treated with 1pM niclosamide for 24 hours and the expression of S100A4 was analyzed by qRT-PCR and immunoblot. Data are presented as mean ± SD (n> 2). The comparison of niclosamide vs solvent treated cells was analyzed with a Student's t-test.

Figure 3 Effect of niclosamide on motility and cell proliferation.

(A) Cell migration of HCT116-vector and HCT116-S100A4 cells exposed to niclosamide treatment. Cells were treated with 1 pM niclosamide for 24 hours and migration rates were measured by the Boyden chamber assay. (B) Cellular invasion of HCT116-vector and HCT116-S100A4 cells exposed to niclosamide treatment. The cells were treated with 1 pM niclosamide for 24 hours and the cell invasion was determined by the Boyden chamber assay. (D) Directed migration of HCT116-vector and HCT116-S100A4 cells exposed to niclosamide treatment and analyzed by the wound closure test. Wounds of 300 pM wide were placed in 60% confluent monolayer of HCT116-vector and HCT116-S100A4 cells on day 1. The cells were treated daily with 1 pM niclosamide for 4 days. Photomicrographs of day 4 are presented herein as black lines indicating the margins of a wound introduced on 'day 1; the scale bars represent 200 pM. The data represent three independent experiments. (D) Adhesive cell proliferation of HCT116-vector and HCT116-S100A4 cells exposed to niclosamide treatment. Cells were treated daily with 1 pM niclosamide and cell viability was determined by MTT assay. (B) Anchor independent cell growth of the HCT116-vector and HCT116-S100A4 cells exposed to niclosamide treatment. The cells were seeded as single cells in 0.33% agarose (w / v) and treatment (solvent or 1 pM niclosamide) containing medium. After 7 days the cells were observed under an optimal microscope at 10 X (overview) and at a 40X magnification (a single colony). (F) Quantification of cells formed. Number of colonies (of more than 4 cells) were counted and normalized with solvent treated HCT116-vector cells. The differences between niclosamide vs solvent treated cells were analyzed with a Student's t-test. Data are presented as mean ± SD (n> 2) of at least two independent experiments each performed at least in duplicate.

Figure 4 Effect of niclosamide on colon cancer cells SW620, LS174T, SW480 and DLD-1.

(A) Expression of S100A4 under treatment with niclosamide. The cells were treated with 1 pM niclosamide for 24 hours. S100A4 expression was analyzed with qRT-PCR and immunoblotting (A) Cellular migration under niclosamide treatment. Migration rates of 1 pM niclosamide treated cells for 24 hours were determined in the Boyden chamber assay and the values were normalized for solvent treated SW620 cells. (A) Cell invasion under treatment with niclosamide. The cells were seeded in trans-wells covered by Matrigel and treated with 1 pM niclosamide for 24 hours. The cells invaded the lower chamber where they were counted and normalized to solvent treated SW620 cells. The differences between solvent vs Niclosamide treated cells were analyzed with a Student's t-test. Data are presented as mean ± SD of at least two independent experiments each performed in triplicate. (A) Targeted migration under niclosamide treatment. Wounds 300 pM wide were placed in 60% confluent monolayer of cells on day 1. The cells were treated daily with 1 pM niclosamide for 4 days. Photomicrographs of day 4 are presented herein as black lines indicating the margins of a wound on day 1; the scale bars represent 200 pM. The directed migration data shown are representative of three independent experiments. (E) Adhesive cell proliferation under niclosamide treatment. The cells were treated daily with 1 pM niclosamide. The amount of viable cells per well is determined by the MTT assay. Independent cell growth of anchorage under treatment with niclosamide. The cells were seeded as single cells in 0.33% agarose (w / v) and treatment (solvent or 1 pM niclosamide) containing medium. After 7 days the cells were observed under an optimal microscope at 10 X (overview) and at a 40X magnification (a single colony). (FG Quantification of cells formed. Number of colonies (of more than 4 cells) were counted and normalized with solvent treated SW620 cells. Differences between solvent vs Niclosamide treated cells were analyzed with a Student t test. Data are presented as mean ±

DS of at least two independent experiments each performed in duplicate.

Figure 5 Effect of niclosamide and its derivatives on the expression of S100A4 and cellular mobility induced by S100A4.

5

(A) Chemical structure of niclosamide and its derivatives. In 2D illustrations the structure of niclosamide was compared with the structure of niclosamide derivatives, marked in filled circles or boxes chemical groups are added, marked in gray or in broken lines chemical groups are removed. In 3D illustrations, gray clouds represent a van der Waals surface, red and 10 blue indicate negative and positive charges, respectively. (B) S100A4 expression under conditions

treated. HTC116 cells were treated with 1 pM niclosamide or one of the niclosamide derivatives for 24 hours. The expression of S100A4 was analyzed by qRT-PCR and immunoblot (C) Cellular migration under treated conditions. HCT116 cells were treated with 1 pM niclosamide or one of its derivatives for 24 hours and the cell invasion was determined by the Boyden chamber 15 assay. The cells migrated to the lower chamber where they were counted and normalized to the number of cells

HCT116 solvent treated migrated. The comparison of cells treated with niclosamide or derivative vs cells treated with solvent was carried out by means of a two-tailed one-way analysis of variance and a Bonferroni post hoc multiple comparison test. Data are presented as mean ± SD of at least four independent experiments each performed in duplicate.

twenty

Figure 6 Effect of niclosamide on constitutively active WNT / CTNNB1 signaling.

For the analysis of the WNT pathway the following cells were applied: HCT116 cells (heterozygous for obtaining the function of mutated CTNNB1; wt / mut), HAB-68mut cells (mutant deletion of HCT116, which only expresses obtaining the mutated function of CTNNB1: - / mut) and HAB-92wt cells (mutant deletion of HCT116, which only expresses the natural type of CTNNB1: wt / -). (A) CTNNB1-dependent genotype effect of niclosamide on the expression of the LEF / TCF transcription factor indicator gene. The cells were treated with 1 pM niclosamide for 24 hours. The expression of the indicator gene was determined through the measurement of luciferase activity. For each condition and cell line the expression of TOPflash was normalized to the expression 30 of FOPflash. (B) Niclosamide-dependent CTNNB1 genotype effect on S100A4 expression. The cells were treated with 1 pM niclosamide for 24 hours. S100A4 expression was analyzed by qRT-PCR and immunoblotting (B) Niclosamide-dependent CTNNB1 genotype effect on migration rates. Cells were treated with niclosamide1 pM for 24 hours and cell migration was determined by the Boyden chamber assay. Data are presented as mean ± SD of at least three independent experiments. The differences were analyzed by Student's T test (n, s, not statistically significant). (D) Nuclear location of CTNNB1 under treatment with niclosamide. Nuclear extracts of HCT116 cells treated with the indicated concentrations of niclosamide for 18 hours were analyzed by immunoblot. (E) Effect of niclosamide on the CTNNB1 / TCF complex. Nuclear extracts from the HCT116 cells treated with the indicated concentrations of niclosamide for 18 hours were analyzed by EMSA for the TCF binding site of the S100A4 promoter. Superdisplacements were performed by the addition of the anti-CTNNB1 monocolonal antibody. (F) Presence of CTNNB1 in the S100A4 promoter under treatment with niclosamide. HCT116 cells were treated with 1 pM niclosamide for 18 hours and processed by the ChlP assay. Soluble chromatin was immunoprecipitated with an anti-CTNNB1 monoclonal antibody or a non-specific control IgG antibody. The primers used in the PCR amplified a 167 bp fragment of the S100A4 promoter or a 149 bp fragment of the FOS promoter. The current verified the integrity of the PCR. The FOS promoter sequence to which CTNNB1 does not bind was used as a control. The data are representative of at least two independent experiments.

Figure 7 In vivo luminescence monitoring of the effect of niclosamide on metastasis in a mouse xenotransplant.

(A) In vivo luminescence image capture of metastasis under treatment with niclosamide. HCT116-CMVp-LUC cells expressing firefly luciferase (Firefly) (LUC) were transplanted in mice in spleen (n = 4 per group) followed by a daily intraperitoneal treatment with 20 mg 55 per kg of niclosamide. To capture luminescence images, the mice were anesthetized on days

indicated and given intraperiotneally D-luciferin. The exposure time for lateral and ventral image capture was 20 seconds per image. In situ image capture and isolated organs was performed for 1 second per exposure time per image. The signal strength of the gray scales of the photos (256 scale) were coded (from the lowest intensity to the highest: 60 blue, green, yellow, red, white) and overlapped with the brightness of the field. (B) S100A4A mRNA level

in the spleen tumor of mice with xenotransplantation treated with niclosamide. Spleens from mice were dissected (n = 9 per group) on day 24. Tumor tissue was cryoplated for RNA isolation. The RNA level of S100A4 was measured by qRT-PCR and expressed as a percentage of the control mouse. The differences were analyzed using a two-tailed one-way variance analysis and a Bonferroni post hoc multiple comparison test. The bars represent mean ± DS. (C) Size of

liver metastases in mice with xenoimplants treated with niclosamide. The liver of the mice was dissected with xenotransplantation (n = 9 per group) treated intreperitoneally twice daily with 15 mg per kg or daily with 20 mg per kg niclosamide for 24 days. Metastasis was quantified by score. Data are presented as mean ± SD.

10

Figure 8 Long-term effects of niclosamide treatment in vitro and in vivo.

(A) Expression of S100A4 in vitro after discontinuation of niclosamide treatment. The HCT116 cells were treated daily with 1 pM niclosamide for three consecutive days, the medium was removed on day 4, and the expression of S100A4 was analyzed 24, 48 and 72 hours after niclosamide was removed. S100A4 expression was analyzed by qRT-PCR and immunoblot. (B) Cellular migration after discontinuation of niclosamide treatment. Migration rates of the treated HCT116 cells as described in (A) were determined by the Boyden chamber assay. The differences between control and treated cells were analyzed with a Student's t-test. (C) Anchor-dependent cell proliferation after discontinuation of niclosamide treatment. HCT116 cells were treated with 1 pM niclosamide or daily solvent or niclosamide during the first five days and solvent from day 5 (the arrow indicates treatment discontinuation). Cell proliferation was determined by the MTT assay. (D) Overall survival of mice treated continuously and discontinuously with niclosamide. HCT116-CMVp-LUC cells were injected spleen in mice (n = 6 per group). The mice were treated daily intraperiotneally with either solvent or 20 mg per kg of niclosamide or 25 during the first 24 days with 20 mg per kg of niclosamide followed by solvent. Survival curves were compared with an achievement test: (E) Luminescence signal of liver metastases and spleen tumors. The mice were injected with D-luciferin 10 minutes before the liver and spleen had been dissected and an image had been obtained for 1 second of exposure. The signal intensity of the gray scales of the photos (256 scale) was color coded, with white being the highest intensity. (F) Expression of 30 mRNA of S100A4 in spleen tumors. Tumor tissue was cryosected for RNA isolation. The RNA level of S100A4 was measured by qRT-PCR and expressed as a percentage of control animals. (G) Size of liver metastases in mice treated continuously or discontinuously with niclosamide. Liver metastases in dissected livers were quantified by score. The bars represent mean ± DS. The differences were analyzed by a two-tailed one-way analysis of variance and a Bonferroni post hoc multiple comparison test.

Claims (12)

1. Niclosamide or its derivative for use as a medicine for the inhibition and / or reduction of dissemination of metastatic cancer, in which said niclosamide or its derivative is selected from the group consisting of 10 image 1 or compounds in which other halogens are present at the positions occupied by Cl in said niclosamide or its derivatives. 2. Niclosamide or its derivative for use as a medicament according to claim 1, comprising the inhibition and / or reduction of migration and invasion of cancer cells. 3. Niclosamide or its derivative for use as a medicament according to claim 1 or 2 for the inhibition and / or reduction of cell migration and invasion directed by S100A4. 20 4. Niclosamide or its derivative for use as a medicament according to claims 1 to 3., wherein The cancer is selected from the group comprising breast cancer, colon cancer, ovarian carcinoma, osteosarcoma, cervical cancer, prostate cancer, lung cancer, synovial carcinoma, melanoma, skin, pancreatic cancer, S100A4-related cancer or another cancer yet to be determined in which the levels of S100A4 are elevated, over-regulated, mutated or altered in their physiology when compared to non-oncogenic cells. 5. Niclosamide or its derivative for use as a medicament according to at least one of the preceding claims, wherein niclosamide or its derivatives modulate the TCF / beta-catenin protein complex. 30 6. Niclosamide or its derivative for use as a medicament according to at least one of the preceding claims, wherein said modulation results in a decrease in the transcription level of S100A4. 7. Niclosamide or its derivative for use as a medicine according to at least one of the previous claims, wherein the patient or group of patients to be treated is identified by the increased expression of S100A4. 5. Niclosamide or its derivative for use as a medicament according to the preceding claim, wherein The body fluid and / or tissue of a patient to be identified is analyzed to determine the levels of S100A4 expression. 9. Niclosamide or its derivative for use as a medicament according to at least one of the 10 preceding claims, wherein the reduction in the propagation of metastatic cells also occurs by means of nucleic acid molecules, preferably through nucleic acids with complementarity with the mRNA of the components of the Wnt pathway. 10. Pharmaceutical composition comprising niclosamide or its derivative according to one of the preceding 15 claims for use as a medicament for the inhibition and / or reduction of the propagation of the metastatic cancer 11. Pharmaceutical composition according to claim 10 comprising at least niclosamide or its derivative with a pharmaceutically acceptable carrier, wherein said composition is a capsule, a 20 tablet, a coated tablet, a suppository, an ointment, a cream, an injection solution and / or an infusion solution. 12. Pharmaceutical composition according to claim 10 or 11, wherein the composition comprises niclosamide or its derivative and one or more chemotherapeutic drugs. 25 13. Niclosamide for use as a medicament according to one of the preceding claims for the treatment of cancer metastasis. 14. Niclosamide for use as a medicament according to one of the preceding claims for the prevention of metastasis formation in cancer.